Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NOC2L	26155	broad.mit.edu	37	1	880525	880525	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:880525C>A	uc001abz.3	-	18	2114	c.2055G>T	c.(2053-2055)GGG>GGT	p.G685G	NOC2L_uc001aby.3_Silent_p.G482G|NOC2L_uc009vjq.2_Silent_p.G685G	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog	685	Asp/Glu-rich (acidic).					nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		GCCTCAGTATCCCTGAGGAAC	0.463													5	5	---	---	---	---	PASS
ACAP3	116983	broad.mit.edu	37	1	1233771	1233771	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1233771C>A	uc001aeb.2	-	12	968	c.894G>T	c.(892-894)CTG>CTT	p.L298L	ACAP3_uc001ady.2_Silent_p.L28L|ACAP3_uc001aea.2_Silent_p.L256L	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH	298	PH.				filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0						TCTGGTAGACCAGCTGGCTGT	0.677													45	56	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1647830	1647830	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1647830C>G	uc001agv.1	-	9	560	c.449G>C	c.(448-450)AGA>ACA	p.R150T	CDK11B_uc001ags.1_5'UTR|CDK11B_uc001agt.1_5'UTR|CDK11B_uc001aha.1_Missense_Mutation_p.R116T|CDK11B_uc001agw.1_Missense_Mutation_p.R105T|CDK11B_uc001agy.1_Missense_Mutation_p.R139T|CDK11B_uc001agx.1_Missense_Mutation_p.R139T|CDK11B_uc001agz.1_5'UTR|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Missense_Mutation_p.R138T|CDK11A_uc009vks.2_Missense_Mutation_p.R148T|CDK11A_uc010nys.1_Missense_Mutation_p.R138T|CDK11A_uc010nyt.1_Missense_Mutation_p.R148T|CDK11A_uc010nyu.1_RNA|CDK11A_uc009vkt.1_Missense_Mutation_p.R138T|CDK11A_uc009vku.1_Missense_Mutation_p.R138T|CDK11A_uc009vkv.1_Missense_Mutation_p.R148T|CDK11A_uc001aht.1_Missense_Mutation_p.R138T|CDK11B_uc001ahu.1_Missense_Mutation_p.R138T|CDK11B_uc001ahv.1_Missense_Mutation_p.R148T|CDK11B_uc001ahw.1_Missense_Mutation_p.R148T	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)	150	Glu-rich.				apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						TCTCTTCTGTCTTTCCCATTC	0.493													25	90	---	---	---	---	PASS
LRRC47	57470	broad.mit.edu	37	1	3701698	3701698	+	Missense_Mutation	SNP	C	A	A	rs147533898		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3701698C>A	uc001akx.1	-	3	1175	c.1147G>T	c.(1147-1149)GTC>TTC	p.V383F		NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	383					translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GGCCCTTTGACGGCACGGAGC	0.602													18	38	---	---	---	---	PASS
PHF13	148479	broad.mit.edu	37	1	6680350	6680350	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6680350G>T	uc001aob.3	+	3	1000	c.629G>T	c.(628-630)CGA>CTA	p.R210L		NM_153812	NP_722519	Q86YI8	PHF13_HUMAN	PHD finger protein 13	210					cell division|chromatin modification|mitotic chromosome condensation	nucleoplasm	chromatin binding|methylated histone residue binding|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		GTGGTGTTCCGAGATGAGGAC	0.507													11	5	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7792569	7792569	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7792569G>C	uc001aoi.2	+	12	3183	c.2976G>C	c.(2974-2976)GAG>GAC	p.E992D	CAMTA1_uc010nzv.1_Missense_Mutation_p.E79D|CAMTA1_uc001aok.3_Missense_Mutation_p.E35D	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	992					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GGATGGCCGAGATGACGGGGT	0.627													9	6	---	---	---	---	PASS
PLOD1	5351	broad.mit.edu	37	1	12027050	12027050	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12027050C>G	uc001atm.2	+	16	1748	c.1657C>G	c.(1657-1659)CCG>GCG	p.P553A	PLOD1_uc010obb.1_Missense_Mutation_p.P600A	NM_000302	NP_000293	Q02809	PLOD1_HUMAN	lysyl hydroxylase 1 precursor	553					epidermis development|hydroxylysine biosynthetic process|protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein homodimerization activity			ovary(2)|breast(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Minoxidil(DB00350)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCAGCCCTGCCCGGATGTCTA	0.607													16	31	---	---	---	---	PASS
TNFRSF8	943	broad.mit.edu	37	1	12169669	12169669	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12169669C>T	uc001atq.2	+	5	690	c.468C>T	c.(466-468)GTC>GTT	p.V156V	TNFRSF8_uc010obc.1_Silent_p.V45V	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	156	Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCAGGGGTCAGCCCTGCCT	0.622													11	12	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16259408	16259408	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16259408G>A	uc001axk.1	+	11	6877	c.6673G>A	c.(6673-6675)GAC>AAC	p.D2225N	SPEN_uc010obp.1_Missense_Mutation_p.D2184N	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2225	RID.|Interaction with MSX2 (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CATCATCAATGACATTTCTGG	0.597													33	34	---	---	---	---	PASS
MFAP2	4237	broad.mit.edu	37	1	17302211	17302211	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17302211G>T	uc001azw.2	-	7	434	c.301C>A	c.(301-303)CAG>AAG	p.Q101K	MFAP2_uc001azx.2_Missense_Mutation_p.Q100K|MFAP2_uc001azy.2_Missense_Mutation_p.Q101K|MFAP2_uc010ocl.1_Missense_Mutation_p.Q100K	NM_002403	NP_002394	P55001	MFAP2_HUMAN	microfibrillar-associated protein 2 isoform a	101						microfibril					0		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CACGGGTACTGTTCCTCACGG	0.627													3	4	---	---	---	---	PASS
SH2D5	400745	broad.mit.edu	37	1	21051028	21051028	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21051028G>C	uc001bdt.1	-	5	864	c.239C>G	c.(238-240)ACA>AGA	p.T80R	SH2D5_uc009vpy.1_Missense_Mutation_p.T164R|SH2D5_uc001bdu.1_RNA	NM_001103160	NP_001096630	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5 isoform 2	80											0		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CACCTCCCCTGTGGGCCCTGG	0.667													10	3	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22155925	22155925	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22155925G>A	uc001bfj.2	-	87	11983	c.11943C>T	c.(11941-11943)TCC>TCT	p.S3981S	HSPG2_uc001bfi.2_5'UTR|HSPG2_uc009vqd.2_Silent_p.S3982S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3981	Laminin G-like 2.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CCATCGCCAGGGACACGAAGT	0.652													26	11	---	---	---	---	PASS
HMGCL	3155	broad.mit.edu	37	1	24143179	24143179	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24143179C>A	uc001bib.2	-	4	378	c.334G>T	c.(334-336)GGC>TGC	p.G112C	HMGCL_uc010oec.1_Missense_Mutation_p.G112C|HMGCL_uc009vqr.2_Intron|HMGCL_uc001bic.2_Missense_Mutation_p.G87C|HMGCL_uc009vqs.1_Missense_Mutation_p.G112C|HMGCL_uc001bid.1_Missense_Mutation_p.G112C	NM_000191	NP_000182	P35914	HMGCL_HUMAN	3-hydroxy-3-methylglutaryl CoA lyase isoform 1	112					acetoacetic acid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA lyase activity|metal ion binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		GCCTCGAAGCCTTTCAAATTT	0.527													67	32	---	---	---	---	PASS
UBXN11	91544	broad.mit.edu	37	1	26612496	26612496	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26612496C>T	uc001blw.2	-	10	865	c.592G>A	c.(592-594)GAC>AAC	p.D198N	UBXN11_uc001blz.1_Missense_Mutation_p.D165N|UBXN11_uc001blv.2_Missense_Mutation_p.D160N|UBXN11_uc001bly.2_Missense_Mutation_p.D78N|UBXN11_uc001blx.2_5'UTR|UBXN11_uc001bma.2_Missense_Mutation_p.D165N|UBXN11_uc001bmb.1_Missense_Mutation_p.D198N|UBXN11_uc010ofb.1_Missense_Mutation_p.D123N|UBXN11_uc010ofc.1_Missense_Mutation_p.D40N	NM_183008	NP_892120	Q5T124	UBX11_HUMAN	socius isoform 2	198						cytoplasm|cytoskeleton				ovary(1)	1						AGCAGCCTGTCAAAGTCCACC	0.627											OREG0013265	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	4	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34076847	34076847	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34076847G>A	uc001bxn.1	-	41	6046	c.6017C>T	c.(6016-6018)GCT>GTT	p.A2006V	CSMD2_uc001bxm.1_Missense_Mutation_p.A2046V|CSMD2_uc001bxo.1_Missense_Mutation_p.A919V	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2006	CUB 12.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGGATGTGAGCTCCTGGGAG	0.552													15	3	---	---	---	---	PASS
OSBPL9	114883	broad.mit.edu	37	1	52227552	52227552	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52227552G>T	uc001cst.2	+	11	706	c.687G>T	c.(685-687)TTG>TTT	p.L229F	OSBPL9_uc001css.2_Missense_Mutation_p.L234F|OSBPL9_uc001csx.2_RNA|OSBPL9_uc009vza.2_Missense_Mutation_p.L230F|OSBPL9_uc001csu.2_Missense_Mutation_p.L239F|OSBPL9_uc001csv.2_Missense_Mutation_p.L64F|OSBPL9_uc001csw.2_Missense_Mutation_p.L216F|OSBPL9_uc001csy.2_Missense_Mutation_p.L51F|OSBPL9_uc001csz.2_Missense_Mutation_p.L51F|OSBPL9_uc001cta.2_Missense_Mutation_p.L119F|OSBPL9_uc001ctb.2_Missense_Mutation_p.L14F	NM_024586	NP_078862	Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9 isoform e	229					lipid transport		lipid binding			central_nervous_system(1)	1						CTGTTCAGTTGTGTAAGTCAG	0.418													61	18	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70226034	70226034	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70226034G>A	uc001dep.2	+	1	177	c.147G>A	c.(145-147)GAG>GAA	p.E49E	LRRC7_uc001deo.1_Silent_p.E87E|LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	49	LRR 2.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						GAACATTAGAGGAGCTTTATC	0.358													11	11	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71512735	71512735	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71512735C>A	uc001dfg.1	-	1	757	c.526G>T	c.(526-528)GCT>TCT	p.A176S	PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Missense_Mutation_p.A176S|PTGER3_uc001dfl.1_Missense_Mutation_p.A176S|PTGER3_uc009wbm.1_Missense_Mutation_p.A176S|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Missense_Mutation_p.A176S|PTGER3_uc009wbn.1_Missense_Mutation_p.A176S|PTGER3_uc009wbo.2_Missense_Mutation_p.A176S|PTGER3_uc001dfo.2_Missense_Mutation_p.A176S|PTGER3_uc001dfp.1_Missense_Mutation_p.A176S|PTGER3_uc001dfq.2_Missense_Mutation_p.A176S|uc001dfr.2_RNA	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	176	Helical; Name=4; (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	AGCAGCACAGCGCGGGTGGCA	0.706													14	5	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038632	75038632	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038632G>T	uc001dgg.2	-	14	2981	c.2762C>A	c.(2761-2763)GCC>GAC	p.A921D		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	921	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTCTCTCAGGGCTGCTACTTC	0.537													79	34	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82452998	82452998	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82452998C>T	uc001dit.3	+						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Intron|LPHN2_uc001div.2_Silent_p.A1161A|LPHN2_uc009wcd.2_Intron|LPHN2_uc001diw.2_Intron	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GTCTGAGAGCCCATCTTCAAG	0.308													16	4	---	---	---	---	PASS
MCOLN3	55283	broad.mit.edu	37	1	85484903	85484903	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85484903C>A	uc001dkp.2	-	13	1658	c.1565G>T	c.(1564-1566)CGT>CTT	p.R522L	MCOLN3_uc001dko.2_Missense_Mutation_p.R141L|MCOLN3_uc001dkq.2_Missense_Mutation_p.R466L	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	522						integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		TATAAATGTACGAAGTTCAGT	0.348													29	6	---	---	---	---	PASS
MCOLN3	55283	broad.mit.edu	37	1	85486820	85486820	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85486820C>T	uc001dkp.2	-	12	1553	c.1460G>A	c.(1459-1461)AGC>AAC	p.S487N	MCOLN3_uc001dko.2_Missense_Mutation_p.S106N|MCOLN3_uc001dkq.2_Missense_Mutation_p.S431N	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	487	Helical; (Potential).					integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		TATAAAGAGGCTGATGAATGA	0.333													24	7	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86581015	86581015	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86581015C>A	uc001dlj.2	-	4	1580	c.1538G>T	c.(1537-1539)GGT>GTT	p.G513V	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.G513V	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	513	Collagen-like 1.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TACCCGTGGACCTCTCTTCCC	0.428													11	4	---	---	---	---	PASS
GBP5	115362	broad.mit.edu	37	1	89729589	89729589	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89729589G>T	uc001dnc.2	-	9	1729	c.1192C>A	c.(1192-1194)CTG>ATG	p.L398M	GBP5_uc001dnd.2_Missense_Mutation_p.L398M|GBP5_uc001dne.1_Missense_Mutation_p.L398M	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5	398						plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		GATGCTTCCAGGTTCCGTTTA	0.398													59	25	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92737095	92737095	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92737095C>A	uc001dor.2	-	8	965	c.850G>T	c.(850-852)GAC>TAC	p.D284Y	GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.D284Y	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	284	Potential.				muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		GCCATTGAGTCTGCTAACTGT	0.353									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				47	23	---	---	---	---	PASS
FRRS1	391059	broad.mit.edu	37	1	100203641	100203641	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100203641C>A	uc001dsh.1	-	7	1361	c.759_splice	c.e7+1	p.M253_splice		NM_001013660	NP_001013682	Q6ZNA5	FRRS1_HUMAN	stromal cell derived factor receptor 2 homolog						electron transport chain|transport	integral to membrane	ferric-chelate reductase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		GAGGTACCAACCATCCACTGA	0.313													36	14	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109792869	109792869	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109792869G>C	uc001dxa.3	+	1	229	c.168G>C	c.(166-168)TGG>TGC	p.W56C		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	56	Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCATGGGCTGGCTCTGTCCAT	0.617													23	6	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118548175	118548175	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118548175A>T	uc001ehk.2	-	32	4706	c.4638T>A	c.(4636-4638)GCT>GCA	p.A1546A		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1546						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GGCAGTACACAGCTGAACAAT	0.383													12	10	---	---	---	---	PASS
LIX1L	128077	broad.mit.edu	37	1	145497486	145497486	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145497486C>A	uc001enr.2	+	4	765	c.691C>A	c.(691-693)CAG>AAG	p.Q231K	NBPF10_uc001emp.3_Intron|LIX1L_uc009wiu.1_5'Flank	NM_153713	NP_714924	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (mouse) like	231										ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTTGGAGTTCCAGGTACTTTC	0.453													9	11	---	---	---	---	PASS
CHD1L	9557	broad.mit.edu	37	1	146766105	146766105	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146766105C>T	uc001epm.3	+	22	2584	c.2521C>T	c.(2521-2523)CCA>TCA	p.P841S	uc001epp.2_Intron|CHD1L_uc001epn.3_Missense_Mutation_p.P728S|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_Missense_Mutation_p.P747S|CHD1L_uc010ozp.1_Missense_Mutation_p.P560S|CHD1L_uc001epo.3_Missense_Mutation_p.P637S|CHD1L_uc009wji.2_Missense_Mutation_p.P560S	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein	841	Macro.				chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					TGTTCATCTTCCACGTATTGG	0.388													21	115	---	---	---	---	PASS
ZNF687	57592	broad.mit.edu	37	1	151263255	151263255	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151263255C>T	uc001exq.2	+	9	3382	c.3284C>T	c.(3283-3285)CCG>CTG	p.P1095L	ZNF687_uc009wmo.2_Missense_Mutation_p.P1095L|ZNF687_uc009wmp.2_3'UTR	NM_020832	NP_065883	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	1095					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding			central_nervous_system(3)|ovary(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGCACGACACCGCCAGCCAAG	0.617													36	61	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152081509	152081509	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152081509T>C	uc001ezp.2	-	2	4184	c.4184A>G	c.(4183-4185)GAG>GGG	p.E1395G	TCHH_uc009wne.1_Missense_Mutation_p.E1395G	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1395	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGTTCCTCCTTAAGGAA	0.597													26	155	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152084022	152084022	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152084022C>A	uc001ezp.2	-	2	1671	c.1671G>T	c.(1669-1671)AGG>AGT	p.R557S	TCHH_uc009wne.1_Missense_Mutation_p.R557S	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	557	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTCGAGCCTCTTCTCCT	0.657													56	89	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152275728	152275728	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152275728C>A	uc001ezu.1	-	3	11670	c.11634G>T	c.(11632-11634)AGG>AGT	p.R3878S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3878	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTCAGATCGCCTCTCAGAGT	0.592									Ichthyosis				62	130	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325907	152325907	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325907G>C	uc001ezw.3	-	3	4428	c.4355C>G	c.(4354-4356)TCT>TGT	p.S1452C	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1452							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCATGTTGAGATCCGGCTTG	0.502													70	348	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152329581	152329581	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329581A>T	uc001ezw.3	-	3	754	c.681T>A	c.(679-681)TCT>TCA	p.S227S	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	227	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTTGATCCAGATCCAGATT	0.438													89	156	---	---	---	---	PASS
LCE1C	353133	broad.mit.edu	37	1	152777758	152777758	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152777758C>T	uc001fap.1	-	2	248	c.197G>A	c.(196-198)GGA>GAA	p.G66E		NM_178351	NP_848128	Q5T751	LCE1C_HUMAN	late cornified envelope 1C	66	Gly-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTGCAGCATCCCCCAGAGCT	0.632													42	66	---	---	---	---	PASS
S100A8	6279	broad.mit.edu	37	1	153362927	153362927	+	Missense_Mutation	SNP	C	G	G	rs138295475	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153362927C>G	uc001fbs.2	-	2	140	c.85G>C	c.(85-87)GTC>CTC	p.V29L		NM_002964	NP_002955	P05109	S10A8_HUMAN	S100 calcium-binding protein A8	29	1; low affinity.|EF-hand 1.				chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCCTGTAGACGGCATGGAAA	0.542													80	149	---	---	---	---	PASS
S100A13	6284	broad.mit.edu	37	1	153591364	153591364	+	3'UTR	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153591364G>A	uc001fcf.3	-	3					S100A14_uc001fce.2_5'Flank|S100A13_uc001fcg.2_3'UTR|S100A13_uc009woh.2_3'UTR|S100A13_uc001fch.2_3'UTR|S100A13_uc001fci.2_3'UTR|S100A13_uc001fcj.2_3'UTR	NM_001024213	NP_001019384	Q99584	S10AD_HUMAN	S100 calcium binding protein A13						interleukin-1 alpha secretion|mast cell degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|extracellular space|nucleus|perinuclear region of cytoplasm	calcium ion binding|copper ion binding|fibroblast growth factor 1 binding|lipid binding|protein homodimerization activity|RAGE receptor binding|zinc ion binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)	ATCTCAGCCAGGCGGCTTTAC	0.502													32	143	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154076576	154076576	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154076576G>A	uc001fdw.2	-	13	1803	c.1731C>T	c.(1729-1731)ACC>ACT	p.T577T	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Silent_p.T577T	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	577						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGGCTTCTTTGGTCTCTTTAT	0.378													25	141	---	---	---	---	PASS
PKLR	5313	broad.mit.edu	37	1	155264347	155264347	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155264347G>T	uc001fkb.3	-	6	930	c.891C>A	c.(889-891)GTC>GTA	p.V297V	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Silent_p.V266V	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	297					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GAGCAGCCCTGACGGCAGCCA	0.602													33	28	---	---	---	---	PASS
SMG5	23381	broad.mit.edu	37	1	156236169	156236169	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156236169C>G	uc001foc.3	-	12	1407	c.1258G>C	c.(1258-1260)GAA>CAA	p.E420Q	SMG5_uc009wrv.2_5'UTR	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	420					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					GACTCTGGTTCATCTGCGGAA	0.567													18	40	---	---	---	---	PASS
TMEM79	84283	broad.mit.edu	37	1	156256105	156256105	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156256105G>A	uc010phi.1	+	3	1008	c.812G>A	c.(811-813)GGG>GAG	p.G271E	TMEM79_uc001fod.2_Missense_Mutation_p.G112E|TMEM79_uc009wrw.2_Missense_Mutation_p.G271E	NM_032323	NP_115699	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	271						integral to membrane				central_nervous_system(1)	1	Hepatocellular(266;0.158)					CGGCCCTTTGGGGAGCCACGG	0.577													27	116	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156627501	156627501	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156627501C>G	uc001fpp.2	+	11	2580	c.2244C>G	c.(2242-2244)AAC>AAG	p.N748K		NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	748	C-type lectin.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCGGACTCAACGACAGGACCA	0.642											OREG0013880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	19	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156642660	156642660	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156642660G>A	uc001fpq.2	-	4	1453	c.1320C>T	c.(1318-1320)GTC>GTT	p.V440V		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	440	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTCCAGGCAGGACGCTGGCAG	0.672													14	63	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156834197	156834197	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156834197G>A	uc001fqh.1	+	2	320	c.264G>A	c.(262-264)AGG>AGA	p.R88R	NTRK1_uc001fqf.1_Silent_p.R58R|NTRK1_uc009wsi.1_5'UTR|NTRK1_uc001fqi.1_Silent_p.R88R|NTRK1_uc009wsk.1_Silent_p.R88R	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	88	Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	GTGATCTGAGGGGCCTGGGGG	0.622			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			20	31	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157767980	157767980	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157767980G>C	uc001frg.2	-	8	1198	c.1085C>G	c.(1084-1086)CCA>CGA	p.P362R	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.P362R|FCRL1_uc001fri.2_Missense_Mutation_p.P323R|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	362	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TAGCTGCCCTGGGGTAGGTGA	0.498													9	24	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158613164	158613164	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158613164C>A	uc001fst.1	-	31	4589	c.4390G>T	c.(4390-4392)GAA>TAA	p.E1464*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1464	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GCATAGTGTTCATCAGCAATG	0.443													26	29	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	159021696	159021696	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159021696C>G	uc001ftg.2	+	9	2015	c.1725C>G	c.(1723-1725)GCC>GCG	p.A575A	IFI16_uc010pis.1_Silent_p.A575A|IFI16_uc001fth.2_Silent_p.A118A|IFI16_uc010pit.1_Silent_p.A174A	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	631	HIN-200 2.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					AGATCATTGCCATAGCAAATT	0.423													16	91	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159170624	159170624	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159170624C>T	uc001ftl.2	+	9	1251	c.1109C>T	c.(1108-1110)TCC>TTC	p.S370F	CADM3_uc001ftk.2_Missense_Mutation_p.S404F|uc001ftm.1_RNA	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	370	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					GCAAAAGGCTCCGACGATGCT	0.572													27	46	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159170626	159170626	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159170626G>C	uc001ftl.2	+	9	1253	c.1111G>C	c.(1111-1113)GAC>CAC	p.D371H	CADM3_uc001ftk.2_Missense_Mutation_p.D405H|uc001ftm.1_RNA	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	371	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					AAAAGGCTCCGACGATGCTCC	0.572													27	48	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159900956	159900956	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159900956G>A	uc001fur.2	-	13	1807	c.1609C>T	c.(1609-1611)CAG>TAG	p.Q537*	IGSF9_uc001fuq.2_Nonsense_Mutation_p.Q521*|IGSF9_uc001fup.2_5'UTR	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	537	Fibronectin type-III 1.|Extracellular (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CTGAATCTCTGCAGATAACCA	0.542													3	14	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160094994	160094994	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160094994C>A	uc001fvc.2	+	7	831	c.699C>A	c.(697-699)AAC>AAA	p.N233K	ATP1A2_uc001fvb.2_Missense_Mutation_p.N233K|ATP1A2_uc010piz.1_Missense_Mutation_p.N78K|ATP1A2_uc001fvd.2_5'Flank	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	233	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCCATGAGAACCCCCTGGAGA	0.537													3	49	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160124847	160124847	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160124847C>A	uc001fve.3	+	3	699	c.220C>A	c.(220-222)CAA>AAA	p.Q74K	ATP1A4_uc001fvf.3_RNA	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	74	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCATAGCCACCAAAGGGCAAA	0.512													20	123	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160281809	160281809	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160281809C>A	uc009wti.2	-	11	1320	c.926_splice	c.e11-1	p.G309_splice	COPA_uc001fvv.3_Splice_Site_p.G309_splice|COPA_uc009wtj.1_Splice_Site_p.G255_splice	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCATCATGGCCTGGGGGACAG	0.443													7	22	---	---	---	---	PASS
HSPA6	3310	broad.mit.edu	37	1	161495433	161495433	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161495433G>A	uc001gap.2	+	2	1645	c.985G>A	c.(985-987)GAC>AAC	p.D329N	HSPA6_uc001gaq.2_Missense_Mutation_p.D329N	NM_002155	NP_002146	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	329					response to unfolded protein		ATP binding			skin(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TGCCAAGCTGGACAAGGCCCA	0.607													17	19	---	---	---	---	PASS
UAP1	6675	broad.mit.edu	37	1	162536109	162536109	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162536109A>G	uc001gce.3	+	2	580	c.251A>G	c.(250-252)CAA>CGA	p.Q84R		NM_003115	NP_003106	Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	84					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|nucleus|plasma membrane	UDP-N-acetylglucosamine diphosphorylase activity			ovary(2)|skin(2)|kidney(1)	5	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			ACAAGGGATCAAGATCAGCTC	0.433													14	27	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162724627	162724627	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162724627G>T	uc001gcf.2	+	6	864	c.399G>T	c.(397-399)CGG>CGT	p.R133R	DDR2_uc001gcg.2_Silent_p.R133R	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	133	Extracellular (Potential).|F5/8 type C.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			TCTCTTGGCGGAACCGTCATG	0.522													18	28	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167095205	167095205	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095205G>A	uc001geb.1	+	5	837	c.837G>A	c.(835-837)ATG>ATA	p.M279I		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	279					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						AGAAGTTGATGGAGGAGAGAG	0.617													23	19	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171086551	171086551	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171086551T>C	uc001ghi.2	+	9	1679	c.1568T>C	c.(1567-1569)CTG>CCG	p.L523P	FMO3_uc001ghh.2_Missense_Mutation_p.L523P|FMO3_uc010pmb.1_Missense_Mutation_p.L503P|FMO3_uc010pmc.1_Missense_Mutation_p.L460P	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	523					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATTCCTATTCTGTTAATCGCT	0.428													29	44	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171755175	171755175	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171755175G>T	uc001ghz.2	+	3	1417	c.1070G>T	c.(1069-1071)AGA>ATA	p.R357I	METTL13_uc001gia.2_Missense_Mutation_p.R271I|METTL13_uc001gib.2_Missense_Mutation_p.R201I|METTL13_uc010pml.1_Missense_Mutation_p.R356I	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	357							methyltransferase activity|protein binding			kidney(1)	1						CTGTCGGCTAGAGTCATGGAG	0.572													5	18	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	172376937	172376937	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172376937C>A	uc001gie.2	+	21	2724	c.2548C>A	c.(2548-2550)CGT>AGT	p.R850S	DNM3_uc001gif.2_Missense_Mutation_p.R846S|DNM3_uc001gih.1_Intron|PIGC_uc001gii.1_Intron|PIGC_uc001gij.1_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	856					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						ATCACCAACTCGTCCCACTAT	0.418													48	54	---	---	---	---	PASS
GPR52	9293	broad.mit.edu	37	1	174417612	174417612	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174417612C>G	uc001gka.1	+	1	401	c.363C>G	c.(361-363)ATC>ATG	p.I121M	RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron|uc010pmu.1_RNA	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	121	Helical; Name=3; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1						GATATATCATCTCAGTTCTAA	0.438													8	248	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175348885	175348885	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175348885C>T	uc001gkp.1	-						TNR_uc009wwu.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TAAAAATAGACAGACATCACC	0.483													12	32	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175362977	175362977	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175362977T>A	uc001gkp.1	-	4	1376	c.1295A>T	c.(1294-1296)GAG>GTG	p.E432V	TNR_uc009wwu.1_Missense_Mutation_p.E432V|TNR_uc010pmz.1_3'UTR	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	432	Fibronectin type-III 2.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CCACTGCACCTCCACGGTGGT	0.483													11	157	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185939523	185939523	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185939523T>C	uc001grq.1	+	15	2498	c.2269T>C	c.(2269-2271)TTG>CTG	p.L757L	HMCN1_uc001grr.1_Silent_p.L98L	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	757	Ig-like C2-type 4.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CTTGGGACTTTTGAAGATTCA	0.418													118	121	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185987391	185987391	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185987391G>T	uc001grq.1	+	34	5606	c.5377G>T	c.(5377-5379)GCT>TCT	p.A1793S		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1793	Ig-like C2-type 15.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ACTGGTTATTGCTCAGGCTCA	0.423													27	83	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186088426	186088426	+	Silent	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186088426T>G	uc001grq.1	+	78	12181	c.11952T>G	c.(11950-11952)GTT>GTG	p.V3984V		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3984					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCCTTCATGTTCATGGTATGG	0.443													18	111	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186122917	186122917	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186122917G>T	uc001grq.1	+	97	15283	c.15054G>T	c.(15052-15054)GGG>GGT	p.G5018G	HMCN1_uc001grs.1_Silent_p.G587G	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5018	Nidogen G2 beta-barrel.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGGTCCTGGGCAGCTGTACG	0.453													20	46	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186278003	186278003	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186278003C>T	uc001gru.3	+	7	3203	c.3152C>T	c.(3151-3153)ACT>ATT	p.T1051I	PRG4_uc001grt.3_Missense_Mutation_p.T1010I|PRG4_uc009wyl.2_Missense_Mutation_p.T958I|PRG4_uc009wym.2_Missense_Mutation_p.T917I|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1051					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACGACACCAACTCCCCGCAAG	0.453													11	70	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186305817	186305817	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186305817C>T	uc001grv.2	-	33	4813	c.4516G>A	c.(4516-4518)GAA>AAA	p.E1506K		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1506	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GTCTCTTTTTCAGATAATGTC	0.343			T	NTRK1	papillary thyroid								8	37	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196309614	196309614	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196309614G>T	uc001gtd.1	-	16	1700	c.1640C>A	c.(1639-1641)ACA>AAA	p.T547K	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.T497K|KCNT2_uc001gtf.1_Missense_Mutation_p.T547K|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.T547K|KCNT2_uc001gth.1_Missense_Mutation_p.T68K	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	547	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						GCATATGTCTGTAGAATTCAT	0.338													31	72	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197398679	197398679	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197398679A>T	uc001gtz.2	+	8	2912	c.2777A>T	c.(2776-2778)CAG>CTG	p.Q926L	CRB1_uc010poz.1_Missense_Mutation_p.Q902L|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.Q814L|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.Q407L|CRB1_uc001gub.1_Missense_Mutation_p.Q575L	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	926	Extracellular (Potential).|EGF-like 14.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						GAGGAGGTTCAGTGGTGTGGA	0.542													50	45	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197398732	197398732	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197398732C>T	uc001gtz.2	+	8	2965	c.2830C>T	c.(2830-2832)CAA>TAA	p.Q944*	CRB1_uc010poz.1_Nonsense_Mutation_p.Q920*|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Nonsense_Mutation_p.Q832*|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Nonsense_Mutation_p.Q425*|CRB1_uc001gub.1_Nonsense_Mutation_p.Q593*	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	944	Extracellular (Potential).|EGF-like 14.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						GCCGGTGCTTCAAGGATTTGA	0.498													5	53	---	---	---	---	PASS
NR5A2	2494	broad.mit.edu	37	1	200017935	200017935	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200017935A>T	uc001gvb.2	+	5	1305	c.1099A>T	c.(1099-1101)AGA>TGA	p.R367*	NR5A2_uc001gvc.2_Nonsense_Mutation_p.R321*|NR5A2_uc009wzh.2_Nonsense_Mutation_p.R327*|NR5A2_uc010pph.1_Nonsense_Mutation_p.R295*	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	367	Ligand-binding.				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					TATCTTCTTCAGAGAACTTAA	0.418													33	59	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201029835	201029835	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201029835T>A	uc001gvv.2	-	26	3592	c.3365A>T	c.(3364-3366)TAC>TTC	p.Y1122F		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1122	IV.|Helical; Name=S1 of repeat IV; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	AAACATCAGGTATTCAAAGTA	0.527													76	73	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201047033	201047033	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201047033G>T	uc001gvv.2	-	11	1820	c.1593C>A	c.(1591-1593)CGC>CGA	p.R531R		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	531	II.|Helical; Name=S4 of repeat II; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TCCTCAGGAGGCGGATGCAGC	0.642													10	14	---	---	---	---	PASS
UBE2T	29089	broad.mit.edu	37	1	202302223	202302223	+	Splice_Site	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202302223T>A	uc001gxx.3	-	6	521	c.385_splice	c.e6-1	p.S129_splice		NM_014176	NP_054895	Q9NPD8	UBE2T_HUMAN	ubiquitin-conjugating enzyme E2T						DNA repair|protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination	nucleoplasm	ATP binding|ubiquitin-protein ligase activity				0						TTCTGAGGACTGAGATGAAAT	0.403													38	42	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202727593	202727593	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202727593T>A	uc001gyf.2	-	9	1239	c.1123A>T	c.(1123-1125)AGG>TGG	p.R375W	KDM5B_uc009xag.2_Missense_Mutation_p.R411W|KDM5B_uc001gyg.1_Missense_Mutation_p.R217W	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	375					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						GTATAGTCCCTGGCTGCTTGT	0.388													13	23	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203452366	203452366	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203452366C>T	uc001gzs.2	+	2	254	c.54C>T	c.(52-54)GCC>GCT	p.A18A	PRELP_uc001gzt.2_Silent_p.A18A	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	18					skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCTCAGTGGCCCAAGGCCAGC	0.617													25	57	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204409310	204409310	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204409310C>A	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CACCCCTACTCCCAACTGACC	0.572													8	35	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204426972	204426972	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204426972C>A	uc001haw.2	-	10	2076	c.1597G>T	c.(1597-1599)GTC>TTC	p.V533F	PIK3C2B_uc010pqv.1_Missense_Mutation_p.V533F|PIK3C2B_uc001hax.1_Missense_Mutation_p.V533F|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	533					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			ACGGACTGGACCACCCTGTCA	0.647													9	21	---	---	---	---	PASS
C1orf74	148304	broad.mit.edu	37	1	209956925	209956925	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209956925C>T	uc001hhp.1	-	2	298	c.55G>A	c.(55-57)GCT>ACT	p.A19T		NM_152485	NP_689698	Q96LT6	CA074_HUMAN	hypothetical protein LOC148304	19										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GTCTGCTGAGCAGCTGCCACC	0.597													27	71	---	---	---	---	PASS
C1orf107	27042	broad.mit.edu	37	1	210006670	210006670	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210006670A>T	uc001hhr.1	+	4	605	c.529A>T	c.(529-531)AGT>TGT	p.S177C	C1orf107_uc009xcu.1_Translation_Start_Site	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	177					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		GGAAGAGGAAAGTGGAGACAA	0.448													13	56	---	---	---	---	PASS
INTS7	25896	broad.mit.edu	37	1	212151614	212151614	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212151614C>A	uc001hiw.1	-	11	1575	c.1470G>T	c.(1468-1470)CTG>CTT	p.L490L	INTS7_uc009xdb.1_Silent_p.L490L|INTS7_uc001hix.1_Silent_p.L366L|INTS7_uc001hiy.1_Silent_p.L490L|INTS7_uc010pta.1_Silent_p.L441L	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	490					snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		GGCTTTTTACCAGAAGTTCTT	0.428													23	100	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214836926	214836926	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214836926T>C	uc001hkm.2	+							NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGATGTTTGTGTTGCAGGTC	0.423													5	5	---	---	---	---	PASS
CAPN2	824	broad.mit.edu	37	1	223943351	223943351	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223943351G>T	uc001hob.3	+	10	1529	c.1305G>T	c.(1303-1305)GAG>GAT	p.E435D	CAPN2_uc010puy.1_Missense_Mutation_p.E357D|CAPN2_uc001hoc.2_5'Flank	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1	435	Domain III.				proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		GCATCTATGAGGTGCAGAGCG	0.612													10	10	---	---	---	---	PASS
PRSS38	339501	broad.mit.edu	37	1	228005074	228005074	+	Missense_Mutation	SNP	G	T	T	rs74588116	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228005074G>T	uc001hrh.2	+	3	476	c.476G>T	c.(475-477)CGC>CTC	p.R159L		NM_183062	NP_898885	A1L453	PRS38_HUMAN	marapsin 2 precursor	159	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2						CTGAAGACCCGCATTGTGTTT	0.562													20	26	---	---	---	---	PASS
ABCB10	23456	broad.mit.edu	37	1	229676360	229676360	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229676360A>C	uc001htp.3	-	5	1239	c.1196T>G	c.(1195-1197)TTT>TGT	p.F399C		NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10	399	Mitochondrial intermembrane (Potential).|Mitochondrial matrix (Potential).|ABC transmembrane type-1.					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TACTGCTCCAAAGAAACCAGC	0.393													33	44	---	---	---	---	PASS
ERO1LB	56605	broad.mit.edu	37	1	236396138	236396138	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236396138G>A	uc001hxt.2	-	9	931	c.675C>T	c.(673-675)GGC>GGT	p.G225G		NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta	225					electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CATCATCTTCGCCTAAAAGAG	0.274													6	17	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236746380	236746380	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236746380C>G	uc001hyd.1	-	18	2483	c.2358G>C	c.(2356-2358)TCG>TCC	p.S786S	HEATR1_uc009xgh.1_Silent_p.S29S	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	786					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CAAGAAAAACCGAGTCCTCCA	0.413													39	94	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237755149	237755149	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237755149C>A	uc001hyl.1	+	32	4391	c.4271C>A	c.(4270-4272)TCC>TAC	p.S1424Y		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1424	Cytoplasmic (By similarity).|B30.2/SPRY 3.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGCAAACGTCCACGGTATGA	0.398													9	8	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777541	237777541	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777541C>A	uc001hyl.1	+	37	5233	c.5113C>A	c.(5113-5115)CTG>ATG	p.L1705M		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1705	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTACTATGACCTGCTGATTGA	0.542													7	8	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237817615	237817615	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237817615C>A	uc001hyl.1	+	52	7986	c.7866C>A	c.(7864-7866)TGC>TGA	p.C2622*		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2622	Modulator (Potential).|Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AATATTACTGCCTGCCTGGAG	0.378													10	32	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947456	237947456	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947456C>A	uc001hyl.1	+	90	12564	c.12444C>A	c.(12442-12444)GTC>GTA	p.V4148V	RYR2_uc010pya.1_Silent_p.V563V	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4148					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCGAGAGGGTCTATTTTGAAA	0.502													12	24	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240939492	240939492	+	Silent	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240939492T>G	uc001hyv.2	-	18	1765	c.1435A>C	c.(1435-1437)AGG>CGG	p.R479R	RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_3'UTR|RGS7_uc001hyu.2_3'UTR|RGS7_uc009xgn.1_3'UTR|RGS7_uc001hyw.2_Silent_p.R461R|RGS7_uc010pyi.1_RNA|RGS7_uc001hyt.2_3'UTR	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	Error:Variant_position_missing_in_P49802_after_alignment					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CTTGTTAACCTCTTGGACGTG	0.398													15	53	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247024390	247024390	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247024390C>A	uc001ibu.1	-	28	3950	c.3943G>T	c.(3943-3945)GAT>TAT	p.D1315Y	AHCTF1_uc001ibv.1_Missense_Mutation_p.D1324Y|AHCTF1_uc009xgs.1_Missense_Mutation_p.D176Y|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1315	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GTAGTCTCATCGGATGTGATT	0.468													13	32	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248039721	248039721	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248039721C>T	uc001ido.2	+	6	1439	c.1391C>T	c.(1390-1392)GCA>GTA	p.A464V	OR2W3_uc001idp.1_Intron	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	464						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACAACAATAGCAGGGTCAGGA	0.428													19	66	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085221	248085221	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085221G>A	uc010pzc.1	+	1	902	c.902G>A	c.(901-903)AGG>AAG	p.R301K		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	301	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCCCTGACAAGGTGTATGGGT	0.443													25	57	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551326	248551326	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551326G>T	uc001iei.1	+	1	417	c.417G>T	c.(415-417)CGG>CGT	p.R139R		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCAGCTGGCGGGTCTGCTGGA	0.582													14	35	---	---	---	---	PASS
OR2T2	401992	broad.mit.edu	37	1	248616139	248616139	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248616139T>C	uc001iek.1	+	1	41	c.41T>C	c.(40-42)GTC>GCC	p.V14A		NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACTAACTTCGTCCTCACAGGC	0.502													9	52	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21230480	21230480	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21230480C>A	uc002red.2	-	26	9388	c.9260G>T	c.(9259-9261)TGG>TTG	p.W3087L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3087					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACTTACTTGCCAACTTGCTTG	0.408													12	65	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21255445	21255445	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21255445G>A	uc002red.2	-	10	1261	c.1133C>T	c.(1132-1134)ACT>ATT	p.T378I		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	378	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GGCTTGTAAAGTGATGGGGCT	0.498													8	8	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26696407	26696407	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26696407T>C	uc002rhk.2	-	28	3564	c.3437A>G	c.(3436-3438)AAG>AGG	p.K1146R	OTOF_uc010yla.1_5'UTR|OTOF_uc002rhh.2_Missense_Mutation_p.K399R|OTOF_uc002rhi.2_Missense_Mutation_p.K456R|OTOF_uc002rhj.2_Missense_Mutation_p.K399R	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1146	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTCACCCGCTTTAGGTCCCG	0.622													11	20	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26696417	26696417	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26696417G>T	uc002rhk.2	-	28	3554	c.3427C>A	c.(3427-3429)CGG>AGG	p.R1143R	OTOF_uc010yla.1_5'UTR|OTOF_uc002rhh.2_Silent_p.R396R|OTOF_uc002rhi.2_Silent_p.R453R|OTOF_uc002rhj.2_Silent_p.R396R	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1143	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTAGGTCCCGTAGGCCCCAG	0.612													11	19	---	---	---	---	PASS
LCLAT1	253558	broad.mit.edu	37	2	30863433	30863433	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30863433G>A	uc002rnj.2	+	7	1402	c.1193G>A	c.(1192-1194)TGT>TAT	p.C398Y	LCLAT1_uc010ymp.1_Missense_Mutation_p.C236Y|LCLAT1_uc002rnl.2_Missense_Mutation_p.C360Y|LCLAT1_uc010ymq.1_Missense_Mutation_p.C360Y	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	398					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						GAACTTGCATGTTACCGACTT	0.328													40	28	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31595154	31595154	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31595154C>G	uc002rnv.1	-	17	1875	c.1796G>C	c.(1795-1797)CGC>CCC	p.R599P		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	599					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	ATTCTCGTAGCGAGGAATGTC	0.632													59	78	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32750675	32750675	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32750675T>C	uc010ezu.2	+	59	12034	c.11900T>C	c.(11899-11901)CTG>CCG	p.L3967P		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3967					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GTGTTTCACCTGTTTCACAAA	0.413													6	21	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33589321	33589321	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33589321G>T	uc002ros.2	+	30	4441	c.4441G>T	c.(4441-4443)GGC>TGC	p.G1481C	LTBP1_uc002rot.2_Missense_Mutation_p.G1155C|LTBP1_uc002rou.2_Missense_Mutation_p.G1154C|LTBP1_uc002rov.2_Missense_Mutation_p.G1101C|LTBP1_uc010ymz.1_Missense_Mutation_p.G1112C|LTBP1_uc010yna.1_Missense_Mutation_p.G1059C|LTBP1_uc010ynb.1_Missense_Mutation_p.G378C	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1480	EGF-like 16; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TTGTATTGATGGCCAGTGTGT	0.413													20	35	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33752399	33752399	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33752399G>C	uc002rox.2	+	11	1630	c.1003G>C	c.(1003-1005)GTT>CTT	p.V335L	RASGRP3_uc010ync.1_Missense_Mutation_p.V335L|RASGRP3_uc002roy.2_Missense_Mutation_p.V335L	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	335	Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					CCAGCTCTCCGTTACCCTGAG	0.478													15	11	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39542442	39542442	+	Intron	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39542442T>G	uc002rro.2	-						MAP4K3_uc002rrp.2_Intron|MAP4K3_uc010yns.1_Intron	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase						JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				GTGTATAGTATATACTTACAG	0.289													16	30	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50149125	50149125	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149125G>T	uc010fbp.2	-	6	2093	c.1286C>A	c.(1285-1287)TCC>TAC	p.S429Y	NRXN1_uc002rxb.3_Missense_Mutation_p.S1163Y|NRXN1_uc010fbq.2_Missense_Mutation_p.S1534Y|NRXN1_uc002rxe.3_Missense_Mutation_p.S1464Y|NRXN1_uc010yon.1_Missense_Mutation_p.S129Y|NRXN1_uc002rxa.3_Missense_Mutation_p.S126Y	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	429	Cytoplasmic (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATTTTTGTTGGAGCTTTTCGC	0.393													8	33	---	---	---	---	PASS
ASB3	51130	broad.mit.edu	37	2	53941600	53941600	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53941600G>A	uc002rxg.1	-	7	1036	c.901C>T	c.(901-903)CGG>TGG	p.R301W	ASB3_uc002rxh.1_Missense_Mutation_p.R228W|ASB3_uc002rxi.3_Missense_Mutation_p.R339W|ASB3_uc010yoo.1_Missense_Mutation_p.R218W	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3	301	ANK 9.				intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TAGCCATTCCGGAGTAATATT	0.468													43	55	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61522091	61522091	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61522091C>A	uc002sbe.2	-	32	4476	c.4454G>T	c.(4453-4455)AGT>ATT	p.S1485I		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	1485					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AACCTTGCAACTCCAGGAATT	0.294													6	21	---	---	---	---	PASS
GKN1	56287	broad.mit.edu	37	2	69207139	69207139	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69207139A>T	uc002sfc.2	+	5	515	c.452A>T	c.(451-453)AAC>ATC	p.N151I		NM_019617	NP_062563	Q9NS71	GKN1_HUMAN	18 kDa antrum mucosa protein precursor	151	BRICHOS.				digestion|positive regulation of cell division	extracellular region				breast(1)	1						TTCGGAAAAAACATTGCAAAC	0.507													21	29	---	---	---	---	PASS
ADD2	119	broad.mit.edu	37	2	70922931	70922931	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70922931C>A	uc002sgz.2	-	6	942	c.477G>T	c.(475-477)TTG>TTT	p.L159F	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Missense_Mutation_p.L159F|ADD2_uc002sha.2_Missense_Mutation_p.L159F|ADD2_uc002sgx.2_Missense_Mutation_p.L159F|ADD2_uc010fdt.1_Missense_Mutation_p.L159F|ADD2_uc002shc.1_Missense_Mutation_p.L159F|ADD2_uc002shd.1_Missense_Mutation_p.L159F|ADD2_uc010fdu.1_Missense_Mutation_p.L175F	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	159					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						TGCTGACTCTCAACTGGAGGA	0.527													6	10	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79255037	79255037	+	Nonsense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79255037T>A	uc002snw.2	+	5	523	c.438T>A	c.(436-438)TGT>TGA	p.C146*	REG3G_uc002snx.2_Nonsense_Mutation_p.C146*|REG3G_uc010ffu.2_Nonsense_Mutation_p.C100*	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	146	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						CTGGCCACTGTGGGAGCCTGT	0.493													25	35	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88474199	88474199	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88474199G>T	uc002ssz.3	+	3	418	c.265G>T	c.(265-267)GTG>TTG	p.V89L	THNSL2_uc002ssv.2_RNA|THNSL2_uc002ssw.3_Missense_Mutation_p.V89L|THNSL2_uc002ssx.3_Missense_Mutation_p.V57L|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Missense_Mutation_p.V89L|THNSL2_uc010fhe.2_5'UTR	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	89					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						TCACAGAGAAGTGGTCCATCT	0.537													14	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89417257	89417257	+	RNA	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89417257G>C	uc010ytr.1	-	41		c.4470C>G			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCCTTACCTGGGAACCAGAGC	0.512													6	120	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90121709	90121709	+	Intron	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90121709C>G	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GCTCTGGTTCCCAGGTAAGGA	0.502													14	5	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98809499	98809499	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98809499G>T	uc002syo.2	+	11	1869	c.1605G>T	c.(1603-1605)CAG>CAT	p.Q535H	VWA3B_uc010yvh.1_Missense_Mutation_p.Q385H|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.Q54H|VWA3B_uc002sym.2_Missense_Mutation_p.Q535H|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.Q192H|VWA3B_uc002syp.1_Translation_Start_Site	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	535	VWFA.									ovary(3)|large_intestine(2)|skin(1)	6						AGTTCATACAGGTTAGATGGA	0.413													47	43	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99170832	99170832	+	Silent	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99170832T>G	uc002syy.2	+	16	1854	c.1461T>G	c.(1459-1461)TCT>TCG	p.S487S	INPP4A_uc010yvj.1_Silent_p.S487S|INPP4A_uc010yvk.1_Silent_p.S487S|INPP4A_uc002syx.2_Silent_p.S482S|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	487					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						CCAAGGCCTCTCCCACTTCGA	0.602													3	7	---	---	---	---	PASS
PDCL3	79031	broad.mit.edu	37	2	101188050	101188050	+	Splice_Site	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101188050A>G	uc002tao.2	+	5	481	c.369_splice	c.e5-2	p.G123_splice		NM_024065	NP_076970	Q9H2J4	PDCL3_HUMAN	phosducin-like 3						apoptosis|interspecies interaction between organisms	cytoplasm	protein binding				0						TGTGTTTTATAGAATTCCCCT	0.388													17	32	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102475492	102475492	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102475492G>A	uc002tbg.2	+	14	1485	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	MAP4K4_uc002tbc.2_Missense_Mutation_p.R477Q|MAP4K4_uc002tbd.2_Missense_Mutation_p.R477Q|MAP4K4_uc002tbe.2_Missense_Mutation_p.R477Q|MAP4K4_uc002tbf.2_Missense_Mutation_p.R477Q|MAP4K4_uc010yvy.1_Missense_Mutation_p.R477Q|MAP4K4_uc002tbh.2_Missense_Mutation_p.R477Q|MAP4K4_uc002tbi.2_Missense_Mutation_p.R330Q|MAP4K4_uc010yvz.1_Missense_Mutation_p.R457Q|MAP4K4_uc002tbk.2_5'UTR|MAP4K4_uc002tbj.1_Missense_Mutation_p.R373Q	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	477					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GAGGAGCAGCGGCACTTGGAA	0.507													11	41	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103095403	103095403	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103095403C>A	uc002tbz.3	+	2	819	c.362C>A	c.(361-363)TCG>TAG	p.S121*		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	121	Extracellular (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GACCACAAATCGCCTCCGGTC	0.612													33	19	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125530578	125530578	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125530578C>A	uc002tno.2	+	17	3097	c.2733C>A	c.(2731-2733)AAC>AAA	p.N911K	CNTNAP5_uc010flu.2_Missense_Mutation_p.N912K	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	911	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGCAGCTGAACAGCCAGTTGT	0.517													32	31	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128409084	128409084	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128409084G>A	uc010yzn.1	+	4	1470	c.859G>A	c.(859-861)GTG>ATG	p.V287M	LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.V287M|GPR17_uc010yzo.1_Missense_Mutation_p.V259M|GPR17_uc002tpd.2_Missense_Mutation_p.V259M	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	287	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		CTCCGTCTACGTGCTGCACTA	0.642													25	20	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128865517	128865517	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128865517G>T	uc002tps.2	+	4	461	c.283G>T	c.(283-285)GAT>TAT	p.D95Y	UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Missense_Mutation_p.D71Y	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	95					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GACAGGTACCGATTATTCCTA	0.378													55	65	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832536	130832536	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832536G>T	uc010fmh.2	-	17	2909	c.2509C>A	c.(2509-2511)CAG>AAG	p.Q837K		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	837	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						AGCACAGCCTGGATGGCCACG	0.587													38	103	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130877781	130877781	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130877781C>A	uc010fmh.2	-	3	708	c.308G>T	c.(307-309)TGC>TTC	p.C103F		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	103						cell cortex	ATP binding			skin(3)|ovary(2)	5						GAAGCAGTGGCAGCACCACTT	0.612													11	153	---	---	---	---	PASS
PTPN18	26469	broad.mit.edu	37	2	131130736	131130736	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131130736A>G	uc002trc.2	+	15	1423	c.1322A>G	c.(1321-1323)AAC>AGC	p.N441S	PTPN18_uc002trd.2_Missense_Mutation_p.N420S|PTPN18_uc002trb.2_Missense_Mutation_p.N334S|PTPN18_uc002tre.2_Missense_Mutation_p.N92S	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	441						cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					CCAGGTTTCAACCTGCGCATT	0.622													5	9	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520610	131520610	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520610G>A	uc002trw.2	+	2	1155	c.965G>A	c.(964-966)CGT>CAT	p.R322H	FAM123C_uc010fmv.2_Missense_Mutation_p.R322H|FAM123C_uc010fms.1_Missense_Mutation_p.R322H|FAM123C_uc010fmt.1_Missense_Mutation_p.R322H|FAM123C_uc010fmu.1_Missense_Mutation_p.R322H	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	322										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CAGCAGCAGCGTGCCCTCCTA	0.662													21	19	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	131976283	131976283	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131976283G>T	uc002tsn.2	+	1	360	c.308G>T	c.(307-309)TGC>TTC	p.C103F	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	103							ATP binding				0						AAGTGGTGCTGCCACTGCTTC	0.622													12	49	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021537	132021537	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021537C>A	uc002tsn.2	+	15	2561	c.2509C>A	c.(2509-2511)CAG>AAG	p.Q837K	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.Q437K|POTEE_uc002tsl.2_Missense_Mutation_p.Q419K|POTEE_uc010fmy.1_Missense_Mutation_p.Q301K	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	837	Actin-like.						ATP binding				0						CGTGGCCATCCAGGCCGTGCC	0.607													7	199	---	---	---	---	PASS
MCM6	4175	broad.mit.edu	37	2	136626375	136626375	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136626375C>A	uc002tuw.2	-	4	497	c.421G>T	c.(421-423)GTG>TTG	p.V141L		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	141					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	GTCCGCACCACCTGCCCACTG	0.468													61	36	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138320815	138320815	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138320815A>T	uc002tva.1	+	15	3076	c.3076A>T	c.(3076-3078)AGT>TGT	p.S1026C	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCCATGTTACAGTGAGTGCAA	0.413													17	13	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139310249	139310249	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139310249G>T	uc002tvh.2	+	5	878	c.478G>T	c.(478-480)GAG>TAG	p.E160*		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	160	MATH.					nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		ATTATTTTGTGAGGTGGGTAC	0.328													25	32	---	---	---	---	PASS
NXPH2	11249	broad.mit.edu	37	2	139429108	139429108	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139429108A>T	uc002tvi.2	-	2	179	c.179T>A	c.(178-180)GTT>GAT	p.V60D		NM_007226	NP_009157	O95156	NXPH2_HUMAN	neurexophilin 2 precursor	60	II.				neuropeptide signaling pathway	extracellular region				ovary(3)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(221;0.101)		AGACTGTTTAACAAACAGGCG	0.577													54	50	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141110623	141110623	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141110623A>G	uc002tvj.1	-	76	12521	c.11549T>C	c.(11548-11550)GTG>GCG	p.V3850A		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3850	Extracellular (Potential).|EGF-like 9.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTGCCAAACACCAAACATTC	0.353										TSP Lung(27;0.18)			38	28	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141243075	141243075	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141243075C>A	uc002tvj.1	-	59	10234	c.9262G>T	c.(9262-9264)GTC>TTC	p.V3088F		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3088	Extracellular (Potential).|LDL-receptor class B 28.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCATTGGGGACCGCTGTGTTA	0.373										TSP Lung(27;0.18)			20	17	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157292	145157292	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157292C>T	uc002tvu.2	-	8	1942	c.1462G>A	c.(1462-1464)GGT>AGT	p.G488S	ZEB2_uc002tvv.2_Missense_Mutation_p.G482S|ZEB2_uc010zbm.1_Missense_Mutation_p.G459S|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.G517S	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	488						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		ATGTGATAACCTTTCAACTTT	0.413													37	35	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152507407	152507407	+	Intron	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152507407C>G	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATACTGAAATCAGAGAAAACA	0.328													30	86	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152521924	152521924	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152521924C>A	uc010fnx.2	-	42	5352	c.5161G>T	c.(5161-5163)GAG>TAG	p.E1721*		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1721	Nebulin 44.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCAGCTTCTCGGGGTGCTGG	0.507													23	13	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152522777	152522777	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152522777C>A	uc010fnx.2	-	41	5049	c.4858G>T	c.(4858-4860)GCC>TCC	p.A1620S		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1620	Nebulin 41.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTCTTGCTGGCTTCATAGCCC	0.463													47	111	---	---	---	---	PASS
CCDC148	130940	broad.mit.edu	37	2	159107382	159107382	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159107382C>A	uc002tzq.2	-	10	1416	c.1153G>T	c.(1153-1155)GAA>TAA	p.E385*	CCDC148_uc002tzr.2_Nonsense_Mutation_p.E233*|CCDC148_uc010foh.2_Nonsense_Mutation_p.E98*	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	385	Potential.									ovary(2)	2						ATTTCCATTTCCAGTCTTGCT	0.239													3	31	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159536994	159536994	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159536994A>G	uc002tzv.2	+	22	3644	c.3384A>G	c.(3382-3384)GCA>GCG	p.A1128A	PKP4_uc002tzw.2_Silent_p.A1085A|PKP4_uc002tzx.2_Silent_p.A785A|PKP4_uc002uaa.2_Silent_p.A937A|uc002uab.1_Intron|PKP4_uc002uac.2_Silent_p.A309A|PKP4_uc002uad.2_RNA	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	1128					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						ACTTTGATGCATACAGATTGT	0.343										HNSCC(62;0.18)			56	42	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160268843	160268843	+	Intron	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160268843T>A	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uaq.1_Intron|BAZ2B_uc002uar.1_Intron	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TTATGTTTCTTACCTTGAGCT	0.353													11	20	---	---	---	---	PASS
GCG	2641	broad.mit.edu	37	2	163003868	163003868	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163003868C>A	uc002ucc.2	-	3	348	c.249G>T	c.(247-249)AGG>AGT	p.R83S		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	83		Cleavage; by PCSK1 and PCSK2.			cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	CTTACCTGTTCCTCTTGGTAT	0.408													46	107	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166152382	166152382	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166152382T>A	uc002udc.2	+	2	339	c.49T>A	c.(49-51)TTT>ATT	p.F17I	SCN2A_uc002udd.2_Missense_Mutation_p.F17I|SCN2A_uc002ude.2_Missense_Mutation_p.F17I	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	17					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	CTTCCGCTTCTTTACCAGGGA	0.483													5	25	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166245260	166245260	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166245260G>T	uc002udc.2	+	27	5234	c.4944G>T	c.(4942-4944)ACG>ACT	p.T1648T	SCN2A_uc002udd.2_Silent_p.T1648T|SCN2A_uc002ude.2_Silent_p.T1648T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1648	IV.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	GGATCCGCACGCTGCTCTTTG	0.488													18	63	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848103	166848103	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848103C>A	uc010zcz.1	-	26	5667	c.5649G>T	c.(5647-5649)ATG>ATT	p.M1883I		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1894						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GATTGGAAGCCATGAATCGCT	0.428													15	41	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168102849	168102849	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168102849T>A	uc002udx.2	+	8	4965	c.4947T>A	c.(4945-4947)GCT>GCA	p.A1649A	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.A1474A|XIRP2_uc010fpq.2_Silent_p.A1427A|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1474					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AATTTCATGCTGAAAAAGAAG	0.333													13	36	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173362747	173362747	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173362747G>A	uc002uhp.1	+	24	3236	c.3033G>A	c.(3031-3033)TCG>TCA	p.S1011S	ITGA6_uc010zdy.1_Silent_p.S892S|ITGA6_uc002uho.1_Silent_p.S1011S|ITGA6_uc010fqm.1_Silent_p.S642S	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	1050	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CTCAGTATTCGGGAGTACCTT	0.443													24	51	---	---	---	---	PASS
AGPS	8540	broad.mit.edu	37	2	178326612	178326612	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178326612G>T	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650	O00116	ADAS_HUMAN	alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			TTAAATTTTTGTTTTTCAGCT	0.378													6	30	---	---	---	---	PASS
RBM45	129831	broad.mit.edu	37	2	178977276	178977276	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178977276G>A	uc002ulv.2	+	1	95	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	1					cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			GGAGCACCATGGACGAAGCTG	0.647											OREG0015102|OREG0006960	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|Gene=DRB1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	15	13	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179453271	179453271	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179453271G>T	uc010zfg.1	-	253	55701	c.55477C>A	c.(55477-55479)CCC>ACC	p.P18493T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P12188T|TTN_uc010zfi.1_Missense_Mutation_p.P12121T|TTN_uc010zfj.1_Missense_Mutation_p.P11996T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19420							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACCTATGGGGTCTTTTGCC	0.398													60	91	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179598064	179598064	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179598064T>C	uc010zfg.1	-	51	12448	c.12224A>G	c.(12223-12225)AAA>AGA	p.K4075R	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.K736R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5002							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAATAAAATTTGAGCTGGGC	0.443													36	38	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179742707	179742707	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179742707A>T	uc002unf.1	-	2	215	c.158T>A	c.(157-159)CTT>CAT	p.L53H	CCDC141_uc002ung.2_Missense_Mutation_p.L628H	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	53							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TATTAAATTAAGGAACTCAAG	0.363													23	65	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183866885	183866885	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183866885T>C	uc002upc.2	-	5	884	c.482A>G	c.(481-483)AAC>AGC	p.N161S	NCKAP1_uc002upb.2_Missense_Mutation_p.N167S	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	161					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATGGGCATAGTTGTATAATCC	0.313													31	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186670556	186670556	+	Intron	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186670556C>G	uc002upm.2	+						uc010zfu.1_Nonsense_Mutation_p.S6*					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		AACCTAACATCAGGGTTGGCT	0.343													32	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186672215	186672215	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186672215A>T	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.Q559L					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		GAGATCTCCCAAGATAAATAT	0.333													37	117	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189861179	189861179	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189861179G>A	uc002uqj.1	+	24	1835	c.1718G>A	c.(1717-1719)GGT>GAT	p.G573D		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	573	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	GGTCCCCGAGGTCAGCCTGGT	0.418													18	18	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189872290	189872290	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189872290G>A	uc002uqj.1	+	45	3437	c.3320G>A	c.(3319-3321)GGA>GAA	p.G1107E		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	1107	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	GGCATCAAAGGACATCGAGGA	0.428													4	11	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196726627	196726627	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196726627A>T	uc002utj.3	-	42	7651	c.7550T>A	c.(7549-7551)TTG>TAG	p.L2517*		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2517	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						AATTTCTTCCAAGAATCGTGA	0.368													5	45	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196729219	196729219	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196729219C>A	uc002utj.3	-	41	7261	c.7160G>T	c.(7159-7161)TGT>TTT	p.C2387F		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2387	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ACCTTCCGCACATTTCCTTAA	0.403													3	56	---	---	---	---	PASS
ORC2L	4999	broad.mit.edu	37	2	201796149	201796149	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201796149C>A	uc002uwr.2	-	11	1087	c.830G>T	c.(829-831)AGC>ATC	p.S277I	ORC2L_uc010zhj.1_Missense_Mutation_p.S277I	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	277					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						GGAAACCTTGCTCAATAAGTT	0.333													16	40	---	---	---	---	PASS
ORC2L	4999	broad.mit.edu	37	2	201796151	201796151	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201796151C>T	uc002uwr.2	-	11	1085	c.828G>A	c.(826-828)TTG>TTA	p.L276L	ORC2L_uc010zhj.1_Silent_p.L276L	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	276					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						AAACCTTGCTCAATAAGTTAC	0.333													15	41	---	---	---	---	PASS
TRAK2	66008	broad.mit.edu	37	2	202252712	202252712	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202252712C>A	uc002uyb.3	-	13	1856	c.1410G>T	c.(1408-1410)AAG>AAT	p.K470N		NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	470	Interaction with HGS (By similarity).			Missing (in Ref. 2).		early endosome|plasma membrane	GABA receptor binding				0						GTTGGCCCATCTTCTGGGAGC	0.458													28	68	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209188864	209188864	+	Splice_Site	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209188864A>T	uc002vcz.2	+	18	2349	c.2191_splice	c.e18-2	p.E731_splice	PIKFYVE_uc010fun.1_Splice_Site_p.E412_splice|PIKFYVE_uc002vcy.1_Splice_Site_p.E675_splice	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TATCTTACTTAGGAAAGGGAA	0.303													30	34	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212566892	212566892	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212566892C>A	uc002veg.1	-	12	1388	c.1290_splice	c.e12-1	p.S430_splice	ERBB4_uc002veh.1_Splice_Site_p.S430_splice|ERBB4_uc010zji.1_Splice_Site_p.S430_splice|ERBB4_uc010zjj.1_Splice_Site_p.S430_splice|ERBB4_uc010fut.1_Splice_Site_p.S430_splice	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		GGACAGGCCACTAAGGAGGGG	0.418										TSP Lung(8;0.080)			38	24	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	214181977	214181977	+	Silent	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214181977A>C	uc002veq.2	+	5	525	c.433A>C	c.(433-435)AGA>CGA	p.R145R	SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Silent_p.R91R|SPAG16_uc010zjk.1_Silent_p.R51R|SPAG16_uc002veo.2_Silent_p.R145R|SPAG16_uc002vep.1_Intron|SPAG16_uc002ves.1_Silent_p.R114R	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	145					cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GACTGAACTTAGAACTGTTGG	0.333													5	46	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	215274863	215274863	+	Splice_Site	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215274863G>T	uc002veq.2	+	16	1813	c.1721_splice	c.e16-1	p.G574_splice	SPAG16_uc002ver.2_Splice_Site_p.G520_splice|SPAG16_uc010zjk.1_Splice_Site_p.G480_splice|VWC2L_uc002vet.2_5'Flank|VWC2L_uc010zjl.1_5'Flank	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GTCTCCCTCAGGTCGAGTTTT	0.393													30	29	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215919290	215919290	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215919290A>T	uc002vew.2	-						ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGAAGAAAATAGCTTACCTAG	0.378													47	57	---	---	---	---	PASS
OBSL1	23363	broad.mit.edu	37	2	220422617	220422617	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220422617C>G	uc010fwk.2	-	11	3775	c.3718G>C	c.(3718-3720)GCA>CCA	p.A1240P	OBSL1_uc002vmh.1_Missense_Mutation_p.A231P|OBSL1_uc010zli.1_Missense_Mutation_p.A139P|OBSL1_uc010fwl.1_Missense_Mutation_p.A715P	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	1240	Ig-like 10.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TAGAGCCCTGCATGGGCTGGG	0.677													3	14	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220501124	220501124	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220501124G>T	uc002vmp.3	+	15	2561	c.2292G>T	c.(2290-2292)GTG>GTT	p.V764V	SLC4A3_uc002vmo.3_Silent_p.V791V|SLC4A3_uc010fwm.2_Silent_p.V314V|SLC4A3_uc010fwn.1_Silent_p.V273V	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	764	Helical; (Potential).|Membrane (anion exchange).				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGCTGCTTGTGGTTGGCTTCT	0.607													12	28	---	---	---	---	PASS
PER2	8864	broad.mit.edu	37	2	239155051	239155051	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239155051A>T	uc002vyc.2	-	23	3970	c.3733T>A	c.(3733-3735)TCC>ACC	p.S1245T		NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	1245	CRY binding domain (By similarity).				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TTCAAGGGGGATCCATTTTCG	0.498													4	8	---	---	---	---	PASS
D2HGDH	728294	broad.mit.edu	37	2	242674879	242674879	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242674879G>A	uc002wce.1	+	2	413	c.240G>A	c.(238-240)ACG>ACA	p.T80T	D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Intron|D2HGDH_uc002wcg.1_RNA	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	80					2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GGGTCGTCACGGACCCGGAAG	0.697													4	9	---	---	---	---	PASS
GAL3ST2	64090	broad.mit.edu	37	2	242738525	242738525	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242738525C>A	uc002wcj.1	+	2	206	c.75C>A	c.(73-75)CTC>CTA	p.L25L		NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	25	Helical; Signal-anchor for type II membrane protein; (Potential).				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		TGACTCTGCTCCTGCTGGCCG	0.647													16	42	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	432814	432814	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:432814G>T	uc003bou.2	+	21	2986	c.2715G>T	c.(2713-2715)GAG>GAT	p.E905D	CHL1_uc003bot.2_Missense_Mutation_p.E921D|CHL1_uc003bow.1_Missense_Mutation_p.E905D|CHL1_uc011asi.1_Missense_Mutation_p.E921D	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	905	Fibronectin type-III 3.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		p.H905Y(1)		skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTGAAAGTGAGCCTTATATAT	0.383													39	8	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9490271	9490271	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9490271G>T	uc003brt.2	+	16	2738	c.2303G>T	c.(2302-2304)CGA>CTA	p.R768L	SETD5_uc003brs.1_Missense_Mutation_p.R749L|SETD5_uc003bru.2_Missense_Mutation_p.R670L|SETD5_uc003brv.2_Missense_Mutation_p.R657L|SETD5_uc010hck.2_Missense_Mutation_p.R250L|SETD5_uc003brx.2_Missense_Mutation_p.R437L	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	768										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GAGAGACGTCGAAGGCCCCTT	0.363													20	7	---	---	---	---	PASS
IL17RE	132014	broad.mit.edu	37	3	9955643	9955643	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9955643C>T	uc003btu.2	+	14	1348	c.1231C>T	c.(1231-1233)CGG>TGG	p.R411W	CIDEC_uc003bto.2_Intron|IL17RE_uc003btw.2_Missense_Mutation_p.R411W|IL17RE_uc003btx.2_Missense_Mutation_p.R295W|IL17RE_uc010hcq.2_Missense_Mutation_p.R411W|IL17RE_uc003bty.2_RNA	NM_153483	NP_705616	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E isoform 1	411	Extracellular (Potential).					cytoplasm|extracellular region|integral to membrane	receptor activity			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		TCTACAGGCCCGGGGCTCAAG	0.453													85	20	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14862055	14862055	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14862055G>T	uc003bzc.2	+	1	1587	c.1477G>T	c.(1477-1479)GTC>TTC	p.V493F	FGD5_uc011avk.1_Missense_Mutation_p.V493F	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	493					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						GGCCGGCTATGTCCCAGAAAC	0.612													31	10	---	---	---	---	PASS
UBE2E2	7325	broad.mit.edu	37	3	23541127	23541127	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23541127G>T	uc003ccg.2	+	4	436	c.256G>T	c.(256-258)GAA>TAA	p.E86*	UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2	86					ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0						CAACATTTATGAATGGAGGTC	0.383													11	13	---	---	---	---	PASS
OSBPL10	114884	broad.mit.edu	37	3	31871714	31871714	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31871714T>C	uc003cev.2	-	5	928	c.547A>G	c.(547-549)AGC>GGC	p.S183G	OSBPL10_uc003ceu.1_5'UTR|OSBPL10_uc011axf.1_Intron	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	183					lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		CTTCGGGAGCTTGGAGCACTC	0.502													4	9	---	---	---	---	PASS
GOLGA4	2803	broad.mit.edu	37	3	37340341	37340341	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37340341G>T	uc003cgv.2	+	8	1136	c.832G>T	c.(832-834)GTA>TTA	p.V278L	GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Missense_Mutation_p.V300L|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.V159L	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	278	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						TGGAACTTCTGTAAAAACACT	0.313													29	12	---	---	---	---	PASS
ZNF197	10168	broad.mit.edu	37	3	44685539	44685539	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44685539C>G	uc003cnm.2	+	6	3123	c.2917C>G	c.(2917-2919)CTT>GTT	p.L973V	ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	973	C2H2-type 22.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AAGAAAAAACCTTACTGTACA	0.373													15	24	---	---	---	---	PASS
CLEC3B	7123	broad.mit.edu	37	3	45077309	45077309	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45077309G>C	uc003cok.3	+	3	598	c.502G>C	c.(502-504)GGC>CGC	p.G168R	CLEC3B_uc003col.2_Missense_Mutation_p.G126R	NM_003278	NP_003269	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	168	C-type lectin.				skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACCCGATGGCGGCAAGACCGA	0.652													9	26	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48677666	48677666	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48677666C>A	uc003cul.2	-	34	9633	c.9352G>T	c.(9352-9354)GGC>TGC	p.G3118C	CELSR3_uc003cuf.1_Missense_Mutation_p.G3216C|CELSR3_uc010hkf.2_Missense_Mutation_p.G408C|CELSR3_uc010hkg.2_Missense_Mutation_p.G1101C	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3118	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGGGTGCTGCCCCGATCTTTG	0.672													23	11	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48677681	48677681	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48677681C>A	uc003cul.2	-	34	9618	c.9337G>T	c.(9337-9339)GAG>TAG	p.E3113*	CELSR3_uc003cuf.1_Nonsense_Mutation_p.E3211*|CELSR3_uc010hkf.2_Nonsense_Mutation_p.E403*|CELSR3_uc010hkg.2_Nonsense_Mutation_p.E1096*	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3113	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCTTTGGGCTCCAGTCGGCCT	0.672													31	9	---	---	---	---	PASS
FEZF2	55079	broad.mit.edu	37	3	62358019	62358019	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62358019C>A	uc003dlh.2	-	1	732	c.525G>T	c.(523-525)CTG>CTT	p.L175L	FEZF2_uc003dli.2_Silent_p.L175L	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	175					transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		CGGTCGAGTCCAGGTAGTTGA	0.701													7	4	---	---	---	---	PASS
UBA3	9039	broad.mit.edu	37	3	69112255	69112255	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69112255C>A	uc003dno.2	-	9	591	c.571G>T	c.(571-573)GAT>TAT	p.D191Y	UBA3_uc003dnq.2_Missense_Mutation_p.D177Y|UBA3_uc011bfy.1_Missense_Mutation_p.D14Y|UBA3_uc011bfz.1_Missense_Mutation_p.D14Y	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1	191					protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		GAGCTTGGATCTAAGACACCA	0.403													34	12	---	---	---	---	PASS
MIR1324	100302212	broad.mit.edu	37	3	75679932	75679932	+	RNA	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75679932G>T	hsa-mir-1324|MI0006657	+			c.19G>T																				0						GGTGCATGAAGCCTGGTCCTG	0.557													3	12	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78666832	78666832	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78666832T>A	uc003dqe.2	-	27	4443	c.4235A>T	c.(4234-4236)GAG>GTG	p.E1412V	ROBO1_uc003dqb.2_Missense_Mutation_p.E1373V|ROBO1_uc003dqc.2_Missense_Mutation_p.E1312V|ROBO1_uc003dqd.2_Missense_Mutation_p.E1367V|ROBO1_uc010hoh.2_Missense_Mutation_p.E604V|ROBO1_uc011bgl.1_Missense_Mutation_p.E984V	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1412	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ACCAGCATACTCTGCCGCTGC	0.507													26	13	---	---	---	---	PASS
POU1F1	5449	broad.mit.edu	37	3	87325618	87325618	+	5'UTR	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87325618C>A	uc003dqq.1	-	1					POU1F1_uc010hoj.1_5'UTR	NM_000306	NP_000297	P28069	PIT1_HUMAN	pituitary specific transcription factor 1						negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)|skin(1)	2	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		CTCATTCCCACAAGAGAGTAG	0.428													12	3	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89259571	89259571	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89259571C>A	uc003dqy.2	+	3	940	c.715C>A	c.(715-717)CCT>ACT	p.P239T	EPHA3_uc003dqx.1_Missense_Mutation_p.P239T|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	239	Extracellular (Potential).|Cys-rich.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGAGGAAGATCCTCCAAGGAT	0.488										TSP Lung(6;0.00050)			80	32	---	---	---	---	PASS
OR5H2	79310	broad.mit.edu	37	3	98001811	98001811	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98001811A>T	uc003dsj.1	+	1	80	c.80A>T	c.(79-81)GAG>GTG	p.E27V		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	27	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						TATCAGCCAGAGTGGAAAATG	0.423													94	103	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188985	98188985	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188985T>A	uc003dsm.2	+	1	565	c.565T>A	c.(565-567)TGT>AGT	p.C189S		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TAGACTCTCTTGTGTTGATCC	0.348													51	123	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	101038473	101038473	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101038473C>A	uc003duq.1	-	2	492	c.289G>T	c.(289-291)GTT>TTT	p.V97F	IMPG2_uc011bhe.1_5'UTR	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	97	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GCCTCTGCAACACTTTCATCT	0.413													48	105	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105389121	105389121	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105389121G>C	uc003dwc.2	-	18	2967	c.2645C>G	c.(2644-2646)ACT>AGT	p.T882S	CBLB_uc003dwa.2_Missense_Mutation_p.T97S|CBLB_uc011bhi.1_Missense_Mutation_p.T860S	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	882	Pro-rich.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						TGTTCTGTTAGTTTTGACATT	0.368			Mis S		AML								26	45	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111603485	111603485	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111603485T>C	uc010hqa.2	+	2	972	c.561T>C	c.(559-561)GAT>GAC	p.D187D	PHLDB2_uc003dyc.2_Silent_p.D214D|PHLDB2_uc003dyd.2_Silent_p.D187D|PHLDB2_uc003dyg.2_Silent_p.D187D|PHLDB2_uc003dyh.2_Silent_p.D187D|PHLDB2_uc003dye.3_Silent_p.D187D|PHLDB2_uc003dyf.3_Silent_p.D187D	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	187						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						CCCTGAGTGATGCTGGCCCGC	0.562													27	27	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112328845	112328845	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112328845C>T	uc003dzf.2	-	6	2623	c.2405G>A	c.(2404-2406)AGT>AAT	p.S802N	CCDC80_uc011bhv.1_Missense_Mutation_p.S802N|CCDC80_uc003dzg.2_Missense_Mutation_p.S802N|CCDC80_uc003dzh.1_Missense_Mutation_p.S802N	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	802										ovary(2)	2						CGCCTGACCACTGAGGGCAGA	0.498													19	30	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114069245	114069245	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114069245C>A	uc003ebi.2	-	4	1860	c.1680G>T	c.(1678-1680)CTG>CTT	p.L560L	ZBTB20_uc003ebj.2_Silent_p.L487L|ZBTB20_uc010hqp.2_Silent_p.L487L|ZBTB20_uc003ebk.2_Silent_p.L487L|ZBTB20_uc003ebl.2_Silent_p.L487L|ZBTB20_uc003ebm.2_Silent_p.L487L|ZBTB20_uc003ebn.2_Silent_p.L487L|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CGGATGAGGCCAGGGGCTGTG	0.602													40	72	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119209540	119209540	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119209540G>T	uc003ecm.2	+	9	1024	c.940G>T	c.(940-942)GTC>TTC	p.V314F	KTELC1_uc011biz.1_RNA|KTELC1_uc011bja.1_Missense_Mutation_p.V155F	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	314						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		CTATATCCCAGTCAAAACAGA	0.423													48	103	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120417269	120417269	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120417269C>A	uc003edx.2	-	5	564	c.534_splice	c.e5+1	p.L178_splice		NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AAAATACATACCAAATTAATT	0.338													77	137	---	---	---	---	PASS
KLF15	28999	broad.mit.edu	37	3	126062660	126062660	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126062660C>T	uc011bkk.1	-	3	1343	c.1161G>A	c.(1159-1161)GAG>GAA	p.E387E		NM_014079	NP_054798	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	387	C2H2-type 3.					nucleus	DNA binding|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(114;0.147)		CGAACTTCTTCTCGCACACAG	0.657													10	17	---	---	---	---	PASS
KLF15	28999	broad.mit.edu	37	3	126070882	126070882	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126070882G>A	uc011bkk.1	-	2	1066	c.884C>T	c.(883-885)CCC>CTC	p.P295L		NM_014079	NP_054798	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	295						nucleus	DNA binding|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(114;0.147)		AGGCCCCAGGGGTCCCGATCC	0.607													2	4	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126229583	126229583	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126229583C>A	uc003eiz.1	-	2	213	c.181G>T	c.(181-183)GCC>TCC	p.A61S	UROC1_uc010hsi.1_Missense_Mutation_p.A61S	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	61					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		AACTCTGGGGCCAGCAGCTCC	0.617													14	21	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126229584	126229584	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126229584C>A	uc003eiz.1	-	2	212	c.180G>T	c.(178-180)CTG>CTT	p.L60L	UROC1_uc010hsi.1_Silent_p.L60L	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	60					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		ACTCTGGGGCCAGCAGCTCCT	0.622													13	21	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128204697	128204697	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128204697G>A	uc003ekm.3	-	4	1179	c.744C>T	c.(742-744)ACC>ACT	p.T248T	GATA2_uc003ekn.3_Silent_p.T248T|GATA2_uc003eko.2_Silent_p.T248T	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	248					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		AGGAGGGGTAGGTGGGGATGG	0.647			Mis		AML(CML blast transformation)								18	23	---	---	---	---	PASS
RAB7A	7879	broad.mit.edu	37	3	128526389	128526389	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128526389G>T	uc003eks.1	+	5	635	c.403G>T	c.(403-405)GCC>TCC	p.A135S	RAB7A_uc010hsv.1_Missense_Mutation_p.A88S|RAB7A_uc003ekt.2_Missense_Mutation_p.A111S	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family	135					endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		CTTTCAGGTGGCCACAAAGCG	0.562													33	47	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130174315	130174315	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130174315C>A	uc010htj.1	+	37	7089	c.6595C>A	c.(6595-6597)CAA>AAA	p.Q2199K	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.Q238K	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2199	Nonhelical region.				axon guidance|cell adhesion	collagen					0						TACTGAGCTACAAGAGGATTT	0.333													10	19	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130292820	130292820	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130292820G>T	uc010htl.2	+	7	3029	c.2998G>T	c.(2998-3000)GAT>TAT	p.D1000Y		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1000	Nonhelical region.|VWFA 6.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TGACAAAGTAGATCTTGTTTT	0.353													14	19	---	---	---	---	PASS
CPNE4	131034	broad.mit.edu	37	3	131624298	131624298	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131624298G>T	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCTGTTTTAGGCAAGTAAAAG	0.418													3	7	---	---	---	---	PASS
CCRL1	51554	broad.mit.edu	37	3	132319692	132319692	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132319692G>T	uc003eow.2	+	2	534	c.451G>T	c.(451-453)GGA>TGA	p.G151*	ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Nonsense_Mutation_p.G151*	NM_016557	NP_057641	Q9NPB9	CCRL1_HUMAN	chemokine (C-C motif) receptor-like 1	151	Cytoplasmic (Potential).				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity				0						ATCAGGAGTGGGAAAACCATG	0.448													25	46	---	---	---	---	PASS
CCRL1	51554	broad.mit.edu	37	3	132319693	132319693	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132319693G>T	uc003eow.2	+	2	535	c.452G>T	c.(451-453)GGA>GTA	p.G151V	ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Missense_Mutation_p.G151V	NM_016557	NP_057641	Q9NPB9	CCRL1_HUMAN	chemokine (C-C motif) receptor-like 1	151	Cytoplasmic (Potential).				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity				0						TCAGGAGTGGGAAAACCATGC	0.448													24	46	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133371465	133371465	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133371465G>A	uc003eps.2	-	8	1063	c.931C>T	c.(931-933)CTT>TTT	p.L311F		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	311					DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						ACATCTGAAAGAGTACGACCT	0.308								Other_conserved_DNA_damage_response_genes					21	39	---	---	---	---	PASS
SOX14	8403	broad.mit.edu	37	3	137484093	137484093	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137484093C>G	uc003erm.1	+	1	515	c.467C>G	c.(466-468)CCC>CGC	p.P156R		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	156					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						GGCGAAGTGCCCCACACCTTG	0.692													7	5	---	---	---	---	PASS
CEP70	80321	broad.mit.edu	37	3	138289268	138289268	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138289268C>A	uc003esl.2	-	6	555	c.357G>T	c.(355-357)ATG>ATT	p.M119I	CEP70_uc011bmk.1_Missense_Mutation_p.M99I|CEP70_uc011bml.1_Missense_Mutation_p.M101I|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Missense_Mutation_p.M119I|CEP70_uc003esn.2_Missense_Mutation_p.M119I	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa	119	Potential.				G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						TCACACTTTCCATAATTTGTT	0.368													38	61	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138400810	138400810	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138400810G>A	uc011bmq.1	-	17	2503	c.2503C>T	c.(2503-2505)CGG>TGG	p.R835W	PIK3CB_uc011bmn.1_Missense_Mutation_p.R347W|PIK3CB_uc011bmo.1_Missense_Mutation_p.R286W|PIK3CB_uc011bmp.1_Missense_Mutation_p.R422W	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	835	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AGATCTCACCGAAGATCCAAA	0.348													8	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700484	149700484	+	IGR	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700484G>A								PFN2 (11743 upstream) : TSC22D2 (426304 downstream)																							ACAGAGATCGGATCACACAAG	0.512													63	96	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153905539	153905539	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153905539T>C	uc011bog.1	+	7	1764	c.1553T>C	c.(1552-1554)GTG>GCG	p.V518A	SGEF_uc011boh.1_Missense_Mutation_p.V518A	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	518	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGTGACATTGTGGAAAAACAC	0.343													9	18	---	---	---	---	PASS
IQCJ	654502	broad.mit.edu	37	3	158983161	158983161	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158983161T>C	uc003fcp.1	+	5	554	c.449T>C	c.(448-450)ATA>ACA	p.I150T	SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Missense_Mutation_p.I123T	NM_001042705	NP_001036170	Q1A5X6	IQCJ_HUMAN	IQ motif containing J isoform CaMBPv1	150											0			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GAGCCCCAGATAGAAAGACTT	0.498													29	37	---	---	---	---	PASS
PPM1L	151742	broad.mit.edu	37	3	160474419	160474419	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160474419G>C	uc003fdr.2	+	1	424	c.323G>C	c.(322-324)CGC>CCC	p.R108P		NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like	108	Cytoplasmic (Potential).|PP2C-like.				protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ATGGAGGACCGCTTCGAAGTT	0.597													12	25	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172165633	172165633	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165633C>A	uc003fib.1	-	1	571	c.571G>T	c.(571-573)GAC>TAC	p.D191Y	GHSR_uc011bpv.1_Missense_Mutation_p.D191Y	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	191	Extracellular (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TCCCAAGGGTCGGTGCCGTTC	0.642													21	22	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173525585	173525585	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173525585G>T	uc003fio.1	+	4	1032	c.609G>T	c.(607-609)GTG>GTT	p.V203V	NLGN1_uc010hww.1_Silent_p.V243V|NLGN1_uc003fip.1_Silent_p.V203V	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	220	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ATGGCAATGTGATCGTCATCA	0.398													42	54	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173998396	173998396	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173998396C>T	uc003fio.1	+	7	2198	c.1775C>T	c.(1774-1776)CCA>CTA	p.P592L	NLGN1_uc003fip.1_Missense_Mutation_p.P592L	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	609	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GGATTAAAACCAAGAGTTAAA	0.388													30	49	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178916930	178916930	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178916930G>T	uc003fjk.2	+	2	474	c.317G>T	c.(316-318)GGC>GTC	p.G106V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	106	PI3K-ABD.		G -> V (in cancer; shows an increase in lipid kinase activity).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.G106V(4)|p.G106_R108del(2)|p.G106R(1)|p.P104_G106>R(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAACCAGTAGGCAACCGTGAA	0.348		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			29	86	---	---	---	---	PASS
ZNF639	51193	broad.mit.edu	37	3	179050862	179050862	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179050862G>C	uc003fjq.1	+	5	598	c.255G>C	c.(253-255)CTG>CTC	p.L85L	ZNF639_uc003fjr.1_Silent_p.L85L	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639	85					initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			agaactacctggttcccagtc	0.085													6	15	---	---	---	---	PASS
ATP11B	23200	broad.mit.edu	37	3	182602633	182602633	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182602633G>T	uc003flb.2	+	22	2859	c.2602G>T	c.(2602-2604)GGT>TGT	p.G868C	ATP11B_uc003flc.2_Missense_Mutation_p.G452C|ATP11B_uc011bqm.1_Missense_Mutation_p.G172C|ATP11B_uc010hxf.1_Missense_Mutation_p.G30C	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	868	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TTTTGTTCATGGTCATTTTTA	0.303													38	67	---	---	---	---	PASS
HTR3E	285242	broad.mit.edu	37	3	183824114	183824114	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183824114C>A	uc010hxq.2	+	8	1590	c.1124C>A	c.(1123-1125)ACC>AAC	p.T375N	HTR3E_uc003fml.3_Missense_Mutation_p.T360N|HTR3E_uc003fmm.2_Missense_Mutation_p.T390N|HTR3E_uc010hxr.2_Missense_Mutation_p.T401N|HTR3E_uc003fmn.2_Missense_Mutation_p.T375N	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	375	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CCGGGTCTCACCCCCACCCAC	0.468													11	5	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184003353	184003353	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184003353G>T	uc003fni.3	+	10	1628	c.1590G>T	c.(1588-1590)CTG>CTT	p.L530L	ECE2_uc011brh.1_Silent_p.L383L|ECE2_uc003fnl.3_Silent_p.L458L|ECE2_uc003fnm.3_Silent_p.L412L|ECE2_uc003fnk.3_Silent_p.L383L|ECE2_uc011bri.1_Silent_p.L445L|ECE2_uc010hxv.2_Silent_p.L174L	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	530	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAGAGAAGCTGCTGGAGACCC	0.507													42	38	---	---	---	---	PASS
TMEM41A	90407	broad.mit.edu	37	3	185209360	185209360	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185209360T>A	uc003fpj.2	-	5	856	c.760A>T	c.(760-762)ACT>TCT	p.T254S	TMEM41A_uc003fpk.2_3'UTR	NM_080652	NP_542383	Q96HV5	TM41A_HUMAN	transmembrane protein 41A precursor	254						integral to membrane					0	all_cancers(143;7.78e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TGATTAGCAGTACTTGTTTCA	0.393													24	75	---	---	---	---	PASS
IGF2BP2	10644	broad.mit.edu	37	3	185414409	185414409	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185414409C>T	uc003fpo.2	-	4	410	c.331G>A	c.(331-333)GTG>ATG	p.V111M	IGF2BP2_uc010hyi.2_Missense_Mutation_p.V48M|IGF2BP2_uc010hyj.2_Missense_Mutation_p.V48M|IGF2BP2_uc010hyk.2_Translation_Start_Site|IGF2BP2_uc010hyl.2_Missense_Mutation_p.V48M|IGF2BP2_uc003fpp.2_Missense_Mutation_p.V111M|IGF2BP2_uc003fpq.2_Missense_Mutation_p.V110M	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding	111	RRM 2.				anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CCTTGTTCCACATTCTCCACT	0.383													59	36	---	---	---	---	PASS
PYDC2	152138	broad.mit.edu	37	3	191179134	191179134	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191179134C>G	uc011bso.1	+	1	183	c.183C>G	c.(181-183)AGC>AGG	p.S61R		NM_001083308	NP_001076777	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	61	DAPIN.					cytoplasm|nucleus					0						TCTTCACCAGCCACTCCTGCA	0.517													35	60	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196386836	196386836	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196386836C>T	uc003fwv.2	+	3	426	c.322C>T	c.(322-324)CGC>TGC	p.R108C		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	108	Extracellular (Potential).|LRR 3.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGGTCACCTGCGCAGCCTGGT	0.672													8	57	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197556525	197556525	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197556525C>G	uc011bul.1	+	6	873	c.868C>G	c.(868-870)CCG>GCG	p.P290A	LRCH3_uc003fyj.1_Missense_Mutation_p.P290A|LRCH3_uc011bum.1_Missense_Mutation_p.P290A|LRCH3_uc011bun.1_Missense_Mutation_p.P164A|LRCH3_uc003fyk.2_5'UTR	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	290	LRR 9.					extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TGATAGGAGACCGTTGGGTTT	0.338													54	36	---	---	---	---	PASS
ADRA2C	152	broad.mit.edu	37	4	3768709	3768709	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3768709G>C	uc003ghm.2	+	1	414	c.376G>C	c.(376-378)GTG>CTG	p.V126L	ADRA2C_uc010icx.2_Missense_Mutation_p.V126L	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	126	Helical; Name=3; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	GTGGTGCGGCGTGTACCTGGC	0.632													12	7	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4228266	4228266	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4228266C>A	uc003ghp.1	-	1	356	c.326G>T	c.(325-327)TGG>TTG	p.W109L		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	109	Helical; (Potential).				biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCCCACGTACCACAGCATCCA	0.726													5	5	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6058414	6058414	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6058414G>T	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						CCTGAGGTGGGGTCACGCACC	0.562													38	13	---	---	---	---	PASS
CD38	952	broad.mit.edu	37	4	15818263	15818263	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15818263G>T	uc011bxc.1	+	2	470	c.363G>T	c.(361-363)AAG>AAT	p.K121N	CD38_uc003goj.1_Missense_Mutation_p.K121N|CD38_uc003gol.1_Missense_Mutation_p.K121N	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen	121	Extracellular (Potential).				B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						CTTGCAACAAGGTAATTGGGG	0.373													27	15	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30724272	30724272	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30724272G>C	uc003gsk.1	+	1	2236	c.1228G>C	c.(1228-1230)GAC>CAC	p.D410H	PCDH7_uc011bxw.1_Missense_Mutation_p.D363H|PCDH7_uc011bxx.1_Missense_Mutation_p.D410H	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	410	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						AGACGAGAACGACAACGTGCC	0.637													12	8	---	---	---	---	PASS
FAM114A1	92689	broad.mit.edu	37	4	38879895	38879895	+	Missense_Mutation	SNP	A	G	G	rs139197115	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38879895A>G	uc003gtn.2	+	3	372	c.196A>G	c.(196-198)ATT>GTT	p.I66V	FAM114A1_uc011byh.1_Intron|FAM114A1_uc011byg.1_Missense_Mutation_p.I66V	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689	66						cytoplasm				ovary(1)	1						GGCTGCCGCCATTGGGCCCCC	0.582													16	9	---	---	---	---	PASS
CHRNA9	55584	broad.mit.edu	37	4	40356465	40356465	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40356465C>G	uc003gva.1	+	5	1384	c.1368C>G	c.(1366-1368)GAC>GAG	p.D456E		NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9	456	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	AAGTCATAGACCGATTCTTCA	0.433													13	51	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42554597	42554597	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42554597T>G	uc003gwr.2	-	17	1676	c.1444A>C	c.(1444-1446)ACA>CCA	p.T482P	ATP8A1_uc003gws.2_Missense_Mutation_p.T467P|ATP8A1_uc011byz.1_Missense_Mutation_p.T467P	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	482	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	GCCATCATTGTAAGAAATTCA	0.368													22	11	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42588390	42588390	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42588390C>A	uc003gwr.2	-	9	930	c.698G>T	c.(697-699)GGA>GTA	p.G233V	ATP8A1_uc003gws.2_Missense_Mutation_p.G233V|ATP8A1_uc011byz.1_Missense_Mutation_p.G233V	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	233	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	CCTTATGTTTCCAACAAAATC	0.383													27	17	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52860817	52860817	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52860817C>A	uc003gzi.2	-	4	2384	c.2371G>T	c.(2371-2373)GAA>TAA	p.E791*		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	791						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						GAGGCATTTTCCAGATGAGTC	0.478													18	6	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52860818	52860818	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52860818C>A	uc003gzi.2	-	4	2383	c.2370G>T	c.(2368-2370)CTG>CTT	p.L790L		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	790						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						AGGCATTTTCCAGATGAGTCT	0.478													19	6	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62599252	62599252	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62599252G>T	uc010ihh.2	+	5	1348	c.1175G>T	c.(1174-1176)GGA>GTA	p.G392V	LPHN3_uc003hcq.3_Missense_Mutation_p.G392V|LPHN3_uc010ihg.1_Missense_Mutation_p.G460V|LPHN3_uc003hcs.1_Missense_Mutation_p.G221V	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	392	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TTGGATTTTGGACCTCTGGAT	0.358													10	1	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69093705	69093705	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69093705C>A	uc003hdw.3	-	10	1311	c.1175G>T	c.(1174-1176)GGT>GTT	p.G392V		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	392	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						ATTCTTTTTACCACATCCATC	0.393													32	11	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69101752	69101752	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69101752C>T	uc003hdw.3	-	4	412	c.276G>A	c.(274-276)AAG>AAA	p.K92K		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	92	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TGACATATTCCTTATATATAC	0.249													23	10	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70505310	70505310	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70505310G>T	uc003hem.3	-						UGT2A1_uc011caq.1_Intron|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron|UGT2A1_uc010ihs.2_Missense_Mutation_p.L9M	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,						detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						TTAAAAACCAGCATCTGGACA	0.338													26	8	---	---	---	---	PASS
SULT1B1	27284	broad.mit.edu	37	4	70620797	70620797	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70620797G>T	uc003hen.2	-	2	437	c.139C>A	c.(139-141)CCT>ACT	p.P47T		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	47					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						CCTGATTTAGGATAAGTGGCT	0.398													79	24	---	---	---	---	PASS
AFM	173	broad.mit.edu	37	4	74350016	74350016	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74350016T>A	uc003hhb.2	+	3	210	c.179T>A	c.(178-180)TTT>TAT	p.F60Y		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	60	Albumin 1.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAAGCAACCTTTGAAGAAATG	0.403													28	15	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79340224	79340224	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79340224T>C	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc010ijj.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAAGGTAAGATGTGCAGTAAA	0.358													14	27	---	---	---	---	PASS
GK2	2712	broad.mit.edu	37	4	80329252	80329252	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80329252G>T	uc003hlu.2	-	1	121	c.103C>A	c.(103-105)CTA>ATA	p.L35I		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	35					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4						TGACTAAGTAGTTCCGCTGTT	0.488													44	18	---	---	---	---	PASS
DSPP	1834	broad.mit.edu	37	4	88532089	88532089	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88532089G>A	uc003hqu.2	+	2	149	c.29G>A	c.(28-30)TGG>TAG	p.W10*		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	10					biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		TTTTGCATTTGGGCAGTAGCA	0.279													31	12	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94343994	94343994	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94343994G>T	uc011cdt.1	+	10	1678	c.1420G>T	c.(1420-1422)GTT>TTT	p.V474F	GRID2_uc011cdu.1_Missense_Mutation_p.V379F	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	474	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	CTCCATTGATGTTTTGGATGC	0.413													29	13	---	---	---	---	PASS
METAP1	23173	broad.mit.edu	37	4	99982392	99982392	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99982392T>G	uc003huf.3	+	11	1202	c.1085T>G	c.(1084-1086)CTG>CGG	p.L362R	METAP1_uc003hug.2_RNA|METAP1_uc010ild.2_RNA	NM_015143	NP_055958	P53582	AMPM1_HUMAN	methionyl aminopeptidase 1	362					N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis|regulation of translation	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		CACACCCTCCTGGTCACAGAC	0.517													53	18	---	---	---	---	PASS
SEC24B	10427	broad.mit.edu	37	4	110384608	110384608	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110384608G>A	uc003hzk.2	+	2	740	c.685G>A	c.(685-687)GGT>AGT	p.G229S	SEC24B_uc003hzl.2_Missense_Mutation_p.G229S|SEC24B_uc011cfp.1_Missense_Mutation_p.G260S|SEC24B_uc011cfq.1_Missense_Mutation_p.G229S|SEC24B_uc011cfr.1_Missense_Mutation_p.G229S	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	229					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCATTCTCTGGTCAAAATAC	0.453													38	24	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115544082	115544082	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115544082G>A	uc003ibs.2	+	2	568	c.46G>A	c.(46-48)GGG>AGG	p.G16R	UGT8_uc003ibt.2_Missense_Mutation_p.G16R|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	16					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		GAGTGCTGTTGGGATAGCGAA	0.418													26	5	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115544083	115544083	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115544083G>T	uc003ibs.2	+	2	569	c.47G>T	c.(46-48)GGG>GTG	p.G16V	UGT8_uc003ibt.2_Missense_Mutation_p.G16V|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	16					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		AGTGCTGTTGGGATAGCGAAG	0.423													26	5	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121961197	121961197	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121961197C>G	uc003idq.1	-	3	728	c.201G>C	c.(199-201)GTG>GTC	p.V67V		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	67											0						CTTCTTCAACCACAAAGAAAT	0.443													26	15	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123234779	123234779	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123234779A>T	uc003ieh.2	+						KIAA1109_uc003iel.1_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						TGATTTTTGTACAGGTGTAGT	0.323													23	20	---	---	---	---	PASS
POU4F2	5458	broad.mit.edu	37	4	147561088	147561088	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147561088G>A	uc003ikv.2	+	2	606	c.358G>A	c.(358-360)GTC>ATC	p.V120I		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	120					estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					CGTGGACATCGTCTCCCAGAG	0.592													3	30	---	---	---	---	PASS
TRIM2	23321	broad.mit.edu	37	4	154217020	154217020	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154217020G>A	uc003ing.2	+	6	1462	c.1261G>A	c.(1261-1263)GTG>ATG	p.V421M	TRIM2_uc003inh.2_Missense_Mutation_p.V448M	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2	421	Filamin.					cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TAAGCTGAAAGTGATCCGATC	0.542													25	9	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507571	155507571	+	Missense_Mutation	SNP	C	A	A	rs145956993		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507571C>A	uc003iod.1	-	5	1068	c.1010G>T	c.(1009-1011)GGG>GTG	p.G337V	FGA_uc003ioe.1_Missense_Mutation_p.G337V|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	337	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCCAGAGCTCCCAGAGTTCCA	0.567													75	19	---	---	---	---	PASS
NPY5R	4889	broad.mit.edu	37	4	164271880	164271880	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164271880C>T	uc003iqn.2	+	4	637	c.455C>T	c.(454-456)ACA>ATA	p.T152I		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	152	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				AATAATTTAACAGCAAACCAT	0.358													75	44	---	---	---	---	PASS
ACSL1	2180	broad.mit.edu	37	4	185694258	185694258	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185694258A>G	uc003iww.2	-	10	1186	c.892T>C	c.(892-894)TCA>CCA	p.S298P	ACSL1_uc011ckm.1_Missense_Mutation_p.S127P|ACSL1_uc003iwt.1_Missense_Mutation_p.S298P|ACSL1_uc003iwu.1_Missense_Mutation_p.S298P|ACSL1_uc011ckn.1_Missense_Mutation_p.S264P|ACSL1_uc003iwv.1_Missense_Mutation_p.S298P|ACSL1_uc010ise.1_RNA	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	298	Cytoplasmic (Potential).				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACAAAAGCTGAACAATCGCTC	0.423													6	4	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189065190	189065190	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189065190G>T	uc003izm.1	+	5	874	c.759G>T	c.(757-759)AGG>AGT	p.R253S	TRIML1_uc003izn.1_5'UTR	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	253					multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TCTCTTGCAGGAGCGAGCCAC	0.572													7	4	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1201977	1201977	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1201977C>T	uc003jbw.3	+							NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGTAGGCTGGCCGGGCGGGGC	0.697													14	7	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5237172	5237172	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5237172C>A	uc003jdl.2	+	14	2252	c.2114C>A	c.(2113-2115)TCG>TAG	p.S705*	ADAMTS16_uc003jdk.1_Nonsense_Mutation_p.S705*|ADAMTS16_uc010itk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	705	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ACTCCATGCTCGGAGGATAGC	0.289													29	69	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6600126	6600126	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6600126T>A	uc003jdu.2	-	19	2282	c.2217A>T	c.(2215-2217)GGA>GGT	p.G739G	NSUN2_uc003jds.2_Silent_p.G185G|NSUN2_uc003jdt.2_Silent_p.G503G|NSUN2_uc011cmk.1_Silent_p.G704G|NSUN2_uc003jdv.2_Silent_p.G503G	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	739						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TGTTGGGCTCTCCTGCTCTCT	0.592													43	36	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10402206	10402206	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10402206C>T	uc003jet.1	+	12	1191	c.1008C>T	c.(1006-1008)ACC>ACT	p.T336T	MARCH6_uc011cmu.1_Silent_p.T288T|MARCH6_uc003jeu.1_Silent_p.T34T|MARCH6_uc011cmv.1_Silent_p.T231T	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	336	Extracellular (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TAATCACAACCATAGTTGGGT	0.323													23	31	---	---	---	---	PASS
FBXL7	23194	broad.mit.edu	37	5	15936631	15936631	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15936631A>G	uc003jfn.1	+	4	1293	c.812A>G	c.(811-813)CAG>CGG	p.Q271R		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	271	LRR 4.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						CATGGCAAACAGATTTCCATC	0.572													8	23	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473458	19473458	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473458G>A	uc003jgc.2	-	12	2627	c.2250C>T	c.(2248-2250)ATC>ATT	p.I750I	CDH18_uc003jgd.2_Silent_p.I750I|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	750	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCAGCGAGCTGATAGACCCAG	0.483													28	31	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975299	21975299	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975299C>A	uc010iuc.2	-	3	885	c.427G>T	c.(427-429)GAA>TAA	p.E143*	CDH12_uc011cno.1_Nonsense_Mutation_p.E143*|CDH12_uc003jgk.2_Nonsense_Mutation_p.E143*	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	143	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AATTCTGATTCAGGCTCCAGG	0.433										HNSCC(59;0.17)			18	60	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975442	21975442	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975442C>A	uc010iuc.2	-	3	742	c.284G>T	c.(283-285)GGA>GTA	p.G95V	CDH12_uc011cno.1_Missense_Mutation_p.G95V|CDH12_uc003jgk.2_Missense_Mutation_p.G95V	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	95	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AGCGCCATCTCCTGAGAGGGT	0.383										HNSCC(59;0.17)			27	88	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23522409	23522409	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522409C>T	uc003jgo.2	+							NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CTTCTCCAACCTAGAACTCAG	0.423										HNSCC(3;0.000094)			66	59	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26916021	26916021	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26916021G>A	uc003jgs.1	-	3	409	c.240C>T	c.(238-240)GAC>GAT	p.D80D	CDH9_uc010iug.2_Silent_p.D80D	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	80	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CTTTATCTTGGTCAGTGTGAA	0.338													36	37	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33588736	33588736	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33588736G>T	uc003jia.1	-	18	2996	c.2833C>A	c.(2833-2835)CCC>ACC	p.P945T	ADAMTS12_uc010iuq.1_Missense_Mutation_p.P860T	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	945	TSP type-1 4.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CAGTCCGAGGGGCACAGGATG	0.597										HNSCC(64;0.19)			30	121	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33637841	33637841	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33637841C>A	uc003jia.1	-	12	1892	c.1729G>T	c.(1729-1731)GGA>TGA	p.G577*	ADAMTS12_uc010iuq.1_Nonsense_Mutation_p.G577*	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	577	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TATTTCCCTCCAAACTTTGGC	0.463										HNSCC(64;0.19)			21	21	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37006572	37006572	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37006572G>T	uc003jkl.3	+	17	4468	c.3969G>T	c.(3967-3969)ATG>ATT	p.M1323I	NIPBL_uc003jkk.3_Missense_Mutation_p.M1323I	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1323					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CCCCTAACATGCCAAAAGCTG	0.353													24	29	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39203058	39203058	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39203058G>A	uc003jls.2	-	1	72	c.5C>T	c.(4-6)GCG>GTG	p.A2V	FYB_uc003jlt.2_Missense_Mutation_p.A2V|FYB_uc003jlu.2_Missense_Mutation_p.A2V|FYB_uc011cpl.1_Missense_Mutation_p.A12V	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	2					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			GTTATATTTCGCCATGAGGGA	0.438													16	59	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41000935	41000935	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41000935C>A	uc003jmj.3	-	38	4685	c.4195G>T	c.(4195-4197)GAG>TAG	p.E1399*	HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.E954*	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1399	HEAT 15.						binding			ovary(6)|central_nervous_system(2)	8						TCATCCTGCTCCTGTGGTGAC	0.473													3	6	---	---	---	---	PASS
ANKRD55	79722	broad.mit.edu	37	5	55396067	55396067	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55396067G>A	uc003jqu.2	-	12	1940	c.1788C>T	c.(1786-1788)CAC>CAT	p.H596H	ANKRD55_uc003jqt.2_Silent_p.H308H	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1	595										skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CTGCTGTGCTGTGTCTTCGTT	0.443													8	88	---	---	---	---	PASS
ERCC8	1161	broad.mit.edu	37	5	60194177	60194177	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60194177C>A	uc003jsm.3	-	9	839	c.769G>T	c.(769-771)GGA>TGA	p.G257*	ERCC8_uc003jsk.2_RNA|ERCC8_uc003jsl.3_Nonsense_Mutation_p.G199*|ERCC8_uc011cqp.1_Nonsense_Mutation_p.G104*	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent	257	WD 4.				positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				AGGTGAAGTCCATCACTTGTA	0.353								Direct_reversal_of_damage|NER					32	14	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61783622	61783622	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61783622G>C	uc003jtc.2	+	13	1433	c.1243G>C	c.(1243-1245)GAT>CAT	p.D415H	IPO11_uc011cqr.1_Missense_Mutation_p.D455H|IPO11_uc003jtb.1_Missense_Mutation_p.D415H	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	415						cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ATTATTTATAGATATATTCCA	0.294													60	24	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65288601	65288601	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288601G>A	uc003juk.1	+	3	363	c.55G>A	c.(55-57)GGG>AGG	p.G19R	ERBB2IP_uc003juh.1_Missense_Mutation_p.G19R|ERBB2IP_uc003jui.1_Missense_Mutation_p.G19R|ERBB2IP_uc003juj.1_Missense_Mutation_p.G19R|ERBB2IP_uc011cqx.1_Missense_Mutation_p.G19R|ERBB2IP_uc011cqy.1_Missense_Mutation_p.G19R|ERBB2IP_uc011cqz.1_Missense_Mutation_p.G19R|ERBB2IP_uc010iwx.1_Missense_Mutation_p.G19R|ERBB2IP_uc003jul.1_Missense_Mutation_p.G19R	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	19					basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CTGTCTACGAGGGGAAGAGGA	0.363													46	18	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65288623	65288623	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288623C>A	uc003juk.1	+	3	385	c.77C>A	c.(76-78)ACT>AAT	p.T26N	ERBB2IP_uc003juh.1_Missense_Mutation_p.T26N|ERBB2IP_uc003jui.1_Missense_Mutation_p.T26N|ERBB2IP_uc003juj.1_Missense_Mutation_p.T26N|ERBB2IP_uc011cqx.1_Missense_Mutation_p.T26N|ERBB2IP_uc011cqy.1_Missense_Mutation_p.T26N|ERBB2IP_uc011cqz.1_Missense_Mutation_p.T26N|ERBB2IP_uc010iwx.1_Missense_Mutation_p.T26N|ERBB2IP_uc003jul.1_Missense_Mutation_p.T26N	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	26	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ACTGTCACTACTCTTGATTAT	0.378													4	53	---	---	---	---	PASS
FCHO2	115548	broad.mit.edu	37	5	72348261	72348261	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72348261C>T	uc003kcl.2	+	13	1216	c.1100C>T	c.(1099-1101)TCA>TTA	p.S367L	FCHO2_uc011csl.1_Missense_Mutation_p.S334L|FCHO2_uc010izb.2_5'UTR	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a	367										ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		CCAAATAACTCACATCACACA	0.363													6	0	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74091907	74091907	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74091907G>T	uc003kdm.2	-	11	1251	c.1208C>A	c.(1207-1209)GCA>GAA	p.A403E	FAM169A_uc010izm.2_Missense_Mutation_p.A343E|FAM169A_uc003kdl.2_Missense_Mutation_p.A221E	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	403	Asp/Glu-rich.										0						TGCTGGCCGTGCATCTCTATC	0.428													83	27	---	---	---	---	PASS
ZFYVE16	9765	broad.mit.edu	37	5	79733783	79733783	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79733783C>T	uc003kgr.3	+	4	1581	c.1279C>T	c.(1279-1281)CCA>TCA	p.P427S	ZFYVE16_uc010jak.1_Missense_Mutation_p.P427S|ZFYVE16_uc003kgp.2_Missense_Mutation_p.P427S|ZFYVE16_uc003kgq.3_Missense_Mutation_p.P427S|ZFYVE16_uc003kgs.3_Missense_Mutation_p.P427S	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	427					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AGGTGGGGAACCATTCAAAGA	0.363													4	38	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82789635	82789635	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82789635G>T	uc003kii.3	+	5	989	c.633G>T	c.(631-633)CGG>CGT	p.R211R	VCAN_uc003kij.3_Silent_p.R211R|VCAN_uc010jau.2_Silent_p.R211R|VCAN_uc003kik.3_Silent_p.R211R|VCAN_uc003kih.3_Silent_p.R211R	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	211	Link 1.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ATCCCATCCGGGCTCCCAGAG	0.473													5	73	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82818033	82818033	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82818033G>T	uc003kii.3	+	7	4264	c.3908G>T	c.(3907-3909)GGA>GTA	p.G1303V	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.G1303V|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1303	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GAGGCCTTTGGACCTCAGGCG	0.448													55	15	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82849264	82849264	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82849264C>A	uc003kii.3	+	11	9931	c.9575C>A	c.(9574-9576)GCA>GAA	p.A3192E	VCAN_uc003kij.3_Missense_Mutation_p.A2205E|VCAN_uc010jau.2_Missense_Mutation_p.A1438E|VCAN_uc003kik.3_Missense_Mutation_p.A451E|VCAN_uc003kil.3_Missense_Mutation_p.A1856E	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3192	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACATGGGATGCAGCTGAACGG	0.483													6	70	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82948403	82948403	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82948403A>G	uc003kim.2	-	2	412	c.341T>C	c.(340-342)CTG>CCG	p.L114P	HAPLN1_uc003kin.2_Missense_Mutation_p.L114P	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	114	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		GCCTCCCTTCAGAAACACTCT	0.438													8	79	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118440944	118440944	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118440944G>T	uc003ksd.2	+	4	536	c.355G>T	c.(355-357)GAT>TAT	p.D119Y	DMXL1_uc010jcl.1_Missense_Mutation_p.D119Y|DMXL1_uc003ksc.1_Missense_Mutation_p.D119Y	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	119	WD 1.									ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATAACCTGGGATCCCACAGG	0.328													31	14	---	---	---	---	PASS
SRFBP1	153443	broad.mit.edu	37	5	121356226	121356226	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121356226G>C	uc003kst.1	+	6	868	c.796G>C	c.(796-798)GAA>CAA	p.E266Q		NM_152546	NP_689759	Q8NEF9	SRFB1_HUMAN	serum response factor binding protein 1	266					regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TGATAGCACAGAAGAAAGGTT	0.408													50	22	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135610393	135610393	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135610393C>A	uc003lbn.1	-	3	1096	c.1093G>T	c.(1093-1095)GCC>TCC	p.A365S	TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.A296S|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	366	Helical; (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TAGGCTATGGCGAGAAAAGGG	0.463													7	1	---	---	---	---	PASS
HNRNPA0	10949	broad.mit.edu	37	5	137089649	137089649	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137089649C>A	uc003lbt.2	-	1	391	c.107G>T	c.(106-108)TGC>TTC	p.C36F	MYOT_uc011cye.1_Intron|HNRNPA0_uc010jeo.2_Intron	NM_006805	NP_006796	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	36	RRM 1.				nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|RNA binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CACCACCACGCAGTCCGTCAG	0.617													16	2	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140249689	140249689	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140249689C>A	uc003lia.2	+	1	1859	c.1001C>A	c.(1000-1002)ACA>AAA	p.T334K	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.T334K	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	334	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCACTGTACAGTCTGGGTG	0.488													27	8	---	---	---	---	PASS
PCDHAC2	56134	broad.mit.edu	37	5	140348236	140348236	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140348236G>A	uc003lii.2	+	1	2125	c.1885G>A	c.(1885-1887)GAC>AAC	p.D629N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_Intron|PCDHAC2_uc011dag.1_Missense_Mutation_p.D629N	NM_018899	NP_061722	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2 isoform 1	629	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGACTTCTGACCTGGACCT	0.502													19	18	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476696	140476696	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476696C>T	uc003lil.2	+	1	2460	c.2322C>T	c.(2320-2322)CCC>CCT	p.P774P	PCDHB2_uc003lim.1_Silent_p.P435P	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	774	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAATTATCCCCAACTTCGTTG	0.512													61	18	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140501817	140501817	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140501817G>T	uc003lip.1	+	1	237	c.237G>T	c.(235-237)CAG>CAT	p.Q79H		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	79	Cadherin 1.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGATCGTCAGACTGGAGATT	0.557													35	13	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140580181	140580181	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140580181C>G	uc003liy.2	+	1	834	c.834C>G	c.(832-834)TGC>TGG	p.C278W	PCDHB11_uc011daj.1_5'UTR	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	278	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGAAATATGCTATACCTTTT	0.383													36	99	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140773410	140773410	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140773410A>T	uc003lkd.1	+	1	1928	c.1030A>T	c.(1030-1032)AGA>TGA	p.R344*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Nonsense_Mutation_p.R344*	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	344	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAATGACAATAGACCAGAAGT	0.428													72	22	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141025765	141025765	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141025765G>A	uc003llk.2	-						FCHSD1_uc010jgg.2_Silent_p.P29P|FCHSD1_uc003llj.2_Intron	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1										FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACCTGGTTGGGAAGGCAGA	0.418													4	1	---	---	---	---	PASS
ZNF300	91975	broad.mit.edu	37	5	150275522	150275522	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275522G>T	uc003lsy.1	-	6	1546	c.1279C>A	c.(1279-1281)CAT>AAT	p.H427N	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	427	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTCTTTTATGTATAATGAGG	0.438													31	45	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150948104	150948104	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150948104G>T	uc003lue.3	-	1	402	c.389C>A	c.(388-390)GCT>GAT	p.A130D	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.A130D	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	130	Extracellular (Potential).|Cadherin 1.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACGGGTCAAAGCTTCCAACTC	0.527													98	21	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156589583	156589583	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156589583C>A	uc003lwn.2	-	2	1793	c.1693G>T	c.(1693-1695)GTG>TTG	p.V565L		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	565						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCTTCTCCACCATCTTAGCC	0.493													130	34	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168216564	168216564	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168216564C>A	uc003mab.2	-	11	1499	c.1079_splice	c.e11+1	p.L360_splice	SLIT3_uc010jjg.2_Splice_Site_p.L360_splice|SLIT3_uc010jji.2_Splice_Site_p.L360_splice|SLIT3_uc003mac.1_Splice_Site_p.L157_splice	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCCCACTTACAGCGATGTGA	0.512													5	4	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169463541	169463541	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169463541G>C	uc003maf.2	+	36	3727	c.3647G>C	c.(3646-3648)AGG>ACG	p.R1216T	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.R708T	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1216	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GATAACAACAGGGAGGAGATG	0.308													29	10	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171471959	171471959	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171471959G>A	uc003mbo.1	-	19	3134	c.2834C>T	c.(2833-2835)GCG>GTG	p.A945V		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	945	Potential.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGGGCACTCCGCCTCCTCGCT	0.592													19	6	---	---	---	---	PASS
PRPF4B	8899	broad.mit.edu	37	6	4053064	4053064	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4053064G>A	uc003mvv.2	+	11	2514	c.2423G>A	c.(2422-2424)AGA>AAA	p.R808K	PRPF4B_uc003mvw.2_RNA|C6orf146_uc010jnq.1_Intron|PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	808	Protein kinase.					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CTCCTTAAAAGATGCAATATC	0.378													15	8	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6152085	6152085	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6152085T>A	uc003mwv.2	-	14	2129	c.2006A>T	c.(2005-2007)GAT>GTT	p.D669V	F13A1_uc011dib.1_Intron	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	669					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TCCAGGACCATCCAGGTGTAC	0.507													41	22	---	---	---	---	PASS
SLC17A2	10246	broad.mit.edu	37	6	25914827	25914827	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25914827G>T	uc011dkb.1	-	10	1366	c.1283C>A	c.(1282-1284)ACT>AAT	p.T428N	SLC17A2_uc011dkc.1_Missense_Mutation_p.L379M|SLC17A2_uc003nfl.2_Missense_Mutation_p.L379M			O00624	NPT3_HUMAN	SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;	428	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1						GAGGAATCCAGTGGCAGTGGA	0.318													17	7	---	---	---	---	PASS
HIST1H2BK	85236	broad.mit.edu	37	6	27114553	27114553	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114553G>C	uc003nix.1	-	1	67	c.25C>G	c.(25-27)CCC>GCC	p.P9A	HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080593	NP_542160	O60814	H2B1K_HUMAN	histone cluster 1, H2bk	9					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						TTGGGCGCGGGAGCGGACTTC	0.582													9	49	---	---	---	---	PASS
ZNF187	7741	broad.mit.edu	37	6	28240567	28240567	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28240567A>T	uc011dld.1	+						ZNF187_uc011dlc.1_Intron|ZNF187_uc003nku.3_Intron|ZNF187_uc003nkw.3_Intron|ZNF187_uc011dle.1_Intron|ZNF187_uc011dlf.1_Intron|ZNF187_uc011dlg.1_Intron	NM_001111039	NP_001104509	Q16670	ZN187_HUMAN	zinc finger protein 187 isoform b						viral reproduction	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGAGAAGGGTAAGAATTGGAT	0.448													8	5	---	---	---	---	PASS
OR2J2	26707	broad.mit.edu	37	6	29141583	29141583	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141583C>A	uc011dlm.1	+	1	273	c.171C>A	c.(169-171)CAC>CAA	p.H57Q		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	57	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCCATCTCCACACACCAATGT	0.473													60	29	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29911978	29911978	+	Nonsense_Mutation	SNP	C	A	A	rs61760922		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911978C>A	uc003nol.2	+	4	699	c.699C>A	c.(697-699)TAC>TAA	p.Y233*	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Nonsense_Mutation_p.Y112*|HLA-A_uc003nok.2_Nonsense_Mutation_p.Y112*|HLA-A_uc003non.2_Nonsense_Mutation_p.Y233*|HLA-A_uc003noo.2_Nonsense_Mutation_p.Y233*|HLA-A_uc010jrr.2_Nonsense_Mutation_p.Y233*|HLA-A_uc003nom.2_Nonsense_Mutation_p.Y112*|HLA-A_uc010klp.2_Nonsense_Mutation_p.Y205*|HLA-A_uc011dmc.1_Nonsense_Mutation_p.Y112*|HLA-A_uc011dmd.1_Nonsense_Mutation_p.Y112*	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	233	Extracellular (Potential).|Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TGGGCTTCTACCCTGCGGAGA	0.622									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			17	34	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29912172	29912172	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29912172G>A	uc003nol.2	+	4	893	c.893G>A	c.(892-894)TGG>TAG	p.W298*	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Nonsense_Mutation_p.W177*|HLA-A_uc003nok.2_Nonsense_Mutation_p.W177*|HLA-A_uc003non.2_Nonsense_Mutation_p.W298*|HLA-A_uc003noo.2_Nonsense_Mutation_p.W298*|HLA-A_uc010jrr.2_Nonsense_Mutation_p.W298*|HLA-A_uc003nom.2_Nonsense_Mutation_p.W177*|HLA-A_uc010klp.2_Nonsense_Mutation_p.W270*|HLA-A_uc011dmc.1_Nonsense_Mutation_p.W177*|HLA-A_uc011dmd.1_Nonsense_Mutation_p.W177*	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	298	Extracellular (Potential).|Alpha-3.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ACCCTGAGATGGGGTAAGGAG	0.592									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			10	13	---	---	---	---	PASS
C6orf15	29113	broad.mit.edu	37	6	31079509	31079509	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31079509C>G	uc003nsk.1	-	2	627	c.627G>C	c.(625-627)TGG>TGC	p.W209C		NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein precursor	209											0						TCAGGGTACCCCAGGGGTGAT	0.602													23	6	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33632657	33632657	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33632657G>T	uc011drk.1	+	12	1378	c.1159G>T	c.(1159-1161)GTC>TTC	p.V387F		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	387	Cytoplasmic (Potential).|MIR 5.				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GAACTCGTACGTCCGGCTGCG	0.632													12	11	---	---	---	---	PASS
STK38	11329	broad.mit.edu	37	6	36475298	36475298	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36475298G>A	uc003omg.2	-	7	1339	c.751C>T	c.(751-753)CAC>TAC	p.H251Y	STK38_uc003omh.2_Missense_Mutation_p.H251Y|STK38_uc003omi.2_Missense_Mutation_p.H251Y	NM_007271	NP_009202	Q15208	STK38_HUMAN	serine/threonine kinase 38	251	Protein kinase.				intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						GGGAGGCTGTGGTTCAGATTC	0.423													125	52	---	---	---	---	PASS
TINAG	27283	broad.mit.edu	37	6	54173707	54173707	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54173707G>T	uc003pcj.2	+						TINAG_uc003pci.2_Intron|TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CCAGAAGGTAGGCTTTGGGAA	0.353													23	8	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54804515	54804515	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54804515C>T	uc003pck.2	+	5	862	c.746C>T	c.(745-747)TCA>TTA	p.S249L		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	249										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TATATGTGGTCATTTGAGAAA	0.318													21	15	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55739518	55739518	+	Missense_Mutation	SNP	C	G	G	rs140823469		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55739518C>G	uc003pcq.2	-	1	858	c.146G>C	c.(145-147)CGG>CCG	p.R49P	BMP5_uc011dxf.1_Missense_Mutation_p.R49P	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	49					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTGTATTTCCCGTCTTTCGTG	0.453													50	18	---	---	---	---	PASS
BEND6	221336	broad.mit.edu	37	6	56880145	56880145	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56880145G>C	uc010kab.2	+	4	1099	c.513G>C	c.(511-513)GAG>GAC	p.E171D	BEND6_uc003pdi.3_Missense_Mutation_p.E73D	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	171	BEN.										0						AGACTGATGAGAAACAGGTCA	0.363													34	16	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70926698	70926698	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70926698C>G	uc003pfg.3	-	38	2827	c.2668G>C	c.(2668-2670)GGA>CGA	p.G890R	COL9A1_uc003pfe.3_Missense_Mutation_p.G439R|COL9A1_uc003pff.3_Missense_Mutation_p.G647R	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	890	Triple-helical region (COL1).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CCCGGGGGTCCAGGCACTCCA	0.622													22	6	---	---	---	---	PASS
MRAP2	112609	broad.mit.edu	37	6	84765036	84765036	+	5'UTR	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84765036A>T	uc003pkg.3	+	2					MRAP2_uc010kbo.2_5'UTR	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2						positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding			skin(2)	2						TGCAGGTCGGAGATGTCCGCC	0.438													26	12	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96054245	96054245	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96054245A>G	uc003poo.1	+	5	1493	c.1353A>G	c.(1351-1353)GCA>GCG	p.A451A		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	451	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AGGAAAGAGCAACTTATGCAT	0.353													4	34	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102503425	102503425	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102503425C>A	uc003pqp.3	+	15	2781	c.2532C>A	c.(2530-2532)TAC>TAA	p.Y844*	GRIK2_uc003pqo.3_Nonsense_Mutation_p.Y844*|GRIK2_uc010kcw.2_Nonsense_Mutation_p.Y844*	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	844	Cytoplasmic (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	AATTTTTATACAAATCCAAAA	0.368													55	24	---	---	---	---	PASS
ZBTB24	9841	broad.mit.edu	37	6	109796671	109796671	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109796671C>A	uc003ptl.1	-	5	1387	c.1219G>T	c.(1219-1221)GAA>TAA	p.E407*	ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Nonsense_Mutation_p.E351*|ZBTB24_uc010kdt.1_RNA	NM_014797	NP_055612	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24 isoform	407	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TCTTTGCATTCCGGTAATGAG	0.448													4	57	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109954162	109954162	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109954162T>A	uc003ptn.2	-	12	1295	c.1218A>T	c.(1216-1218)ACA>ACT	p.T406T	AKD1_uc003ptr.3_Silent_p.T406T	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	406					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TATTGCAAAGTGTTGTTTTCC	0.294													27	8	---	---	---	---	PASS
WASF1	8936	broad.mit.edu	37	6	110424670	110424670	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110424670C>T	uc003ptv.1	-	9	1641	c.804G>A	c.(802-804)GAG>GAA	p.E268E	WASF1_uc003ptw.1_Silent_p.E268E|WASF1_uc003ptx.1_Silent_p.E268E|WASF1_uc003pty.1_Silent_p.E268E	NM_003931	NP_003922	Q92558	WASF1_HUMAN	Wiskott-Aldrich syndrome protein family member	268					actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		ATACCCTTTCCTCAGCTCTAG	0.458													5	80	---	---	---	---	PASS
COL10A1	1300	broad.mit.edu	37	6	116441971	116441971	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116441971A>G	uc003pwm.2	-	3	1404	c.1308T>C	c.(1306-1308)AAT>AAC	p.N436N	NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_000493	NP_000484	Q03692	COAA1_HUMAN	type X collagen alpha 1 precursor	436	Triple-helical region.				skeletal system development	collagen	metal ion binding			central_nervous_system(1)	1		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		CAGCCTCTCCATTGTGTCCGG	0.602													5	55	---	---	---	---	PASS
RSPH4A	345895	broad.mit.edu	37	6	116938131	116938131	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116938131T>C	uc003pxe.2	+	1	490	c.345T>C	c.(343-345)AGT>AGC	p.S115S	RSPH4A_uc010kee.2_Silent_p.S115S	NM_001010892	NP_001010892	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A isoform 1	115					cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke					0						GGACCACGAGTGTGATTCCTG	0.547									Kartagener_syndrome				6	46	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117665372	117665372	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117665372C>T	uc003pxp.1	-	27	4574	c.4375G>A	c.(4375-4377)GCC>ACC	p.A1459T	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1459	Extracellular (Potential).|Fibronectin type-III 6.				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTGTTAGTGGCATTAAGTATA	0.378			T	GOPC|ROS1	glioblastoma|NSCLC								46	21	---	---	---	---	PASS
MAN1A1	4121	broad.mit.edu	37	6	119510840	119510840	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119510840T>C	uc003pym.1	-	10	1977	c.1535A>G	c.(1534-1536)TAT>TGT	p.Y512C		NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	512	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		TGTTCGATTATATGATTCATG	0.463													6	109	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130761936	130761936	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130761936T>C	uc003qca.2	+	3	1240	c.369T>C	c.(367-369)GAT>GAC	p.D123D	TMEM200A_uc010kfh.2_Silent_p.D123D|TMEM200A_uc010kfi.2_Silent_p.D123D|TMEM200A_uc003qcb.2_Silent_p.D123D	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	123	Extracellular (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TGCATTCTGATAAGATGAAAA	0.408													41	12	---	---	---	---	PASS
C6orf192	116843	broad.mit.edu	37	6	133100533	133100533	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133100533T>A	uc003qdw.1	-	7	821	c.669A>T	c.(667-669)CCA>CCT	p.P223P	C6orf192_uc010kgd.1_RNA|C6orf192_uc011eco.1_Silent_p.P97P	NM_052831	NP_439896	Q6NT16	CF192_HUMAN	hypothetical protein LOC116843	223	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)		AGTGTTCACCTGGATCAGACT	0.363													56	17	---	---	---	---	PASS
C6orf192	116843	broad.mit.edu	37	6	133118167	133118167	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133118167C>A	uc003qdw.1	-	2	289	c.137G>T	c.(136-138)GGT>GTT	p.G46V	C6orf192_uc011eco.1_5'UTR	NM_052831	NP_439896	Q6NT16	CF192_HUMAN	hypothetical protein LOC116843	46	Helical; (Potential).				transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)		CATCATGGAACCTAAGTTCAC	0.423													50	25	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135521455	135521455	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135521455G>T	uc003qfc.2	+	12	1688	c.1489G>T	c.(1489-1491)GAT>TAT	p.D497Y	MYB_uc003qfh.2_Missense_Mutation_p.D618Y|MYB_uc003qfi.2_Missense_Mutation_p.D602Y|MYB_uc010kgi.2_Missense_Mutation_p.D497Y|MYB_uc003qfq.2_Missense_Mutation_p.D615Y|MYB_uc010kgj.2_Missense_Mutation_p.D462Y|MYB_uc003qfo.2_Missense_Mutation_p.D412Y|MYB_uc003qfu.2_Missense_Mutation_p.D494Y|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_Missense_Mutation_p.D123Y|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Missense_Mutation_p.D309Y|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.D497Y	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	497					blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TCTAGTAGAAGATCTGCAGGA	0.398			T	NFIB	adenoid cystic carcinoma								51	22	---	---	---	---	PASS
TAB2	23118	broad.mit.edu	37	6	149699963	149699963	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149699963A>G	uc003qmj.2	+	3	1090	c.912A>G	c.(910-912)TCA>TCG	p.S304S	TAB2_uc011eec.1_Silent_p.S272S|TAB2_uc010kia.1_Silent_p.S304S|TAB2_uc010kib.1_Silent_p.S304S|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	304					activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						CTGGTAGCTCACAGTCTTCTG	0.413													35	40	---	---	---	---	PASS
PLEKHG1	57480	broad.mit.edu	37	6	151152718	151152718	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151152718A>T	uc003qny.1	+	16	2783	c.2471A>T	c.(2470-2472)CAT>CTT	p.H824L	PLEKHG1_uc011eel.1_Missense_Mutation_p.H864L|PLEKHG1_uc011eem.1_Missense_Mutation_p.H883L|PLEKHG1_uc003qnz.2_Missense_Mutation_p.H824L	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	824					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TCTATGCCTCATAAGCCTGTA	0.458													7	115	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152332811	152332811	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152332811C>A	uc003qom.3	+	7	1487	c.1117C>A	c.(1117-1119)CAT>AAT	p.H373N	ESR1_uc010kin.2_Missense_Mutation_p.H373N|ESR1_uc010kio.2_Missense_Mutation_p.H375N|ESR1_uc010kip.2_Missense_Mutation_p.H372N|ESR1_uc003qon.3_Missense_Mutation_p.H373N|ESR1_uc003qoo.3_Missense_Mutation_p.H373N|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Missense_Mutation_p.H42N|ESR1_uc011eex.1_Missense_Mutation_p.H154N|ESR1_uc010kit.1_Intron|ESR1_uc011eey.1_Missense_Mutation_p.H110N	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	373	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	TTTGACCCTCCATGATCAGGT	0.468													64	26	---	---	---	---	PASS
C6orf118	168090	broad.mit.edu	37	6	165715692	165715692	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165715692T>A	uc003qum.3	-	2	155	c.119A>T	c.(118-120)AAT>ATT	p.N40I	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	40											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TTTCTTCAGATTACACAGGGT	0.542													7	48	---	---	---	---	PASS
C7orf70	84792	broad.mit.edu	37	7	6370547	6370547	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6370547C>A	uc003spu.2	-	2	707	c.239G>T	c.(238-240)GGC>GTC	p.G80V		NM_001037163	NP_001032240	Q7Z4H9	SIPAR_HUMAN	hypothetical protein LOC84792	80						nucleus					0						AAGCACTGGGCCGCCACTGTG	0.517													20	20	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7645637	7645637	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7645637C>T	uc003srf.2	+	12	2774	c.2466C>T	c.(2464-2466)AAC>AAT	p.N822N	MIOS_uc003srg.2_Silent_p.N357N|MIOS_uc010ktq.2_Silent_p.N217N	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	822											0						AATTTAACAACTGGTTTACAT	0.378													66	56	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14722261	14722261	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14722261G>T	uc003ssz.2	-	11	1139	c.952C>A	c.(952-954)CCA>ACA	p.P318T	DGKB_uc011jxt.1_Missense_Mutation_p.P311T|DGKB_uc003sta.2_Missense_Mutation_p.P318T|DGKB_uc011jxu.1_Missense_Mutation_p.P318T	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	318	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CACTTGGTTGGGCAGTTACCT	0.433													29	49	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15599845	15599845	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15599845T>A	uc003stb.1	-	2	348	c.178A>T	c.(178-180)ATT>TTT	p.I60F		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	60	Helical; (Potential).				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						CCTTTGAGAATCCAGCTGACA	0.428													23	47	---	---	---	---	PASS
ANKMY2	57037	broad.mit.edu	37	7	16642048	16642048	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16642048C>A	uc003sti.2	-	9	1298	c.1098G>T	c.(1096-1098)AAG>AAT	p.K366N	ANKMY2_uc010ktz.2_RNA	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	366						cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CCAACTGTTGCTTTTCGTAAA	0.373													53	78	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20691071	20691071	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20691071C>G	uc003suw.3	+	4	572	c.26C>G	c.(25-27)GCT>GGT	p.A9G	ABCB5_uc010kuh.2_Missense_Mutation_p.A454G|ABCB5_uc003suv.3_Missense_Mutation_p.A9G|ABCB5_uc011jyi.1_Missense_Mutation_p.A9G	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	9	ABC transporter 1.|Extracellular (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						GACATCAGAGCTTTAAATGTG	0.403													18	18	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23213843	23213843	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23213843G>T	uc003svs.3	+	11	1980	c.1687G>T	c.(1687-1689)GCT>TCT	p.A563S	KLHL7_uc003svr.3_Missense_Mutation_p.A541S|KLHL7_uc011jys.1_Missense_Mutation_p.A487S|KLHL7_uc011jyt.1_Missense_Mutation_p.A338S|KLHL7_uc003svt.2_Missense_Mutation_p.A515S|KLHL7_uc011jyv.1_Missense_Mutation_p.A293S	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	563	Kelch 6.					Golgi apparatus|nucleolus|plasma membrane					0						CAAAGTTCGTGCTTTTCCAGT	0.403													27	45	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30830854	30830854	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30830854G>A	uc003tbt.2	+	5	814	c.737G>A	c.(736-738)CGG>CAG	p.R246Q	FAM188B_uc010kwe.2_Missense_Mutation_p.R217Q	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	246				R -> G (in Ref. 1; AAQ10898).							0						GAAGAGAGCCGGAAGGTCCCT	0.547													54	104	---	---	---	---	PASS
SEPT7	989	broad.mit.edu	37	7	35903268	35903268	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35903268G>T	uc010kxc.2	+	3	469	c.276G>T	c.(274-276)CAG>CAT	p.Q92H	SEPT7_uc011kat.1_Missense_Mutation_p.Q91H|SEPT7_uc011kau.1_Missense_Mutation_p.Q56H|SEPT7_uc011kav.1_Missense_Mutation_p.Q39H|SEPT7_uc003tey.2_Translation_Start_Site	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1	92					cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						AGACTGTACAGGTATGGATAT	0.338													10	22	---	---	---	---	PASS
SEPT7	989	broad.mit.edu	37	7	35903269	35903269	+	Splice_Site	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35903269G>T	uc010kxc.2	+	3	469	c.276_splice	c.e3+1	p.Q92_splice	SEPT7_uc011kat.1_Splice_Site_p.Q91_splice|SEPT7_uc011kau.1_Splice_Site_p.Q56_splice|SEPT7_uc011kav.1_Splice_Site_p.Q39_splice|SEPT7_uc003tey.2_Splice_Site	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1						cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						GACTGTACAGGTATGGATATT	0.333													10	22	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36662852	36662852	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36662852T>C	uc003tfh.3	-	7	927	c.526A>G	c.(526-528)ATG>GTG	p.M176V	AOAH_uc010kxf.2_Missense_Mutation_p.M176V|AOAH_uc011kba.1_Missense_Mutation_p.M144V	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	176					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						GACTGTTCCATAGCTCTAGGA	0.358													18	27	---	---	---	---	PASS
MYL7	58498	broad.mit.edu	37	7	44179956	44179956	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44179956G>C	uc003tkg.2	-	4	276	c.264C>G	c.(262-264)ACC>ACG	p.T88T		NM_021223	NP_067046	Q01449	MLRA_HUMAN	myosin light chain 2a	88					actin filament-based movement|smooth muscle contraction	A band|myosin complex	ATPase activity, coupled|calcium ion binding|microfilament motor activity				0						TGAGGAAGACGGTGAAGTTGA	0.557													4	92	---	---	---	---	PASS
CAMK2B	816	broad.mit.edu	37	7	44323773	44323773	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44323773C>T	uc003tkq.2	-	2	327	c.117G>A	c.(115-117)GAG>GAA	p.E39E	CAMK2B_uc003tkp.2_Silent_p.E39E|CAMK2B_uc003tkx.2_Silent_p.E39E|CAMK2B_uc010kyd.2_RNA|CAMK2B_uc003tkr.2_Silent_p.E39E|CAMK2B_uc003tks.2_Silent_p.E39E|CAMK2B_uc003tku.2_Silent_p.E39E|CAMK2B_uc003tkv.2_Silent_p.E39E|CAMK2B_uc003tkt.2_Silent_p.E39E|CAMK2B_uc003tkw.2_Silent_p.E39E|CAMK2B_uc010kyc.2_Silent_p.E39E	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II	39	Protein kinase.				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						TGGCTGCATACTCATGGCCGG	0.532													5	28	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47851492	47851492	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47851492C>T	uc003tny.1	-	50	7504	c.7504G>A	c.(7504-7506)GTC>ATC	p.V2502I	C7orf69_uc003tnz.3_Intron|C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_Missense_Mutation_p.V229I	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2502	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						GATGAGGGGACGAGACTCCCC	0.592													4	9	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48312761	48312761	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48312761G>C	uc003toq.2	+	17	3523	c.3498G>C	c.(3496-3498)AAG>AAC	p.K1166N	ABCA13_uc010kyr.2_Missense_Mutation_p.K669N	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1166					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AATTATTTAAGTTTGACATGA	0.373													13	52	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48317834	48317834	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48317834A>G	uc003toq.2	+	18	7068	c.7043A>G	c.(7042-7044)AAT>AGT	p.N2348S		NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2348					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ATATTAGACAATGGAGAATTT	0.294													8	13	---	---	---	---	PASS
VSTM2A	222008	broad.mit.edu	37	7	54617574	54617574	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54617574C>T	uc010kzf.2	+	4	750	c.345C>T	c.(343-345)TCC>TCT	p.S115S	VSTM2A_uc010kze.2_Silent_p.S115S|VSTM2A_uc003tqc.3_Silent_p.S115S	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	115	Ig-like V-type.					extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			TTCAGATTTCCAAAGTGAGGA	0.423													9	18	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55874819	55874819	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55874819C>A	uc003tqz.2	-	8	1067	c.950G>T	c.(949-951)GGC>GTC	p.G317V		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	317					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ATCTGTAAAGCCCATTTTCTG	0.383													21	33	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55874820	55874820	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55874820C>A	uc003tqz.2	-	8	1066	c.949G>T	c.(949-951)GGC>TGC	p.G317C		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	317					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCTGTAAAGCCCATTTTCTGC	0.388													21	32	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57193725	57193725	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57193725C>G	uc010kzo.2	-	4	533	c.262G>C	c.(262-264)GTT>CTT	p.V88L		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	88					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			TCTCACCTACCTGGGTGTTTG	0.458													35	57	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71488657	71488657	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71488657G>T	uc003twa.3	-	4	887	c.360C>A	c.(358-360)GAC>GAA	p.D120E	CALN1_uc003twb.3_Missense_Mutation_p.D162E|CALN1_uc003twc.3_Missense_Mutation_p.D120E	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	120	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGAATATGCTGTCTATCGTGT	0.408													18	7	---	---	---	---	PASS
SRRM3	222183	broad.mit.edu	37	7	75894703	75894703	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75894703C>A	uc010ldi.2	+	10	956	c.747C>A	c.(745-747)GGC>GGA	p.G249G	SRRM3_uc011kgi.1_5'UTR	NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						AGTCCCCAGGCCGGAGGTCTC	0.642													4	9	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82583557	82583557	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583557C>A	uc003uhx.2	-	5	7001	c.6712G>T	c.(6712-6714)GAC>TAC	p.D2238Y	PCLO_uc003uhv.2_Missense_Mutation_p.D2238Y|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2169					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCTGGATAGTCTATAATGCTG	0.373													15	8	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87150161	87150161	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87150161G>T	uc003uiz.1	-	23	3135	c.2717C>A	c.(2716-2718)ACC>AAC	p.T906N	ABCB1_uc011khc.1_Missense_Mutation_p.T842N	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	906	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AGAAACAACGGTTCGGAAGTT	0.418													31	12	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92763119	92763119	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92763119T>C	uc003umh.1	-	5	3382	c.2166A>G	c.(2164-2166)ATA>ATG	p.I722M	SAMD9L_uc003umj.1_Missense_Mutation_p.I722M|SAMD9L_uc003umi.1_Missense_Mutation_p.I722M|SAMD9L_uc010lfb.1_Missense_Mutation_p.I722M|SAMD9L_uc003umk.1_Missense_Mutation_p.I722M|SAMD9L_uc010lfc.1_Missense_Mutation_p.I722M|SAMD9L_uc010lfd.1_Missense_Mutation_p.I722M|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	722										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CCCAGCAGTGTATTAAATCTT	0.378													57	32	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94039141	94039141	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94039141G>A	uc003ung.1	+						COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GTTGTAAGTGGTCATGACTGT	0.517										HNSCC(75;0.22)			21	4	---	---	---	---	PASS
ZSCAN21	7589	broad.mit.edu	37	7	99654654	99654654	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99654654G>T	uc003uso.2	+	2	169	c.25G>T	c.(25-27)GCC>TCC	p.A9S	ZSCAN21_uc011kje.1_Missense_Mutation_p.A8S|ZSCAN21_uc003usn.1_Missense_Mutation_p.A8S	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	zinc finger protein 38	9					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ACTAGGCATGGCCCCAGTTCT	0.527													96	34	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100364685	100364685	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100364685C>A	uc003uwj.2	+	25	4830	c.4665C>A	c.(4663-4665)GGC>GGA	p.G1555G	ZAN_uc003uwk.2_Silent_p.G1555G|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Silent_p.G132G	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1555	Extracellular (Potential).|VWFD 2.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCTTCGATGGCGCCTTGCACC	0.602													34	18	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100855820	100855820	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100855820C>G	uc003uyd.2	-	9	1452	c.996G>C	c.(994-996)CTG>CTC	p.L332L	PLOD3_uc010lhs.2_5'UTR	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	332					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CGTTGTTGTGCAGGAAAAGGG	0.607													20	19	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102667932	102667932	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102667932T>C	uc003vaq.2	-	5	718	c.291A>G	c.(289-291)ACA>ACG	p.T97T	FBXL13_uc010liq.1_5'Flank|FBXL13_uc010lir.1_Silent_p.T97T|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Silent_p.T97T|FBXL13_uc003vav.2_RNA	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	97											0						TATGTCTTGCTGTATTCCGCC	0.318													28	12	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102669158	102669158	+	Missense_Mutation	SNP	C	A	A	rs147832645	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102669158C>A	uc003vaq.2	-	4	533	c.106G>T	c.(106-108)GTC>TTC	p.V36F	FBXL13_uc010lir.1_Missense_Mutation_p.V36F|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.V36F|FBXL13_uc003vav.2_Intron	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	36											0						TCAGCCAGGACGACATTTTCA	0.343													21	14	---	---	---	---	PASS
C7orf66	154907	broad.mit.edu	37	7	108524478	108524478	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108524478A>T	uc003vfo.2	-							NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907							integral to membrane				ovary(2)	2						aagaaTTCCCACCTTACCTGA	0.398													10	3	---	---	---	---	PASS
CAV2	858	broad.mit.edu	37	7	116139935	116139935	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116139935G>T	uc003vid.2	+	1	492	c.100G>T	c.(100-102)GCG>TCG	p.A34S	CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_RNA|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_RNA|CAV2_uc003via.2_RNA|CAV1_uc010lkd.1_Intron|CAV1_uc010lke.1_Intron|CAV2_uc003vie.2_Missense_Mutation_p.A34S	NM_001233	NP_001224	P51636	CAV2_HUMAN	caveolin 2 isoform a and b	34	Cytoplasmic (Potential).				caveola assembly|endoplasmic reticulum organization|mitochondrion organization|negative regulation of endothelial cell proliferation|positive regulation of dopamine receptor signaling pathway|regulation of mitosis|skeletal muscle fiber development|vesicle docking|vesicle fusion	caveola|extrinsic to internal side of plasma membrane|Golgi membrane|integral to plasma membrane|membrane fraction|nucleus|perinuclear region of cytoplasm|transport vesicle	D1 dopamine receptor binding|protein homodimerization activity				0	all_epithelial(6;1.53e-06)|Lung NSC(10;0.00592)|all_lung(10;0.00642)		STAD - Stomach adenocarcinoma(10;0.00878)			CGAGAAGTTCGCGGACTCGGA	0.682													8	1	---	---	---	---	PASS
LMOD2	442721	broad.mit.edu	37	7	123302254	123302254	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123302254A>G	uc003vky.2	+	2	771	c.614A>G	c.(613-615)AAG>AGG	p.K205R		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	205						cytoskeleton	actin binding|tropomyosin binding				0						GCTTTGGACAAGATTAAAAGC	0.463													5	6	---	---	---	---	PASS
WASL	8976	broad.mit.edu	37	7	123332787	123332787	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123332787C>A	uc003vkz.2	-	9	1289	c.961G>T	c.(961-963)GCA>TCA	p.A321S		NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein	321	Pro-rich.				actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						GGTGGAGGTGCAGCTGTGGGA	0.473													42	13	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127253810	127253810	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127253810C>T	uc010lld.1	-	4	744	c.538G>A	c.(538-540)GAG>AAG	p.E180K	PAX4_uc003vmf.2_Missense_Mutation_p.E178K|PAX4_uc003vmg.1_Missense_Mutation_p.E180K|PAX4_uc003vmh.2_Missense_Mutation_p.E178K	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	188	Homeobox.				cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						AGCCCAGCACCTTTCTCCAGT	0.622													46	11	---	---	---	---	PASS
CCDC136	64753	broad.mit.edu	37	7	128452222	128452222	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128452222C>T	uc003vnv.1	+	13	2764	c.2397C>T	c.(2395-2397)GCC>GCT	p.A799A	CCDC136_uc003vnu.1_Intron|CCDC136_uc003vnw.1_Intron|CCDC136_uc003vnx.1_Silent_p.A615A|CCDC136_uc010llq.1_Silent_p.A168A|CCDC136_uc003vny.1_Silent_p.A409A	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	799	Ser-rich.					integral to membrane	protein binding			ovary(2)	2						CCAGTGAGGCCTATGGGAAGA	0.493													12	10	---	---	---	---	PASS
SLC13A4	26266	broad.mit.edu	37	7	135380107	135380107	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135380107G>A	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0						AAAGGGCCCTGGAACTCACTT	0.572													29	11	---	---	---	---	PASS
CREB3L2	64764	broad.mit.edu	37	7	137570171	137570171	+	Missense_Mutation	SNP	G	A	A	rs148366639		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137570171G>A	uc003vtw.2	-	9	1516	c.1121C>T	c.(1120-1122)ACG>ATG	p.T374M	CREB3L2_uc003vtx.1_Missense_Mutation_p.T374M|CREB3L2_uc003vtv.2_Missense_Mutation_p.T311M	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like	374	Cytoplasmic (Potential).				chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						GCCAGTCTGCGTGCCAGCTAA	0.587			T	FUS	fibromyxoid sarcoma								12	25	---	---	---	---	PASS
SLC37A3	84255	broad.mit.edu	37	7	140035210	140035210	+	3'UTR	SNP	G	A	A	rs144151206	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140035210G>A	uc003vvo.2	-	15					SLC37A3_uc003vvn.2_3'UTR|SLC37A3_uc003vvp.2_Silent_p.T395T|SLC37A3_uc010lnh.2_3'UTR	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate						carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)					CGCGGGCACCGGTCACTCCCT	0.488													31	20	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140301267	140301267	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301267G>T	uc010lnj.2	-	1	1076	c.931C>A	c.(931-933)CCC>ACC	p.P311T	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.P311T|DENND2A_uc003vvw.2_Missense_Mutation_p.P311T|DENND2A_uc003vvx.2_Missense_Mutation_p.P311T	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	311										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					gaaggtgggggagaggagggc	0.398													17	6	---	---	---	---	PASS
CLEC5A	23601	broad.mit.edu	37	7	141631620	141631620	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141631620G>C	uc003vwv.1	-	6	549	c.352C>G	c.(352-354)CTT>GTT	p.L118V	CLEC5A_uc011krm.1_Missense_Mutation_p.L95V|CLEC5A_uc003vww.1_Missense_Mutation_p.L117V|CLEC5A_uc010lnq.1_Missense_Mutation_p.L95V|CLEC5A_uc010lnr.1_RNA	NM_013252	NP_037384	Q9NY25	CLC5A_HUMAN	C-type lectin, superfamily member 5	118	C-type lectin.|Extracellular (Potential).				anti-apoptosis|cellular defense response|innate immune response|interspecies interaction between organisms|osteoblast development	cell surface|integral to plasma membrane	sugar binding|viral receptor activity				0	Melanoma(164;0.0171)					ATGTCCTGAAGAAACTTCTGG	0.373													27	8	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142000841	142000841	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142000841C>A	uc011kro.1	+	1	66	c.21C>A	c.(19-21)TGC>TGA	p.C7*						SubName: Full=V_segment translation product; Flags: Fragment;																		GGCTCGTATGCTGGGCAATTT	0.458													40	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142326844	142326844	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142326844C>A	uc011krp.1	+						uc011krr.1_Intron|uc003vzo.2_Missense_Mutation_p.H48N					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		GAATTTGAACCACGATGCCAT	0.463													56	15	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143039500	143039500	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143039500G>A	uc003wcr.1	+	16	1919	c.1832G>A	c.(1831-1833)CGT>CAT	p.R611H	CLCN1_uc011ktc.1_Missense_Mutation_p.R223H	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	611	CBS 1.|Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					ATCATGGTACGTGATGTGAAG	0.468													8	15	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146818061	146818061	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146818061G>A	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTTCACTTCTGTGTACGCAGG	0.468										HNSCC(39;0.1)			23	6	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147914586	147914586	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147914586G>T	uc003weu.1	+	19	3733	c.3217G>T	c.(3217-3219)GAC>TAC	p.D1073Y		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1073	Laminin G-like 4.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTTCACCACAGACTTCTTGGC	0.537										HNSCC(39;0.1)			43	20	---	---	---	---	PASS
ZNF862	643641	broad.mit.edu	37	7	149545084	149545084	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149545084C>T	uc010lpn.2	+	4	694	c.502C>T	c.(502-504)CCC>TCC	p.P168S	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	168	TTF-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						CCGAGAATACCCCTCCATCAG	0.517													3	3	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10467053	10467053	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10467053C>T	uc003wtc.2	-	4	4784	c.4555G>A	c.(4555-4557)GTG>ATG	p.V1519M		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1519					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AACACGGACACCCAGATGGGG	0.652													19	40	---	---	---	---	PASS
DEFB136	613210	broad.mit.edu	37	8	11831636	11831636	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11831636G>A	uc011kxm.1	-							NM_001033018	NP_001028190	Q30KP8	DB136_HUMAN	beta-defensin 136 precursor						defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)		TCCTGAAGCGGGGAGAGACCA	0.478													54	16	---	---	---	---	PASS
NPM2	10361	broad.mit.edu	37	8	21882972	21882972	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21882972G>T	uc003xab.2	+	3	742	c.84G>T	c.(82-84)CGG>CGT	p.R28R	NPM2_uc003xac.2_Silent_p.R28R|NPM2_uc003xad.2_Silent_p.R28R|NPM2_uc003xae.2_Silent_p.R28R|NPM2_uc003xaf.2_Silent_p.R28R	NM_182795	NP_877724	Q86SE8	NPM2_HUMAN	nucleoplasmin 2	28					chromatin remodeling|embryo development|oocyte differentiation|positive regulation of meiosis|regulation of exit from mitosis|single fertilization	cytoplasmic chromatin|nuclear chromatin	histone binding|nucleic acid binding				0				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		AGGAGAGGCGGACTTGGACCT	0.622													13	11	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22162343	22162343	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22162343A>G	uc003xbn.2	+	12	1565	c.1417A>G	c.(1417-1419)ATT>GTT	p.I473V	PIWIL2_uc011kzf.1_Missense_Mutation_p.I473V|PIWIL2_uc010ltv.2_Missense_Mutation_p.I473V	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	473	PAZ.				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		GCCATTGCTGATTCACAGGCC	0.443													20	5	---	---	---	---	PASS
FZD3	7976	broad.mit.edu	37	8	28413259	28413259	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28413259G>T	uc003xgx.2	+	7	2036	c.1558G>T	c.(1558-1560)GTG>TTG	p.V520L	FZD3_uc010lvb.2_Missense_Mutation_p.V520L	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	520	Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		GTCTAGGATAGTGAATGAGAG	0.383													44	14	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30702240	30702240	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30702240T>G	uc003xil.2	-	1	4294	c.4294A>C	c.(4294-4296)AGT>CGT	p.S1432R		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1432										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GAACTATCACTGGAAGATAAT	0.348													51	14	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32463206	32463206	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32463206G>A	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CAAACGGTAAGAGATACCTAC	0.393													13	54	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32621881	32621881	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32621881G>T	uc003xiv.2	+	12	2401	c.1884G>T	c.(1882-1884)CTG>CTT	p.L628L	NRG1_uc010lvo.2_3'UTR|NRG1_uc003xiu.2_Silent_p.L633L|NRG1_uc003xiw.2_Silent_p.L625L|NRG1_uc003xit.2_3'UTR|NRG1_uc010lvr.2_Silent_p.L370L|NRG1_uc010lvs.2_Silent_p.L370L|NRG1_uc010lvp.2_Silent_p.L582L|NRG1_uc010lvq.2_Silent_p.L565L|NRG1_uc011lbg.1_3'UTR|NRG1_uc011lbh.1_Silent_p.L471L|NRG1_uc003xja.2_Silent_p.L439L	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha	628	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AGGCCAGGCTGTCTAGTGTAA	0.448													20	2	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35579850	35579850	+	Missense_Mutation	SNP	G	T	T	rs149536132		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35579850G>T	uc003xjr.1	+	9	1568	c.1240G>T	c.(1240-1242)GTC>TTC	p.V414F	UNC5D_uc003xjs.1_Missense_Mutation_p.V409F|UNC5D_uc003xju.1_5'Flank|UNC5D_uc003xjt.1_Missense_Mutation_p.V172F	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	414	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGGCGTGGACGTCATTGACTC	0.557													102	30	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36663799	36663799	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36663799G>T	uc010lvw.2	+	5	568	c.481G>T	c.(481-483)GAT>TAT	p.D161Y	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	161	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TATGGCAGCTGATGACAAGAT	0.353													11	3	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48809844	48809844	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48809844G>A	uc003xqi.2	-	30	3532	c.3475C>T	c.(3475-3477)CCT>TCT	p.P1159S	PRKDC_uc003xqj.2_Missense_Mutation_p.P1159S|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1159					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				GATGCGGAAGGTGGAAATCCT	0.433								NHEJ					64	53	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52322090	52322090	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52322090G>C	uc003xqu.3	-	17	2195	c.2094C>G	c.(2092-2094)CGC>CGG	p.R698R	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	698					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGCTGAGGGAGCGCGGGGACA	0.617													5	25	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53079509	53079509	+	Silent	SNP	C	T	T	rs139354986	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53079509C>T	uc003xqz.2	-	6	1263	c.1107G>A	c.(1105-1107)CCG>CCA	p.P369P	ST18_uc011ldq.1_Silent_p.P16P|ST18_uc011ldr.1_Silent_p.P334P|ST18_uc011lds.1_Silent_p.P274P|ST18_uc003xra.2_Silent_p.P369P|ST18_uc003xrb.2_Silent_p.P369P	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	369	C2HC-type 1.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ATCCAGGGATCGGGCACTTGG	0.522													23	94	---	---	---	---	PASS
PLAG1	5324	broad.mit.edu	37	8	57079512	57079512	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57079512C>A	uc003xsq.3	-	3	1244	c.793G>T	c.(793-795)GAG>TAG	p.E265*	PLAG1_uc003xsr.3_Nonsense_Mutation_p.E265*|PLAG1_uc010lyi.2_Nonsense_Mutation_p.E265*|PLAG1_uc010lyj.2_Nonsense_Mutation_p.E183*	NM_001114635	NP_001108107	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform b	265	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Repression domain; contains 3 sumoylation motifs and massively decrease transcription activity.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			GGAAGGAGCTCGTCTTTTATA	0.423			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								59	150	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61749490	61749490	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61749490A>T	uc003xue.2	+	17	4581	c.4104A>T	c.(4102-4104)GCA>GCT	p.A1368A		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1368	Helicase C-terminal.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTACAAGGGCAGGAGGTTTAG	0.488													42	115	---	---	---	---	PASS
SGK3	23678	broad.mit.edu	37	8	67743512	67743512	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67743512T>C	uc003xwr.2	+	8	790	c.491T>C	c.(490-492)TTC>TCC	p.F164S	SGK3_uc003xwp.2_Missense_Mutation_p.F158S|SGK3_uc003xwt.2_Missense_Mutation_p.F164S|SGK3_uc003xwu.2_Missense_Mutation_p.F164S	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform	164	Protein kinase.				cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GACTTTGATTTCTTAAAAGTT	0.289													3	153	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68984805	68984805	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68984805G>A	uc003xxv.1	+	14	1596	c.1569G>A	c.(1567-1569)CAG>CAA	p.Q523Q	PREX2_uc003xxu.1_Silent_p.Q523Q|PREX2_uc011lez.1_Silent_p.Q458Q	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	523	DEP 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TAATTGCACAGGTAAATAGAC	0.348													20	51	---	---	---	---	PASS
PRDM14	63978	broad.mit.edu	37	8	70981441	70981441	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70981441G>A	uc003xym.2	-	2	857	c.655C>T	c.(655-657)CTG>TTG	p.L219L		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	219					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GCATGGTGCAGGCTGGCTGGG	0.597													26	53	---	---	---	---	PASS
ZNF704	619279	broad.mit.edu	37	8	81599491	81599491	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81599491G>C	uc003yby.1	-	4	760	c.528C>G	c.(526-528)CTC>CTG	p.L176L		NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	176						intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GCTCGTCGAAGAGCAGGTTGC	0.637											OREG0018841	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	66	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885208	88885208	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885208G>A	uc003ydz.2	-	1	1089	c.992C>T	c.(991-993)GCC>GTC	p.A331V		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	331	WD 2.									ovary(1)	1						CTGGCCCACGGCCGCCACGAC	0.567													23	38	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89128908	89128908	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89128908G>A	uc003yeb.3	-	6	1193	c.911C>T	c.(910-912)CCG>CTG	p.P304L	MMP16_uc003yec.2_Missense_Mutation_p.P304L	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	304	Extracellular (Potential).				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						GGGCACTGTCGGTAGAGGTCT	0.517													19	87	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	99045299	99045299	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99045299G>T	uc003yic.2	+	17	2842	c.2611G>T	c.(2611-2613)GAC>TAC	p.D871Y	MATN2_uc010mbh.1_Missense_Mutation_p.D830Y|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Missense_Mutation_p.D871Y|MATN2_uc010mbi.1_Intron|MATN2_uc010mbj.1_Missense_Mutation_p.D232Y|RPL30_uc010mbk.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	871						proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AAATATCCAAGACCTACTTTC	0.378													3	18	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100589769	100589769	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100589769G>C	uc003yiv.2	+	33	5314	c.5203G>C	c.(5203-5205)GAC>CAC	p.D1735H	VPS13B_uc003yiw.2_Missense_Mutation_p.D1710H	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1735					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CACAAACCTGGACTTCTTCCT	0.393													43	53	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100831708	100831708	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100831708A>T	uc003yiv.2	+	48	8876	c.8765A>T	c.(8764-8766)AAG>ATG	p.K2922M	VPS13B_uc003yiw.2_Missense_Mutation_p.K2897M	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2922					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATAGCCACTAAGGTACACCCT	0.398													38	47	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103312247	103312247	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103312247G>A	uc003ykr.1	-	23	3120	c.3087C>T	c.(3085-3087)GAC>GAT	p.D1029D	UBR5_uc003yks.1_Silent_p.D1029D	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1029					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TCGCAGGAGGGTCAGGAACCC	0.443													23	38	---	---	---	---	PASS
BAALC	79870	broad.mit.edu	37	8	104225140	104225140	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104225140C>A	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|BAALC_uc003ylg.2_5'UTR|BAALC_uc010mcc.2_5'Flank	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			CTGCTTACCTCCCCCAGGCAT	0.493													16	49	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104442907	104442907	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104442907C>A	uc003yln.2	+	6	1425	c.1148C>A	c.(1147-1149)CCT>CAT	p.P383H	DCAF13_uc003ylm.1_Missense_Mutation_p.P116H|DCAF13_uc003ylo.2_Missense_Mutation_p.P94H	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	231	WD 4.				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						CAAGCTACTCCTTTGAAAAAG	0.333													11	136	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898348	104898348	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898348G>A	uc003yls.2	+	2	1096	c.855G>A	c.(853-855)ATG>ATA	p.M285I	RIMS2_uc003ylp.2_Missense_Mutation_p.M507I|RIMS2_uc003ylw.2_Missense_Mutation_p.M315I|RIMS2_uc003ylq.2_Missense_Mutation_p.M315I|RIMS2_uc003ylr.2_Missense_Mutation_p.M315I	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	538					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GCGGTAAAATGCGCCAGATTT	0.428										HNSCC(12;0.0054)			21	21	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113871489	113871489	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113871489G>A	uc003ynu.2	-	11	1799	c.1640C>T	c.(1639-1641)ACG>ATG	p.T547M	CSMD3_uc003ynt.2_Missense_Mutation_p.T507M|CSMD3_uc011lhx.1_Missense_Mutation_p.T443M	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	547	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGAGCCACACGTTTTCACTAA	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			8	48	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114031360	114031360	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114031360C>T	uc003ynu.2	-	6	1125	c.966G>A	c.(964-966)TGG>TGA	p.W322*	CSMD3_uc003ynt.2_Nonsense_Mutation_p.W282*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.W322*|CSMD3_uc010mcx.1_Nonsense_Mutation_p.W322*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	322	Extracellular (Potential).|CUB 2.		W -> G (in a colorectal cancer sample; somatic mutation).			integral to membrane|plasma membrane		p.W322G(1)		ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCAGTCTGAGCCAGTTTTTGT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			34	65	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116631903	116631903	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116631903G>A	uc003ynz.2	-	2	842	c.383C>T	c.(382-384)CCG>CTG	p.P128L	TRPS1_uc011lhy.1_Missense_Mutation_p.P132L|TRPS1_uc003yny.2_Missense_Mutation_p.P141L|TRPS1_uc010mcy.2_Missense_Mutation_p.P128L	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	128					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGCTCTTTGCGGAGACTTCAA	0.522									Langer-Giedion_syndrome				21	44	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120605998	120605998	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120605998C>T	uc003yot.1	-	12	1161	c.1075G>A	c.(1075-1077)GAC>AAC	p.D359N	ENPP2_uc003yor.1_5'Flank|ENPP2_uc003yos.1_Missense_Mutation_p.D411N|ENPP2_uc010mdd.1_Missense_Mutation_p.D359N	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	359		Zinc 1 (By similarity).			cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTACCATGGTCTCCGACAAAG	0.398													56	218	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120810067	120810067	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120810067G>C	uc003you.2	-	7	1082	c.812C>G	c.(811-813)CCC>CGC	p.P271R		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	271					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AAGAAGTTGGGGCAAACAAAA	0.323													12	33	---	---	---	---	PASS
TRIB1	10221	broad.mit.edu	37	8	126445615	126445615	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126445615G>T	uc003yrx.2	+	2	999	c.417G>T	c.(415-417)TCG>TCT	p.S139S	TRIB1_uc011lis.1_5'UTR|TRIB1_uc010mdn.2_5'Flank	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	G-protein-coupled receptor induced protein	139	Protein kinase.				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AGCTGCCATCGCACAGCAACA	0.493													80	225	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133895148	133895148	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133895148G>T	uc003ytw.2	+	8	1020	c.979G>T	c.(979-981)GCG>TCG	p.A327S		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	327	Thyroglobulin type-1 4.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CGACTATCAGGCGGTGCAGTG	0.592													5	33	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134478270	134478270	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134478270C>A	uc003yuk.2	-	6	1199	c.370G>T	c.(370-372)GTG>TTG	p.V124L	ST3GAL1_uc003yum.2_Missense_Mutation_p.V124L	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	124	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			TTCCCAGGCACCACTCTGAAC	0.587													17	67	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139890506	139890506	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139890506C>T	uc003yvd.2	-	3	592	c.145G>A	c.(145-147)GTG>ATG	p.V49M		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	49	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCCTTGCCCACGCTGGAGGAG	0.622										HNSCC(7;0.00092)			6	2	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142458036	142458036	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142458036G>T	uc003ywi.2	-	23	2871	c.2790C>A	c.(2788-2790)GCC>GCA	p.A930A	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	930							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CCGCCTCCTGGGCCTGCTGCT	0.652													6	7	---	---	---	---	PASS
LY6K	54742	broad.mit.edu	37	8	143784555	143784555	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143784555T>C	uc011ljv.1	+	3	681	c.264T>C	c.(262-264)GGT>GGC	p.G88G	LY6K_uc011ljw.1_3'UTR|LY6K_uc011ljx.1_Silent_p.L78L	NM_017527	NP_059997	Q17RY6	LY6K_HUMAN	lymphocyte antigen 6 complex, locus K isoform 1	88	UPAR/Ly6.					anchored to membrane|cytoplasm|extracellular region|nucleolus|plasma membrane				central_nervous_system(1)	1	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCTCCGCTGGTTGTGCAGCGA	0.473													23	37	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143999104	143999104	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143999104C>A	uc003yxk.1	-	1	156	c.153G>T	c.(151-153)AGG>AGT	p.R51S		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	51					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	TCTGCAGCAGCCTCAGCCACC	0.627									Familial_Hyperaldosteronism_type_I				26	55	---	---	---	---	PASS
DMRT1	1761	broad.mit.edu	37	9	894055	894055	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:894055T>C	uc003zgv.2	+	3	831	c.682T>C	c.(682-684)TGC>CGC	p.C228R	DMRT1_uc003zgu.1_Missense_Mutation_p.C228R	NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	228					cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		TCTATACAACTGCCCGCAGTA	0.552											OREG0019071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	44	9	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16552644	16552644	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16552644G>A	uc003zml.2	-	5	693	c.553C>T	c.(553-555)CGG>TGG	p.R185W	BNC2_uc011lmw.1_Missense_Mutation_p.R90W|BNC2_uc003zmm.2_Missense_Mutation_p.R143W|BNC2_uc003zmq.1_Missense_Mutation_p.R199W|BNC2_uc003zmr.1_Missense_Mutation_p.R222W|BNC2_uc003zmp.1_Missense_Mutation_p.R213W|BNC2_uc010mij.1_Missense_Mutation_p.R107W|BNC2_uc011lmv.1_Missense_Mutation_p.R11W|BNC2_uc003zmo.1_Missense_Mutation_p.R107W	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	185					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		ATCTTTAGCCGCACAGGCACT	0.572													13	17	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20764907	20764907	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20764907G>T	uc003zog.1	+	9	897	c.534G>T	c.(532-534)CTG>CTT	p.L178L		NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	178						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CACCATTTCTGTGGTATCTGT	0.378													24	51	---	---	---	---	PASS
IFNA1	3439	broad.mit.edu	37	9	21441038	21441038	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21441038T>A	uc003zpd.1	+	1	599	c.532T>A	c.(532-534)TCA>ACA	p.S178T		NM_024013	NP_076918	P01562	IFNA1_HUMAN	interferon, alpha 1 precursor	178					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(2)	2				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CCTCTCTTTATCAACAAACTT	0.403													68	34	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32631014	32631014	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32631014C>A	uc003zrg.1	-	1	4654	c.4564G>T	c.(4564-4566)GAC>TAC	p.D1522Y	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1522					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCCACTTGGTCATCATCATCC	0.403													55	19	---	---	---	---	PASS
NFX1	4799	broad.mit.edu	37	9	33344173	33344173	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33344173G>T	uc003zsq.2	+	14	2392	c.2331G>T	c.(2329-2331)GAG>GAT	p.E777D	SUGT1P1_uc010mjq.1_Intron|NFX1_uc011lnw.1_Missense_Mutation_p.E777D|NFX1_uc003zso.2_Missense_Mutation_p.E777D|NFX1_uc003zsp.1_Missense_Mutation_p.E777D|NFX1_uc010mjr.1_Missense_Mutation_p.E778D|NFX1_uc003zsr.2_Missense_Mutation_p.E778D	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	777					inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAGTCCATGAGTGTGACCATC	0.493													31	13	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37744832	37744832	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37744832G>C	uc004aag.1	+	16	2847	c.2803G>C	c.(2803-2805)GAC>CAC	p.D935H	FRMPD1_uc004aah.1_Missense_Mutation_p.D935H	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	935						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		ATCAGTCATCGACTCTCGAGT	0.542													46	64	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84249063	84249063	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84249063G>A	uc004aly.2	-	7	967	c.526C>T	c.(526-528)CAC>TAC	p.H176Y	TLE1_uc004alz.2_Missense_Mutation_p.H186Y|TLE1_uc011lsr.1_Missense_Mutation_p.H176Y|TLE1_uc004ama.1_Missense_Mutation_p.H176Y|TLE1_uc011lss.1_Intron|TLE1_uc004amb.2_Missense_Mutation_p.H176Y	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	176	Gly/Pro-rich.				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						ATTGCCAAGTGAGACTGCCCA	0.572													5	3	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90501662	90501662	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90501662A>G	uc004app.3	+	4	2295	c.2260A>G	c.(2260-2262)AGG>GGG	p.R754G	C9orf79_uc004apo.1_Missense_Mutation_p.R566G	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	754						integral to membrane				ovary(3)	3						TTCCACACCCAGGGACCCAGA	0.552													6	26	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90501901	90501901	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90501901G>T	uc004app.3	+	4	2534	c.2499G>T	c.(2497-2499)CAG>CAT	p.Q833H	C9orf79_uc004apo.1_Missense_Mutation_p.Q645H	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	833						integral to membrane				ovary(3)	3						GCACCCAGCAGATACTGGAAG	0.572													19	6	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90502545	90502545	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90502545C>A	uc004app.3	+	4	3178	c.3143C>A	c.(3142-3144)ACC>AAC	p.T1048N		NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	1048						integral to membrane				ovary(3)	3						TGGGAAGTCACCTTGGGAGCC	0.602													50	10	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96407921	96407921	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96407921G>C	uc004aub.2	+	4	457	c.310G>C	c.(310-312)GTG>CTG	p.V104L	PHF2_uc011lug.1_5'UTR	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	104					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TGCTGAAGACGTGGTGGCCCG	0.647													47	17	---	---	---	---	PASS
OR13C9	286362	broad.mit.edu	37	9	107379788	107379788	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107379788C>A	uc011lvr.1	-	1	698	c.698G>T	c.(697-699)GGG>GTG	p.G233V		NM_001001956	NP_001001956	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTTGCTTCTCCCCTCAGAGGA	0.428													10	40	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107580940	107580940	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107580940T>C	uc004bcl.2	-							NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGACTGCAGCTCACCTTTTTC	0.517													45	10	---	---	---	---	PASS
FKTN	2218	broad.mit.edu	37	9	108366510	108366510	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108366510G>T	uc004bcr.2	+	6	600	c.384G>T	c.(382-384)CGG>CGT	p.R128R	FKTN_uc011lvx.1_Silent_p.R128R|FKTN_uc004bcs.2_Silent_p.R128R|FKTN_uc011lvy.1_Silent_p.R128R|FKTN_uc010mtm.2_5'UTR	NM_001079802	NP_001073270	O75072	FKTN_HUMAN	fukutin	128	Lumenal (Potential).				muscle organ development|negative regulation of cell proliferation|negative regulation of JNK cascade|nervous system development|regulation of protein glycosylation	cis-Golgi network|endoplasmic reticulum|extracellular space|Golgi membrane|integral to membrane|nucleus	transferase activity			breast(2)|ovary(1)	3						GCTGGTTTCGGATAGCTGAGA	0.408													40	15	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117103887	117103887	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117103887C>T	uc004biq.3	-	20	4128	c.3993G>A	c.(3991-3993)GCG>GCA	p.A1331A	AKNA_uc004bin.3_Silent_p.A578A|AKNA_uc004bio.3_Silent_p.A791A|AKNA_uc004bip.3_Silent_p.A1250A|AKNA_uc004bir.3_Silent_p.A1331A|AKNA_uc004bis.3_Silent_p.A1331A|AKNA_uc010mve.2_Silent_p.A1212A	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1331					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						GTGCTGGGGGCGCTGTTGCCA	0.617													13	39	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117846600	117846600	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117846600G>C	uc004bjj.3	-	4	2381	c.2019C>G	c.(2017-2019)GAC>GAG	p.D673E	TNC_uc010mvf.2_Missense_Mutation_p.D673E	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	673	Fibronectin type-III 1.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						TGGACGTCTGGTCCCCAGGCA	0.567													27	18	---	---	---	---	PASS
OR1L8	138881	broad.mit.edu	37	9	125330764	125330764	+	5'Flank	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125330764G>T	uc004bmp.1	-							NM_001004454	NP_001004454	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3						CATTGACTTGGGCTCAGTTAT	0.433													11	16	---	---	---	---	PASS
LHX2	9355	broad.mit.edu	37	9	126783547	126783547	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126783547C>G	uc004boe.1	+	4	1636	c.897C>G	c.(895-897)CTC>CTG	p.L299L	LHX2_uc010mwi.1_Silent_p.L307L	NM_004789	NP_004780	P50458	LHX2_HUMAN	LIM homeobox protein 2	299	Homeobox.					nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TGAAGCAGCTCGCGCAAAAGA	0.622													23	6	---	---	---	---	PASS
LMX1B	4010	broad.mit.edu	37	9	129458164	129458164	+	Silent	SNP	G	T	T	rs145052881	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129458164G>T	uc004bqj.2	+	7	914	c.864G>T	c.(862-864)CCG>CCT	p.P288P	LMX1B_uc004bqi.2_Silent_p.P288P|LMX1B_uc011maa.1_Silent_p.P299P	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	288					dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCTACACGCCGCTGGCCCCAC	0.677									Nail-Patella_Syndrome				23	6	---	---	---	---	PASS
FAM129B	64855	broad.mit.edu	37	9	130293981	130293981	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130293981C>T	uc004brh.2	-	2	334	c.132G>A	c.(130-132)ATG>ATA	p.M44I	FAM129B_uc004bri.2_Missense_Mutation_p.M31I|FAM129B_uc004brj.3_Missense_Mutation_p.M44I	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	44							protein binding				0						TCTCATGGCGCATGCTGTTGA	0.493													54	15	---	---	---	---	PASS
TBC1D13	54662	broad.mit.edu	37	9	131568188	131568188	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131568188G>T	uc010myj.2	+	10	1092	c.969G>T	c.(967-969)CTG>CTT	p.L323L	TBC1D13_uc010myk.2_Silent_p.L198L|TBC1D13_uc010myl.2_Silent_p.L142L	NM_018201	NP_060671	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	323	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0						GGCTGACACTGCTGCTGTCCC	0.607													16	8	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134351810	134351810	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134351810A>C	uc004can.3	+	15	4349	c.4294A>C	c.(4294-4296)AGC>CGC	p.S1432R	BAT2L1_uc010mzj.1_Missense_Mutation_p.S1015R|BAT2L1_uc004cao.3_Missense_Mutation_p.S790R	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1432							protein binding				0						TGACAGACAGAGCCGAAAGCT	0.607											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	PASS
GFI1B	8328	broad.mit.edu	37	9	135863634	135863634	+	Missense_Mutation	SNP	G	T	T	rs145562579		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135863634G>T	uc004ccg.2	+	4	440	c.289G>T	c.(289-291)GAC>TAC	p.D97Y	GFI1B_uc010mzy.2_Missense_Mutation_p.D97Y	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	97	Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		TCCACTGTCCGACTCACCCCC	0.587													20	24	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136259504	136259504	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136259504A>C	uc004cdk.2	+	8	731	c.670A>C	c.(670-672)ATT>CTT	p.I224L	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	224	Protein kinase.						ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGGCTGCATCATTCTGGACAT	0.587													9	76	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136305595	136305595	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136305595C>G	uc004cdv.3	+	16	2361	c.1917C>G	c.(1915-1917)CGC>CGG	p.R639R	ADAMTS13_uc004cdp.3_Missense_Mutation_p.A17G|ADAMTS13_uc004cdt.1_Silent_p.R639R|ADAMTS13_uc004cdu.1_Silent_p.R608R|ADAMTS13_uc004cdw.3_Silent_p.R639R|ADAMTS13_uc004cdx.3_Silent_p.R608R|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Silent_p.R309R|ADAMTS13_uc004cds.1_Silent_p.R164R|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	639	Spacer.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGCTGCCCCGCCTGGAGGAGA	0.647													6	19	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1421274	1421274	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1421274G>T	uc009xhq.2	-	2	556	c.182C>A	c.(181-183)ACC>AAC	p.T61N		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	61					mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CTTACTGAGGGTGTCGTCATC	0.512													26	6	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12046643	12046643	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12046643C>A	uc001ila.2	-	4	1864	c.1390G>T	c.(1390-1392)GCT>TCT	p.A464S	UPF2_uc001ilb.2_Missense_Mutation_p.A464S|UPF2_uc001ilc.2_Missense_Mutation_p.A464S|UPF2_uc009xiz.1_Missense_Mutation_p.A464S	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	464					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				AAATTCCGAGCATCTTCATCT	0.363													53	8	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	22002759	22002759	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22002759A>G	uc001iqs.2	+	15	2154	c.1806A>G	c.(1804-1806)GGA>GGG	p.G602G	MLLT10_uc001iqt.2_Silent_p.G586G|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Silent_p.G586G|MLLT10_uc001ira.2_Silent_p.G43G|MLLT10_uc001irb.2_RNA	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	602	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						CTGGCTCGGGATCTAGTACTC	0.433			T	MLL|PICALM|CDK6	AL								28	16	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23251018	23251018	+	Intron	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23251018T>G	uc001irm.3	+						ARMC3_uc010qcv.1_Intron|ARMC3_uc010qcw.1_Intron	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3								binding				0						GTATTTAGTTTCATTCATTCC	0.308													3	4	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26789940	26789940	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26789940C>A	uc001iss.2	+	5	674	c.353C>A	c.(352-354)GCC>GAC	p.A118D	APBB1IP_uc001isr.2_Missense_Mutation_p.A118D|APBB1IP_uc009xks.1_Missense_Mutation_p.A118D	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	118					blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						AATGTTGCTGCCACTGGTATC	0.488													102	28	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26789941	26789941	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26789941C>A	uc001iss.2	+	5	675	c.354C>A	c.(352-354)GCC>GCA	p.A118A	APBB1IP_uc001isr.2_Silent_p.A118A|APBB1IP_uc009xks.1_Silent_p.A118A	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	118					blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						ATGTTGCTGCCACTGGTATCA	0.488													99	28	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38344973	38344973	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38344973G>T	uc001izh.2	+	5	2096	c.1918G>T	c.(1918-1920)GAG>TAG	p.E640*	ZNF33A_uc001izg.2_Nonsense_Mutation_p.E641*|ZNF33A_uc010qev.1_Nonsense_Mutation_p.E647*|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	640	C2H2-type 12.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						TAAATGTAATGAGTGTGGAAA	0.378													36	25	---	---	---	---	PASS
ZNF488	118738	broad.mit.edu	37	10	48370984	48370984	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48370984G>T	uc001jex.2	+	2	614	c.452G>T	c.(451-453)TGG>TTG	p.W151L	ZNF488_uc001jey.2_Missense_Mutation_p.W44L	NM_153034	NP_694579	Q96MN9	ZN488_HUMAN	zinc finger protein 488	151					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTCTCTGTGTGGCCCAGCGGA	0.602													6	19	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50944083	50944083	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50944083G>T	uc001jie.2	-	22	3037	c.2895C>A	c.(2893-2895)CGC>CGA	p.R965R	OGDHL_uc009xog.2_Silent_p.R992R|OGDHL_uc010qgt.1_Silent_p.R908R|OGDHL_uc010qgu.1_Silent_p.R756R	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	965					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						TGGGCCGTGCGCGCCTCAGGA	0.607													11	20	---	---	---	---	PASS
ZWINT	11130	broad.mit.edu	37	10	58119771	58119771	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58119771C>A	uc001jjx.1	-						ZWINT_uc001jjy.1_Intron|ZWINT_uc001jka.1_Intron|ZWINT_uc009xoy.1_Intron	NM_007057	NP_008988	O95229	ZWINT_HUMAN	ZW10 interactor isoform a						cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding				0						AATCCCCTGCCTACTCACGGC	0.567													24	40	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68040354	68040354	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68040354C>A	uc009xpn.1	-	13	1881	c.1758G>T	c.(1756-1758)GTG>GTT	p.V586V	CTNNA3_uc001jmw.2_Silent_p.V586V	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	586					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AGGCAACATTCACTTGTGTTA	0.318													19	56	---	---	---	---	PASS
DNAJC12	56521	broad.mit.edu	37	10	69571261	69571261	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69571261C>T	uc001jnb.2	-						DNAJC12_uc001jnc.2_Silent_p.A106A	NM_021800	NP_068572	Q9UKB3	DJC12_HUMAN	J domain containing protein 1 isoform a						protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1						AAATTCACGTCGCACCCAGCG	0.502													23	39	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69881370	69881370	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69881370G>T	uc001jnm.3	+	3	360	c.175G>T	c.(175-177)GAC>TAC	p.D59Y	MYPN_uc001jnl.1_Missense_Mutation_p.D59Y|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.D59Y|MYPN_uc001jnp.1_Missense_Mutation_p.D59Y|MYPN_uc009xps.2_Missense_Mutation_p.D59Y|MYPN_uc009xpt.2_Missense_Mutation_p.D59Y|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	59	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AGGCCAAGATGACCTTCCAGA	0.532													30	40	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69908132	69908132	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69908132T>C	uc001jnm.3	+	6	1338	c.1153T>C	c.(1153-1155)TCA>CCA	p.S385P	MYPN_uc001jnl.1_Missense_Mutation_p.S385P|MYPN_uc001jnn.3_Missense_Mutation_p.S110P|MYPN_uc001jno.3_Missense_Mutation_p.S385P|MYPN_uc001jnp.1_Missense_Mutation_p.S385P|MYPN_uc009xps.2_Missense_Mutation_p.S385P|MYPN_uc009xpt.2_Missense_Mutation_p.S385P|MYPN_uc010qit.1_Missense_Mutation_p.S91P|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	385	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AAATGAGGTGTCATCTCCTCC	0.413													3	77	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70426853	70426853	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70426853C>T	uc001jok.3	+	7	5018	c.4513C>T	c.(4513-4515)CGT>TGT	p.R1505C		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1505					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding	p.R1505C(1)		ovary(5)|lung(2)|prostate(1)|breast(1)	9						GGTCCGGCAGCGTACAGGCCA	0.463													5	29	---	---	---	---	PASS
OPN4	94233	broad.mit.edu	37	10	88415908	88415908	+	Intron	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88415908G>C	uc001kdq.2	+						OPN4_uc001kdp.2_Intron|OPN4_uc010qmk.1_Intron	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1						phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						CTGTCTCTCCGCAGGCACCTG	0.378													25	32	---	---	---	---	PASS
PANK1	53354	broad.mit.edu	37	10	91353613	91353613	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91353613C>T	uc001kgp.1	-	4	1600	c.1444G>A	c.(1444-1446)GAC>AAC	p.D482N	PANK1_uc001kgn.1_Missense_Mutation_p.D257N|PANK1_uc001kgo.1_Intron|PANK1_uc009xtu.1_Missense_Mutation_p.D284N|uc001kgq.1_5'Flank|MIR107_hsa-mir-107|MI0000114_5'Flank	NM_148977	NP_683878	Q8TE04	PANK1_HUMAN	pantothenate kinase 1 isoform alpha	482					coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity				0					Bezafibrate(DB01393)	CGTTCATAGTCTCCTCCGTAA	0.468													6	116	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91497668	91497668	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91497668A>G	uc001kgs.1	+	20	3142	c.3070A>G	c.(3070-3072)ACA>GCA	p.T1024A	KIF20B_uc001kgr.1_Missense_Mutation_p.T984A|KIF20B_uc001kgt.1_Missense_Mutation_p.T235A|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1024					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						TTTGCCAAATACACAGTTAGA	0.348													43	80	---	---	---	---	PASS
HECTD2	143279	broad.mit.edu	37	10	93244288	93244288	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93244288A>G	uc001khl.2	+	9	946	c.846A>G	c.(844-846)CAA>CAG	p.Q282Q	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Silent_p.Q286Q|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'UTR|HECTD2_uc001khn.1_5'UTR	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	282					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						GGTTCAAACAATTGGTAGAGA	0.338													43	18	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95126238	95126238	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95126238G>A	uc001kin.2	-	26	2787	c.2664C>T	c.(2662-2664)GTC>GTT	p.V888V	MYOF_uc001kio.2_Silent_p.V875V|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	888	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TTTTTCCTGTGACATCAGAAA	0.378													34	66	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95126239	95126239	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95126239A>C	uc001kin.2	-	26	2786	c.2663T>G	c.(2662-2664)GTC>GGC	p.V888G	MYOF_uc001kio.2_Missense_Mutation_p.V875G|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	888	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TTTTCCTGTGACATCAGAAAA	0.373													33	66	---	---	---	---	PASS
PDE6C	5146	broad.mit.edu	37	10	95400666	95400666	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95400666T>C	uc001kiu.3	+							NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C						visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				ATATATATGTTATTTTTTTAG	0.383													6	20	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801850	120801850	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801850C>A	uc001ldu.2	-	19	3328	c.3182G>T	c.(3181-3183)CGT>CTT	p.R1061L	EIF3A_uc010qsu.1_Missense_Mutation_p.R1027L|EIF3A_uc009xzg.1_Missense_Mutation_p.R100L	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1061	14.|Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATCAGCATTACGCCAGGATGA	0.622													82	38	---	---	---	---	PASS
FOXI2	399823	broad.mit.edu	37	10	129537212	129537212	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129537212G>T	uc009yas.2	+	2	940	c.940G>T	c.(940-942)GAA>TAA	p.E314*	uc009yar.1_5'Flank	NM_207426	NP_997309	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	314					epidermal cell fate specification|otic placode formation|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				CTACAGCCGGGAAGGGACCGA	0.687													5	6	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135112951	135112951	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135112951T>A	uc001lmg.1	-	4	793	c.436A>T	c.(436-438)ACA>TCA	p.T146S	TUBGCP2_uc010qvc.1_Missense_Mutation_p.T146S|TUBGCP2_uc009ybk.1_Missense_Mutation_p.T146S|TUBGCP2_uc010qvd.1_Missense_Mutation_p.T16S|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	146					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GTGGAGCCTGTGGCCACGCTG	0.632													35	8	---	---	---	---	PASS
ECHS1	1892	broad.mit.edu	37	10	135179530	135179530	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135179530G>A	uc001lmu.2	-	6	760	c.689C>T	c.(688-690)GCC>GTC	p.A230V		NM_004092	NP_004083	P30084	ECHM_HUMAN	mitochondrial short-chain enoyl-coenzyme A	230					fatty acid beta-oxidation	mitochondrial matrix	enoyl-CoA hydratase activity|protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		AGAATTGCTGGCAATTTTTTC	0.473													18	86	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1016835A>T	uc001lsw.2	-	31	6017	c.5966T>A	c.(5965-5967)TTC>TAC	p.F1989Y		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1989	Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567													16	663	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1271328	1271328	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1271328C>A	uc009ycr.1	+	51	14763	c.14637C>A	c.(14635-14637)GGC>GGA	p.G4879G	MUC5B_uc001ltb.2_Silent_p.G4409G	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4406	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCCACTGGCCCCACGGCCA	0.657													27	11	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1271329	1271329	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1271329C>A	uc009ycr.1	+	51	14764	c.14638C>A	c.(14638-14640)CCC>ACC	p.P4880T	MUC5B_uc001ltb.2_Missense_Mutation_p.P4410T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4407	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCCACTGGCCCCACGGCCAC	0.657													25	11	---	---	---	---	PASS
TNNT3	7140	broad.mit.edu	37	11	1955670	1955670	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1955670G>C	uc001luu.3	+	12	687	c.475G>C	c.(475-477)GCC>CCC	p.A159P	TNNT3_uc001lun.2_Missense_Mutation_p.A55P|TNNT3_uc001luw.3_Missense_Mutation_p.A151P|TNNT3_uc001luo.3_Missense_Mutation_p.A151P|TNNT3_uc001lup.3_Missense_Mutation_p.A157P|TNNT3_uc001luq.3_Missense_Mutation_p.A151P|TNNT3_uc001lur.2_Missense_Mutation_p.A151P|TNNT3_uc010qxf.1_Missense_Mutation_p.A157P|TNNT3_uc010qxg.1_Missense_Mutation_p.A91P	NM_006757	NP_006748	P45378	TNNT3_HUMAN	troponin T3, skeletal, fast isoform 1	170					muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding			ovary(1)	1		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		CAGCTACCTGGCCAAGGTGTG	0.622													19	4	---	---	---	---	PASS
OR52B4	143496	broad.mit.edu	37	11	4388922	4388922	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4388922A>T	uc010qye.1	-	1	604	c.604T>A	c.(604-606)TTT>ATT	p.F202I		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAATGGAAAACCCATACCAA	0.383													37	11	---	---	---	---	PASS
OR52A5	390054	broad.mit.edu	37	11	5153566	5153566	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153566T>A	uc010qyx.1	-	1	307	c.307A>T	c.(307-309)ATG>TTG	p.M103L		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATAAGCCACATTTGAAAAAGA	0.453													24	7	---	---	---	---	PASS
OR51B5	282763	broad.mit.edu	37	11	5364332	5364332	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5364332C>A	uc001map.1	-	1	423	c.423G>T	c.(421-423)AAG>AAT	p.K141N	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Missense_Mutation_p.K141N	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,	141	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCAGCCCAATCTTCACTACTC	0.453													41	16	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809645	5809645	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809645A>T	uc010qzo.1	-	1	402	c.402T>A	c.(400-402)TAT>TAA	p.Y134*	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	134	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GGATGGTGGCATAACGCAGAG	0.527													43	10	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023520	6023520	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023520C>T	uc010qzv.1	-	1	859	c.859G>A	c.(859-861)GGT>AGT	p.G287S		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCACAGCACCCTCGGCCTTG	0.498													20	3	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048746	6048746	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048746G>T	uc010qzw.1	-	1	189	c.189C>A	c.(187-189)CAC>CAA	p.H63Q		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	63	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACAGGGGCTGGTGCAGAGAGG	0.607													39	9	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6645060	6645060	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6645060G>C	uc001mem.1	-	21	8257	c.7847C>G	c.(7846-7848)CCT>CGT	p.P2616R		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	2616	Cadherin 25.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCTCCAACAGGTGTGTCCTC	0.572													5	124	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6651120	6651120	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6651120C>A	uc001mem.1	-	11	5228	c.4818G>T	c.(4816-4818)CCG>CCT	p.P1606P		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1606	Cadherin 15.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGCGGTCCAACGGCCGCACCA	0.662													37	10	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6661977	6661977	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6661977C>A	uc001mem.1	-	2	1278	c.868G>T	c.(868-870)GTG>TTG	p.V290L		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	290	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCGTAAGTCACAGCCCCATTG	0.597													10	36	---	---	---	---	PASS
OR5P3	120066	broad.mit.edu	37	11	7847153	7847153	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7847153A>G	uc010rbg.1	-	1	367	c.367T>C	c.(367-369)TAT>CAT	p.Y123H		NM_153445	NP_703146	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATGGCCACATAGCGATCATAG	0.562													47	10	---	---	---	---	PASS
FAR1	84188	broad.mit.edu	37	11	13729621	13729621	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13729621T>C	uc001mld.2	+	4	695	c.540T>C	c.(538-540)TCT>TCC	p.S180S	FAR1_uc009ygp.2_Silent_p.S180S	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	180					ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						TGATTGATTCTTTAGAGTATG	0.264													34	17	---	---	---	---	PASS
PTPN5	84867	broad.mit.edu	37	11	18750578	18750578	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18750578C>T	uc001mpd.2	-						IGSF22_uc009yht.2_5'Flank|IGSF22_uc001mpa.2_5'Flank|PTPN5_uc001mpb.2_Intron|PTPN5_uc001mpc.2_Intron|PTPN5_uc001mpe.2_Intron|PTPN5_uc010rdj.1_Intron|PTPN5_uc001mpf.2_Intron|PTPN5_uc010rdk.1_Intron	NM_006906	NP_008837	P54829	PTN5_HUMAN	protein-tyrosine-phosphatase non-receptor 5							integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(2)	2						GCCGCCCCTGCCCGGCAGAGA	0.607													5	39	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19970369	19970369	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19970369C>T	uc010rdm.1	+	11	2818	c.2457C>T	c.(2455-2457)GAC>GAT	p.D819D	NAV2_uc001mpp.2_Silent_p.D732D|NAV2_uc001mpr.3_Silent_p.D796D	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	819						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						AAGCAGGAGACGCCCCCTCAA	0.617													5	39	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22391595	22391595	+	Missense_Mutation	SNP	C	A	A	rs142120566		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22391595C>A	uc001mqk.2	+	8	1315	c.902C>A	c.(901-903)ACT>AAT	p.T301N		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	301	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						AAATTCAAGACTCCATGGAGG	0.338													23	11	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22399182	22399182	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22399182C>T	uc001mqk.2	+	12	2058	c.1645C>T	c.(1645-1647)CAG>TAG	p.Q549*		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	549	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						TGCCACAACACAGGCCAATGG	0.393													26	5	---	---	---	---	PASS
FSHB	2488	broad.mit.edu	37	11	30253514	30253514	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30253514A>T	uc001msl.2	+	2	134	c.65A>T	c.(64-66)GAG>GTG	p.E22V	FSHB_uc001msm.2_Missense_Mutation_p.E22V|FSHB_uc001msn.2_Missense_Mutation_p.E22V	NM_000510	NP_000501	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	22					cellular nitrogen compound metabolic process|female gamete generation|female pregnancy|ovarian follicle development|peptide hormone processing|progesterone biosynthetic process|spermatogenesis|transforming growth factor beta receptor signaling pathway	cytoplasm|extracellular region|soluble fraction	follicle-stimulating hormone activity|protein heterodimerization activity			ovary(3)	3					Follitropin beta(DB00066)|Thyrotropin Alfa(DB00024)|Urofollitropin(DB00094)	AATAGCTGTGAGCTGACCAAC	0.458													47	12	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33620386	33620386	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33620386G>T	uc001mup.3	+	12	4023	c.3899G>T	c.(3898-3900)GGC>GTC	p.G1300V	C11orf41_uc001mun.1_3'UTR	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1294						integral to membrane				ovary(2)	2						AGTGAGAATGGCTCTGTCATC	0.522													18	10	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45274009	45274009	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45274009C>T	uc001myq.2	-	4	935	c.809G>A	c.(808-810)GGG>GAG	p.G270E	SYT13_uc009yku.1_Missense_Mutation_p.G126E	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	270	Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						CTGGGCAGCCCCTAGAGGCAC	0.642											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	15	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594910	55594910	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594910C>A	uc001nhy.1	+	1	216	c.216C>A	c.(214-216)TGC>TGA	p.C72*		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TAGATTTCTGCTACTCCTCAA	0.458										HNSCC(27;0.073)			118	30	---	---	---	---	PASS
OR8H3	390152	broad.mit.edu	37	11	55890494	55890494	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890494G>T	uc001nii.1	+	1	646	c.646G>T	c.(646-648)GCA>TCA	p.A216S		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					CACAATATCTGCATCCTATGT	0.438													87	27	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043882	56043882	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043882C>T	uc001nio.1	+	1	768	c.768C>T	c.(766-768)CAC>CAT	p.H256H		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					GTGGAGCTCACCTAACTGGAG	0.423													111	33	---	---	---	---	PASS
OR8K3	219473	broad.mit.edu	37	11	56086400	56086400	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56086400T>A	uc010rjf.1	+	1	618	c.618T>A	c.(616-618)GAT>GAA	p.D206E		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					CAGCTATTGATTTGATTTCAT	0.358													6	67	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58980283	58980283	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58980283G>C	uc001nnu.3	-	1	212	c.56C>G	c.(55-57)TCA>TGA	p.S19*		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	19						integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				AGGCTTGCCTGATTTAGCCCA	0.572													88	24	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59611377	59611377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59611377G>T	uc001noi.2	-	2	279	c.231C>A	c.(229-231)TAC>TAA	p.Y77*	GIF_uc010rkz.1_Nonsense_Mutation_p.Y77*	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	77					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						ACATGAGCTGGTAAGTCAGGA	0.537													15	7	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63059062	63059062	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63059062A>T	uc009yor.2	+	2	661	c.453A>T	c.(451-453)CTA>CTT	p.L151L	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Silent_p.L99L	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	151	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						TTCAATTCCTACTTCTGACTG	0.458													10	88	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63449137	63449137	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63449137C>T	uc001nxq.2	+	1	216	c.29C>T	c.(28-30)TCC>TTC	p.S10F	RTN3_uc001nxo.2_Missense_Mutation_p.S10F|RTN3_uc001nxm.2_Missense_Mutation_p.S10F|RTN3_uc001nxn.2_Missense_Mutation_p.S10F|RTN3_uc001nxp.2_Missense_Mutation_p.S10F|RTN3_uc009yov.2_Missense_Mutation_p.S10F|RTN3_uc010rmt.1_RNA|RTN3_uc010rmu.1_Missense_Mutation_p.S10F	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	10					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						GCCACTCAGTCCCATTCCATC	0.687													36	9	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64681895	64681895	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64681895G>A	uc001obx.2	-	2	364	c.249C>T	c.(247-249)GCC>GCT	p.A83A	ATG2A_uc010rnt.1_Silent_p.A83A	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	83							protein binding			ovary(1)|central_nervous_system(1)	2						CCCAGGGCACGGCCACCTCGA	0.652													5	5	---	---	---	---	PASS
ACY3	91703	broad.mit.edu	37	11	67410278	67410278	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67410278C>T	uc001omq.2	-	8	1048	c.877G>A	c.(877-879)GTT>ATT	p.V293I		NM_080658	NP_542389	Q96HD9	ACY3_HUMAN	aspartoacylase 3	293					interspecies interaction between organisms	apical plasma membrane|cytoplasm	hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)	ACAAAGGCAACGCCCTTCTCA	0.582													83	14	---	---	---	---	PASS
FOLR3	2352	broad.mit.edu	37	11	71850028	71850028	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71850028G>A	uc001ory.1	+	3	368	c.318G>A	c.(316-318)ATG>ATA	p.M106I	FOLR3_uc001orx.1_Missense_Mutation_p.A64T			P41439	FOLR3_HUMAN	SubName: Full=FOLR3 protein; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					folic acid transport	extracellular region|extrinsic to membrane|membrane fraction	folic acid binding|receptor activity				0					Folic Acid(DB00158)	GAAGAAGAATGCCTGCTGCAC	0.572													20	4	---	---	---	---	PASS
SERPINH1	871	broad.mit.edu	37	11	75282989	75282989	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75282989G>C	uc001owr.2	+	5	1347	c.1118G>C	c.(1117-1119)CGC>CCC	p.R373P	SERPINH1_uc009yug.2_Missense_Mutation_p.R373P|SERPINH1_uc001ows.2_Missense_Mutation_p.R373P|SERPINH1_uc001owt.2_Missense_Mutation_p.R156P	NM_001235	NP_001226	P50454	SERPH_HUMAN	serine (or cysteine) proteinase inhibitor, clade	373					regulation of proteolysis|response to unfolded protein	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	collagen binding|serine-type endopeptidase inhibitor activity			ovary(2)	2	Ovarian(111;0.11)					ATCTACGGGCGCGAGGAGCTG	0.607													20	2	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83962335	83962335	+	Splice_Site	SNP	C	A	A	rs147726548		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83962335C>A	uc001paj.2	-	3	508	c.205_splice	c.e3-1	p.A69_splice	DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Splice_Site_p.A36_splice|DLG2_uc010rsz.1_Splice_Site_p.A69_splice|DLG2_uc010rta.1_Splice_Site_p.A69_splice|DLG2_uc001pak.2_Splice_Site_p.A174_splice|DLG2_uc010rtb.1_Splice_Site_p.A36_splice|DLG2_uc001pal.1_Splice_Site_p.A69_splice|DLG2_uc001pam.1_Splice_Site_p.A108_splice	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CAGGACTGGCCTGAAAAAAGA	0.269													13	3	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89073306	89073306	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89073306T>C	uc001pct.2	-	15	1610	c.1371A>G	c.(1369-1371)CTA>CTG	p.L457L	NOX4_uc009yvr.2_Silent_p.L432L|NOX4_uc001pcu.2_Silent_p.L383L|NOX4_uc001pcw.2_Silent_p.L150L|NOX4_uc001pcx.2_Silent_p.L110L|NOX4_uc001pcv.2_Silent_p.L417L|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Silent_p.L291L|NOX4_uc009yvp.2_Silent_p.L221L|NOX4_uc010rtv.1_Silent_p.L393L|NOX4_uc009yvq.2_Silent_p.L433L	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	457	Cytoplasmic (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AAATAAAGTATAGTCTTCTAA	0.338													91	18	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93837756	93837756	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93837756G>A	uc001pep.2	+	16	2902	c.2745G>A	c.(2743-2745)AAG>AAA	p.K915K	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	915	Extracellular (Potential).|Plastocyanin-like 6.				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TGAATGAAAAGGGAAGAAGAA	0.348													35	14	---	---	---	---	PASS
SESN3	143686	broad.mit.edu	37	11	94924617	94924617	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94924617C>A	uc001pfk.1	-	3	515	c.293G>T	c.(292-294)CGC>CTC	p.R98L	SESN3_uc010rug.1_Missense_Mutation_p.R20L|SESN3_uc001pfl.2_Missense_Mutation_p.R98L	NM_144665	NP_653266	P58005	SESN3_HUMAN	sestrin 3	98					cell cycle arrest	nucleus					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		ACCATCCATGCGCAACATGTA	0.443													26	104	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99944961	99944961	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99944961C>T	uc001pga.2	+	13	1854	c.1515C>T	c.(1513-1515)CCC>CCT	p.P505P	CNTN5_uc009ywv.1_Silent_p.P505P|CNTN5_uc001pfz.2_Silent_p.P505P|CNTN5_uc001pgb.2_Silent_p.P431P	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	505	Ig-like C2-type 5.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGTGCAAACCCCAAGGCTCTC	0.358													13	3	---	---	---	---	PASS
ELMOD1	55531	broad.mit.edu	37	11	107501187	107501187	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107501187G>T	uc010rvs.1	+	3	466	c.62G>T	c.(61-63)TGG>TTG	p.W21L	ELMOD1_uc001pjm.2_Missense_Mutation_p.W21L|ELMOD1_uc010rvt.1_Missense_Mutation_p.W15L	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	21					phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AAATTTCTGTGGCGCTGCCTG	0.403													9	3	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119025544	119025544	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119025544C>A	uc001pvs.2	+	6	941	c.605C>A	c.(604-606)TCT>TAT	p.S202Y	ABCG4_uc009zar.2_Missense_Mutation_p.S202Y	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	202	Cytoplasmic (Potential).|ABC transporter.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GCCCTGCTCTCTGGCGGGCAG	0.622													64	13	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059486	119059486	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059486C>A	uc001pwb.2	+	7	1919	c.1395C>A	c.(1393-1395)TCC>TCA	p.S465S	PDZD3_uc001pvy.2_Silent_p.S385S|PDZD3_uc001pvz.2_Silent_p.S399S|PDZD3_uc010rzd.1_Silent_p.S386S|PDZD3_uc001pwa.2_Silent_p.S95S			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	465					cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CTCTTGGCTCCCGACAGTGCT	0.617													72	13	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134237152	134237152	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134237152G>C	uc001qhp.2	+	9	994	c.806G>C	c.(805-807)GGG>GCG	p.G269A	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	269					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GGTGTCCAGGGGACTCAGCCC	0.423													24	4	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2757671	2757671	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2757671A>T	uc009zdu.1	+	33	4400	c.4087A>T	c.(4087-4089)ATG>TTG	p.M1363L	CACNA1C_uc009zdv.1_Missense_Mutation_p.M1312L|CACNA1C_uc001qkb.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkc.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkd.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Missense_Mutation_p.M1315L|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Missense_Mutation_p.M1363L|CACNA1C_uc001qkn.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qko.2_Missense_Mutation_p.M1335L|CACNA1C_uc001qkp.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkq.2_Missense_Mutation_p.M1343L|CACNA1C_uc001qks.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qkt.2_Missense_Mutation_p.M1315L|CACNA1C_uc001qki.1_Missense_Mutation_p.M1051L|CACNA1C_uc001qkj.1_Missense_Mutation_p.M1051L|CACNA1C_uc001qkk.1_Missense_Mutation_p.M1051L|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1363	Extracellular (Potential).|IV.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CTCTCCCTCTATGGTAAGACC	0.552													34	6	---	---	---	---	PASS
EFCAB4B	84766	broad.mit.edu	37	12	3806145	3806145	+	Missense_Mutation	SNP	C	A	A	rs67819433		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3806145C>A	uc001qmj.2	-	4	593	c.21G>T	c.(19-21)AGG>AGT	p.R7S	EFCAB4B_uc010sen.1_Missense_Mutation_p.R7S|EFCAB4B_uc010seo.1_Missense_Mutation_p.R7S	NM_032680	NP_116069	Q9BSW2	EFC4B_HUMAN	EF-hand calcium binding domain 4B isoform c	7					activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TGGAGACTACCCTCCCGTCAG	0.572													11	4	---	---	---	---	PASS
SCNN1A	6337	broad.mit.edu	37	12	6483596	6483596	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6483596G>A	uc001qnx.2	-	2	643	c.354C>T	c.(352-354)ATC>ATT	p.I118I	SCNN1A_uc001qnw.2_Silent_p.I177I|SCNN1A_uc010sfb.1_Silent_p.I141I|LTBR_uc010sfc.1_5'Flank	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	118	Extracellular (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)	AGTTGAGGTTGATGTTGAGGC	0.582													11	25	---	---	---	---	PASS
CD4	920	broad.mit.edu	37	12	6927603	6927603	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6927603C>T	uc001qqv.1	+	8	1418	c.1173C>T	c.(1171-1173)TCC>TCT	p.S391S	CD4_uc010sfj.1_Silent_p.S118S|CD4_uc009zfc.1_Silent_p.S212S|CD4_uc010sfk.1_Silent_p.S118S|CD4_uc010sfl.1_Silent_p.S118S|CD4_uc010sfm.1_Silent_p.S118S	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	391	Extracellular (Potential).				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)				CCACATGGTCCACCCCGGTGC	0.637													16	65	---	---	---	---	PASS
GPR162	27239	broad.mit.edu	37	12	6933862	6933862	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6933862C>A	uc001qqw.1	+	2	1333	c.798C>A	c.(796-798)TCC>TCA	p.S266S	LEPREL2_uc001qqz.1_5'Flank|GPR162_uc010sfn.1_Silent_p.S266S|GPR162_uc001qqx.1_Intron|GPR162_uc009zfd.1_Intron|GPR162_uc001qqy.1_5'UTR	NM_019858	NP_062832	Q16538	GP162_HUMAN	G protein-coupled receptor 162 isoform 2	266	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CCAAGACATCCCTGCAGGTCA	0.607													33	26	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9242509	9242509	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9242509G>A	uc001qvk.1	-	21	2820	c.2707C>T	c.(2707-2709)CTG>TTG	p.L903L	A2M_uc009zgk.1_Silent_p.L753L	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	903					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TCAACCAACAGAGGCTTGATG	0.348													33	27	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9346700	9346700	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9346700A>T	uc001qvl.2	-	11	1256	c.1227T>A	c.(1225-1227)AGT>AGA	p.S409R	PZP_uc009zgl.2_Missense_Mutation_p.S278R	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						TAACCGAGATACTGGTAGTAT	0.373													48	58	---	---	---	---	PASS
KLRC4	8302	broad.mit.edu	37	12	10560282	10560282	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10560282C>A	uc001qye.2	-	4	629	c.447G>T	c.(445-447)GTG>GTT	p.V149V	KLRK1_uc001qyc.2_5'UTR|KLRK1_uc009zhk.2_5'UTR|KLRK1_uc001qyd.2_5'UTR	NM_013431	NP_038459	O43908	NKG2F_HUMAN	killer cell lectin-like receptor subfamily C,	149	Extracellular (Potential).				cellular defense response	integral to membrane	binding|receptor activity				0						TTCTTCGAAGCACAGGCCAGC	0.338													75	191	---	---	---	---	PASS
TAS2R9	50835	broad.mit.edu	37	12	10961936	10961936	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10961936C>A	uc001qyx.2	-	1	832	c.739G>T	c.(739-741)GTC>TTC	p.V247F	TAS2R8_uc010shh.1_5'Flank	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	247	Helical; Name=6; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1						ACAAGAAAGACTGGGTAGTAC	0.463													21	58	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18716391	18716391	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18716391C>A	uc001rdt.2	+	27	3854	c.3738C>A	c.(3736-3738)CAC>CAA	p.H1246Q	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.H1287Q|PIK3C2G_uc010sic.1_Missense_Mutation_p.H1065Q	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1246	PX.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				CAAAACTTCACAGCCAACTTC	0.408													28	8	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20769273	20769273	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20769273G>T	uc001reh.1	+	4	1401	c.1379G>T	c.(1378-1380)AGA>ATA	p.R460I		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	460					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	CCAGTACGGAGAGACCGCAGC	0.537													40	13	---	---	---	---	PASS
SSPN	8082	broad.mit.edu	37	12	26383792	26383792	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26383792T>A	uc001rhe.2	+	3	615	c.515T>A	c.(514-516)CTC>CAC	p.L172H	SSPN_uc001rhd.2_Missense_Mutation_p.L69H|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077	Q14714	SSPN_HUMAN	sarcospan isoform 1	172	Extracellular (Potential).				cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)					TCGGAGCCGCTCAGCAGGACC	0.537													50	14	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26809298	26809298	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26809298C>A	uc001rhg.2	-	19	2793	c.2376G>T	c.(2374-2376)CAG>CAT	p.Q792H		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	792	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CCACGGACTCCTGGGGATCCC	0.552													42	13	---	---	---	---	PASS
ALG10B	144245	broad.mit.edu	37	12	38714685	38714685	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38714685A>G	uc001rln.3	+	3	1231	c.1092A>G	c.(1090-1092)CAA>CAG	p.Q364Q	ALG10B_uc001rlo.3_Silent_p.Q334Q|ALG10B_uc010skk.1_Silent_p.Q304Q	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	364	Extracellular (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				GAGTTTTTCAAAGATATGCAA	0.308													73	53	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40715839	40715839	+	Missense_Mutation	SNP	C	G	G	rs11564176		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40715839C>G	uc001rmg.3	+	36	5294	c.5173C>G	c.(5173-5175)CGA>GGA	p.R1725G	LRRK2_uc009zjw.2_Missense_Mutation_p.R563G|LRRK2_uc001rmi.2_Missense_Mutation_p.R558G	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1725					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTTTTAGAACGAGCACTTCG	0.363													4	62	---	---	---	---	PASS
PRICKLE1	144165	broad.mit.edu	37	12	42864063	42864063	+	Silent	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42864063T>G	uc010skv.1	-	3	518	c.231A>C	c.(229-231)CCA>CCC	p.P77P	PRICKLE1_uc001rnl.2_Silent_p.P77P|PRICKLE1_uc010skw.1_Silent_p.P77P|PRICKLE1_uc001rnm.2_Silent_p.P77P|PRICKLE1_uc009zka.2_Silent_p.P73P	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	77	PET.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		TATCATGTGGTGGTAACTGGT	0.403													13	49	---	---	---	---	PASS
HDAC7	51564	broad.mit.edu	37	12	48185723	48185723	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48185723C>G	uc010slo.1	-	14	1938	c.1743G>C	c.(1741-1743)CCG>CCC	p.P581P	HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_Silent_p.P15P|HDAC7_uc001rqj.3_Silent_p.P544P|HDAC7_uc001rqk.3_Silent_p.P564P	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a	542	Histone deacetylase.|Transcription repression 2 (By similarity).				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		CGGCGTGCTCCGGGTGCCTGC	0.682													15	13	---	---	---	---	PASS
ANP32D	23519	broad.mit.edu	37	12	48866596	48866596	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48866596T>C	uc010slt.1	+	1	149	c.149T>C	c.(148-150)ATC>ACC	p.I50T		NM_012404	NP_036536	O95626	AN32D_HUMAN	acidic nuclear phosphoprotein 32D	50	LRR 2.									ovary(1)|central_nervous_system(1)	2						TTAAATACAATCAACATAGGC	0.393													9	102	---	---	---	---	PASS
WNT10B	7480	broad.mit.edu	37	12	49364267	49364267	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49364267C>T	uc001rss.2	-	2	392	c.46G>A	c.(46-48)GGT>AGT	p.G16S	WNT10B_uc001rst.2_Missense_Mutation_p.G16S	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	16					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						AACAGGAGACCCGCGAGGCCC	0.687													7	2	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49723186	49723186	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49723186G>T	uc001rtx.3	+	11	1280	c.1113G>T	c.(1111-1113)TGG>TGT	p.W371C	TROAP_uc009zlh.2_Missense_Mutation_p.W371C|TROAP_uc001rty.2_Missense_Mutation_p.W79C	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	371					cell adhesion	cytoplasm				ovary(1)	1						AGGCCCAGTGGCTGCGTGGTG	0.592													11	40	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52200923	52200923	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52200923C>A	uc001ryw.2	+	27	5831	c.5653C>A	c.(5653-5655)CCA>ACA	p.P1885T	uc001rzb.1_5'Flank	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1885					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	GTCTTACGAGCCAATCACAAC	0.587													33	147	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52201149	52201149	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52201149G>C	uc001ryw.2	+	27	6057	c.5879G>C	c.(5878-5880)CGG>CCG	p.R1960P	uc001rzb.1_5'Flank	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1960					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	AAACAGCAGCGGGCAGAGGAA	0.448													4	7	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52774941	52774941	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52774941T>A	uc001sah.1	-	6	1174	c.1126A>T	c.(1126-1128)AAC>TAC	p.N376Y		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	376	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TTCCGTATGTTGCGCAGGTTG	0.542													104	57	---	---	---	---	PASS
KRT73	319101	broad.mit.edu	37	12	53004594	53004594	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53004594G>T	uc001sas.2	-	7	1171	c.1136C>A	c.(1135-1137)GCT>GAT	p.A379D		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	379	Rod.|Coil 2.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCGGCGTCAGCGATGGCCGT	0.652													32	13	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53671296	53671296	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53671296G>T	uc001sck.2	+	10	2219	c.2128G>T	c.(2128-2130)GAG>TAG	p.E710*	ESPL1_uc001scj.2_Nonsense_Mutation_p.E385*|ESPL1_uc010soe.1_5'Flank	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	710					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						TGGTAACTTGGAGGAATTTGA	0.413													5	35	---	---	---	---	PASS
ATP5G2	517	broad.mit.edu	37	12	54059154	54059154	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54059154C>G	uc009znc.2	-	6	1071	c.370G>C	c.(370-372)GAG>CAG	p.E124Q	ATP5G2_uc001sec.2_Missense_Mutation_p.E181Q|ATP5G2_uc001sed.2_Missense_Mutation_p.E140Q	NM_001002031	NP_001002031	Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	124	Helical; (Potential).	Reversibly protonated during proton transport (By similarity).			ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding			ovary(1)	1						CCCATGGCCTCCGAGAGGGCA	0.522													5	34	---	---	---	---	PASS
KIAA0748	9840	broad.mit.edu	37	12	55357522	55357522	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55357522T>C	uc001sgn.3	-						KIAA0748_uc001sgl.3_Intron|KIAA0748_uc001sgm.3_Intron|KIAA0748_uc010spb.1_Intron|KIAA0748_uc010spc.1_Intron|KIAA0748_uc010spd.1_Intron|KIAA0748_uc001sgo.3_Intron	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840											ovary(1)|central_nervous_system(1)	2						GGAGGGACACTCACTGGCCAG	0.527													5	13	---	---	---	---	PASS
INHBC	3626	broad.mit.edu	37	12	57843589	57843589	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57843589A>G	uc001snv.1	+	2	970	c.843A>G	c.(841-843)CCA>CCG	p.P281P		NM_005538	NP_005529	P55103	INHBC_HUMAN	inhibin beta C chain preproprotein	281					growth	extracellular region	growth factor activity|hormone activity|transforming growth factor beta receptor binding				0						GGCAGTGCCCACTACACATAG	0.552													7	28	---	---	---	---	PASS
ARHGAP9	64333	broad.mit.edu	37	12	57868736	57868736	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57868736A>T	uc001sod.2	-	16	2036	c.1843T>A	c.(1843-1845)TTG>ATG	p.L615M	ARHGAP9_uc001sny.2_RNA|ARHGAP9_uc001snz.2_Missense_Mutation_p.L341M|ARHGAP9_uc001soa.2_Missense_Mutation_p.L214M|ARHGAP9_uc001sob.2_Missense_Mutation_p.L525M|ARHGAP9_uc001soc.2_Missense_Mutation_p.L525M|ARHGAP9_uc001soe.1_Missense_Mutation_p.L604M	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	544	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)			AGTGATTCCAACTGGCAGCCG	0.547													21	14	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66700232	66700232	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66700232G>T	uc001sti.2	+	3	743	c.715G>T	c.(715-717)GAG>TAG	p.E239*	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	239					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AGGTTCTAAAGAGATGTTGAA	0.363													21	64	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78583938	78583938	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78583938C>T	uc001syp.2	+	34	6403	c.6230C>T	c.(6229-6231)TCT>TTT	p.S2077F	NAV3_uc001syo.2_Missense_Mutation_p.S2055F|NAV3_uc010sub.1_Missense_Mutation_p.S1534F|NAV3_uc009zsf.2_Missense_Mutation_p.S886F	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2077						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						ATAACCAAATCTGGAAGGAAA	0.373										HNSCC(70;0.22)			7	34	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78593258	78593258	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78593258G>T	uc001syp.2	+	37	6835	c.6662G>T	c.(6661-6663)TGG>TTG	p.W2221L	NAV3_uc001syo.2_Missense_Mutation_p.W2199L|NAV3_uc010sub.1_Missense_Mutation_p.W1678L|NAV3_uc009zsf.2_Missense_Mutation_p.W1030L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2221						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CCGAAGACGTGGCATCATCTC	0.363										HNSCC(70;0.22)			43	38	---	---	---	---	PASS
MYF5	4617	broad.mit.edu	37	12	81111114	81111114	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81111114G>A	uc001szg.2	+	1	407	c.272G>A	c.(271-273)CGC>CAC	p.R91H		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	91	Basic motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						GCCACTATGCGCGAGCGGAGG	0.617													11	44	---	---	---	---	PASS
NTS	4922	broad.mit.edu	37	12	86272298	86272298	+	Missense_Mutation	SNP	T	C	C	rs141571076		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86272298T>C	uc001tag.2	+	3	418	c.311T>C	c.(310-312)ATA>ACA	p.I104T		NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein	104					regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						ATGTTGACAATATACCAGCTC	0.398													29	71	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88554483	88554483	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88554483G>T	uc001tau.2	+	6	872	c.652G>T	c.(652-654)GCT>TCT	p.A218S	TMTC3_uc009zsm.2_RNA	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	218						integral to membrane	binding			skin(1)	1						ATGTACTACTGCTGGACAGTT	0.338													21	73	---	---	---	---	PASS
CLLU1OS	574016	broad.mit.edu	37	12	92821902	92821902	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92821902G>T	uc001tcb.1	-	1	23	c.21C>A	c.(19-21)AAC>AAA	p.N7K	CLLU1_uc001tcc.2_Intron|CLLU1_uc001tcd.2_Intron|CLLU1_uc001tce.1_Intron|CLLU1_uc001tcf.2_Intron	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	7											0						ccttaagttcgttgtgcccca	0.060													12	62	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100451504	100451504	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100451504C>A	uc001tgq.2	-	15	3498	c.3269G>T	c.(3268-3270)TGC>TTC	p.C1090F	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.C740F	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1090										ovary(2)	2						GTTGGGTGGGCAACGTTCCTT	0.318													8	26	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101552093	101552093	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101552093C>A	uc001thz.3	-	14	2034	c.1644G>T	c.(1642-1644)CAG>CAT	p.Q548H		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	548	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						GGTCTAAGTTCTGTTTTCTTC	0.333													26	79	---	---	---	---	PASS
SPIC	121599	broad.mit.edu	37	12	101876641	101876641	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101876641G>T	uc001tid.2	+	5	441	c.282G>T	c.(280-282)CTG>CTT	p.L94L	SPIC_uc009zua.2_5'UTR|SPIC_uc010svp.1_Silent_p.L93L	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	94						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						AAAACCAGCTGGTACAACCCA	0.358													33	130	---	---	---	---	PASS
PMCH	5367	broad.mit.edu	37	12	102591330	102591330	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102591330G>T	uc001tjl.2	-	1	285	c.219C>A	c.(217-219)TTC>TTA	p.F73L		NM_002674	NP_002665	P20382	MCH_HUMAN	pro-melanin-concentrating hormone	73					cell differentiation|neuropeptide signaling pathway|spermatogenesis|synaptic transmission		melanin-concentrating hormone activity				0						CTTCGTTCATGAAACTGCTCT	0.348													17	68	---	---	---	---	PASS
C12orf42	374470	broad.mit.edu	37	12	103700042	103700042	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103700042A>T	uc001tjt.2	-	5	429	c.341T>A	c.(340-342)GTA>GAA	p.V114E	C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Missense_Mutation_p.V114E|C12orf42_uc001tju.2_Missense_Mutation_p.V19E	NM_198521	NP_940923	Q96LP6	CL042_HUMAN	hypothetical protein LOC374470	114										ovary(1)|central_nervous_system(1)	2						AACTGTGCTTACAGAACACCT	0.408													8	21	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104376979	104376979	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104376979C>A	uc001tkg.2	+	6	903	c.680C>A	c.(679-681)GCA>GAA	p.A227E	TDG_uc009zuk.2_Missense_Mutation_p.A223E|TDG_uc010swi.1_Missense_Mutation_p.A84E|TDG_uc010swj.1_Intron	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	227					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CCACGAATAGCAGTGTTTAAT	0.249								BER_DNA_glycosylases					53	170	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109696829	109696829	+	Missense_Mutation	SNP	G	T	T	rs145553418		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109696829G>T	uc001tob.2	+	47	6531	c.6412G>T	c.(6412-6414)GCC>TCC	p.A2138S	ACACB_uc001toc.2_Missense_Mutation_p.A2138S|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.A804S	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	2138	Carboxyltransferase.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CTACAAAACCGCCCAGGCCGT	0.572													85	101	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109835560	109835560	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109835560C>A	uc010sxn.1	+	4	465	c.465C>A	c.(463-465)CTC>CTA	p.L155L		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						CCAGAACGCTCCGGAATGACA	0.378													15	24	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113314509	113314509	+	Missense_Mutation	SNP	G	A	A	rs144497607	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113314509G>A	uc010syl.1	+	13	1371	c.1009G>A	c.(1009-1011)GGG>AGG	p.G337R	RPH3A_uc001ttz.2_Missense_Mutation_p.G337R|RPH3A_uc001tty.2_Missense_Mutation_p.G333R|RPH3A_uc009zwe.1_Missense_Mutation_p.G333R|RPH3A_uc010sym.1_Missense_Mutation_p.G288R|RPH3A_uc001tua.2_Missense_Mutation_p.G97R	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	337	Pro-rich.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGGGGGAGTCGGGGGCTACCC	0.652													7	27	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114803917	114803917	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114803917G>T	uc001tvo.2	-						TBX5_uc001tvp.2_Intron|TBX5_uc001tvq.2_Intron|TBX5_uc010syv.1_Silent_p.S345S	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1						cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CCCAACCCAAGGAAAGGAAAA	0.378													10	24	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114803918	114803918	+	Intron	SNP	G	T	T	rs139154253	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114803918G>T	uc001tvo.2	-						TBX5_uc001tvp.2_Intron|TBX5_uc001tvq.2_Intron|TBX5_uc010syv.1_Missense_Mutation_p.S345Y	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1						cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CCAACCCAAGGAAAGGAAAAG	0.378													10	23	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114836486	114836486	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114836486G>T	uc001tvo.2	-	5	897	c.402C>A	c.(400-402)CGC>CGA	p.R134R	TBX5_uc001tvp.2_Silent_p.R134R|TBX5_uc001tvq.2_Silent_p.R84R|TBX5_uc010syv.1_Silent_p.R134R	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	134	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCACGTACAGGCGGCCAGGCA	0.617													6	15	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117726024	117726024	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117726024C>T	uc001twm.1	-	5	1668	c.982G>A	c.(982-984)GAA>AAA	p.E328K		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	328					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CATCCCGTTTCCTGGAAGATC	0.507													21	54	---	---	---	---	PASS
ORAI1	84876	broad.mit.edu	37	12	122079195	122079195	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122079195G>A	uc010szz.1	+	3	745	c.552G>A	c.(550-552)ACG>ACA	p.T184T		NM_032790	NP_116179	Q96D31	CRCM1_HUMAN	calcium release-activated calcium channel	184	Helical; (Potential).				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		TCATCGGCACGCTGCTCTTCC	0.632													7	41	---	---	---	---	PASS
MPHOSPH9	10198	broad.mit.edu	37	12	123687432	123687432	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123687432G>A	uc001uel.2	-	6	1171	c.1064C>T	c.(1063-1065)CCA>CTA	p.P355L	MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	355					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GGGATATTTTGGAAATCCAGG	0.428													67	70	---	---	---	---	PASS
MPHOSPH9	10198	broad.mit.edu	37	12	123687514	123687514	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123687514G>A	uc001uel.2	-	6	1089	c.982C>T	c.(982-984)CTA>TTA	p.L328L	MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	328					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		CTAGGCTCTAGAACAGAGTCC	0.448													42	86	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130648664	130648664	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130648664G>T	uc001uii.2	+	1	1633	c.1177G>T	c.(1177-1179)GCG>TCG	p.A393S	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	393	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GGACGTCAACGCGCTCACCGG	0.657													37	30	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20024413	20024413	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20024413G>T	uc001umd.2	-	13	1085	c.874C>A	c.(874-876)CCC>ACC	p.P292T	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.P181T|TPTE2_uc001ume.2_Missense_Mutation_p.P215T|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	292	Phosphatase tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TGTAGAGTGGGGACATTATGA	0.294													26	26	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25448297	25448297	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25448297C>A	uc001upr.2	+	33	4534	c.4493C>A	c.(4492-4494)GCG>GAG	p.A1498E	RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.A1494E|RNF17_uc001ups.2_Missense_Mutation_p.A1437E|RNF17_uc010aac.2_Missense_Mutation_p.A690E|RNF17_uc010aad.2_Missense_Mutation_p.A508E	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1498	Tudor 4.				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TGGTATAGAGCGAAGATTGTT	0.299													20	20	---	---	---	---	PASS
STARD13	90627	broad.mit.edu	37	13	33704176	33704176	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33704176C>A	uc001uuw.2	-	5	764	c.638G>T	c.(637-639)GGC>GTC	p.G213V	STARD13_uc001uuu.2_Missense_Mutation_p.G205V|STARD13_uc001uuv.2_Missense_Mutation_p.G95V|STARD13_uc001uux.2_Missense_Mutation_p.G178V|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.G198V	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	213					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ACAGCACTGGCCCGGCTGGCT	0.637													14	9	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39597192	39597192	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39597192G>A	uc001uwy.2	-	8	1513	c.640C>T	c.(640-642)CCA>TCA	p.P214S	C13orf23_uc001uwz.2_Missense_Mutation_p.P192S	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1	214	Pro-rich.									ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		TCCTTACTTGGTGCAATAGTT	0.368													30	12	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46946479	46946479	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46946479G>C	uc010acl.2	-	3	737	c.132C>G	c.(130-132)ATC>ATG	p.I44M	C13orf18_uc001vbf.3_Intron|C13orf18_uc001vbg.3_Translation_Start_Site|C13orf18_uc010tfz.1_Intron|C13orf18_uc010acm.2_Intron|C13orf18_uc010acn.2_Intron|C13orf18_uc001vbe.3_Missense_Mutation_p.I44M|C13orf18_uc001vbh.3_Missense_Mutation_p.I44M|C13orf18_uc001vbi.3_Intron|C13orf18_uc010aco.1_Missense_Mutation_p.I44M|C13orf18_uc010tga.1_Intron	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	44											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		TCATGAGCCTGATGTCTAATT	0.552													11	3	---	---	---	---	PASS
RCBTB1	55213	broad.mit.edu	37	13	50123776	50123776	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50123776T>A	uc001vde.1	-	9	1124	c.863A>T	c.(862-864)GAG>GTG	p.E288V		NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and	288	RCC1 5.				cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GGCTGCAATCTCTACCACCCT	0.517													21	8	---	---	---	---	PASS
PCDH8	5100	broad.mit.edu	37	13	53419552	53419552	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53419552G>A	uc001vhi.2	-						PCDH8_uc001vhj.2_Intron	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor						cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GGAAAGAAGAGTCCTCACCAC	0.552													12	9	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70370953	70370953	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70370953G>T	uc001vip.2	-	7	2350	c.1556C>A	c.(1555-1557)ACA>AAA	p.T519K	KLHL1_uc010thm.1_Missense_Mutation_p.T458K	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	519	Kelch 2.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AGTGTTCAATGTCTTTAAGCC	0.423													37	17	---	---	---	---	PASS
PIBF1	10464	broad.mit.edu	37	13	73428239	73428239	+	Missense_Mutation	SNP	G	A	A	rs141453174	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73428239G>A	uc001vjc.2	+	10	1573	c.1268G>A	c.(1267-1269)CGA>CAA	p.R423Q	PIBF1_uc001vja.1_Missense_Mutation_p.R423Q|PIBF1_uc010aeo.1_RNA|PIBF1_uc001vjb.2_Missense_Mutation_p.R423Q|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	423						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		GAAAAGGAACGAGCAGTGATG	0.343													13	23	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101768836	101768836	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101768836A>T	uc001vox.1	-							NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AAACACCACTAGTTGTTTATA	0.373													7	1	---	---	---	---	PASS
ITGBL1	9358	broad.mit.edu	37	13	102366859	102366859	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102366859G>A	uc001vpb.2	+	10	1570	c.1351G>A	c.(1351-1353)GAT>AAT	p.D451N	ITGBL1_uc010agb.2_Missense_Mutation_p.D402N|ITGBL1_uc001vpc.3_Missense_Mutation_p.D310N	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat	451	IX.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGTGACTGTGATGACAGAGA	0.408													49	25	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103288052	103288052	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103288052G>T	uc001vpi.3	+	12	1612	c.1509G>T	c.(1507-1509)CAG>CAT	p.Q503H		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	503					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTATTATTCAGGTATTGTTGC	0.323													13	8	---	---	---	---	PASS
ARHGEF7	8874	broad.mit.edu	37	13	111932896	111932896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111932896G>T	uc001vrs.2	+	16	1910	c.1660G>T	c.(1660-1662)GAG>TAG	p.E554*	ARHGEF7_uc001vrr.2_Nonsense_Mutation_p.E533*|ARHGEF7_uc001vrt.2_Nonsense_Mutation_p.E504*|ARHGEF7_uc010tjn.1_RNA|ARHGEF7_uc001vru.1_Nonsense_Mutation_p.E376*|ARHGEF7_uc001vrv.3_Nonsense_Mutation_p.E376*|ARHGEF7_uc001vrw.3_Nonsense_Mutation_p.E376*|ARHGEF7_uc001vrx.3_Nonsense_Mutation_p.E376*|ARHGEF7_uc010tjo.1_Nonsense_Mutation_p.E451*|ARHGEF7_uc010tjp.1_Nonsense_Mutation_p.E298*|ARHGEF7_uc001vry.1_5'Flank	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c	554	PH.				apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GAGCATGATTGAGCGGATATT	0.512													33	55	---	---	---	---	PASS
GRK1	6011	broad.mit.edu	37	13	114325953	114325953	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114325953G>T	uc010tkf.1	+	3	1075	c.967G>T	c.(967-969)GTG>TTG	p.V323L		NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase precursor	323	Protein kinase.				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			GCCCGAGAACGTGCTGCTGGA	0.473													4	8	---	---	---	---	PASS
OSGEP	55644	broad.mit.edu	37	14	20916116	20916116	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20916116C>T	uc001vxf.2	-	8	1096	c.740G>A	c.(739-741)CGA>CAA	p.R247Q		NM_017807	NP_060277	Q9NPF4	OSGEP_HUMAN	O-sialoglycoprotein endopeptidase	247					proteolysis|tRNA processing		metal ion binding|metalloendopeptidase activity|protein binding				0	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		TGCCATGGCTCGCTCTGTGAT	0.458													11	32	---	---	---	---	PASS
RNASE2	6036	broad.mit.edu	37	14	21424307	21424307	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21424307C>A	uc010aif.2	+	2	446	c.377C>A	c.(376-378)GCG>GAG	p.A126E	RNASE2_uc001vyl.1_Missense_Mutation_p.A126E	NM_002934	NP_002925	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver,	126					chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		TGCAGGTATGCGCAGACACCA	0.458													44	14	---	---	---	---	PASS
RNF31	55072	broad.mit.edu	37	14	24624472	24624472	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24624472C>T	uc001wmn.1	+	12	2486	c.2237C>T	c.(2236-2238)GCC>GTC	p.A746V	RNF31_uc001wml.1_Missense_Mutation_p.A595V|RNF31_uc001wmm.1_RNA|RNF31_uc010alg.1_Missense_Mutation_p.A505V|RNF31_uc001wmo.1_Missense_Mutation_p.A213V|RNF31_uc001wmp.2_RNA|RNF31_uc010alh.1_5'Flank	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	746	RING-type; degenerate.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		GTGTGCCCTGCCTGTGGCCGC	0.582													35	25	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33292105	33292105	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292105G>T	uc001wrq.2	+	13	5256	c.5086G>T	c.(5086-5088)GAG>TAG	p.E1696*		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1696	Ser-rich.				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CAGCAGTGACGAGCTCTCTCT	0.458													19	47	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36039857	36039857	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36039857C>T	uc001wti.2	-	38	6335	c.5944G>A	c.(5944-5946)GCT>ACT	p.A1982T	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.A1982T|RALGAPA1_uc010tpv.1_Missense_Mutation_p.A1995T|RALGAPA1_uc010tpw.1_Missense_Mutation_p.A2029T	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1982	Minimal domain that binds to TCF3/E12 (By similarity).|Rap-GAP.				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						GATTTCAGAGCACGGCTTGCA	0.368													8	28	---	---	---	---	PASS
MIPOL1	145282	broad.mit.edu	37	14	37969326	37969326	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37969326C>A	uc001wuc.2	+	13	1748	c.1245C>A	c.(1243-1245)GCC>GCA	p.A415A	MIPOL1_uc010amr.2_RNA|MIPOL1_uc001wub.3_Silent_p.A384A|MIPOL1_uc001wud.2_Silent_p.A415A|MIPOL1_uc010ams.2_Silent_p.A415A|MIPOL1_uc001wue.2_Silent_p.A384A|MIPOL1_uc010amt.2_Silent_p.A234A	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	415	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		CCCAAGTGGCCAATGAAAAAG	0.363													19	30	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47351344	47351344	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47351344C>A	uc001wwj.3	-	11	2308	c.2112G>T	c.(2110-2112)TTG>TTT	p.L704F	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.L475F|MDGA2_uc010ani.2_Missense_Mutation_p.L264F	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	704					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TTAGCTCTGTCAAGTTATATG	0.373													12	18	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47426788	47426788	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47426788G>T	uc001wwj.3	-	9	1867	c.1671C>A	c.(1669-1671)GTC>GTA	p.V557V	MDGA2_uc001wwi.3_Silent_p.V328V|MDGA2_uc010ani.2_Silent_p.V117V	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	557	Ig-like 6.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						AACTCATAGTGACACTTCGAT	0.458													19	47	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50597419	50597419	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50597419C>T	uc001wxs.3	-	20	3235	c.3137G>A	c.(3136-3138)GGC>GAC	p.G1046D	SOS2_uc010ans.2_5'UTR|SOS2_uc010tql.1_Missense_Mutation_p.G1013D	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	1046					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					TGAGGTAGAGCCATGTCGGCC	0.398													28	41	---	---	---	---	PASS
PYGL	5836	broad.mit.edu	37	14	51398395	51398395	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51398395C>A	uc001wyu.2	-	4	651	c.524G>T	c.(523-525)TGG>TTG	p.W175L	PYGL_uc010tqq.1_Missense_Mutation_p.W141L|PYGL_uc001wyv.2_5'UTR|PYGL_uc001wyw.3_Missense_Mutation_p.W175L	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1	175					glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	ACACACCTGCCATCCATCTCG	0.423													16	44	---	---	---	---	PASS
PELI2	57161	broad.mit.edu	37	14	56763638	56763638	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56763638G>T	uc001xch.2	+	6	1303	c.1017G>T	c.(1015-1017)AGG>AGT	p.R339S		NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2	339					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1						CCATGTGCAGGACTGTGGGCC	0.592													35	41	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112968	59112968	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112968G>T	uc001xdw.2	+	4	1791	c.1627G>T	c.(1627-1629)GAG>TAG	p.E543*	DACT1_uc010trv.1_Nonsense_Mutation_p.E262*|DACT1_uc001xdx.2_Nonsense_Mutation_p.E506*|DACT1_uc010trw.1_Nonsense_Mutation_p.E262*	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	543					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						TTTCAAGAGCGAGGGCTCTTC	0.627													37	34	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59113532	59113532	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59113532G>T	uc001xdw.2	+	4	2355	c.2191G>T	c.(2191-2193)GAG>TAG	p.E731*	DACT1_uc010trv.1_Nonsense_Mutation_p.E450*|DACT1_uc001xdx.2_Nonsense_Mutation_p.E694*|DACT1_uc010trw.1_Nonsense_Mutation_p.E450*	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	731					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						GGCCGAGTGCGAGTCCCTGTT	0.647													21	40	---	---	---	---	PASS
KIAA0317	9870	broad.mit.edu	37	14	75134184	75134184	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75134184C>A	uc001xqb.2	-	16	2533	c.2028G>T	c.(2026-2028)GTG>GTT	p.V676V	KIAA0317_uc010tut.1_Silent_p.V515V	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870	676	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		GGAAATGTTCCACCTCCTCTT	0.428													30	17	---	---	---	---	PASS
FCF1	51077	broad.mit.edu	37	14	75181615	75181615	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75181615A>G	uc001xqh.2	+	3	163	c.112A>G	c.(112-114)AAG>GAG	p.K38E	KIAA0317_uc001xqb.2_5'Flank|KIAA0317_uc010tut.1_5'Flank|KIAA0317_uc001xqc.2_5'Flank|KIAA0317_uc001xqd.1_5'Flank|FCF1_uc001xqe.1_RNA|FCF1_uc001xqf.1_Missense_Mutation_p.K23E|FCF1_uc001xqg.2_RNA|FCF1_uc001xqi.2_RNA	NM_015962	NP_057046	Q9Y324	FCF1_HUMAN	FCF1 small subunit	38					rRNA processing	nucleolus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0037)		GAAAGAAAAGAAGGATCCCAG	0.338													6	8	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75265978	75265978	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75265978G>T	uc001xqj.3	+	5	4102	c.3978G>T	c.(3976-3978)CGG>CGT	p.R1326R	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	1131	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TTCGTGAACGGGATATTCCAT	0.438													25	41	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75284933	75284933	+	Splice_Site	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75284933G>A	uc001xqj.3	+	16	6071	c.5947_splice	c.e16-1	p.M1983_splice	YLPM1_uc001xql.3_Splice_Site|YLPM1_uc001xqm.1_Splice_Site_p.M466_splice	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TTTTTCAATAGATGGCTGATC	0.358													11	6	---	---	---	---	PASS
GSTZ1	2954	broad.mit.edu	37	14	77791264	77791264	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77791264G>T	uc001xtj.2	+	2	349	c.67G>T	c.(67-69)GCT>TCT	p.A23S	GSTZ1_uc001xtk.2_Missense_Mutation_p.A23S|GSTZ1_uc010ass.2_5'UTR|GSTZ1_uc001xtm.2_5'UTR	NM_145870	NP_665877	O43708	MAAI_HUMAN	glutathione transferase zeta 1 isoform 1	23	GST N-terminal.				glutathione metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol|mitochondrion	glutathione peroxidase activity|glutathione transferase activity|maleylacetoacetate isomerase activity|protein homodimerization activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Glutathione(DB00143)	AGTTCGAATTGGTAAGAGATG	0.572													29	24	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81251450	81251450	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81251450T>A	uc001xux.2	-	14	2171	c.2000A>T	c.(1999-2001)GAC>GTC	p.D667V	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	667	Potential.					centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGCAGTGAGGTCAGAAAGGTC	0.478													50	85	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92470935	92470935	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92470935T>C	uc001xzy.2	-	11	4173	c.3385A>G	c.(3385-3387)AAG>GAG	p.K1129E	TRIP11_uc010auf.1_Missense_Mutation_p.K865E	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1129	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		GCTGCTTCCTTGGCAGCAACA	0.328			T	PDGFRB	AML								21	24	---	---	---	---	PASS
ITPK1	3705	broad.mit.edu	37	14	93483148	93483148	+	Splice_Site	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93483148T>A	uc001ybg.2	-	4	410	c.121_splice	c.e4-1	p.L41_splice	ITPK1_uc001ybe.2_Splice_Site_p.L41_splice|ITPK1_uc001ybf.2_Splice_Site|ITPK1_uc001ybh.2_Splice_Site_p.L41_splice	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		AAGGTTCAGCTGTGAGGCAGG	0.577													12	36	---	---	---	---	PASS
PRIMA1	145270	broad.mit.edu	37	14	94245617	94245617	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94245617G>T	uc001ybw.1	-	3	176	c.134C>A	c.(133-135)ACT>AAT	p.T45N	PRIMA1_uc001ybx.1_RNA	NM_178013	NP_821092	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1 precursor	45	Extracellular (Potential).				neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GCAGCTGTCAGTCACTTTGGA	0.368													11	8	---	---	---	---	PASS
SERPINA6	866	broad.mit.edu	37	14	94780383	94780383	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94780383G>T	uc001ycv.2	-	2	707	c.603C>A	c.(601-603)ATC>ATA	p.I201I	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	201					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	CTTTGAAGAAGATATAGTTGA	0.488													27	37	---	---	---	---	PASS
SERPINA12	145264	broad.mit.edu	37	14	94962827	94962827	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94962827G>T	uc001ydj.2	-	4	1584	c.788C>A	c.(787-789)CCC>CAC	p.P263H		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	263					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		TTTCTGGTAGGGTATTTCCAG	0.468													47	60	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102505346	102505346	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102505346C>T	uc001yks.2	+	60	11379	c.11215C>T	c.(11215-11217)CAG>TAG	p.Q3739*		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3739	Potential.|AAA 5 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						AGGGGAATTTCAGCTCCGTTT	0.433													13	66	---	---	---	---	PASS
KLC1	3831	broad.mit.edu	37	14	104145867	104145867	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104145867C>A	uc001yno.2	+	13	1943	c.1635C>A	c.(1633-1635)AGC>AGA	p.S545R	KLC1_uc010tyd.1_Missense_Mutation_p.S704R|KLC1_uc010tye.1_Intron|KLC1_uc001ynm.1_Missense_Mutation_p.S545R|KLC1_uc001ynn.1_Intron|KLC1_uc010tyf.1_Missense_Mutation_p.S545R|KLC1_uc001ynp.1_RNA|KLC1_uc001ynr.1_Missense_Mutation_p.S55R|KLC1_uc010awu.1_Intron|KLC1_uc001ynq.1_Intron|KLC1_uc001yns.2_Intron	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2	545					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				TGAGTATGAGCGTAGAGTGGA	0.612													9	34	---	---	---	---	PASS
NUDT14	256281	broad.mit.edu	37	14	105642975	105642975	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105642975C>A	uc010tyn.1	-	4	438	c.324G>T	c.(322-324)GTG>GTT	p.V108V	NUDT14_uc001yqi.2_RNA	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14	108	Nudix hydrolase.					cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CAGGCTGGTCCACGAGGCCGG	0.672										HNSCC(42;0.11)			18	37	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106173640	106173640	+	RNA	SNP	G	T	T	rs71423285		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106173640G>T	uc010tyt.1	-	3633		c.60258C>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysc.2_5'Flank					Parts of antibodies, mostly variable regions.												0						AGGAGAAGGTGTCCCCCTTCT	0.637													12	58	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106320447	106320447	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106320447G>T	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						GGCCAGCAGGGTCAGTAGCAG	0.582													30	45	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106573402	106573402	+	RNA	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106573402C>A	uc010tyt.1	-	1362		c.29123G>T								Parts of antibodies, mostly variable regions.												0						CAGCCCCTTCCCTGGAGCCTG	0.552													64	96	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106610475	106610475	+	RNA	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106610475C>T	uc010tyt.1	-	1167		c.26356G>A								Parts of antibodies, mostly variable regions.												0						GGCCAACCCACTCCAGCCCCT	0.537													37	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20169932	20169932	+	IGR	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20169932A>C								None (None upstream) : GOLGA6L6 (567162 downstream)																							CTCACACAGTAATACATGGCC	0.517													39	130	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28491925	28491925	+	Silent	SNP	G	A	A	rs112980995	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28491925G>A	uc001zbj.2	-	22	3460	c.3354C>T	c.(3352-3354)TTC>TTT	p.F1118F		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1118					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCACCTCCGCGAAGTGCCGCC	0.488													15	7	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33925290	33925290	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33925290G>T	uc001zhi.2	+	24	3078	c.3008G>T	c.(3007-3009)TGG>TTG	p.W1003L	RYR3_uc010bar.2_Missense_Mutation_p.W1003L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1003	2.|4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAACAAGGATGGACCTATGGC	0.413													14	8	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33999221	33999221	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33999221C>A	uc001zhi.2	+	43	6655	c.6585C>A	c.(6583-6585)TAC>TAA	p.Y2195*	RYR3_uc010bar.2_Nonsense_Mutation_p.Y2195*	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2195	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGGAACGCTACCTGTCCTTCC	0.517													10	4	---	---	---	---	PASS
GPR176	11245	broad.mit.edu	37	15	40099429	40099429	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40099429C>A	uc001zkj.1	-	2	1069	c.203G>T	c.(202-204)CGC>CTC	p.R68L	GPR176_uc010uck.1_Missense_Mutation_p.R8L	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	68	Cytoplasmic (Potential).			GNFMVLWSTCRTTVFKSVTN -> EFGNMEVTRKLDKSRLP GI (in Ref. 2).	synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		CACGGTTGTGCGGCAAGTTGA	0.393													24	7	---	---	---	---	PASS
GPR176	11245	broad.mit.edu	37	15	40099430	40099430	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40099430G>A	uc001zkj.1	-	2	1068	c.202C>T	c.(202-204)CGC>TGC	p.R68C	GPR176_uc010uck.1_Missense_Mutation_p.R8C	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	68	Cytoplasmic (Potential).			GNFMVLWSTCRTTVFKSVTN -> EFGNMEVTRKLDKSRLP GI (in Ref. 2).	synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		ACGGTTGTGCGGCAAGTTGAC	0.388													24	7	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48714206	48714206	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48714206C>A	uc001zwx.1	-	61	7841	c.7513G>T	c.(7513-7515)GGC>TGC	p.G2505C	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2505	EGF-like 43; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTGAAGCCGCCAATGGTGTTA	0.453													18	6	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53998163	53998163	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53998163G>T	uc002acj.2	-	10	1105	c.1063C>A	c.(1063-1065)CCT>ACT	p.P355T	WDR72_uc010bfi.1_Missense_Mutation_p.P355T	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	355	WD 4.									lung(1)|skin(1)	2				all cancers(107;0.0511)		GGAACATCAGGGATGTGCCAC	0.383													10	54	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56387339	56387339	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56387339C>A	uc010bfn.2	-	9	2587	c.2587G>T	c.(2587-2589)GAG>TAG	p.E863*	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Nonsense_Mutation_p.E677*	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	766					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						GGCTCAAACTCCTTCAGTTCA	0.398													11	38	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65766574	65766574	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65766574C>A	uc002aov.2	-	12	3135	c.1557G>T	c.(1555-1557)TGG>TGT	p.W519C	DPP8_uc002aow.2_Missense_Mutation_p.W519C|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.W503C|DPP8_uc002aoy.2_Missense_Mutation_p.W519C|DPP8_uc002aoz.2_Missense_Mutation_p.W503C|DPP8_uc010bhj.2_Missense_Mutation_p.W519C|DPP8_uc002apa.2_Missense_Mutation_p.W416C|DPP8_uc010bhk.1_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	519					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						CAAGAACTTCCCATTCACCAC	0.338													25	12	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72146721	72146721	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72146721T>A	uc002atl.3	-	35	6816	c.6343A>T	c.(6343-6345)ACA>TCA	p.T2115S	MYO9A_uc002atj.2_Missense_Mutation_p.T28S|MYO9A_uc002atk.2_Missense_Mutation_p.T910S	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	2115	Phorbol-ester/DAG-type 2.|Tail.|Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						ATCTTACCTGTATCTAGACCC	0.338													74	28	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72252431	72252431	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72252431G>A	uc002atl.3	-	14	2466	c.1993C>T	c.(1993-1995)CGG>TGG	p.R665W	MYO9A_uc010biq.2_Missense_Mutation_p.R260W|MYO9A_uc002ato.2_Missense_Mutation_p.R665W|MYO9A_uc002atn.1_Missense_Mutation_p.R646W	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	665	Myosin head-like 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TTTTTTTCCCGGAAATCCTAT	0.323													15	24	---	---	---	---	PASS
STRA6	64220	broad.mit.edu	37	15	74476241	74476241	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74476241C>A	uc002axk.2	-	14	1438	c.1256G>T	c.(1255-1257)TGT>TTT	p.C419F	STRA6_uc002axi.2_Missense_Mutation_p.C228F|STRA6_uc010ulh.1_Missense_Mutation_p.C457F|STRA6_uc002axj.2_Missense_Mutation_p.C458F|STRA6_uc010bji.2_Missense_Mutation_p.C419F|STRA6_uc002axl.2_Missense_Mutation_p.C351F|STRA6_uc002axm.2_Missense_Mutation_p.C419F|STRA6_uc002axn.2_Missense_Mutation_p.C410F|STRA6_uc010uli.1_Missense_Mutation_p.C456F|STRA6_uc010bjj.1_RNA	NM_022369	NP_071764	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid gene 6 homolog	419	Extracellular (Potential).				adrenal gland development|alveolar primary septum development|developmental growth|diaphragm development|digestive tract morphogenesis|ear development|embryonic camera-type eye formation|embryonic digestive tract development|eyelid development in camera-type eye|face morphogenesis|feeding behavior|female genitalia development|kidney development|lung vasculature development|neuromuscular process|nose morphogenesis|paramesonephric duct development|positive regulation of behavior|pulmonary artery morphogenesis|pulmonary valve morphogenesis|smooth muscle tissue development|transport|uterus morphogenesis|ventricular septum development|vocal learning	integral to membrane|plasma membrane|protein complex	receptor activity			central_nervous_system(1)	1						GCTCATCCAACAGAATATGGC	0.617													38	16	---	---	---	---	PASS
CPLX3	594855	broad.mit.edu	37	15	75122513	75122513	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75122513G>T	uc002ayu.1	+	3	389	c.295G>T	c.(295-297)GTG>TTG	p.V99L		NM_001030005	NP_001025176	Q8WVH0	CPLX3_HUMAN	complexin 3 precursor	99						cell junction|synapse	syntaxin binding				0						AGGTGGAGACGTGGAGCTGCC	0.617													18	8	---	---	---	---	PASS
SH3GL3	6457	broad.mit.edu	37	15	84245363	84245363	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84245363G>T	uc002bjw.2	+	6	689	c.494G>T	c.(493-495)CGC>CTC	p.R165L	SH3GL3_uc010uot.1_Missense_Mutation_p.R165L|SH3GL3_uc002bjx.2_Missense_Mutation_p.R96L|SH3GL3_uc002bju.2_Missense_Mutation_p.R173L|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	165	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						GAAGGCCGCCGCCTGGATTAC	0.403													8	6	---	---	---	---	PASS
HAPLN3	145864	broad.mit.edu	37	15	89421336	89421336	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89421336C>T	uc002bnc.2	-	5	1076	c.948G>A	c.(946-948)CTG>CTA	p.L316L	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Silent_p.L378L	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	316	Link 2.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)					TACCATCTGCCAGCCAGCCAG	0.657													25	49	---	---	---	---	PASS
TMEM8A	58986	broad.mit.edu	37	16	424044	424044	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:424044G>A	uc002cgu.3	-	11	1992	c.1863C>T	c.(1861-1863)ACC>ACT	p.T621T	TMEM8A_uc002cgv.3_Silent_p.T428T	NM_021259	NP_067082	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8 (five membrane-spanning	621	Helical; (Potential).				cell adhesion	integral to plasma membrane				central_nervous_system(2)|pancreas(1)	3						TGCACAGGATGGTGACCCAGA	0.667											OREG0003702	type=REGULATORY REGION|Gene=TMEM8|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	12	5	---	---	---	---	PASS
E4F1	1877	broad.mit.edu	37	16	2279567	2279567	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2279567G>A	uc002cpm.2	+						E4F1_uc010bsi.2_Intron|E4F1_uc010bsj.2_Intron	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F						cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						TCCCCCTTTGGCAGGTGGTGC	0.602													58	101	---	---	---	---	PASS
C16orf68	79091	broad.mit.edu	37	16	8722979	8722979	+	Intron	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8722979T>A	uc002cyz.2	+						C16orf68_uc002cza.2_Intron	NM_024109	NP_077014	Q9BUU2	MET22_HUMAN	hypothetical protein LOC79091								methyltransferase activity				0						TAAATAGAGGTGTGATGTGGC	0.547													61	90	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9923493	9923493	+	Silent	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9923493A>C	uc002czo.3	-	9	2342	c.1794T>G	c.(1792-1794)TCT>TCG	p.S598S	GRIN2A_uc010uym.1_Silent_p.S598S|GRIN2A_uc010uyn.1_Silent_p.S441S|GRIN2A_uc002czr.3_Silent_p.S598S	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	598	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	p.S598F(1)		skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CAATTGTAAAAGAAGGCCCAT	0.463													19	25	---	---	---	---	PASS
RRN3	54700	broad.mit.edu	37	16	15155611	15155611	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15155611C>A	uc002dde.2	-	18	2014	c.1946G>T	c.(1945-1947)AGT>ATT	p.S649I	PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Missense_Mutation_p.S517I|RRN3_uc010uzq.1_Missense_Mutation_p.S619I	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor	649	Interaction with EIF3L.|Interaction with TWISTNB.				regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1						TCAGAGGGGACTGGGTTGCAT	0.512													19	33	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15876249	15876249	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15876249G>T	uc002ddy.2	-	6	826	c.719C>A	c.(718-720)TCA>TAA	p.S240*	MYH11_uc002ddv.2_Nonsense_Mutation_p.S247*|MYH11_uc002ddw.2_Nonsense_Mutation_p.S240*|MYH11_uc002ddx.2_Nonsense_Mutation_p.S247*|MYH11_uc010bvg.2_Nonsense_Mutation_p.S72*|MYH11_uc002dea.1_5'UTR	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	240	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TACGAATCGTGAGGAGTTGTC	0.502			T	CBFB	AML								29	43	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18887445	18887445	+	Splice_Site	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18887445C>A	uc002dfm.2	-	13	2253	c.1890_splice	c.e13+1	p.G630_splice	SMG1_uc010bwb.2_Splice_Site_p.G490_splice	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TAAAGACTCACCCCTATTAGT	0.333													36	55	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20371903	20371903	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20371903T>C	uc002dhc.1	-	11	1716	c.1493A>G	c.(1492-1494)GAG>GGG	p.E498G		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	498					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						ATCCTCATCCTCAATCTTAGT	0.453													107	139	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20638573	20638573	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20638573C>T	uc002dhm.1	-	10	1433	c.1365G>A	c.(1363-1365)AAG>AAA	p.K455K	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Silent_p.K455K	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	455					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						CTTCATCCATCTTACCTCTGT	0.507													163	259	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21145703	21145703	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21145703T>C	uc010vbe.1	-	7	959	c.959A>G	c.(958-960)CAA>CGA	p.Q320R	DNAH3_uc002die.2_Missense_Mutation_p.Q291R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	320	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GATCACTCTTTGAGGAAACAA	0.542													33	66	---	---	---	---	PASS
ARHGAP17	55114	broad.mit.edu	37	16	24950823	24950823	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24950823G>A	uc002dnb.2	-	17	1679	c.1586C>T	c.(1585-1587)CCC>CTC	p.P529L	ARHGAP17_uc002dmy.2_5'Flank|ARHGAP17_uc002dmz.2_Missense_Mutation_p.P53L|ARHGAP17_uc002dna.2_Missense_Mutation_p.P256L|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	529	Pro-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		GCCATCTGTGGGCGGAAGTGG	0.632													4	11	---	---	---	---	PASS
NSMCE1	197370	broad.mit.edu	37	16	27246603	27246603	+	Nonsense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27246603T>A	uc002doi.1	-	3	252	c.154A>T	c.(154-156)AAG>TAG	p.K52*	NSMCE1_uc002doj.1_RNA	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog	52					DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						TCCTCCAACTTATCTACGGTG	0.438											OREG0023693	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	16	---	---	---	---	PASS
IL21R	50615	broad.mit.edu	37	16	27441400	27441400	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27441400G>T	uc002doq.1	+	2	241	c.8G>T	c.(7-9)CGT>CTT	p.R3L	IL21R_uc002dor.1_Missense_Mutation_p.R3L|IL21R_uc002dos.1_Missense_Mutation_p.R3L	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	3					natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						AGCATGCCGCGTGGCTGGGCC	0.701			T	BCL6	NHL								3	19	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27480717	27480717	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27480717C>T	uc002dov.1	-	32	5009	c.4969G>A	c.(4969-4971)GTC>ATC	p.V1657I	GTF3C1_uc002dou.2_Missense_Mutation_p.V1657I	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1657						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CGGGTGCTGACGATGCCGGGG	0.637													3	16	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27503961	27503961	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27503961C>A	uc002dov.1	-	18	2990	c.2950G>T	c.(2950-2952)GAA>TAA	p.E984*	GTF3C1_uc002dou.2_Nonsense_Mutation_p.E984*	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	984						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						TGAAACTTTTCCGTGGGACCA	0.498													58	63	---	---	---	---	PASS
CCDC101	112869	broad.mit.edu	37	16	28592408	28592408	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28592408C>G	uc002dqf.2	+	2	203	c.18C>G	c.(16-18)GCC>GCG	p.A6A	uc010vct.1_Intron	NM_138414	NP_612423	Q96ES7	SGF29_HUMAN	coiled-coil domain containing 101	6	Potential.				establishment of protein localization to chromatin|histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|SAGA-type complex	methylated histone residue binding			central_nervous_system(1)	1						TCGTGTCTGCCGATTCCCGCA	0.473													3	24	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29990517	29990517	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29990517G>T	uc002dva.1	+	7	1234	c.451G>T	c.(451-453)GAT>TAT	p.D151Y	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Missense_Mutation_p.D151Y|TAOK2_uc002dvc.1_Missense_Mutation_p.D151Y|TAOK2_uc010bzm.1_Missense_Mutation_p.D151Y|TAOK2_uc002dvd.1_5'Flank	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	151	Protein kinase.	Proton acceptor (By similarity).			actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						CTCTGGCAGGGATGTGAAGGC	0.562													12	32	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31131698	31131698	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31131698C>T	uc002eay.2	+	3	343	c.325C>T	c.(325-327)CTG>TTG	p.L109L	MYST1_uc002eax.2_Silent_p.L109L	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	109	Chromo.				histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						CAAGAACCGGCTGGCGCTGAC	0.577													21	41	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31373414	31373414	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31373414G>T	uc002ebu.1	+	11	1172	c.1105G>T	c.(1105-1107)GCT>TCT	p.A369S	ITGAX_uc002ebt.2_Missense_Mutation_p.A369S|ITGAX_uc010vfk.1_Missense_Mutation_p.A19S	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	369	FG-GAP 3.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CGTTCTGGGGGCTGTGGGGAG	0.582													5	150	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31434716	31434716	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31434716T>G	uc002ebv.1	+	25	2952	c.2903T>G	c.(2902-2904)TTC>TGC	p.F968C	ITGAD_uc010cap.1_Missense_Mutation_p.F969C	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	968	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						AGCATTAACTTCTGGGTTCCT	0.527													35	46	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51174429	51174429	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51174429G>C	uc010vgs.1	-	2	1735	c.1704C>G	c.(1702-1704)CCC>CCG	p.P568P	SALL1_uc010vgr.1_Silent_p.P471P|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	568					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCTTGATGAAGGGTATGAGGC	0.612													13	33	---	---	---	---	PASS
SLC6A2	6530	broad.mit.edu	37	16	55733543	55733543	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55733543T>C	uc002eif.2	+	12	1678	c.1567T>C	c.(1567-1569)TTC>CTC	p.F523L	SLC6A2_uc010ccd.2_Missense_Mutation_p.F523L|SLC6A2_uc002eig.2_Missense_Mutation_p.F523L|SLC6A2_uc002eih.2_Missense_Mutation_p.F523L|SLC6A2_uc002eii.2_Missense_Mutation_p.F418L|SLC6A2_uc002eij.2_Missense_Mutation_p.F237L	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	523	Helical; Name=11; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GTGCTGGAAGTTCGTCAGTCC	0.582													7	23	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55860210	55860210	+	Intron	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55860210G>C	uc002eim.2	-						CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	GGGTGCACCTGGGGAGGGGGA	0.512													33	72	---	---	---	---	PASS
AMFR	267	broad.mit.edu	37	16	56435764	56435764	+	Intron	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56435764A>G	uc002eiy.2	-						AMFR_uc002eix.2_Intron	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						ACCTGTGGAAACAAAACAAGC	0.517													24	23	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56904619	56904619	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904619T>C	uc010ccm.2	+	6	852	c.823T>C	c.(823-825)TCC>CCC	p.S275P	SLC12A3_uc002ekd.3_Missense_Mutation_p.S275P|SLC12A3_uc010ccn.2_Missense_Mutation_p.S274P	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	275	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GCTGGCCATCTCCCTGGCTGG	0.637													8	24	---	---	---	---	PASS
ARL2BP	23568	broad.mit.edu	37	16	57284369	57284369	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57284369A>T	uc002elf.1	+	5	582	c.340A>T	c.(340-342)ACC>TCC	p.T114S	ARL2BP_uc010vhl.1_Missense_Mutation_p.T114S	NM_012106	NP_036238	Q9Y2Y0	AR2BP_HUMAN	binder of Arl Two	114					maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity				0						CATGCTGCTCACCTTCACAGA	0.408													12	42	---	---	---	---	PASS
SLC7A6OS	84138	broad.mit.edu	37	16	68338008	68338008	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68338008A>C	uc002evw.1	-	3	618	c.599T>G	c.(598-600)ATT>AGT	p.I200S		NM_032178	NP_115554	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite	200					protein transport	cytoplasm|nucleus				ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		CAAGTAGTAAATGTCATACAC	0.517													51	55	---	---	---	---	PASS
ST3GAL2	6483	broad.mit.edu	37	16	70429084	70429084	+	Intron	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70429084G>A	uc002eyw.2	-						ST3GAL2_uc002eyx.2_Intron	NM_006927	NP_008858	Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						amino sugar metabolic process	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity			ovary(1)	1		Ovarian(137;0.0694)				AGCATCTGTGGAAGGGAGGGG	0.602													27	35	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70891612	70891612	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70891612G>T	uc002ezr.2	-	72	12416	c.12288C>A	c.(12286-12288)CTC>CTA	p.L4096L	HYDIN_uc010cfy.2_RNA	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	4097										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				CCTTACCAATGAGGAGAGAGC	0.493													8	40	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	71098610	71098610	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71098610G>A	uc002ezr.2	-	16	2337	c.2209C>T	c.(2209-2211)CAG>TAG	p.Q737*	HYDIN_uc010cfz.1_Nonsense_Mutation_p.Q482*|HYDIN_uc002ezv.2_Nonsense_Mutation_p.Q737*|HYDIN_uc010vmc.1_Nonsense_Mutation_p.Q754*|HYDIN_uc010vmd.1_Nonsense_Mutation_p.Q764*	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	737										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GAACTCACCTGAGGCTGGACC	0.458													5	13	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72984563	72984563	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72984563C>T	uc002fck.2	-	3	3694	c.3021G>A	c.(3019-3021)AAG>AAA	p.K1007K	ZFHX3_uc002fcl.2_Silent_p.K93K	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1007	C2H2-type 7; atypical.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TCTGCACGTGCTTGTCTGTCT	0.602													9	30	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75513561	75513561	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75513561C>A	uc002fef.2	-	3	346	c.166G>T	c.(166-168)GTG>TTG	p.V56L	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.V56L	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	56	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						AGTTGGCCCACGAAGGACGAG	0.682													5	14	---	---	---	---	PASS
WWOX	51741	broad.mit.edu	37	16	78466374	78466374	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78466374C>T	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		GTCATATTTCCTATTTTTAAG	0.318													7	48	---	---	---	---	PASS
OSGIN1	29948	broad.mit.edu	37	16	83998779	83998779	+	Missense_Mutation	SNP	G	A	A	rs138968808		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83998779G>A	uc002fha.2	+	7	1233	c.850G>A	c.(850-852)GTG>ATG	p.V284M	OSGIN1_uc002fhb.2_Missense_Mutation_p.V201M|OSGIN1_uc002fhc.2_Missense_Mutation_p.V201M	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	284					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						AGTCACAGCCGTGGAGTGGGG	0.657													24	52	---	---	---	---	PASS
KIAA0513	9764	broad.mit.edu	37	16	85111073	85111073	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85111073C>T	uc002fiu.2	+	6	837	c.617C>T	c.(616-618)GCG>GTG	p.A206V	KIAA0513_uc002fis.3_Missense_Mutation_p.A206V|KIAA0513_uc010voj.1_Missense_Mutation_p.A206V|KIAA0513_uc002fit.2_Missense_Mutation_p.A206V	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	206						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		GAGAAGCCCGCGGGCAGCATC	0.617													10	45	---	---	---	---	PASS
JPH3	57338	broad.mit.edu	37	16	87717830	87717830	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87717830A>T	uc002fkd.2	+	3	1497	c.1243A>T	c.(1243-1245)ACT>TCT	p.T415S	JPH3_uc010vou.1_RNA	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3	415	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CGCCAGGATCACTGCCAAAGA	0.657													11	17	---	---	---	---	PASS
JPH3	57338	broad.mit.edu	37	16	87717831	87717831	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87717831C>T	uc002fkd.2	+	3	1498	c.1244C>T	c.(1243-1245)ACT>ATT	p.T415I	JPH3_uc010vou.1_RNA	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3	415	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)		GCCAGGATCACTGCCAAAGAG	0.657													12	17	---	---	---	---	PASS
OR1D2	4991	broad.mit.edu	37	17	2995615	2995615	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2995615G>T	uc010vrb.1	-	1	676	c.676C>A	c.(676-678)CTC>ATC	p.L226I		NM_002548	NP_002539	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D,	226	Cytoplasmic (Potential).				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						GGTATTCTGAGGATGGCTCTG	0.453													30	13	---	---	---	---	PASS
PHF23	79142	broad.mit.edu	37	17	7139892	7139892	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7139892A>G	uc002gfa.2	-	4	581	c.354T>C	c.(352-354)CGT>CGC	p.R118R	DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Intron|PHF23_uc010cma.2_5'UTR	NM_024297	NP_077273	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	118							zinc ion binding				0						GGGCCTGCAGACGAGAGAAAG	0.537													26	42	---	---	---	---	PASS
FXR2	9513	broad.mit.edu	37	17	7495861	7495861	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7495861T>C	uc002gia.1	-	15	2013	c.1786A>G	c.(1786-1788)AAT>GAT	p.N596D	MPDU1_uc010vuc.1_3'UTR|SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	596						cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)		TCAGTCCGATTACCACGGTTA	0.552													57	31	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577556	7577556	+	Missense_Mutation	SNP	C	A	A	rs121912655		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577556C>A	uc002gim.2	-	7	919	c.725G>T	c.(724-726)TGC>TTC	p.C242F	TP53_uc002gig.1_Missense_Mutation_p.C242F|TP53_uc002gih.2_Missense_Mutation_p.C242F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C110F|TP53_uc010cng.1_Missense_Mutation_p.C110F|TP53_uc002gii.1_Missense_Mutation_p.C110F|TP53_uc010cnh.1_Missense_Mutation_p.C242F|TP53_uc010cni.1_Missense_Mutation_p.C242F|TP53_uc002gij.2_Missense_Mutation_p.C242F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C149F|TP53_uc002gio.2_Missense_Mutation_p.C110F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	242	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).	Zinc.	C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C242F(63)|p.C242Y(37)|p.C242S(25)|p.C242fs*5(16)|p.C242R(11)|p.C242W(7)|p.0?(7)|p.N239_C242delNSSC(3)|p.C242*(3)|p.C242C(2)|p.C242G(2)|p.C242fs*20(1)|p.C242fs*23(1)|p.Y236_M243delYMCNSSCM(1)|p.C242_M246>L(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*98(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.S241_G245delSCMGG(1)|p.N239_C242del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCCGCCCATGCAGGAACTGTT	0.577		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	6	---	---	---	---	PASS
WRAP53	55135	broad.mit.edu	37	17	7606164	7606164	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7606164C>T	uc010vuh.1	+	9	1423	c.1268C>T	c.(1267-1269)CCG>CTG	p.P423L	WRAP53_uc010vui.1_Missense_Mutation_p.P423L|WRAP53_uc002gip.2_Missense_Mutation_p.P423L|WRAP53_uc002gir.2_Missense_Mutation_p.P423L|WRAP53_uc002giq.2_RNA|WRAP53_uc010cnl.2_Missense_Mutation_p.P390L|EFNB3_uc002gis.2_5'Flank	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2	423	WD 6.				positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						GATCTGGACCCGTGAGTGGCT	0.607													24	5	---	---	---	---	PASS
ARHGEF15	22899	broad.mit.edu	37	17	8215926	8215926	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8215926C>A	uc002glc.2	+	2	690	c.569C>A	c.(568-570)ACC>AAC	p.T190N	ARHGEF15_uc002glb.1_Missense_Mutation_p.T190N|ARHGEF15_uc002gld.2_Missense_Mutation_p.T190N|ARHGEF15_uc010vuw.1_Missense_Mutation_p.T190N	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	190					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						GCTCCCCTCACCGGGAGTGGG	0.622													14	8	---	---	---	---	PASS
GLP2R	9340	broad.mit.edu	37	17	9792900	9792900	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9792900G>T	uc002gmd.1	+	13	1540	c.1540G>T	c.(1540-1542)GGC>TGC	p.G514C		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	514	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	TGGGGAGCTGGGCGCCCAGCC	0.637													3	20	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10318833	10318833	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10318833C>A	uc002gmm.2	-	7	699	c.604G>T	c.(604-606)GCA>TCA	p.A202S	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	202	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CCAGTAACTGCAATTGTTGCA	0.458									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				29	16	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10549330	10549330	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10549330G>A	uc002gmq.1	-	10	995	c.918C>T	c.(916-918)ACC>ACT	p.T306T		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	306	Myosin head-like.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						CGTAAGGGTTGGTCGTAATAA	0.512											OREG0024181	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	11	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26092696	26092696	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26092696G>T	uc002gzu.2	-	20	2557	c.2293C>A	c.(2293-2295)CTG>ATG	p.L765M		NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	765	FAD-binding FR-type.				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	AGGTAGTTCAGGCCTTGGCCA	0.622													24	18	---	---	---	---	PASS
FLJ40504	284085	broad.mit.edu	37	17	26604071	26604071	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26604071A>C	uc002has.3	-	3	500	c.404T>G	c.(403-405)GTT>GGT	p.V135G		NM_173624	NP_775895			SubName: Full=Putative uncharacterized protein FLJ40504; SubName: Full=cDNA FLJ40504 fis, clone TESTI2045509, highly similar to KERATIN, TYPE I CYTOSKELETAL 18;												0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		CAGGCTCCTAACTCTGTCCAG	0.567													39	53	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27958650	27958650	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958650C>A	uc002heo.1	-	15	3481	c.3481G>T	c.(3481-3483)GAA>TAA	p.E1161*	SSH2_uc010wbh.1_Nonsense_Mutation_p.E1188*	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1161					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						TGACTTTCTTCCCAGCTAACC	0.512													10	35	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27958751	27958751	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958751G>A	uc002heo.1	-	15	3380	c.3380C>T	c.(3379-3381)GCC>GTC	p.A1127V	SSH2_uc010wbh.1_Missense_Mutation_p.A1154V	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1127					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						ATCCAAACTGGCAGACAGTAA	0.542													11	44	---	---	---	---	PASS
GOSR1	9527	broad.mit.edu	37	17	28804445	28804445	+	5'UTR	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28804445G>T	uc002hfe.2	+	1					GOSR1_uc002hfd.2_5'UTR|GOSR1_uc002hff.2_5'UTR|GOSR1_uc002hfc.1_5'UTR	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						GACGTTGGACGACAAAGATGG	0.637											OREG0024301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	14	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33475336	33475336	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33475336G>T	uc002hja.2	+	2	151	c.54G>T	c.(52-54)CAG>CAT	p.Q18H	UNC45B_uc002hjb.2_Missense_Mutation_p.Q18H|UNC45B_uc002hjc.2_Missense_Mutation_p.Q18H|UNC45B_uc010cto.2_Missense_Mutation_p.Q18H	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	18	TPR 1.				cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GGCATTTCCAGCTCCAGGACT	0.597													34	28	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36705431	36705431	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36705431G>C	uc002hqd.2	-	16	3203	c.2978C>G	c.(2977-2979)CCC>CGC	p.P993R	SRCIN1_uc002hqf.1_Missense_Mutation_p.P865R|SRCIN1_uc002hqe.2_Missense_Mutation_p.P847R	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	865	Pro-rich.				exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						GCGGTATCGGGGCACGGTCAA	0.632													15	3	---	---	---	---	PASS
KRTAP9-4	85280	broad.mit.edu	37	17	39406116	39406116	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39406116C>A	uc002hwi.2	+	1	178	c.144C>A	c.(142-144)TGC>TGA	p.C48*	KRTAP9-9_uc010wfq.1_Intron	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	48	15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCAGCTGCTGCCAGCCTTGCT	0.647													5	24	---	---	---	---	PASS
KRT33B	3884	broad.mit.edu	37	17	39525647	39525647	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39525647C>A	uc002hwl.2	-							NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				TGGTGCCCACCTCCTCACCTT	0.488													19	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	40180115	40180115	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40180115A>T	uc002hyu.2	-	2	273	c.130T>A	c.(130-132)TGT>AGT	p.C44S						RecName: Full=Zinc finger protein 385C;																		CAGAGAGCACAGTGGAAGGCA	0.682													10	42	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41341086	41341086	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41341086G>C	uc010czd.2	+	7	570	c.430G>C	c.(430-432)GAC>CAC	p.D144H	NBR1_uc010diz.2_Missense_Mutation_p.D144H|NBR1_uc010whu.1_Missense_Mutation_p.D144H|NBR1_uc010whv.1_Missense_Mutation_p.D144H|NBR1_uc010whw.1_Missense_Mutation_p.D123H|NBR1_uc010whx.1_5'Flank	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	144					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ATGTGACACAGACCAGCCTCA	0.468													6	48	---	---	---	---	PASS
GRN	2896	broad.mit.edu	37	17	42430088	42430088	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42430088G>C	uc002igp.1	+	13	1923	c.1704G>C	c.(1702-1704)AGG>AGC	p.R568S	GRN_uc002igr.1_3'UTR	NM_002087	NP_002078	P28799	GRN_HUMAN	granulin precursor	568					signal transduction	extracellular space	cytokine activity|growth factor activity			ovary(2)|central_nervous_system(2)|skin(1)	5		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCGCAGCCAGGGGTACCAAGT	0.657													31	50	---	---	---	---	PASS
CRHR1	1394	broad.mit.edu	37	17	43912051	43912051	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43912051G>T	uc010dap.2	+	14	1521	c.1256G>T	c.(1255-1257)CGA>CTA	p.R419L	CRHR1_uc010wjx.1_Missense_Mutation_p.R215L|CRHR1_uc002ijp.2_Nonsense_Mutation_p.E244*|CRHR1_uc002ijm.2_Missense_Mutation_p.R390L|CRHR1_uc002ijn.2_Missense_Mutation_p.R350L|CRHR1_uc010dar.2_Missense_Mutation_p.R376L|CRHR1_uc010dao.2_Missense_Mutation_p.R289L|CRHR1_uc010daq.2_Missense_Mutation_p.R215L	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	419	Cytoplasmic (Potential).				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		ATCCGTGCCCGAGTGGCCCGT	0.632													13	11	---	---	---	---	PASS
SP6	80320	broad.mit.edu	37	17	45924907	45924907	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45924907G>A	uc002img.1	-	2	1221	c.889C>T	c.(889-891)CGC>TGC	p.R297C	SP6_uc002imh.1_Missense_Mutation_p.R297C	NM_199262	NP_954871	Q3SY56	SP6_HUMAN	Sp6 transcription factor	297	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TCGTCCGAGCGCGTGAAGCGC	0.667													4	29	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	50149697	50149697	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50149697G>A	uc002itw.3	-	2	1104	c.118C>T	c.(118-120)CAG>TAG	p.Q40*	CA10_uc002itv.3_Nonsense_Mutation_p.Q46*|CA10_uc002itx.3_Nonsense_Mutation_p.Q40*|CA10_uc002ity.3_Nonsense_Mutation_p.Q40*|CA10_uc002itz.2_Nonsense_Mutation_p.Q40*	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	40					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			AAGCTTCCCTGGACCACCTCC	0.353													21	33	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54428241	54428241	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428241T>A	uc002iun.1	+	4	347	c.312T>A	c.(310-312)TCT>TCA	p.S104S		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	104										large_intestine(1)|ovary(1)	2						GGAACCTCTCTGAGAAACTGA	0.458													27	37	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54428242	54428242	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428242G>T	uc002iun.1	+	4	348	c.313G>T	c.(313-315)GAG>TAG	p.E105*		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	105										large_intestine(1)|ovary(1)	2						GAACCTCTCTGAGAAACTGAA	0.458													28	38	---	---	---	---	PASS
EPX	8288	broad.mit.edu	37	17	56277639	56277639	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56277639C>G	uc002ivq.2	+	10	1677	c.1591C>G	c.(1591-1593)CGT>GGT	p.R531G		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	531					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						CAAGCTGAACCGTCAGGATGC	0.622											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	61	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59024696	59024696	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59024696G>T	uc002iyv.3	+	14	1313	c.1204G>T	c.(1204-1206)GGA>TGA	p.G402*	BCAS3_uc010wow.1_Nonsense_Mutation_p.G189*|BCAS3_uc002iyu.3_Nonsense_Mutation_p.G402*|BCAS3_uc002iyw.3_Nonsense_Mutation_p.G398*|BCAS3_uc002iyx.1_Nonsense_Mutation_p.G217*|BCAS3_uc002iyy.3_Nonsense_Mutation_p.G173*	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	402						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TCTTCACAGGGGAGAAACTGA	0.413													81	92	---	---	---	---	PASS
NACA2	342538	broad.mit.edu	37	17	59668336	59668336	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59668336T>G	uc002izj.2	-	1	232	c.206A>C	c.(205-207)CAG>CCG	p.Q69P		NM_199290	NP_954984	Q9H009	NACA2_HUMAN	nascent-polypeptide-associated complex alpha	69					protein transport	cytoplasm|nucleus				ovary(1)	1	all_epithelial(1;3.12e-14)					ACTCCGACTCTGTTTTGCTTT	0.473													100	163	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60028323	60028323	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60028323G>T	uc002izo.2	-	28	6231	c.6154C>A	c.(6154-6156)CAT>AAT	p.H2052N		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2052					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						ACTTCCTCATGAGGTTCTGTT	0.393													8	58	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60742270	60742270	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60742270C>A	uc002jad.2	+	2	882	c.480C>A	c.(478-480)ATC>ATA	p.I160I	MRC2_uc002jac.2_Silent_p.I160I	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	160	Extracellular (Potential).|Ricin B-type lectin.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						AGTGGCGCATCTACGGCAGCG	0.667													33	26	---	---	---	---	PASS
TANC2	26115	broad.mit.edu	37	17	61391859	61391859	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61391859G>A	uc002jal.3	+	8	1071	c.1048G>A	c.(1048-1050)GAA>AAA	p.E350K	TANC2_uc010wpe.1_Missense_Mutation_p.E260K	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	350							binding			ovary(2)	2						GGTTTTCCACGAAATAGATGC	0.463													10	78	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61611240	61611240	+	Intron	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61611240C>A	uc002jay.2	+						KCNH6_uc002jax.1_Intron|KCNH6_uc010wpl.1_Intron|KCNH6_uc010wpm.1_Intron|KCNH6_uc002jaz.1_Intron	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	TCGGCCCCCACCCCCAGGTCC	0.687													13	45	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62855863	62855863	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62855863C>T	uc002jey.2	-	11	4932	c.4401G>A	c.(4399-4401)TCG>TCA	p.S1467S	LRRC37A3_uc010wqg.1_Silent_p.S585S|LRRC37A3_uc002jex.1_Silent_p.S444S|LRRC37A3_uc010wqf.1_Silent_p.S505S|LRRC37A3_uc010dek.1_Silent_p.S473S	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1467	Extracellular (Potential).					integral to membrane					0						CACCTGGGGACGAGAGCAATG	0.488													13	180	---	---	---	---	PASS
APOH	350	broad.mit.edu	37	17	64210608	64210608	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64210608A>T	uc002jfn.3	-	7	1004	c.945T>A	c.(943-945)TGT>TGA	p.C315*		NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor	315	Sushi-like.				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			TGCCATCTATACACTGAGCAT	0.403													40	65	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65083074	65083074	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65083074C>A	uc010wqk.1	-	32	5555	c.5368G>T	c.(5368-5370)GAC>TAC	p.D1790Y	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.D1789Y	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TTACTGTGGTCCTGAAGCTCT	0.458													35	83	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65163616	65163616	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65163616C>G	uc010wqk.1	-	14	1914	c.1727G>C	c.(1726-1728)TGT>TCT	p.C576S	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.C576S	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AAGTTCTTCACAGCATTCCCT	0.393													18	77	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67197714	67197714	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67197714T>C	uc010dfa.1	-	11	1981	c.1102A>G	c.(1102-1104)ATA>GTA	p.I368V	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'UTR|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	368					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TCAGGATTTATTTCATTCTCA	0.348													33	67	---	---	---	---	PASS
USH1G	124590	broad.mit.edu	37	17	72915908	72915908	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72915908C>A	uc002jme.1	-	2	1206	c.1023G>T	c.(1021-1023)GCG>GCT	p.A341A	USH1G_uc010wro.1_Silent_p.A238A	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	341					equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					GACCCCGCGGCGCTCCCACCC	0.701													20	112	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74288383	74288383	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74288383G>A	uc002jrd.1	-	4	2107	c.1927C>T	c.(1927-1929)CGT>TGT	p.R643C	QRICH2_uc010wsz.1_Missense_Mutation_p.R569C|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	643	Gln-rich.						protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						accaaaccacgctgaactgca	0.075													13	28	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76451813	76451813	+	Silent	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76451813G>C	uc010dhp.1	-	8	1305	c.1083C>G	c.(1081-1083)GCC>GCG	p.A361A	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGGACACGAAGGCAGAGATGA	0.522													4	10	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76566458	76566458	+	Intron	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76566458G>C	uc002jvv.1	-											RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGGGAGCTGGGGGGAGACAG	0.607													10	15	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76831527	76831527	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76831527G>A	uc002jvz.1	-	4	635	c.310C>T	c.(310-312)CTT>TTT	p.L104F	USP36_uc002jwa.1_Missense_Mutation_p.L104F|USP36_uc002jwd.1_Missense_Mutation_p.L104F	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	104					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GTGGGGAAAAGCACTTTCTGC	0.572													6	19	---	---	---	---	PASS
SGSH	6448	broad.mit.edu	37	17	78185956	78185956	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78185956G>A	uc002jxz.3	-	7	950	c.863C>T	c.(862-864)CCG>CTG	p.P288L	SGSH_uc002jya.3_Missense_Mutation_p.P85L|SGSH_uc002jxy.2_3'UTR|SGSH_uc010wue.1_3'UTR	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	288			P -> S (in MPS3A).		proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			AGCAGTGCCCGGCCAGTACAG	0.617													13	29	---	---	---	---	PASS
SLC38A10	124565	broad.mit.edu	37	17	79219575	79219575	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79219575G>A	uc002jzz.1	-	16	3516	c.3141C>T	c.(3139-3141)TCC>TCT	p.S1047S	SLC38A10_uc002jzy.1_Silent_p.S965S	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	1047					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCCGGAGGTCGGAGCCAGCCT	0.672													7	47	---	---	---	---	PASS
TSPAN10	83882	broad.mit.edu	37	17	79612390	79612390	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79612390G>T	uc010die.2	+	2	499	c.409G>T	c.(409-411)GCT>TCT	p.A137S	TSPAN10_uc002kaw.1_Missense_Mutation_p.A137S|TSPAN10_uc010did.1_RNA	NM_031945	NP_114151	Q9H1Z9	TSN10_HUMAN	tetraspanin 10	137	Helical; (Potential).					integral to membrane				ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AGTGAGCCTGGCTGGCTACCT	0.677													11	12	---	---	---	---	PASS
WDR45L	56270	broad.mit.edu	37	17	80579613	80579613	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80579613C>A	uc002kfq.2	-	6	685	c.490G>T	c.(490-492)GGC>TGC	p.G164C	WDR45L_uc002kfr.2_RNA	NM_019613	NP_062559	Q5MNZ6	WIPI3_HUMAN	WDR45-like	164					autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding			ovary(1)	1	Breast(20;0.00106)|all_neural(118;0.0952)	all_cancers(8;0.101)|all_epithelial(8;0.198)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.0835)			TGCACATGGCCCGTGTGCGTG	0.592													16	12	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7016502	7016502	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7016502C>A	uc002knm.2	-	21	3071	c.2977G>T	c.(2977-2979)GGT>TGT	p.G993C	LAMA1_uc010wzj.1_Missense_Mutation_p.G469C	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	993	Laminin EGF-like 10.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTACAGCTACCATCCTGGTAG	0.512													23	17	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12358809	12358809	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12358809C>A	uc002kqz.1	-	8	999	c.886G>T	c.(886-888)GCC>TCC	p.A296S		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	296					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	AAGACCTTGGCAGTGGTTTCT	0.498													10	40	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19995556	19995556	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19995556G>A	uc002ktv.1	-	1	2323	c.2219C>T	c.(2218-2220)CCC>CTC	p.P740L		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	740	Pro-rich.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GGGGGCTGGGGGGAAAAATGC	0.502													8	9	---	---	---	---	PASS
TAF4B	6875	broad.mit.edu	37	18	23895265	23895265	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23895265A>G	uc002kvu.3	+	10	2394	c.1905A>G	c.(1903-1905)TTA>TTG	p.L635L	TAF4B_uc002kvs.3_RNA|TAF4B_uc002kvt.3_Silent_p.L640L	NM_005640	NP_005631	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding	635					transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			CCTGCATCTTAGCAACAAACT	0.343													11	31	---	---	---	---	PASS
DSC3	1825	broad.mit.edu	37	18	28604414	28604414	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28604414G>T	uc002kwj.3	-	6	831	c.676C>A	c.(676-678)CCC>ACC	p.P226T	DSC3_uc002kwi.3_Missense_Mutation_p.P226T	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	226	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			AGTGGGAGGGGCAGATCTGCT	0.408													26	28	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28979253	28979253	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28979253G>A	uc002kwq.2	+	9	1159	c.1024G>A	c.(1024-1026)GCA>ACA	p.A342T	DSG4_uc002kwr.2_Missense_Mutation_p.A342T	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	342	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTATGAACAAGCACCTAACAT	0.378													21	88	---	---	---	---	PASS
SLC39A6	25800	broad.mit.edu	37	18	33706432	33706432	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33706432T>A	uc010dmy.2	-	2	829	c.539A>T	c.(538-540)GAC>GTC	p.D180V	SLC39A6_uc002kzj.2_Intron	NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),	180	Extracellular (Potential).					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						ACTAACACTGTCCTTGACATT	0.468													41	102	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42281564	42281564	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42281564G>T	uc010dni.2	+	2	549	c.253G>T	c.(253-255)GGT>TGT	p.G85C	SETBP1_uc002lay.2_Missense_Mutation_p.G85C	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	85						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGCAGGAGATGGTTTGGAAGA	0.522									Schinzel-Giedion_syndrome				20	26	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42281695	42281695	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42281695G>T	uc010dni.2	+	2	680	c.384G>T	c.(382-384)GAG>GAT	p.E128D	SETBP1_uc002lay.2_Missense_Mutation_p.E128D	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	128						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GTCCACCTGAGATCAAGATCA	0.463									Schinzel-Giedion_syndrome				10	35	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561037	44561037	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561037G>T	uc002lcr.1	-	1	952	c.599C>A	c.(598-600)GCG>GAG	p.A200E	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	200					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GCCCTGAGCCGCGTGAGTGTG	0.692													5	31	---	---	---	---	PASS
ME2	4200	broad.mit.edu	37	18	48446850	48446850	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48446850G>T	uc002ley.2	+	8	1015	c.759G>T	c.(757-759)CAG>CAT	p.Q253H	ME2_uc010dpd.2_Missense_Mutation_p.Q253H	NM_002396	NP_002387	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	253					malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding				0		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	NADH(DB00157)	CACTCATTCAGTTCGAAGACT	0.338													12	31	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55027251	55027251	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55027251C>A	uc002lgn.2	+	4	1243	c.886C>A	c.(886-888)CCT>ACT	p.P296T		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	296	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		ACATTTGTCACCTAAACGGCT	0.423													20	9	---	---	---	---	PASS
NARS	4677	broad.mit.edu	37	18	55270055	55270055	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55270055G>C	uc002lgs.2	-	12	1600	c.1372C>G	c.(1372-1374)CTT>GTT	p.L458V	NARS_uc002lgt.2_Missense_Mutation_p.L457V|NARS_uc010xea.1_Missense_Mutation_p.L209V	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	458					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)	GATTCAGTAAGACGGGAATCC	0.428													23	23	---	---	---	---	PASS
NEDD4L	23327	broad.mit.edu	37	18	56033437	56033437	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56033437C>T	uc002lgy.2	+	21	2314	c.2040C>T	c.(2038-2040)TAC>TAT	p.Y680Y	NEDD4L_uc002lgz.2_Silent_p.Y616Y|NEDD4L_uc002lgx.2_Silent_p.Y660Y|NEDD4L_uc010xee.1_Silent_p.Y559Y|NEDD4L_uc002lhc.2_Silent_p.Y672Y|NEDD4L_uc002lhd.2_Silent_p.Y559Y|NEDD4L_uc002lhb.2_Silent_p.Y539Y|NEDD4L_uc002lhe.2_Silent_p.Y652Y|NEDD4L_uc002lhf.2_Silent_p.Y539Y|NEDD4L_uc002lhg.2_Silent_p.Y559Y|NEDD4L_uc002lhh.2_Silent_p.Y455Y|NEDD4L_uc010dpn.2_Translation_Start_Site	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	680	HECT.				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						ACCCCTACTACGGCCTCTTTG	0.458													5	7	---	---	---	---	PASS
CCBE1	147372	broad.mit.edu	37	18	57103262	57103262	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57103262C>A	uc002lib.2	-	11	1169	c.1099G>T	c.(1099-1101)GAG>TAG	p.E367*	CCBE1_uc010dpq.2_Nonsense_Mutation_p.E96*|CCBE1_uc002lia.2_Nonsense_Mutation_p.E220*	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	367					lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				AAAGGGAACTCCTCTGCTGAA	0.517													66	59	---	---	---	---	PASS
SERPINB12	89777	broad.mit.edu	37	18	61232760	61232760	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61232760T>C	uc010xen.1	+	6	728	c.728T>C	c.(727-729)CTG>CCG	p.L243P	SERPINB12_uc010xeo.1_Missense_Mutation_p.L263P	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	243					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						GCACAGATCCTGGAAATGAGG	0.453													12	47	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63525062	63525062	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63525062G>C	uc002ljz.2	+	8	1571	c.1246G>C	c.(1246-1248)GAC>CAC	p.D416H	CDH7_uc002lka.2_Missense_Mutation_p.D416H|CDH7_uc002lkb.2_Missense_Mutation_p.D416H	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	416	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GTACTCAATTGACAGAAACAC	0.353													29	65	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70526277	70526277	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70526277C>A	uc002lkw.2	-	4	537	c.253G>T	c.(253-255)GAT>TAT	p.D85Y	NETO1_uc002lkx.1_Missense_Mutation_p.D84Y|NETO1_uc002lky.1_Missense_Mutation_p.D85Y|NETO1_uc002lkz.2_Missense_Mutation_p.D84Y	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	85	CUB 1.|Extracellular (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TACTTTTCATCAAAGTAAAGT	0.383													15	43	---	---	---	---	PASS
FBXO15	201456	broad.mit.edu	37	18	71740911	71740911	+	Missense_Mutation	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71740911A>C	uc002lle.2	-	10	1426	c.1090T>G	c.(1090-1092)TGT>GGT	p.C364G	FBXO15_uc002lld.2_RNA|FBXO15_uc002llf.2_Missense_Mutation_p.C440G	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	364										ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		GAACTGAAACACCAAAAGGGT	0.478													59	62	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72251777	72251777	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72251777A>T	uc002llq.2	+	12	1714	c.1503A>T	c.(1501-1503)TTA>TTT	p.L501F	CNDP1_uc002lls.2_Missense_Mutation_p.L304F	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	501					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CCTTTTTCTTAGAGATGGCCC	0.403													29	25	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72345798	72345798	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72345798G>A	uc002llw.2	+	1	2880	c.2823G>A	c.(2821-2823)ATG>ATA	p.M941I	ZNF407_uc010xfc.1_Missense_Mutation_p.M941I|ZNF407_uc010dqu.1_Missense_Mutation_p.M941I|ZNF407_uc002llu.2_Missense_Mutation_p.M940I	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	941					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CAGTGACCATGTCAGATGAAC	0.438													4	24	---	---	---	---	PASS
CTDP1	9150	broad.mit.edu	37	18	77477825	77477825	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77477825G>A	uc002lnh.1	+	10	2373	c.2226G>A	c.(2224-2226)GCG>GCA	p.A742A	CTDP1_uc002lni.1_Silent_p.A742A|CTDP1_uc010drd.1_Silent_p.A742A	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	742					positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		ACAGCCCTGCGGCCTTTCCCG	0.667													15	47	---	---	---	---	PASS
RNF126	55658	broad.mit.edu	37	19	652863	652863	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:652863C>A	uc010drs.2	-	2	203	c.97G>T	c.(97-99)GAG>TAG	p.E33*	RNF126_uc002lpi.2_5'Flank	NM_194460	NP_919442	Q9BV68	RN126_HUMAN	ring finger protein 126	33							protein binding|zinc ion binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAACCAGACTCGCATCTTGGA	0.592													8	2	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2191145	2191145	+	Silent	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2191145C>G	uc002lvb.3	+	5	435	c.399C>G	c.(397-399)CCC>CCG	p.P133P		NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	133						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTCTCCCCCGAGGTGTACG	0.602													3	33	---	---	---	---	PASS
PNPLA6	10908	broad.mit.edu	37	19	7618810	7618810	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7618810C>A	uc010xjq.1	+	21	2535	c.2340C>A	c.(2338-2340)AGC>AGA	p.S780R	PNPLA6_uc002mgq.1_Missense_Mutation_p.S732R|PNPLA6_uc010xjp.1_Missense_Mutation_p.S705R|PNPLA6_uc002mgr.1_Missense_Mutation_p.S732R|PNPLA6_uc002mgs.2_Missense_Mutation_p.S770R|PNPLA6_uc002mgt.1_5'Flank	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	771	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						ACCCAGCCAGCAACCTGGCAA	0.607													8	19	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7677726	7677726	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7677726C>T	uc002mgv.3	+	11	2448	c.2347C>T	c.(2347-2349)CAC>TAC	p.H783Y	KIAA1543_uc002mgu.3_Missense_Mutation_p.H810Y|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	783	Pro-rich.				epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CAGCCCGAAACACACGCGGCC	0.741													4	4	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9060167	9060167	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060167G>A	uc002mkp.2	-	3	27483	c.27279C>T	c.(27277-27279)ACC>ACT	p.T9093T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9095	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCAAGGTAAGGGTACCCCTTG	0.473													50	15	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9091069	9091069	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9091069C>A	uc002mkp.2	-	1	950	c.746G>T	c.(745-747)AGA>ATA	p.R249I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	249	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTTTCACCTCTGGAATTTGG	0.473													17	7	---	---	---	---	PASS
MRPL4	51073	broad.mit.edu	37	19	10370337	10370337	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10370337A>T	uc002mnm.2	+	10	938	c.784A>T	c.(784-786)ACG>TCG	p.T262S	MRPL4_uc002mnn.2_Missense_Mutation_p.T262S|MRPL4_uc002mno.2_3'UTR	NM_146387	NP_666499	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4 isoform a	262					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		GCTGGTCCTGACGCTGCCCAC	0.532													10	6	---	---	---	---	PASS
PRKCSH	5589	broad.mit.edu	37	19	11559427	11559427	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11559427C>T	uc002mrt.2	+	14	1584	c.1248C>T	c.(1246-1248)TAC>TAT	p.Y416Y	PRKCSH_uc002mru.2_Silent_p.Y413Y|PRKCSH_uc010xlz.1_Silent_p.Y423Y|PRKCSH_uc010dya.2_Silent_p.Y198Y|PRKCSH_uc010dyb.2_Silent_p.Y413Y	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	416	PRKCSH.				innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						GCCAGTGCTACGAGCTCACCA	0.622													36	10	---	---	---	---	PASS
PKN1	5585	broad.mit.edu	37	19	14552023	14552023	+	Silent	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14552023G>T	uc002myp.2	+	2	258	c.90G>T	c.(88-90)GGG>GGT	p.G30G	PKN1_uc002myq.2_Silent_p.G36G	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2	30					activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						CGGCCCCCGGGGTACAGCAGC	0.687													10	2	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17949164	17949164	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17949164T>G	uc002nhn.3	-	11	1577	c.1477A>C	c.(1477-1479)AGC>CGC	p.S493R	JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Missense_Mutation_p.S493R|JAK3_uc010xpx.1_3'UTR	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	493					B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.S493C(1)		haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						GTGGGTGGGCTGTGACCTCTC	0.512		2	Mis		acute megakaryocytic leukemia|								49	58	---	---	---	---	PASS
SFRS14	10147	broad.mit.edu	37	19	19115271	19115271	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19115271G>A	uc002nkx.2	-	7	2781	c.2635C>T	c.(2635-2637)CCT>TCT	p.P879S	SFRS14_uc002nkz.1_Missense_Mutation_p.P893S|SFRS14_uc002nla.1_Missense_Mutation_p.P879S|SFRS14_uc002nlb.2_Missense_Mutation_p.P879S|SFRS14_uc010xqk.1_Missense_Mutation_p.P648S	NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	splicing factor, arginine/serine-rich 14	879	Asp/Glu-rich.				mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)			TCCCGCGGAGGGGGCTCGTCT	0.517													24	27	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271876	22271876	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271876C>T	uc010ecx.2	+	4	1493	c.1324C>T	c.(1324-1326)CGG>TGG	p.R442W	ZNF257_uc010ecy.2_Missense_Mutation_p.R410W	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	442	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGCCTTTAACCGGTCTTCATA	0.403													7	29	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935911	30935911	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935911C>T	uc002nsu.1	+	2	1580	c.1442C>T	c.(1441-1443)CCG>CTG	p.P481L	ZNF536_uc010edd.1_Missense_Mutation_p.P481L	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	481					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CACGGCGTCCCGGAGGGGGAC	0.662													10	54	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936632	30936632	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936632C>A	uc002nsu.1	+	2	2301	c.2163C>A	c.(2161-2163)TCC>TCA	p.S721S	ZNF536_uc010edd.1_Silent_p.S721S	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	721					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCTCGCCATCCTCCTCAGGTA	0.667													9	11	---	---	---	---	PASS
FXYD5	53827	broad.mit.edu	37	19	35657195	35657195	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35657195G>C	uc002nyg.1	+	8	540	c.454G>C	c.(454-456)GTG>CTG	p.V152L	FXYD5_uc010xsq.1_Missense_Mutation_p.V152L|FXYD5_uc002nyh.1_Missense_Mutation_p.V152L|FXYD5_uc002nyi.1_Missense_Mutation_p.V89L|FXYD5_uc002nyj.1_5'Flank	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5	152	Helical; (Potential).				microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGTCGCAGCTGTGCTGTTCAT	0.567													118	176	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35829214	35829214	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35829214A>T	uc010edt.2	+	6	1206	c.1129A>T	c.(1129-1131)ACA>TCA	p.T377S	CD22_uc010xst.1_Missense_Mutation_p.T205S|CD22_uc010edu.2_Intron|CD22_uc010edv.2_Missense_Mutation_p.T377S|CD22_uc002nzb.3_Intron|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	377	Extracellular (Potential).|Ig-like C2-type 3.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	GCAGGGAAGGACAGAGGAGAA	0.512													32	44	---	---	---	---	PASS
RBM42	79171	broad.mit.edu	37	19	36122069	36122069	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36122069G>T	uc002oan.2	+	3	386	c.310G>T	c.(310-312)GCT>TCT	p.A104S	RBM42_uc010xsx.1_Missense_Mutation_p.A104S|RBM42_uc010eef.2_Missense_Mutation_p.A104S|RBM42_uc002oao.2_Missense_Mutation_p.A104S|RBM42_uc002oap.2_Missense_Mutation_p.A104S|RBM42_uc002oaq.2_Missense_Mutation_p.A104S|RBM42_uc010eeg.2_Missense_Mutation_p.A104S	NM_024321	NP_077297	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	104						cytoplasm|nucleus	nucleotide binding|RNA binding				0	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GGCCCGAGCAGCTGCTGCAGC	0.607													44	91	---	---	---	---	PASS
PRODH2	58510	broad.mit.edu	37	19	36303119	36303119	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36303119G>A	uc002obx.1	-	4	673	c.655C>T	c.(655-657)CGG>TGG	p.R219W		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	219					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGAGGCCCCGTGACAGGTCC	0.642													45	64	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36334412	36334412	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36334412T>A	uc002oby.2	-	17	2296	c.2296A>T	c.(2296-2298)AAT>TAT	p.N766Y		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	766	Ig-like C2-type 7.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGATGGGATTGGCATCGACA	0.552													72	87	---	---	---	---	PASS
CLIP3	25999	broad.mit.edu	37	19	36515422	36515422	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36515422G>T	uc010eeq.1	-	6	1076	c.794C>A	c.(793-795)GCA>GAA	p.A265E	uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.A265E	NM_015526	NP_056341	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	265					chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TAGTGGCACTGCCTCTTCCAG	0.622													6	93	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37904928	37904928	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904928T>G	uc002ogi.2	-	6	1190	c.632A>C	c.(631-633)GAG>GCG	p.E211A	ZNF569_uc002ogh.2_Missense_Mutation_p.E52A|ZNF569_uc002ogj.2_Missense_Mutation_p.E235A	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	211					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAGGGCTTCTCTCCAGTATG	0.368													24	113	---	---	---	---	PASS
SPRED3	399473	broad.mit.edu	37	19	38880956	38880956	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38880956G>A	uc002oim.2	+	1	18	c.14G>A	c.(13-15)CGA>CAA	p.R5Q	GGN_uc002oij.1_5'Flank|GGN_uc002oik.1_5'Flank|GGN_uc010efy.1_5'Flank|SPRED3_uc002oil.1_Missense_Mutation_p.R5Q	NM_001042522	NP_001035987	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	5	WH1.				multicellular organismal development					central_nervous_system(2)|lung(1)|skin(1)	4	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTGCGGGTCCGAGCTGTGGTG	0.657													10	47	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38956762	38956762	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38956762C>A	uc002oit.2	+	24	3032	c.2902C>A	c.(2902-2904)CCG>ACG	p.P968T	RYR1_uc002oiu.2_Missense_Mutation_p.P968T	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	968	2.|Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CAAGCCGGCTCCGCTGGACCT	0.637													11	23	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41029338	41029338	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41029338C>T	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTCCCTCCTCCCCAGGAGAT	0.617													14	13	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43414792	43414792	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43414792A>T	uc002ovj.1	-	3	698	c.646T>A	c.(646-648)TGT>AGT	p.C216S	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.C223S|PSG6_uc002ovi.2_Missense_Mutation_p.C217S|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_5'UTR|PSG6_uc002ovf.1_Missense_Mutation_p.C216S|PSG6_uc002ovg.1_Missense_Mutation_p.C216S	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	216	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				CGTATTTCACATTCATAGGGT	0.512													149	18	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43585075	43585075	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43585075C>T	uc002ovi.2	-	2	481	c.388G>A	c.(388-390)GGG>AGG	p.G130R	PSG6_uc010xwk.1_Intron|PSG2_uc002ovr.2_Missense_Mutation_p.G130R|PSG2_uc002ovq.3_Missense_Mutation_p.G130R|PSG2_uc010eiq.1_Missense_Mutation_p.G130R|PSG2_uc002ovs.3_Missense_Mutation_p.G130R|PSG2_uc002ovt.3_Missense_Mutation_p.G130R			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	129	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				CCTCTAGTCCCATCACCTCGC	0.488													5	247	---	---	---	---	PASS
PSG4	5672	broad.mit.edu	37	19	43702369	43702369	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43702369C>A	uc002ovy.2	-	3	591	c.489G>T	c.(487-489)GAG>GAT	p.E163D	PSG6_uc010xwk.1_Missense_Mutation_p.E2D|PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Intron|PSG4_uc002ovz.2_Missense_Mutation_p.E163D	NM_002780	NP_002771	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4 isoform	163	Ig-like C2-type 1.				defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)				AGATCACAGCCTCCATGGCCT	0.547													127	172	---	---	---	---	PASS
IRGC	56269	broad.mit.edu	37	19	44223577	44223577	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44223577C>A	uc002oxh.2	+	2	1014	c.867C>A	c.(865-867)TAC>TAA	p.Y289*		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	289						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				CGGCCGCCTACGATGATGCGT	0.632													56	84	---	---	---	---	PASS
C5AR1	728	broad.mit.edu	37	19	47823944	47823944	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47823944G>A	uc002pgj.1	+	2	959	c.910G>A	c.(910-912)GGC>AGC	p.G304S		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	304	Cytoplasmic (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CGTGGTGGCCGGCCAGGGCTT	0.587													45	64	---	---	---	---	PASS
C5AR1	728	broad.mit.edu	37	19	47823945	47823945	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47823945G>T	uc002pgj.1	+	2	960	c.911G>T	c.(910-912)GGC>GTC	p.G304V		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	304	Cytoplasmic (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		GTGGTGGCCGGCCAGGGCTTC	0.592													44	63	---	---	---	---	PASS
GRWD1	83743	broad.mit.edu	37	19	48953980	48953980	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48953980G>T	uc002pjd.2	+	5	973	c.740G>T	c.(739-741)GGC>GTC	p.G247V		NM_031485	NP_113673	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	247	WD 1.					nucleolus				ovary(1)	1		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		CCTACGGACGGCGGCTCCTGG	0.597													24	42	---	---	---	---	PASS
PIH1D1	55011	broad.mit.edu	37	19	49950682	49950682	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49950682G>T	uc002pns.2	-	6	808	c.524C>A	c.(523-525)TCG>TAG	p.S175*		NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17	175					box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GTTCTGCTGCGAGATGGAGCC	0.637													16	75	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50462099	50462099	+	Silent	SNP	G	A	A	rs150050230		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50462099G>A	uc010ybh.1	-	7	1255	c.1164C>T	c.(1162-1164)CGC>CGT	p.R388R	SIGLEC11_uc010ybi.1_Silent_p.R388R	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	388	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CACAGACCAGGCGCAGGCTTT	0.682													18	55	---	---	---	---	PASS
ZNF473	25888	broad.mit.edu	37	19	50548559	50548559	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50548559A>T	uc002prn.2	+	5	1096	c.859A>T	c.(859-861)ACT>TCT	p.T287S	ZNF473_uc002prm.2_Missense_Mutation_p.T287S|ZNF473_uc010ybo.1_Missense_Mutation_p.T275S	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473	287					histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		GAAAACTCACACTGGAGAAAA	0.428													77	90	---	---	---	---	PASS
C19orf63	284361	broad.mit.edu	37	19	50984169	50984169	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50984169C>T	uc002psl.2	+	6	679	c.613C>T	c.(613-615)CTG>TTG	p.L205L	C19orf63_uc002psj.2_Silent_p.L205L|C19orf63_uc002psk.2_Silent_p.L205L	NM_206538	NP_996261	Q5UCC4	INM02_HUMAN	hematopoietic signal peptide-containing isoform	205	Extracellular (Potential).					extracellular region|integral to membrane					0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00733)|GBM - Glioblastoma multiforme(134;0.0252)		CATTGAGCGCCTGGAGATGGA	0.652													28	52	---	---	---	---	PASS
CEACAM18	729767	broad.mit.edu	37	19	51981852	51981852	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51981852G>C	uc002pwv.1	+	2	139	c.139G>C	c.(139-141)GTG>CTG	p.V47L		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	47						integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGAGGTGGCTGTGTCTCTGGA	0.637													13	18	---	---	---	---	PASS
ZNF350	59348	broad.mit.edu	37	19	52468188	52468188	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52468188G>A	uc002pyd.2	-	5	1746	c.1518C>T	c.(1516-1518)GAC>GAT	p.D506D	uc002pyb.2_Intron|uc002pyc.2_Intron	NM_021632	NP_067645	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	506					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			breast(1)	1		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		CAAGGTTTCTGTCCTGTGCAA	0.448													27	43	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52619561	52619561	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52619561C>A	uc002pym.2	-	4	1139	c.856G>T	c.(856-858)GTT>TTT	p.V286F	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	286	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CTCTGATGAACTGCAAGGTGG	0.388													48	49	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53959361	53959361	+	Nonsense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53959361A>T	uc010eqp.2	+	7	2058	c.1600A>T	c.(1600-1602)AAG>TAG	p.K534*	ZNF761_uc010ydy.1_Nonsense_Mutation_p.K480*|ZNF761_uc002qbt.1_Nonsense_Mutation_p.K480*	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	534	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		CTTTAGTTGGAAGTCATCCCT	0.443													57	87	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54406349	54406349	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54406349G>T	uc002qcq.1	+	15	1880	c.1598G>T	c.(1597-1599)GGG>GTG	p.G533V	PRKCG_uc010yeg.1_Missense_Mutation_p.G533V|PRKCG_uc010yeh.1_Missense_Mutation_p.G420V	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	533	Protein kinase.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		CAGCCCTATGGGAAGTCTGTC	0.547													175	178	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55179209	55179209	+	Silent	SNP	A	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55179209A>C	uc002qgp.2	+	11	1527	c.1165A>C	c.(1165-1167)AGA>CGA	p.R389R	LILRB4_uc002qgq.2_Silent_p.R388R|LILRB4_uc002qgr.2_Silent_p.R431R|LILRB4_uc010ert.2_Silent_p.R430R|LILRB4_uc010eru.2_Silent_p.R419R	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	389	Cytoplasmic (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		CACAAAGGACAGACAGGCAGA	0.587													3	30	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55377877	55377877	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55377877G>C	uc002qhl.3	+	8	1221	c.1158G>C	c.(1156-1158)CAG>CAC	p.Q386H	KIR3DL2_uc010esh.2_Missense_Mutation_p.Q369H|KIR3DL2_uc002qho.3_Missense_Mutation_p.Q386H			P43629	KI3L1_HUMAN	SubName: Full=KIR3DS1;	386	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		TGAATAGGCAGGTAGGTCCTC	0.547													75	56	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55708790	55708790	+	Intron	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55708790A>T	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Intron	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GGGAGCTGAGAAGTGAGAACA	0.537													27	24	---	---	---	---	PASS
ZNF579	163033	broad.mit.edu	37	19	56090015	56090015	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56090015C>T	uc002qlh.2	-	2	1044	c.991G>A	c.(991-993)GCG>ACG	p.A331T		NM_152600	NP_689813	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	331	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		TTGCCCGCCGCGGGCAGCGGG	0.751													5	30	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243490	56243490	+	Silent	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243490G>A	uc002qly.2	-	2	1735	c.1707C>T	c.(1705-1707)TTC>TTT	p.F569F		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	569						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAATATAAATGAAAACTTCTT	0.343													12	65	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56321237	56321237	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56321237T>A	uc010ygf.1	-	5	1450	c.739A>T	c.(739-741)AGT>TGT	p.S247C	NLRP11_uc002qlz.2_Missense_Mutation_p.S148C|NLRP11_uc002qmb.2_Missense_Mutation_p.S148C|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	247	NACHT.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GTGCTGTTACTACACAAAGCA	0.463													17	64	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56329297	56329297	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56329297A>G	uc010ygf.1	-	4	955	c.244T>C	c.(244-246)TGT>CGT	p.C82R	NLRP11_uc002qmb.2_Intron|NLRP11_uc002qmc.2_Intron|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	82	DAPIN.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ATCTTCCTACAAAGATCTTCC	0.448													27	39	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56379151	56379151	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56379151T>A	uc002qmd.3	+	6	2685	c.2263T>A	c.(2263-2265)TAT>AAT	p.Y755N	NLRP4_uc002qmf.2_Missense_Mutation_p.Y680N|NLRP4_uc010etf.2_Intron	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	755	LRR 4.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GAAGCTGACGTATCTGAATGT	0.498													36	84	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56473426	56473426	+	Intron	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56473426C>G	uc002qmh.2	+						NLRP8_uc010etg.2_Intron	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8							cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TTCTCCCTTCCATGTAGAGCG	0.498													78	69	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56487650	56487650	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56487650T>A	uc002qmh.2	+	8	2928	c.2857T>A	c.(2857-2859)TGT>AGT	p.C953S	NLRP8_uc010etg.2_Missense_Mutation_p.C934S	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	953						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GAACCCTGACTGTACATTACA	0.448													9	56	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57327553	57327553	+	Missense_Mutation	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57327553T>A	uc002qnu.2	-	7	2608	c.2257A>T	c.(2257-2259)AGC>TGC	p.S753C	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.S724C|PEG3_uc002qnv.2_Missense_Mutation_p.S753C|PEG3_uc002qnw.2_Missense_Mutation_p.S629C|PEG3_uc002qnx.2_Missense_Mutation_p.S627C|PEG3_uc010etr.2_Missense_Mutation_p.S753C	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	753					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGGTTAGAGCTAATGGTGAAC	0.408													88	173	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57670559	57670559	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57670559C>G	uc002qoa.1	-	3	313	c.268G>C	c.(268-270)GAT>CAT	p.D90H		NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A	90						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CCAGGTTGATCTTGCCCCTGG	0.458													10	127	---	---	---	---	PASS
ZNF135	7694	broad.mit.edu	37	19	58578313	58578313	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58578313C>A	uc010yhq.1	+	5	593	c.497C>A	c.(496-498)ACG>AAG	p.T166K	ZNF135_uc002qre.2_Missense_Mutation_p.T154K|ZNF135_uc002qrd.1_Missense_Mutation_p.T112K|ZNF135_uc002qrf.2_Missense_Mutation_p.T112K|ZNF135_uc002qrg.2_Missense_Mutation_p.T124K|ZNF135_uc010yhr.1_5'UTR	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	166					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCTGTGAAGACGCCTGTTCTG	0.557													29	24	---	---	---	---	PASS
ZNF274	10782	broad.mit.edu	37	19	58724257	58724257	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58724257G>T	uc002qrq.1	+	10	2169	c.1710G>T	c.(1708-1710)AGG>AGT	p.R570S	ZNF274_uc002qrr.1_Missense_Mutation_p.R538S|ZNF274_uc002qrs.1_Missense_Mutation_p.R465S|ZNF274_uc010eum.1_Missense_Mutation_p.R329S	NM_133502	NP_598009	Q96GC6	ZN274_HUMAN	zinc finger protein 274 isoform c	570	C2H2-type 3.				viral reproduction	centrosome|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AGTGTGGGAGGACCTTCAATG	0.522													31	33	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58966989	58966989	+	Silent	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58966989A>G	uc002qsv.1	+	4	785	c.678A>G	c.(676-678)GCA>GCG	p.A226A	ZNF324B_uc002qsu.1_Silent_p.A216A|ZNF324B_uc010euq.1_Silent_p.A226A	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	226					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GAATGGGCGCAGCTTGGCAGG	0.647													10	26	---	---	---	---	PASS
TRIB3	57761	broad.mit.edu	37	20	368924	368924	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:368924A>T	uc002wdm.2	+	2	776	c.270A>T	c.(268-270)ACA>ACT	p.T90T	TRIB3_uc002wdn.2_Silent_p.T117T	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN	tribbles 3	90	Protein kinase.				apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		ACTGCCCTACAGGCACTGAGT	0.662													30	47	---	---	---	---	PASS
SIRPB2	284759	broad.mit.edu	37	20	1458025	1458025	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1458025C>A	uc002wfg.2	-	4	1045	c.817G>T	c.(817-819)GCA>TCA	p.A273S	SIRPB2_uc002wfh.3_Missense_Mutation_p.A175S|SIRPB2_uc010zpr.1_Missense_Mutation_p.A135S	NM_001122962	NP_001116434	Q5JXA9	SIRB2_HUMAN	signal-regulatory protein beta 2 isoform 1	273	Extracellular (Potential).					integral to membrane					0						GTGAATTCTGCCTCTTTGGAA	0.512													56	70	---	---	---	---	PASS
SMOX	54498	broad.mit.edu	37	20	4163291	4163291	+	Missense_Mutation	SNP	G	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4163291G>C	uc002wkm.1	+	5	1366	c.1165G>C	c.(1165-1167)GAG>CAG	p.E389Q	SMOX_uc002wkk.1_Missense_Mutation_p.E336Q|SMOX_uc002wkl.1_Missense_Mutation_p.E336Q|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.E389Q|SMOX_uc010zqo.1_Missense_Mutation_p.E313Q|SMOX_uc002wko.1_Missense_Mutation_p.E389Q	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	389					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	GTTTGTGTGGGAGGACGAAGC	0.597													18	18	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4880189	4880189	+	Intron	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4880189C>G	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						CCCATTAGTACCCCAATCTCA	0.542													71	145	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5294857	5294857	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5294857C>A	uc010zqw.1	-	1	159	c.159G>T	c.(157-159)AAG>AAT	p.K53N	PROKR2_uc010zqx.1_Missense_Mutation_p.K53N|PROKR2_uc010zqy.1_Missense_Mutation_p.K53N|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	53	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CAATGACGATCTTGGCTGCGA	0.517										HNSCC(71;0.22)			39	54	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9388677	9388677	+	Silent	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9388677A>T	uc002wnf.2	+	20	1861	c.1725A>T	c.(1723-1725)GTA>GTT	p.V575V	PLCB4_uc010gbw.1_Silent_p.V575V|PLCB4_uc010gbx.2_Silent_p.V587V|PLCB4_uc002wne.2_Silent_p.V575V|PLCB4_uc002wnh.2_Silent_p.V422V	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	575	PI-PLC Y-box.				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						CCCAGCCTGTAAAGTTTCAAG	0.403													71	108	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9538323	9538323	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9538323G>T	uc002wnl.2	-	8	2220	c.1675C>A	c.(1675-1677)CTT>ATT	p.L559I	PAK7_uc002wnk.2_Missense_Mutation_p.L559I|PAK7_uc002wnj.2_Missense_Mutation_p.L559I|PAK7_uc010gby.1_Missense_Mutation_p.L559I	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	559	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			TGGTTATGAAGGTAGGAGAGA	0.438													35	29	---	---	---	---	PASS
DEFB118	117285	broad.mit.edu	37	20	29960684	29960684	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29960684G>T	uc002wvr.2	+	2	109	c.83G>T	c.(82-84)TGG>TTG	p.W28L		NM_054112	NP_473453	Q96PH6	DB118_HUMAN	beta-defensin 118 precursor	28					cell-matrix adhesion|defense response to bacterium|innate immune response|spermatogenesis	extracellular region				ovary(3)|pancreas(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AAAAAATGCTGGAACAGATCA	0.398													15	22	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33329845	33329845	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33329845C>A	uc002xav.2	-	12	6786	c.4215G>T	c.(4213-4215)GTG>GTT	p.V1405V	NCOA6_uc002xaw.2_Silent_p.V1405V	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1405					brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						CAACTGCAGCCACAGACACAG	0.498													36	47	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41408888	41408888	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41408888C>A	uc002xkg.2	-	4	722	c.538G>T	c.(538-540)GAC>TAC	p.D180Y	PTPRT_uc010ggj.2_Missense_Mutation_p.D180Y	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	180	Extracellular (Potential).|MAM.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGGACCTCGTCCACGGCGATG	0.527													24	36	---	---	---	---	PASS
L3MBTL	26013	broad.mit.edu	37	20	42158983	42158983	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42158983G>T	uc010zwh.1	+	10	1096	c.1050G>T	c.(1048-1050)TGG>TGT	p.W350C	L3MBTL_uc002xkl.2_Missense_Mutation_p.W282C|L3MBTL_uc002xkm.2_Missense_Mutation_p.W282C|L3MBTL_uc010ggl.2_Missense_Mutation_p.W282C|L3MBTL_uc002xkn.1_Missense_Mutation_p.W41C|L3MBTL_uc002xko.2_5'Flank	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	282	MBT 1.				chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ATGACTTCTGGGTCAATGCCA	0.562													42	70	---	---	---	---	PASS
SGK2	10110	broad.mit.edu	37	20	42196293	42196293	+	Intron	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42196293C>T	uc002xkv.2	+						SGK2_uc002xkt.2_Intron|SGK2_uc002xkr.2_Intron|SGK2_uc010ggm.2_Intron|SGK2_uc002xks.2_Intron|SGK2_uc002xku.2_Intron|SGK2_uc002xkq.1_Intron	NM_016276	NP_057360	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2 isoform						intracellular protein kinase cascade|response to oxidative stress		ATP binding|potassium channel regulator activity|protein serine/threonine kinase activity|sodium channel regulator activity			lung(3)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	6		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GTGTTTTTCCCTCTTCCCCCA	0.517													36	46	---	---	---	---	PASS
YWHAB	7529	broad.mit.edu	37	20	43530314	43530314	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43530314C>T	uc002xmt.2	+	3	422	c.140C>T	c.(139-141)TCT>TTT	p.S47F	YWHAB_uc002xmu.2_Missense_Mutation_p.S47F	NM_003404	NP_003395	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan	47					activation of MAPKK activity|activation of pro-apoptotic gene products|axon guidance|cytoplasmic sequestering of protein|epidermal growth factor receptor signaling pathway|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|mRNA metabolic process|negative regulation of protein dephosphorylation|nerve growth factor receptor signaling pathway|Ras protein signal transduction	centrosome|cytosol|melanosome|perinuclear region of cytoplasm	histone deacetylase binding|phosphoserine binding|protein domain specific binding			kidney(2)|ovary(1)|breast(1)	4		Myeloproliferative disorder(115;0.0122)				AATCTGCTCTCTGTTGCCTAC	0.527													25	36	---	---	---	---	PASS
CD40	958	broad.mit.edu	37	20	44751260	44751260	+	Missense_Mutation	SNP	C	T	T	rs144542285		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44751260C>T	uc002xrg.1	+	4	345	c.268C>T	c.(268-270)CGG>TGG	p.R90W	CD40_uc002xrf.1_Missense_Mutation_p.R90W|CD40_uc002xrh.1_Missense_Mutation_p.R90W|CD40_uc002xri.1_Missense_Mutation_p.R90W|CD40_uc002xrj.1_RNA|CD40_uc002xrk.1_RNA	NM_001250	NP_001241	P25942	TNR5_HUMAN	CD40 antigen isoform 1 precursor	90	TNFR-Cys 2.|Extracellular (Potential).				B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity			lung(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)			Simvastatin(DB00641)	CCTAGGGCTTCGGGTCCAGCA	0.587									Immune_Deficiency_with_Hyper-IgM				22	31	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45905058	45905058	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45905058C>A	uc002xta.1	-	11	1674	c.1420G>T	c.(1420-1422)GCT>TCT	p.A474S	ZMYND8_uc010ghq.1_Missense_Mutation_p.A151S|ZMYND8_uc010ghr.1_Missense_Mutation_p.A449S|ZMYND8_uc002xst.1_Missense_Mutation_p.D449Y|ZMYND8_uc002xsu.1_Missense_Mutation_p.A474S|ZMYND8_uc002xsv.1_Missense_Mutation_p.D449Y|ZMYND8_uc002xsw.1_Missense_Mutation_p.A226S|ZMYND8_uc002xsx.1_Missense_Mutation_p.A226S|ZMYND8_uc002xsy.1_Missense_Mutation_p.A449S|ZMYND8_uc002xsz.1_Missense_Mutation_p.A411S|ZMYND8_uc010zxy.1_Missense_Mutation_p.A501S|ZMYND8_uc002xtb.1_Missense_Mutation_p.A494S|ZMYND8_uc002xss.2_Missense_Mutation_p.A474S|ZMYND8_uc010zxz.1_Missense_Mutation_p.A469S|ZMYND8_uc002xtc.1_Missense_Mutation_p.A494S|ZMYND8_uc002xtd.1_Missense_Mutation_p.A469S|ZMYND8_uc002xte.1_Missense_Mutation_p.A474S|ZMYND8_uc010zya.1_Missense_Mutation_p.A474S|ZMYND8_uc002xtf.1_Missense_Mutation_p.A494S|ZMYND8_uc002xtg.2_Missense_Mutation_p.A468S|ZMYND8_uc010ghs.1_Missense_Mutation_p.A468S	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b	474							protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			CGGAGCTGACCTGTGCTCTTA	0.632													9	17	---	---	---	---	PASS
SPATA2	9825	broad.mit.edu	37	20	48522559	48522559	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48522559C>A	uc010gie.2	-	3	1510	c.1160G>T	c.(1159-1161)GGG>GTG	p.G387V	SPATA2_uc002xuw.2_Missense_Mutation_p.G387V|SPATA2_uc010zyn.1_Missense_Mutation_p.G250V	NM_001135773	NP_001129245	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	387					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			GCAGGACAGCCCGCAGCTTTG	0.647													14	27	---	---	---	---	PASS
BCAS1	8537	broad.mit.edu	37	20	52645317	52645317	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52645317C>A	uc002xws.2	-	4	675	c.337G>T	c.(337-339)GAT>TAT	p.D113Y	BCAS1_uc010zzb.1_Missense_Mutation_p.D16Y|BCAS1_uc010gim.2_Missense_Mutation_p.D16Y|BCAS1_uc002xwt.2_Missense_Mutation_p.D113Y|BCAS1_uc010gil.1_Missense_Mutation_p.D113Y|BCAS1_uc010zzc.1_Missense_Mutation_p.D16Y	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	113						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			AGGGATGAATCTGCGGCTTGG	0.537													21	45	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027069	55027069	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027069C>A	uc002xxp.2	+	6	1062	c.837C>A	c.(835-837)TTC>TTA	p.F279L	CASS4_uc002xxq.3_Missense_Mutation_p.F279L|CASS4_uc002xxr.2_Missense_Mutation_p.F279L|CASS4_uc010zze.1_Missense_Mutation_p.F225L|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	279					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						GCTCCACTTTCTACAATCCTC	0.517													21	38	---	---	---	---	PASS
EDN3	1908	broad.mit.edu	37	20	57896191	57896191	+	Missense_Mutation	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57896191T>C	uc002yap.2	+	3	854	c.485T>C	c.(484-486)GTG>GCG	p.V162A	EDN3_uc002yao.1_Missense_Mutation_p.V162A|EDN3_uc002yaq.2_Missense_Mutation_p.V162A|EDN3_uc002yar.2_Missense_Mutation_p.V162A|EDN3_uc002yas.2_Missense_Mutation_p.V162A	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein	162	Endothelin-like.				cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					TGCGCTTGTGTGGGGAGATAT	0.557													61	72	---	---	---	---	PASS
CDH26	60437	broad.mit.edu	37	20	58571763	58571763	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58571763G>T	uc002ybe.2	+	13	2266	c.1966G>T	c.(1966-1968)GGC>TGC	p.G656C	CDH26_uc002ybf.1_Missense_Mutation_p.G236C|CDH26_uc010zzy.1_RNA|CDH26_uc002ybg.2_Missense_Mutation_p.G170C|CDH26_uc002ybh.2_Intron|CDH26_uc002ybi.2_Intron	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a	656	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CAATGATGAAGGCCACCAAAC	0.438													76	82	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34921983	34921983	+	Missense_Mutation	SNP	A	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34921983A>G	uc002yse.1	+	3	495	c.446A>G	c.(445-447)GAT>GGT	p.D149G	SON_uc002ysb.1_Missense_Mutation_p.D149G|SON_uc002ysc.2_Missense_Mutation_p.D149G|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	149					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						GGGAACATAGATTTAGAATCT	0.328													22	10	---	---	---	---	PASS
KCNJ15	3772	broad.mit.edu	37	21	39671792	39671792	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39671792G>T	uc002ywv.2	+	4	911	c.609G>T	c.(607-609)AGG>AGT	p.R203S	KCNJ15_uc002yww.2_Missense_Mutation_p.R203S|KCNJ15_uc002ywx.2_Missense_Mutation_p.R203S	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15	203	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						CCAATATGAGGAAGAGCCTCT	0.537													20	16	---	---	---	---	PASS
MMP11	4320	broad.mit.edu	37	22	24121573	24121573	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24121573G>T	uc002zxx.2	+	2	330	c.308G>T	c.(307-309)GGG>GTG	p.G103V	MMP11_uc002zxy.2_Intron|MMP11_uc002zxz.2_5'Flank	NM_005940	NP_005931	P24347	MMP11_HUMAN	matrix metalloproteinase 11 preproprotein	103					collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|large_intestine(1)	3		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)				CTTTCTGGCGGGCGCTGGGAG	0.662													8	10	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26231381	26231381	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26231381C>A	uc003abz.1	+	17	3429	c.3179C>A	c.(3178-3180)GCT>GAT	p.A1060D	MYO18B_uc003aca.1_Missense_Mutation_p.A941D|MYO18B_uc010guy.1_Missense_Mutation_p.A942D|MYO18B_uc010guz.1_Missense_Mutation_p.A941D|MYO18B_uc011aka.1_Missense_Mutation_p.A214D|MYO18B_uc011akb.1_Missense_Mutation_p.A573D	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1060	Myosin head-like.			A -> T (in Ref. 3; AAL75811).		nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CTGTGTGCTGCTTTCGAGAAG	0.567													25	47	---	---	---	---	PASS
TFIP11	24144	broad.mit.edu	37	22	26906143	26906143	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26906143C>G	uc003acr.2	-	3	470	c.96G>C	c.(94-96)CAG>CAC	p.Q32H	TFIP11_uc003acs.2_Missense_Mutation_p.Q32H|TFIP11_uc003act.2_Missense_Mutation_p.Q32H	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	32					biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						TGAACTCATTCTGGAGATCCC	0.562													43	61	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28195100	28195100	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28195100G>T	uc003adj.2	-	1	2387	c.1432C>A	c.(1432-1434)CAC>AAC	p.H478N		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	478							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						GCGCCGTTGTGCATGCTGCCG	0.672			T	ETV6	AML|meningioma								7	10	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32293623	32293623	+	Silent	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32293623C>T	uc003als.2	+	39	4408	c.4266C>T	c.(4264-4266)AGC>AGT	p.S1422S	DEPDC5_uc011als.1_Silent_p.S1353S|DEPDC5_uc011alu.1_Silent_p.S1453S|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Silent_p.S1444S|DEPDC5_uc003alu.2_Silent_p.S871S|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_Silent_p.S720S|DEPDC5_uc011alx.1_Silent_p.S270S|DEPDC5_uc010gwk.2_Silent_p.S448S|DEPDC5_uc011aly.1_Silent_p.S270S	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1422					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						AGGAGGGCAGCGAGCACCTGT	0.537													30	51	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34046429	34046429	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34046429C>A	uc003and.3	-	4	911	c.332G>T	c.(331-333)AGC>ATC	p.S111I	LARGE_uc003ane.3_Missense_Mutation_p.S111I|LARGE_uc010gwp.2_Missense_Mutation_p.S111I|LARGE_uc011ame.1_Missense_Mutation_p.S43I|LARGE_uc011amf.1_Missense_Mutation_p.S111I	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	111	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				AAGGTTCTCGCTGTCTCCAGT	0.662													40	57	---	---	---	---	PASS
CSF2RB	1439	broad.mit.edu	37	22	37333900	37333900	+	Nonsense_Mutation	SNP	G	T	T	rs150659075	byFrequency	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37333900G>T	uc003aqa.3	+	14	2267	c.2050G>T	c.(2050-2052)GGA>TGA	p.G684*	CSF2RB_uc003aqc.3_Nonsense_Mutation_p.G690*	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	684	Cytoplasmic (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GCCAAGGGTGGGAGGACAGGA	0.652													12	2	---	---	---	---	PASS
APOBEC3F	200316	broad.mit.edu	37	22	39448112	39448112	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39448112T>G	uc003aww.2	+	6	1050	c.757T>G	c.(757-759)TGC>GGC	p.C253G		NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	261					base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					TGCAGAAAGGTGCTTCCTCTC	0.577													60	19	---	---	---	---	PASS
TEF	7008	broad.mit.edu	37	22	41783378	41783378	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41783378C>G	uc003azy.2	+	2	267	c.181C>G	c.(181-183)CTG>GTG	p.L61V	TEF_uc003azx.2_Missense_Mutation_p.L31V|TEF_uc011apa.1_Missense_Mutation_p.L66V	NM_003216	NP_003207	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 1	61					rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GAAGGAAAAGCTGGAGGAGGA	0.532													11	29	---	---	---	---	PASS
PARVG	64098	broad.mit.edu	37	22	44592283	44592283	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44592283T>C	uc011aqe.1	+	11	1123	c.699T>C	c.(697-699)AAT>AAC	p.N233N	PARVG_uc003bep.2_Silent_p.N233N|PARVG_uc011aqf.1_Silent_p.N233N|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma	233	CH 2.				cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				CTGTGCAGAATCTGGACACCC	0.612													18	39	---	---	---	---	PASS
ARSH	347527	broad.mit.edu	37	X	2933302	2933302	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2933302G>T	uc011mhj.1	+	4	632	c.632G>T	c.(631-633)TGG>TTG	p.W211L		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	211						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTCACTTCCTGGTACTCTAGT	0.458													10	4	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3229352	3229352	+	Missense_Mutation	SNP	T	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3229352T>G	uc004crg.3	-	7	7049	c.6892A>C	c.(6892-6894)ACC>CCC	p.T2298P		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2298	Ig-like C2-type 7.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TAGCGCTTGGTGCGTCCACCG	0.562													25	8	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5821361	5821361	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5821361G>T	uc010ndh.2	-	5	1859	c.1358C>A	c.(1357-1359)GCC>GAC	p.A453D	NLGN4X_uc004crp.2_Missense_Mutation_p.A473D|NLGN4X_uc004crq.2_Missense_Mutation_p.A453D|NLGN4X_uc010ndi.2_Missense_Mutation_p.A490D|NLGN4X_uc004crr.2_Missense_Mutation_p.A453D|NLGN4X_uc010ndj.2_Missense_Mutation_p.A453D	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	453	Extracellular (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						GGTGGCCACGGCGGGGGCCAC	0.592													16	4	---	---	---	---	PASS
SH3KBP1	30011	broad.mit.edu	37	X	19568202	19568202	+	Splice_Site	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19568202C>T	uc004czm.2	-	14	1701	c.1385_splice	c.e14-1	p.D462_splice	SH3KBP1_uc011mje.1_Splice_Site_p.D201_splice|SH3KBP1_uc011mjf.1_Splice_Site_p.D224_splice|SH3KBP1_uc004czl.2_Splice_Site_p.D425_splice|SH3KBP1_uc010nfm.2_Splice_Site	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						CCTTCTAAGTCTAAAACAAAA	0.423													23	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26178974	26178974	+	IGR	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26178974C>A								MAGEB18 (20122 upstream) : MAGEB6 (31583 downstream)																							GATGTGGCTGCCATGGGTCAA	0.527													24	17	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30237315	30237315	+	Silent	SNP	T	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30237315T>A	uc004dbz.2	+	2	721	c.618T>A	c.(616-618)CCT>CCA	p.P206P		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	206	MAGE.						protein binding			ovary(1)	1						TTCTGATGCCTCTCCTGGGTG	0.498													9	3	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148669	34148669	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148669C>T	uc004ddg.2	-	1	1760	c.1727G>A	c.(1726-1728)CGA>CAA	p.R576Q		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	576										ovary(4)|central_nervous_system(1)	5						GTAGGATGCTCGAATCTTGGG	0.512													30	8	---	---	---	---	PASS
CYBB	1536	broad.mit.edu	37	X	37670107	37670107	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37670107C>A	uc004ddr.2	+	13	1711	c.1650C>A	c.(1648-1650)AGC>AGA	p.S550R	CYBB_uc011mkf.1_Missense_Mutation_p.S518R|CYBB_uc011mkg.1_Missense_Mutation_p.S283R	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	550	Cytoplasmic (Potential).				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						GTAAACAAAGCATCTCCAACT	0.418													27	6	---	---	---	---	PASS
SRPX	8406	broad.mit.edu	37	X	38008974	38008974	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38008974C>A	uc004ddy.1	-	10	1471	c.1385G>T	c.(1384-1386)TGT>TTT	p.C462F	SRPX_uc004ddz.1_Missense_Mutation_p.C442F|SRPX_uc011mkh.1_Missense_Mutation_p.C403F|SRPX_uc011mki.1_3'UTR	NM_006307	NP_006298	P78539	SRPX_HUMAN	sushi-repeat-containing protein, X-linked	462					cell adhesion	cell surface|membrane					0						TCAGGTGTTACAGGTCTGGCT	0.453													12	1	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64709195	64709195	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64709195G>T	uc010nko.2	+	1	490	c.481G>T	c.(481-483)GAG>TAG	p.E161*		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	161							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CAGCTCCAGAGAGATTGCAAG	0.448													39	11	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65423209	65423209	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65423209C>T	uc011moz.1	+	13	2150	c.2090C>T	c.(2089-2091)ACA>ATA	p.T697I	HEPH_uc004dwn.2_Missense_Mutation_p.T697I|HEPH_uc004dwo.2_Missense_Mutation_p.T427I|HEPH_uc010nkr.2_Missense_Mutation_p.T505I|HEPH_uc011mpa.1_Missense_Mutation_p.T697I|HEPH_uc010nks.2_5'UTR	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	694	Plastocyanin-like 4.|Extracellular (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CCCTCAGGGACATTTGAGATT	0.527													9	22	---	---	---	---	PASS
ARR3	407	broad.mit.edu	37	X	69500607	69500607	+	Intron	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69500607T>C	uc004dyb.2	+						ARR3_uc004dya.2_Intron|RAB41_uc004dyc.2_5'Flank|RAB41_uc010nkv.2_5'Flank	NM_004312	NP_004303	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)						signal transduction|visual perception	cytoplasm|soluble fraction				large_intestine(2)|ovary(2)	4						CACCTTGGGATCCTTGCAGCG	0.547													10	24	---	---	---	---	PASS
ZCCHC5	203430	broad.mit.edu	37	X	77912828	77912828	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77912828C>A	uc004edc.1	-	2	1386	c.1090G>T	c.(1090-1092)GGT>TGT	p.G364C		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	364							nucleic acid binding|zinc ion binding			ovary(1)	1						CTGGCAAGACCTTCTTGAAAT	0.493													26	7	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91642888	91642888	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91642888C>T	uc004efk.1	+	5	4144	c.3299C>T	c.(3298-3300)CCC>CTC	p.P1100L	PCDH11X_uc004efl.1_Missense_Mutation_p.P1090L|PCDH11X_uc004efo.1_Missense_Mutation_p.P1063L|PCDH11X_uc010nmv.1_Intron|PCDH11X_uc004efm.1_Missense_Mutation_p.P1100L|PCDH11X_uc004efn.1_Missense_Mutation_p.P1090L	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1100	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CGTGCTACACCCAGCAATCGC	0.517													25	4	---	---	---	---	PASS
TNMD	64102	broad.mit.edu	37	X	99854696	99854696	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99854696C>A	uc004efy.3	+	7	1162	c.936C>A	c.(934-936)CGC>CGA	p.R312R	TNMD_uc004efz.2_3'UTR	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN	tenomodulin	312	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						GGGTGGCCCGCATGCTGGGGA	0.463													10	2	---	---	---	---	PASS
GLRA4	441509	broad.mit.edu	37	X	102977157	102977157	+	Missense_Mutation	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102977157G>T	uc011mse.1	-	6	1062	c.641C>A	c.(640-642)GCT>GAT	p.A214D	GLRA4_uc010nou.2_Missense_Mutation_p.A214D	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	214	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						CAGCCCCTCAGCCACTTGGAC	0.502													90	23	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105190366	105190366	+	Missense_Mutation	SNP	A	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105190366A>T	uc004emd.2	+	26	4566	c.4263A>T	c.(4261-4263)AAA>AAT	p.K1421N	NRK_uc011msi.1_5'Flank	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1421	CNH.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GTTCTGAAAAAAGACTAAAGA	0.393										HNSCC(51;0.14)			12	28	---	---	---	---	PASS
VSIG1	340547	broad.mit.edu	37	X	107301436	107301436	+	Intron	SNP	G	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107301436G>T	uc004eno.2	+						VSIG1_uc011msk.1_Intron	NM_182607	NP_872413	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2						ATTTCTGTAAGGACACTTTTT	0.438													16	3	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107448925	107448925	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107448925C>A	uc004enw.3	-	10	716	c.613G>T	c.(613-615)GGT>TGT	p.G205C	COL4A6_uc004env.3_Missense_Mutation_p.G204C|COL4A6_uc011msn.1_Missense_Mutation_p.G204C|COL4A6_uc010npk.2_Missense_Mutation_p.G204C	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	205	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CCTGGAGGACCCTAGATTTTT	0.428									Alport_syndrome_with_Diffuse_Leiomyomatosis				16	7	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108619153	108619153	+	Missense_Mutation	SNP	C	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108619153C>T	uc004eod.3	-	19	3578	c.3302G>A	c.(3301-3303)AGG>AAG	p.R1101K	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	1101	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						CACCAACTGCCTTTCTGCTTT	0.502													59	21	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127185755	127185755	+	Missense_Mutation	SNP	G	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185755G>A	uc004eum.2	-	1	628	c.431C>T	c.(430-432)GCG>GTG	p.A144V		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	144						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						GGCATAGAGCGCTGCCACCGC	0.527													36	75	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130218252	130218252	+	Missense_Mutation	SNP	C	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130218252C>G	uc004evz.2	+	5	964	c.619C>G	c.(619-621)CAG>GAG	p.Q207E	ARHGAP36_uc004ewa.2_Missense_Mutation_p.Q195E|ARHGAP36_uc004ewb.2_Missense_Mutation_p.Q176E|ARHGAP36_uc004ewc.2_Missense_Mutation_p.Q71E	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	207					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						GCAGACCCTGCAGCTTTCAAA	0.473													25	4	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135432348	135432348	+	Silent	SNP	T	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135432348T>C	uc004ezu.1	+	6	6774	c.6483T>C	c.(6481-6483)ACT>ACC	p.T2161T	GPR112_uc010nsb.1_Silent_p.T1956T|GPR112_uc010nsc.1_Silent_p.T1928T	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2161	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					GAATTCCAACTGCATCATCAC	0.433													41	6	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138713648	138713648	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138713648C>A	uc004fau.2	-	3	488	c.194G>T	c.(193-195)AGT>ATT	p.S65I	MCF2_uc004fav.2_Missense_Mutation_p.S65I|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Missense_Mutation_p.S65I|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Missense_Mutation_p.S210I|MCF2_uc004faw.2_Missense_Mutation_p.S125I|MCF2_uc011mwo.1_Missense_Mutation_p.S125I	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	65	CRAL-TRIO.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CAGCAAATCACTAACTGAGCT	0.398													41	13	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140985491	140985491	+	Missense_Mutation	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140985491C>A	uc011mwp.1	+	8	1805	c.1805C>A	c.(1804-1806)TCC>TAC	p.S602Y	MAGEC3_uc004fbs.2_3'UTR|MAGEC3_uc010nsj.2_3'UTR	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	602	MAGE 2.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTTTCCATCCTGGTACATG	0.478													47	6	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151818973	151818973	+	Silent	SNP	C	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151818973C>A	uc004ffp.1	+	7	851	c.831C>A	c.(829-831)GTC>GTA	p.V277V		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	277	Helical; (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGCCTACTGTCCTCACCACTA	0.473													156	20	---	---	---	---	PASS
NADK	65220	broad.mit.edu	37	1	1688587	1688588	+	Intron	INS	-	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1688587_1688588insC	uc009vkw.2	-						NADK_uc001aic.2_Intron|NADK_uc001aid.3_Intron|NADK_uc001aie.2_Frame_Shift_Ins_p.G246fs|NADK_uc010nyv.1_Intron|NADK_uc009vkx.1_Intron	NM_023018	NP_075394	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process|NAD metabolic process|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|NAD+ kinase activity|protein binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		CTCCATGTGCACCCCAGGCCCC	0.634													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24814065	24814066	+	IGR	INS	-	GGAGGGAA	GGAGGGAA	rs140464813	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24814065_24814066insGGAGGGAA								NIPAL3 (14593 upstream) : RCAN3 (15321 downstream)																							GGGggagggagggaaggaagga	0.040													4	3	---	---	---	---	
KPNA6	23633	broad.mit.edu	37	1	32623754	32623754	+	Intron	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32623754delG	uc001bug.2	+						KPNA6_uc001buh.2_Intron|KPNA6_uc010ogx.1_Intron|KPNA6_uc010ogy.1_Intron|KPNA6_uc009vtz.2_Intron	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AAGGGAGTTTGGGAATGTTTG	0.393													8	27	---	---	---	---	
CC2D1B	200014	broad.mit.edu	37	1	52828278	52828278	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52828278delC	uc001ctq.1	-	3	348	c.210delG	c.(208-210)GGGfs	p.G70fs	CC2D1B_uc001cts.2_5'Flank	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	70										ovary(2)	2						ACTCACCCTGCCCCTTGGGTG	0.607													65	115	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121137803	121137805	+	IGR	DEL	CCA	-	-	rs60375635	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121137803_121137805delCCA								FCGR1B (201859 upstream) : LOC647121 (123105 downstream)																							ACCGCCGCCGCCACGGCTTTTTG	0.645													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143217265	143217266	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143217265_143217266insA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		GTTAGTAAAGCAAAAAAAAAAC	0.282													9	4	---	---	---	---	
ABL2	27	broad.mit.edu	37	1	179078241	179078242	+	Frame_Shift_Ins	INS	-	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179078241_179078242insC	uc001gmj.3	-	12	2447_2448	c.2160_2161insG	c.(2158-2163)GGGAGCfs	p.G720fs	ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Frame_Shift_Ins_p.G699fs|ABL2_uc001gmg.3_Intron|ABL2_uc001gmi.3_Frame_Shift_Ins_p.G705fs|ABL2_uc001gmh.3_Frame_Shift_Ins_p.G684fs|ABL2_uc010pne.1_Intron	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	720_721	F-actin-binding (By similarity).				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TGTGCAAAGCTCCCCCCATAGC	0.569			T	ETV6	AML								31	25	---	---	---	---	
KIAA1614	57710	broad.mit.edu	37	1	180886141	180886141	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180886141delG	uc001gok.2	+	2	969	c.902delG	c.(901-903)CGCfs	p.R301fs		NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710	301										ovary(3)|skin(1)	4						GAGAGAAACCGCCTGTTGCTG	0.637													67	33	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236577762	236577763	+	Intron	INS	-	T	T	rs139439265	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236577762_236577763insT	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TAATTTTTTTCTTTTTTAAATA	0.257													2	4	---	---	---	---	
GALNT14	79623	broad.mit.edu	37	2	31168579	31168579	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31168579delC	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					CCTTCACTCTCCCCACTTAAA	0.502													9	7	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32362155	32362156	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32362155_32362156insA	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAAATGAATTGAAAAAAGATTT	0.317													31	15	---	---	---	---	
ALMS1P	200420	broad.mit.edu	37	2	73899306	73899306	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73899306delC	uc010yrl.1	+							NR_003683				RecName: Full=Putative ALMS1-like protein;												0						cctctctcttcccatcactcc	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102153599	102153599	+	IGR	DEL	C	-	-	rs57504118		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102153599delC								RFX8 (62434 upstream) : MAP4K4 (160889 downstream)																							tcttttccttccttccttcct	0.000													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116510930	116510930	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116510930delC	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGCAGCTTTACAAAGGGGAAA	0.294													10	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130676240	130676241	+	IGR	INS	-	AGGA	AGGA			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130676240_130676241insAGGA								None (None upstream) : LOC389033 (4194 downstream)																							ggagggaggggaggaaggaagg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132215012	132215019	+	IGR	DEL	CTTCCTTT	-	-	rs72054041	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132215012_132215019delCTTCCTTT								LOC401010 (12545 upstream) : TUBA3D (18647 downstream)																							tccttccttccttcctttctttcttcct	0.091													1	5	---	---	---	---	
COL3A1	1281	broad.mit.edu	37	2	189857788	189857788	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189857788delC	uc002uqj.1	+						COL3A1_uc010frw.1_Intron	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	CTATACATGTCTTTAAAGCCC	0.333													5	6	---	---	---	---	
EEF1B2	1933	broad.mit.edu	37	2	207026490	207026491	+	Intron	INS	-	T	T	rs142413994	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207026490_207026491insT	uc002vbf.1	+						NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Intron|EEF1B2_uc002vbh.1_Intron|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	NM_001037663	NP_001032752	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta							cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						gagactccgtcccaaaaaaaaa	0.069													10	5	---	---	---	---	
IRAK2	3656	broad.mit.edu	37	3	10283659	10283660	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10283659_10283660insA	uc003bve.1	+							NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						cctgtctcgataaaaaaaaaag	0.119													4	2	---	---	---	---	
COL7A1	1294	broad.mit.edu	37	3	48611122	48611122	+	Splice_Site	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48611122delC	uc003ctz.2	-	81	6574	c.6573_splice	c.e81+1	p.P2191_splice		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor						cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGTCACTCACCGGGGCACCA	0.597													5	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146995077	146995077	+	IGR	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146995077delA								PLSCR5 (671074 upstream) : ZIC4 (108760 downstream)																							TCTGGACTGtaaaaaaaaaaa	0.209													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148704652	148704652	+	IGR	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148704652delC								CPA3 (89782 upstream) : GYG1 (4723 downstream)																							TTGCTCAGGGCCCGGTCCTGG	0.567													51	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196395222	196395223	+	IGR	DEL	AG	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196395222_196395223delAG								LRRC33 (6350 upstream) : C3orf34 (37926 downstream)																							agaaagagaaagagagagagag	0.064													5	3	---	---	---	---	
PTPN13	5783	broad.mit.edu	37	4	87553205	87553206	+	Intron	INS	-	TCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCT	rs148756344	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87553205_87553206insTCCTTCCTTCCTTCCT	uc003hpz.2	+						PTPN13_uc003hpy.2_Intron|PTPN13_uc003hqa.2_Intron|PTPN13_uc003hqb.2_Intron	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TTGTCCTTCCATCCTTCCTTAT	0.342													2	4	---	---	---	---	
TRAM1L1	133022	broad.mit.edu	37	4	118005288	118005288	+	3'UTR	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118005288delC	uc003ibv.3	-	1						NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like						protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						TAATCCTCCTCCCCTCAAATG	0.308													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	767654	767657	+	IGR	DEL	AGAA	-	-	rs72246159		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:767654_767657delAGAA								TPPP (74144 upstream) : ZDHHC11 (28063 downstream)																							GAGGAAGAGGAGAAAGAGAGCATC	0.588													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25911409	25911410	+	IGR	INS	-	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25911409_25911410insC								None (None upstream) : CDH9 (969299 downstream)																							CACCTAACTCACCTAACTCATA	0.520													8	6	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43666736	43666736	+	Intron	DEL	T	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43666736delT	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	gggagaTCTATTTTTTTTTTT	0.279													7	4	---	---	---	---	
MCTP1	79772	broad.mit.edu	37	5	94353240	94353241	+	Intron	INS	-	TCTCTAAAGGGGGACCA	TCTCTAAAGGGGGACCA	rs139116758	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94353240_94353241insTCTCTAAAGGGGGACCA	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Intron	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CTGTTCTATTTTCTCTAAAGGG	0.302													9	6	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127710431	127710432	+	Frame_Shift_Ins	INS	-	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127710431_127710432insG	uc003kuu.2	-	15	2423_2424	c.1984_1985insC	c.(1984-1986)TGCfs	p.C662fs	FBN2_uc003kuv.2_Frame_Shift_Ins_p.C629fs	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	662	EGF-like 10; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGGGGTCTGGCATTCATCAACA	0.510													16	27	---	---	---	---	
PCDHGA11	56105	broad.mit.edu	37	5	140803325	140803326	+	Intron	INS	-	GC	GC	rs138224377	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140803325_140803326insGC	uc003lkq.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_3'UTR|PCDHGA11_uc003lkp.1_Intron|PCDHGB8P_uc011daz.1_5'Flank	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTGGGGGGGGGGTGGGGCGGC	0.381													4	9	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150490075	150490076	+	Intron	INS	-	GG	GG			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150490075_150490076insGG	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGGAGAGAGAGAAGCCGCACA	0.406													6	3	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180056232	180056248	+	Intron	DEL	CAAGGACCCTGGTTTCC	-	-	rs34601450		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180056232_180056248delCAAGGACCCTGGTTTCC	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_Intron|FLT4_uc011dgy.1_Intron|FLT4_uc011dgz.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CCACAGGGCACAAGGACCCTGGTTTCCCAGGCCATAC	0.636									Congenital_Hereditary_Lymphedema				12	6	---	---	---	---	
MYLK4	340156	broad.mit.edu	37	6	2692889	2692889	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2692889delC	uc003mty.3	-							NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4								ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				GGGGGGGGGGCATTTTTTTAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18365337	18365355	+	5'Flank	DEL	TGATTCTGAATTGGGAGAC	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18365337_18365355delTGATTCTGAATTGGGAGAC	uc011djh.1	+											DQ597117																		TTTTCTTTTTTGATTCTGAATTGGGAGACTGCATTGCTG	0.347													4	5	---	---	---	---	
HIST1H2AH	85235	broad.mit.edu	37	6	27114710	27114710	+	5'Flank	DEL	T	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114710delT	uc003niz.2	+						HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080596	NP_542163	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah						nucleosome assembly	nucleosome|nucleus	DNA binding				0						GTCCTGTATCTGATTGGTGGT	0.418													2	7	---	---	---	---	
C6orf25	80739	broad.mit.edu	37	6	31691815	31691815	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31691815delA	uc011doc.1	+						LY6G6C_uc003nwh.2_5'Flank|LY6G6C_uc010jtd.2_5'Flank|C6orf25_uc003nwk.2_Intron|C6orf25_uc011dod.1_Intron|C6orf25_uc011doe.1_Intron|C6orf25_uc003nwo.2_Intron|C6orf25_uc003nwn.2_Intron	NM_138272	NP_612116	O95866	G6B_HUMAN	G6B protein isoform G6b-B precursor							endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	heparin binding|receptor activity				0						ACATACCCGGAGGAGGGAAGA	0.647													8	17	---	---	---	---	
MAPK13	5603	broad.mit.edu	37	6	36098497	36098498	+	Intron	INS	-	GGGGGGC	GGGGGGC	rs146539855	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36098497_36098498insGGGGGGC	uc003ols.2	+						MAPK13_uc003olt.2_Intron	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13						cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						CCTgggccgctggggggcgggg	0.599													4	2	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42823452	42823452	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42823452delA	uc003osn.1	+						KIAA0240_uc011duw.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			TTTTTTTTTTATTTTTCAGCA	0.333													4	2	---	---	---	---	
SLC22A7	10864	broad.mit.edu	37	6	43269340	43269340	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43269340delC	uc003out.2	+	7	1070	c.971delC	c.(970-972)GCCfs	p.A324fs	SLC22A7_uc010jyl.1_Frame_Shift_Del_p.A325fs|SLC22A7_uc003ous.2_Frame_Shift_Del_p.A322fs	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	324						basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AAAGTGGCCGCCGGGGAACGG	0.587													11	11	---	---	---	---	
ENPP5	59084	broad.mit.edu	37	6	46129042	46129043	+	3'UTR	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46129042_46129043insA	uc003oxz.1	-	4					ENPP5_uc003oya.1_3'UTR|ENPP5_uc011dvz.1_3'UTR|ENPP5_uc010jzc.1_3'UTR	NM_021572	NP_067547	Q9UJA9	ENPP5_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase							extracellular region|integral to membrane	hydrolase activity				0						CTTCAATATGCAAATCCACTTC	0.337													7	16	---	---	---	---	
CRISP2	7180	broad.mit.edu	37	6	49668265	49668267	+	Intron	DEL	AAC	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49668265_49668267delAAC	uc003ozq.2	-						CRISP2_uc003ozl.2_Intron|CRISP2_uc003ozn.2_Intron|CRISP2_uc003ozr.2_Intron|CRISP2_uc003ozo.2_Intron|CRISP2_uc003ozm.2_Intron|CRISP2_uc003ozp.2_Intron	NM_001142408	NP_001135880	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2 precursor							extracellular space				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CAAATAAAATAACAAAACAGAGA	0.369													10	7	---	---	---	---	
FAM135A	57579	broad.mit.edu	37	6	71236468	71236469	+	Intron	DEL	AT	-	-	rs111717563		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71236468_71236469delAT	uc003pfj.2	+						FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_Intron|FAM135A_uc010kan.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						acacacacacatacacacacac	0.218													4	3	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7550587	7550588	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7550587_7550588insA	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ACATGTTTTACAGATGTGAAAA	0.386													3	4	---	---	---	---	
SNX10	29887	broad.mit.edu	37	7	26385938	26385938	+	Intron	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26385938delG	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						ACTGTGGGGCGGGGGGGGCTC	0.572													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56431160	56431161	+	IGR	INS	-	A	A	rs71528887		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56431160_56431161insA								PSPH (247070 upstream) : DKFZp434L192 (132755 downstream)																							CCTTCTCCCACGGGGGGTACAC	0.584													5	3	---	---	---	---	
VPS37D	155382	broad.mit.edu	37	7	73085563	73085564	+	Frame_Shift_Ins	INS	-	G	G			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73085563_73085564insG	uc003tyr.2	+	4	728_729	c.613_614insG	c.(613-615)CGGfs	p.R205fs		NM_001077621	NP_001071089	Q86XT2	VP37D_HUMAN	vacuolar protein sorting 37D	205					cellular membrane organization|endosome transport|protein transport	late endosome membrane					0		Lung NSC(55;0.0908)|all_lung(88;0.198)				TGGGGCCGCCCGGGGGCCACCA	0.772													2	10	---	---	---	---	
MUC17	140453	broad.mit.edu	37	7	100678893	100678894	+	Frame_Shift_Ins	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678893_100678894insA	uc003uxp.1	+	3	4249_4250	c.4196_4197insA	c.(4195-4197)ACAfs	p.T1399fs	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1399	Extracellular (Potential).|59 X approximate tandem repeats.|21.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTCCGTTAACAAGTATACCTG	0.510													88	127	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	107866747	107866747	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107866747delG	uc003vfb.2	-	9	1097	c.626delC	c.(625-627)CCAfs	p.P209fs	NRCAM_uc003vfc.2_Frame_Shift_Del_p.P203fs|NRCAM_uc011kmk.1_Frame_Shift_Del_p.P204fs|NRCAM_uc003vfd.2_Frame_Shift_Del_p.P204fs|NRCAM_uc003vfe.2_Frame_Shift_Del_p.P204fs	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	209	Ig-like 2.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						GGTGTCCTCTGGGAGGACATT	0.413													46	88	---	---	---	---	
RNF148	378925	broad.mit.edu	37	7	122342616	122342616	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122342616delC	uc003vkk.1	-	1	406	c.189delG	c.(187-189)GGGfs	p.G63fs	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF148_uc010lkr.1_Intron	NM_198085	NP_932351	Q8N7C7	RN148_HUMAN	ring finger protein 148 precursor	63						integral to membrane	zinc ion binding				0						GAGAATGATTCCCGAACACTC	0.468													18	20	---	---	---	---	
RP1L1	94137	broad.mit.edu	37	8	10470527	10470527	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10470527delC	uc003wtc.2	-	4	1310	c.1081delG	c.(1081-1083)GAGfs	p.E361fs		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	361					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GGGTCTACCTCCCCCAGAACG	0.692													26	61	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43298273	43298273	+	IGR	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43298273delG								POTEA (79945 upstream) : None (None downstream)																							GTTTGGGAAAGGAGAGCTCTG	0.408													12	8	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614660	48614667	+	Intron	DEL	TACACACA	-	-	rs2725273		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614660_48614667delTACACACA	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				ctctctctctTacacacacacacacaca	0.149													4	2	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100443691	100443703	+	Intron	DEL	GAAAATACGTTTG	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100443691_100443703delGAAAATACGTTTG	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAACAATCTTGAAAATACGTTTGGTATGTTCTG	0.286													24	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109391375	109391376	+	IGR	INS	-	A	A	rs138334015		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109391375_109391376insA								EIF3E (130416 upstream) : TTC35 (64477 downstream)																							gactacgtctcaaaaaaaaaaa	0.208													9	4	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	133015515	133015515	+	Frame_Shift_Del	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133015515delA	uc003yte.2	+	22	2544	c.2343delA	c.(2341-2343)ATAfs	p.I781fs		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	781						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTGCCCAAATATTGGAACTCA	0.318													67	58	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6639010	6639011	+	Intron	INS	-	A	A	rs78066890		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6639010_6639011insA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	ctctgtctcagaaaaaaaaaaa	0.158													2	5	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69391298	69391299	+	Intron	INS	-	TA	TA			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69391298_69391299insTA	uc004afn.2	+						ANKRD20A4_uc010mnw.1_Intron	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						CTACTCCATCTTATACATTAGG	0.317													6	3	---	---	---	---	
HNRNPK	3190	broad.mit.edu	37	9	86588072	86588072	+	Intron	DEL	T	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86588072delT	uc004ang.3	-						HNRNPK_uc011lsw.1_Intron|HNRNPK_uc004and.3_Intron|HNRNPK_uc004ank.3_Intron|HNRNPK_uc004anf.3_Intron|HNRNPK_uc004anh.3_Intron|HNRNPK_uc011lsx.1_Intron|HNRNPK_uc004ani.3_Intron|HNRNPK_uc004anj.3_Intron|HNRNPK_uc004ann.3_Intron|HNRNPK_uc004anl.3_Intron|HNRNPK_uc004anm.3_Intron	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						GTGCCAGACATTTTTTGTCAT	0.358													7	9	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119942945	119942945	+	Intron	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119942945delG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|SNORA70C_uc011lxu.1_5'Flank	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						AGAATTTATTGGTGAGTATTA	0.343													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	131208284	131208285	+	IGR	DEL	AA	-	-	rs143368600		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131208284_131208285delAA								CERCAM (8657 upstream) : ODF2 (9181 downstream)																							AGTTTGAGACAAGAGGAGAAAA	0.223													0	6	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14490773	14490773	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14490773delC	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						aaacacctggccccaaggagt	0.065													7	25	---	---	---	---	
SLC22A20	440044	broad.mit.edu	37	11	64997532	64997532	+	Intron	DEL	T	-	-	rs150430504	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64997532delT	uc010roc.1	+							NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
MAML2	84441	broad.mit.edu	37	11	95825687	95825687	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95825687delC	uc001pfw.1	-	2	2793	c.1508delG	c.(1507-1509)GGCfs	p.G503fs		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	503					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CTGGCCGCTGCCGCCAGCTAC	0.582			T	MECT1|CRTC3	salivary gland mucoepidermoid								20	37	---	---	---	---	
DRD2	1813	broad.mit.edu	37	11	113284125	113284125	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113284125delC	uc001pnz.2	-						DRD2_uc010rwv.1_Intron|DRD2_uc001poa.3_Intron|DRD2_uc001pob.3_Intron	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	AAAAGGCTGACCCCTGGGGCC	0.572													3	13	---	---	---	---	
RECQL	5965	broad.mit.edu	37	12	21639361	21639361	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21639361delC	uc001rex.2	-						RECQL_uc001rey.2_Intron	NM_032941	NP_116559	P46063	RECQ1_HUMAN	RecQ protein-like						DNA recombination|DNA repair|DNA replication	nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|DNA strand annealing activity|protein binding			ovary(1)|lung(1)	2						AGGTAAAGCTCCTATTTCAGT	0.214								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					3	6	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42826881	42826881	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42826881delA	uc001rng.1	+						PPHLN1_uc001rmy.2_Intron|PPHLN1_uc001rne.2_Intron|PPHLN1_uc001rnb.2_Intron|PPHLN1_uc001rnd.2_Intron|PPHLN1_uc001rnc.2_Intron|PPHLN1_uc001rnf.2_Intron|PPHLN1_uc010skq.1_Intron|PPHLN1_uc010skr.1_Intron|PPHLN1_uc010sks.1_Intron|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Intron|PPHLN1_uc001rnh.1_Intron|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TGACAGTTTTATTTTTATTGA	0.333													36	45	---	---	---	---	
TMEM194A	23306	broad.mit.edu	37	12	57456740	57456747	+	Intron	DEL	TAAAAAAA	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57456740_57456747delTAAAAAAA	uc001smy.2	-						TMEM194A_uc001smx.2_Intron|TMEM194A_uc010sra.1_Intron	NM_001130963	NP_001124435	O14524	T194A_HUMAN	transmembrane protein 194A isoform a							integral to membrane					0						CTATAGAAAGTAAAAAAAAAAAAATAGA	0.322													2	11	---	---	---	---	
CDK17	5128	broad.mit.edu	37	12	96693884	96693884	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96693884delC	uc001tep.1	-						CDK17_uc009ztk.2_Intron|CDK17_uc010svb.1_Intron	NM_002595	NP_002586	Q00537	CDK17_HUMAN	PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						AAATTCATTTCCTCTCAAACT	0.308													4	7	---	---	---	---	
CRY1	1407	broad.mit.edu	37	12	107391875	107391875	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107391875delC	uc001tmi.3	-							NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3						AATTAGTTTGCACACACATAA	0.363													56	43	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74993420	74993421	+	5'Flank	INS	-	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74993420_74993421insT	uc001vjj.1	-											Homo sapiens cDNA FLJ35839 fis, clone TESTI2006659.																		gtttcctttccttccttccttc	0.000													4	2	---	---	---	---	
PSMB5	5693	broad.mit.edu	37	14	23502434	23502434	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23502434delA	uc001wii.2	-						PSMB5_uc001wij.2_Intron|PSMB5_uc010tni.1_Intron	NM_002797	NP_002788	P28074	PSB5_HUMAN	proteasome beta 5 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus	protein binding|threonine-type endopeptidase activity			ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)	aaaaaacaggaaaaaaaaaaa	0.194													4	3	---	---	---	---	
CLEC14A	161198	broad.mit.edu	37	14	38723962	38723962	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38723962delC	uc001wum.1	-	1	1613	c.1266delG	c.(1264-1266)AAGfs	p.K422fs		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	422	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GAAAGCAGAGCTTGACAAGCC	0.562													29	22	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64574067	64574068	+	Intron	INS	-	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64574067_64574068insC	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc010apz.1_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAATGAACAAACTTTTTTCTAA	0.371													33	16	---	---	---	---	
MAP3K9	4293	broad.mit.edu	37	14	71275774	71275776	+	In_Frame_Del	DEL	CCT	-	-	rs3832971		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71275774_71275776delCCT	uc001xmm.2	-	1	113_115	c.113_115delAGG	c.(112-117)GAGGCG>GCG	p.E38del	MAP3K9_uc001xml.2_In_Frame_Del_p.E38del	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	38	Ala-rich.|Poly-Glu.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GCCGCCGCCGcctcctcctcctc	0.680													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79270147	79270147	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79270147delC	uc001xun.2	+	6	1601	c.1110delC	c.(1108-1110)GTCfs	p.V370fs	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Frame_Shift_Del_p.V504fs	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	743	Laminin G-like 4.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGGGGCGTGTCAAGCTCATGG	0.522													32	31	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81227834	81227834	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81227834delC	uc001xux.2	-	16	2671	c.2500delG	c.(2500-2502)GAAfs	p.E834fs	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	834						centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		GCATCAATTTCCTTTCCTATC	0.393													91	43	---	---	---	---	
LGMN	5641	broad.mit.edu	37	14	93170553	93170554	+	3'UTR	INS	-	C	C			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93170553_93170554insC	uc001yav.2	-	15					LGMN_uc001yat.2_3'UTR|LGMN_uc001yau.2_3'UTR|LGMN_uc001yaw.2_3'UTR|LGMN_uc010aul.2_3'UTR|LGMN_uc001yax.2_3'UTR|LGMN_uc001yay.2_3'UTR	NM_001008530	NP_001008530	Q99538	LGMN_HUMAN	legumain preproprotein						hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity			skin(1)	1		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		GAGCGGGGGCTCCCCAGGAGGG	0.569													11	6	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106800270	106800271	+	Intron	INS	-	C	C	rs147832868	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106800270_106800271insC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CATTGCAGGAAATCTGTGTCTG	0.510													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107190991	107191002	+	Intron	DEL	TCCTTCCATCCT	-	-	rs75354394		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107190991_107191002delTCCTTCCATCCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						cctccttctgtccttccatccttccttccttt	0.014													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20663141	20663142	+	Frame_Shift_Ins	INS	-	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20663141_20663142insT	uc001ytg.2	-	9	1179_1180	c.470_471insA	c.(469-471)GAGfs	p.E157fs	uc010tyx.1_RNA|uc001yth.3_Frame_Shift_Ins_p.E157fs|uc010tyy.1_Frame_Shift_Ins_p.E157fs|uc010tyz.1_Frame_Shift_Ins_p.E5fs					RecName: Full=Putative HERC2-like protein 3;																		CCACGGGATGCTCGGGGGGAAA	0.455													2	5	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40257735	40257735	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40257735delA	uc001zkm.1	+						EIF2AK4_uc001zkl.2_Intron|EIF2AK4_uc010bbj.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		AAAATTGTTTACAAAAGGACA	0.338													6	3	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1393852	1393865	+	Intron	DEL	CTGGGACAGGCCGT	-	-	rs71711503		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1393852_1393865delCTGGGACAGGCCGT	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				GAAACCGAGGCTGGGACAGGCCGTCTGGGACAGG	0.692													4	4	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19752998	19752998	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19752998delA	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GCTAGAATCtaaaaaaaaaaa	0.229													4	4	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037276	58037277	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037276_58037277insA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			gtctcaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
COLEC12	81035	broad.mit.edu	37	18	480572	480572	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:480572delC	uc002kkm.2	-							NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CACTTTCCAACCAAAATTGGA	0.572													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68373390	68373390	+	IGR	DEL	T	-	-	rs72394695		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68373390delT								SOCS6 (375956 upstream) : None (None downstream)																							tccttccttctttccttcctt	0.065													4	2	---	---	---	---	
STK11	6794	broad.mit.edu	37	19	1221314	1221314	+	Frame_Shift_Del	DEL	C	-	-	rs67873004		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1221314delC	uc002lrl.1	+	6	1952	c.837delC	c.(835-837)GGCfs	p.G279fs		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	279	Protein kinase.				anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.P281fs*6(2)|p.?(2)|p.Y246fs*3(1)|p.G279F(1)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGACTGTGGCCCCCCGCTCT	0.607		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			5	5	---	---	---	---	
PLIN4	729359	broad.mit.edu	37	19	4510389	4510389	+	Intron	DEL	C	-	-	rs56906779		TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4510389delC	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0						aaaaaaaaaacaaaaCAGTCA	0.294													3	4	---	---	---	---	
RAB3D	9545	broad.mit.edu	37	19	11447650	11447651	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11447650_11447651insA	uc002mqy.2	-							NM_004283	NP_004274	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family						exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2						tgtctcgagagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
FXYD7	53822	broad.mit.edu	37	19	35642299	35642299	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35642299delC	uc002nye.1	+						FXYD7_uc002nyf.1_Frame_Shift_Del_p.Y68fs	NM_022006	NP_071289	P58549	FXYD7_HUMAN	FXYD domain-containing ion transport regulator							integral to membrane	ion channel activity				0	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;2.32e-21)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;2.43e-18)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCATATCCTACCCGCTATGTC	0.552													104	68	---	---	---	---	
SBSN	374897	broad.mit.edu	37	19	36017720	36017720	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36017720delC	uc002oae.1	-	2	505	c.435delG	c.(433-435)GGGfs	p.G145fs	SBSN_uc002oad.1_Frame_Shift_Del_p.G488fs	NM_198538	NP_940940	Q6UWP8	SBSN_HUMAN	suprabasin isoform 2 precursor	145	Ala/Gly/His-rich.					extracellular region				ovary(1)	1	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGCTTCCTTCCCAGCCTGGT	0.597													41	34	---	---	---	---	
SPRED3	399473	broad.mit.edu	37	19	38886320	38886320	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38886320delG	uc002oim.2	+	5	772	c.768delG	c.(766-768)GCGfs	p.A256fs		NM_001042522	NP_001035987	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	256	Pro-rich.				multicellular organismal development					central_nervous_system(2)|lung(1)|skin(1)	4	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTCCCCCAGCGGCACTACCTG	0.582													8	4	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	39018582	39018583	+	Intron	INS	-	A	A	rs142679376	by1000genomes	TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39018582_39018583insA	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron|RYR1_uc010xuf.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TAGAATGGATCGGGGGAGGGGT	0.569													4	4	---	---	---	---	
SHKBP1	92799	broad.mit.edu	37	19	41083456	41083456	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41083456delC	uc002oob.2	+						SHKBP1_uc002ooc.2_Intron|SHKBP1_uc002ood.2_Intron|SHKBP1_uc010xvl.1_Intron|SHKBP1_uc002ooe.2_Intron|SHKBP1_uc002oof.2_5'Flank|SHKBP1_uc010xvm.1_5'Flank|SHKBP1_uc010xvn.1_5'Flank	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCCCCCTTTCCCGCAGATCT	0.577													221	136	---	---	---	---	
POU2F2	5452	broad.mit.edu	37	19	42597951	42597951	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42597951delC	uc002osp.2	-						POU2F2_uc002osn.2_Intron|POU2F2_uc002oso.2_Intron|POU2F2_uc002osq.2_Intron|POU2F2_uc002osr.1_Intron	NM_002698	NP_002689	P09086	PO2F2_HUMAN	POU domain, class 2, transcription factor 2						humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)				TCCTCCCAGTCCCCCCTCACC	0.632													216	102	---	---	---	---	
LILRA5	353514	broad.mit.edu	37	19	54823752	54823752	+	Intron	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54823752delG	uc002qfe.2	-						LILRA5_uc002qff.2_Intron|LILRA5_uc010yev.1_Intron|LILRA5_uc010yew.1_Intron|LILRA5_uc002qfh.1_Intron|LILRA5_uc002qfg.1_Intron	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily						innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCCTCGTTATGGGGTGGGGTC	0.602													36	22	---	---	---	---	
NLRP13	126204	broad.mit.edu	37	19	56424343	56424343	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56424343delG	uc010ygg.1	-	5	865	c.840delC	c.(838-840)ACCfs	p.T280fs		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	280	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ATTCAGCAAAGGTAGTTTCCT	0.418													56	53	---	---	---	---	
ITPA	3704	broad.mit.edu	37	20	3190180	3190180	+	5'UTR	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3190180delG	uc002wid.2	+	1					ITPA_uc002wie.2_5'UTR|ITPA_uc002wif.2_RNA	NM_033453	NP_258412	Q9BY32	ITPA_HUMAN	inosine triphosphatase isoform a						nucleotide metabolic process	cytoplasm	metal ion binding|nucleoside-triphosphate diphosphatase activity|nucleotide binding			ovary(1)	1						TGGCTCAGCTGGGTAACCGGG	0.607													17	9	---	---	---	---	
ISM1	140862	broad.mit.edu	37	20	13260384	13260385	+	Frame_Shift_Ins	INS	-	T	T			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13260384_13260385insT	uc010gce.1	+	3	488_489	c.482_483insT	c.(481-483)TGGfs	p.W161fs	TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor	161						extracellular region					0						TGGCGGGCCTGGTGGCAGAGGT	0.599													40	27	---	---	---	---	
DDX27	55661	broad.mit.edu	37	20	47843103	47843103	+	Intron	DEL	A	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47843103delA	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGGTGGGCAGAAGGGTGTTAC	0.473													15	9	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18968856	18968856	+	Intron	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18968856delC	uc002zom.1	+						DGCR5_uc002zon.1_Intron	NR_002733				Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						AGAAGAAATGCCCCTAATTAA	0.343													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21424139	21424139	+	IGR	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21424139delC								LOC400891 (5684 upstream) : POM121L8P (212575 downstream)																							GGAAACCTGACCAAGTTGCAA	0.542													17	8	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43465699	43465699	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43465699delC	uc003bdi.2	-	4	506	c.265delG	c.(265-267)GAGfs	p.E89fs	TTLL1_uc010gzh.2_Frame_Shift_Del_p.E89fs|TTLL1_uc003bdj.2_5'UTR|TTLL1_uc003bdh.2_Frame_Shift_Del_p.E51fs	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	89	TTL.				protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		CCTTCTTTCTCCAGCTCCTTC	0.448													40	58	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49145628	49145629	+	Intron	DEL	CT	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49145628_49145629delCT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GAGGCTCACCCTCTCTCTCTCT	0.658													4	2	---	---	---	---	
MAGEC3	139081	broad.mit.edu	37	X	140969385	140969385	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140969385delG	uc011mwp.1	+	4	712	c.712delG	c.(712-714)GGCfs	p.G238fs		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	238	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GATTCTTTTTGGCATTTCCCT	0.468													30	87	---	---	---	---	
AFF2	2334	broad.mit.edu	37	X	148072687	148072688	+	Intron	INS	-	A	A			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148072687_148072688insA	uc004fcp.2	+						AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron|AFF2_uc011mxc.1_Intron	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CAATGTGGTGCATATTTTCATG	0.376													7	26	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13538476	13538476	+	IGR	DEL	G	-	-			TCGA-37-5819-01A-01D-1632-08	TCGA-37-5819-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13538476delG								None (None upstream) : None (None downstream)																							TAAAATTTTTGCTTCTTTTTC	0.338													4	2	---	---	---	---	
