Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ACOT7	11332	broad.mit.edu	37	1	6341204	6341204	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6341204C>T	uc001ams.2	-	8	1159	c.1002G>A	c.(1000-1002)TCG>TCA	p.S334S	ACOT7_uc010nzq.1_Silent_p.S219S|ACOT7_uc001amt.2_Silent_p.S324S|ACOT7_uc001amu.2_RNA|ACOT7_uc001amv.2_RNA|ACOT7_uc001amq.2_Silent_p.S283S|ACOT7_uc001amr.2_Silent_p.S304S	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb	334						mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		CCTGGCTCAGCGACACGTAGG	0.647											OREG0013034	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	22	---	---	---	---	PASS
CELA2A	63036	broad.mit.edu	37	1	15788058	15788058	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15788058C>G	uc001awk.2	+	3	158	c.132C>G	c.(130-132)GTC>GTG	p.V44V		NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein	44	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						CTCCCCAGGTCTCCCTGCAGT	0.512													9	45	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16358208	16358208	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16358208C>A	uc001axu.2	+	16	1706	c.1626C>A	c.(1624-1626)TCC>TCA	p.S542S	CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_Silent_p.S542S|CLCNKA_uc010obw.1_Silent_p.S499S|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010oby.1_Silent_p.S278S	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	542					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CCTGCAGCTCCCACCATGTGA	0.622													9	22	---	---	---	---	PASS
PADI4	23569	broad.mit.edu	37	1	17660457	17660457	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17660457G>T	uc001baj.2	+	3	321	c.293G>T	c.(292-294)GGA>GTA	p.G98V	PADI4_uc009vpc.2_Missense_Mutation_p.G98V	NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	98					chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TCATACTACGGACCCAAGACT	0.393													7	27	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19062446	19062446	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19062446G>T	uc001bay.2	+	8	2074	c.1476G>T	c.(1474-1476)ATG>ATT	p.M492I	PAX7_uc001baz.2_Missense_Mutation_p.M490I|PAX7_uc010oct.1_Intron	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	492					anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GCTTGTTTATGGAGAGctaca	0.338			T	FOXO1A	alveolar rhabdomyosarcoma								4	26	---	---	---	---	PASS
ALDH4A1	8659	broad.mit.edu	37	1	19212005	19212005	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19212005G>A	uc001bbb.2	-	5	691	c.415C>T	c.(415-417)CGC>TGC	p.R139C	ALDH4A1_uc010ocu.1_Missense_Mutation_p.R79C|ALDH4A1_uc001bbc.2_Missense_Mutation_p.R139C	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	139					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	TCAGCCCTGCGCGGCCCACTC	0.453													5	8	---	---	---	---	PASS
ALDH4A1	8659	broad.mit.edu	37	1	19212006	19212006	+	Silent	SNP	C	G	G	rs141755639	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19212006C>G	uc001bbb.2	-	5	690	c.414G>C	c.(412-414)CCG>CCC	p.P138P	ALDH4A1_uc010ocu.1_Silent_p.P78P|ALDH4A1_uc001bbc.2_Silent_p.P138P	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	138					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	CAGCCCTGCGCGGCCCACTCA	0.453													5	8	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19451160	19451160	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19451160C>A	uc001bbi.2	-	65	9467	c.9463G>T	c.(9463-9465)GCC>TCC	p.A3155S	UBR4_uc001bbk.1_Missense_Mutation_p.A802S	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3155					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGAGTATAGGCCTCAAACACA	0.433													4	41	---	---	---	---	PASS
CAPZB	832	broad.mit.edu	37	1	19666102	19666102	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19666102C>A	uc010ocz.1	-	9	1256	c.828G>T	c.(826-828)CAG>CAT	p.Q276H	CAPZB_uc001bce.2_Missense_Mutation_p.Q247H|CAPZB_uc009vpk.2_Missense_Mutation_p.D248Y|CAPZB_uc001bcd.2_Missense_Mutation_p.Q235H	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		CTGCAAAAGTCTGCACAGACC	0.517													32	132	---	---	---	---	PASS
RHD	6007	broad.mit.edu	37	1	25627436	25627436	+	Splice_Site	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25627436G>A	uc001bjz.2	+	4	545	c.487_splice	c.e4-1	p.T163_splice	RHD_uc010oep.1_Splice_Site_p.T163_splice|RHD_uc001bkc.2_Splice_Site_p.T163_splice|RHD_uc009vrm.2_Intron|RHD_uc001bka.2_Splice_Site_p.T163_splice|RHD_uc001bkb.2_Splice_Site_p.T163_splice|RHD_uc009vrn.2_Splice_Site_p.T163_splice|RHD_uc009vro.2_Splice_Site_p.T163_splice|RHD_uc009vrp.2_Splice_Site_p.T163_splice	NM_016124	NP_057208	Q02161	RHD_HUMAN	Rh blood group D antigen isoform 1							integral to plasma membrane				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTTTATTGCAGACAGACTACC	0.537													13	88	---	---	---	---	PASS
SLC9A1	6548	broad.mit.edu	37	1	27480681	27480681	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27480681A>C	uc001bnm.2	-	1	771	c.145T>G	c.(145-147)TCA>GCA	p.S49A	SLC9A1_uc010ofk.1_5'UTR|SLC9A1_uc001bnn.2_Missense_Mutation_p.S49A	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1	49	Extracellular (Potential).				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GGTGGCTCTGAGCTTCGAATG	0.597													8	30	---	---	---	---	PASS
SFRS4	6429	broad.mit.edu	37	1	29475183	29475183	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29475183G>A	uc001bro.2	-	6	1597	c.1224C>T	c.(1222-1224)TCC>TCT	p.S408S	SFRS4_uc010ofy.1_3'UTR	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4	408	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		ACACGGAGCGGGATGGAGATC	0.428													48	126	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34123686	34123686	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34123686C>T	uc001bxn.1	-	27	4216	c.4187G>A	c.(4186-4188)CGG>CAG	p.R1396Q	CSMD2_uc001bxm.1_Missense_Mutation_p.R1436Q|CSMD2_uc001bxo.1_Missense_Mutation_p.R309Q	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1396	Extracellular (Potential).|Sushi 8.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCACCACTCCGACTCCCATT	0.587													21	54	---	---	---	---	PASS
GJB5	2709	broad.mit.edu	37	1	35223426	35223426	+	Silent	SNP	C	T	T	rs149592496	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35223426C>T	uc001bxu.2	+	2	595	c.495C>T	c.(493-495)CAC>CAT	p.H165H	GJB4_uc001bxv.1_5'Flank	NM_005268	NP_005259	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	165	Extracellular (Potential).				cell communication|epidermis development	connexon complex|integral to membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)				TCAAGTGCCACGCAGATCCAT	0.512													18	50	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39823534	39823534	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39823534C>G	uc010oiu.1	+	9	7363	c.7232C>G	c.(7231-7233)GCA>GGA	p.A2411G	MACF1_uc010ois.1_Missense_Mutation_p.A1909G|MACF1_uc001cda.1_Missense_Mutation_p.A1817G|MACF1_uc001cdc.1_Missense_Mutation_p.A996G|MACF1_uc001cdb.1_Missense_Mutation_p.A996G	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3976					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTGAAGGATGCAACAGAAAGA	0.433													10	9	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43897158	43897158	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43897158G>T	uc001cjk.1	+	20	2817	c.2355G>T	c.(2353-2355)ACG>ACT	p.T785T		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	1684						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATTTGGCCACGCCCCACAGAC	0.463													13	101	---	---	---	---	PASS
TMEM53	79639	broad.mit.edu	37	1	45120240	45120240	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45120240G>A	uc001cmc.2	-	3	861	c.825C>T	c.(823-825)GTC>GTT	p.V275V	TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.2_Silent_p.V202V|TMEM53_uc009vxh.1_Silent_p.V158V|TMEM53_uc010ola.1_Silent_p.V158V	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	275						integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					CTCAGCAGCGGACGCAGTTGC	0.542													5	55	---	---	---	---	PASS
FOXE3	2301	broad.mit.edu	37	1	47882444	47882444	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47882444G>A	uc001crk.2	+	1	701	c.457G>A	c.(457-459)GAC>AAC	p.D153N		NM_012186	NP_036318	Q13461	FOXE3_HUMAN	forkhead box E3	153	Fork-head.				cell migration|embryonic organ morphogenesis|enteric nervous system development|hair follicle morphogenesis|hard palate development|lens morphogenesis in camera-type eye|pattern specification process|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|soft palate development|thyroid gland development|thyroid hormone generation	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0				READ - Rectum adenocarcinoma(2;0.0908)		CGCGGCCGCAGACATGTTCGA	0.557													8	37	---	---	---	---	PASS
GLIS1	148979	broad.mit.edu	37	1	53986384	53986384	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53986384T>C	uc001cvr.1	-	6	1691	c.1124A>G	c.(1123-1125)CAG>CGG	p.Q375R		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	375					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GTGGAGCTGCTGCAGGACCAG	0.672													3	9	---	---	---	---	PASS
PPAP2B	8613	broad.mit.edu	37	1	57002623	57002623	+	Intron	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57002623T>G	uc001cyj.1	-							NM_177414	NP_803133	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B						canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0						GTCTGGACACTTACCGCGAGG	0.468													12	62	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57383237	57383237	+	Splice_Site	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57383237G>T	uc001cyo.2	+	11	1736	c.1604_splice	c.e11-1	p.G535_splice		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						TTCCTCTGCAGGAGCCAAAGC	0.413													14	23	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57383238	57383238	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57383238G>T	uc001cyo.2	+	11	1736	c.1604G>T	c.(1603-1605)GGA>GTA	p.G535V		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	535					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						TCCTCTGCAGGAGCCAAAGCA	0.418													14	25	---	---	---	---	PASS
JUN	3725	broad.mit.edu	37	1	59248409	59248409	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59248409C>G	uc001cze.2	-	1	1377	c.334G>C	c.(334-336)GAG>CAG	p.E112Q	uc001czf.2_5'Flank|uc010oop.1_5'Flank	NM_002228	NP_002219	P05412	JUN_HUMAN	jun oncogene	112					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding				0	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)	ACGAAGCCCTCGGCGAAGCCC	0.672			A		sarcoma								19	66	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63329799	63329799	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63329799G>C	uc001dat.2	+	11	1508	c.1346G>C	c.(1345-1347)AGA>ACA	p.R449T	ATG4C_uc001dau.2_Missense_Mutation_p.R449T	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	449					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						CAATTAAAAAGATTTAGCACG	0.313													13	35	---	---	---	---	PASS
AK3L1	205	broad.mit.edu	37	1	65614087	65614087	+	5'UTR	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65614087G>C	uc001dby.2	+	2					AK3L1_uc009wan.2_Intron|AK3L1_uc001dbz.2_5'UTR|AK3L1_uc001dca.2_5'UTR	NM_203464	NP_982289	P27144	KAD4_HUMAN	adenylate kinase 3-like 1 isoform 7							mitochondrial matrix	adenylate kinase activity|ATP binding|GTP binding				0						TCCTCGCGAAGGCAATGGCTT	0.697													4	7	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65855081	65855081	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65855081A>G	uc001dcd.1	+	10	1329	c.1165A>G	c.(1165-1167)AGC>GGC	p.S389G	DNAJC6_uc001dcc.1_Missense_Mutation_p.S420G|DNAJC6_uc010opc.1_Missense_Mutation_p.S376G|DNAJC6_uc001dce.1_Missense_Mutation_p.S446G	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	389					cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						TGTCAATCCCAGCATCCTCTT	0.443													16	39	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70291484	70291484	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70291484G>T	uc001dep.2	+	3	391	c.361G>T	c.(361-363)GAA>TAA	p.E121*	LRRC7_uc001deo.1_Nonsense_Mutation_p.E159*|LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	121	LRR 5.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						AACAATTATTGAAGCCAGTGT	0.274													4	44	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70493891	70493891	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70493891C>G	uc001dep.2	+	16	1748	c.1718C>G	c.(1717-1719)CCA>CGA	p.P573R	LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	573						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						ACTCCTTACCCAGAGGATTTA	0.348													12	50	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71478136	71478136	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71478136G>A	uc001dfg.1	-	2	1160	c.929C>T	c.(928-930)ACA>ATA	p.T310I	PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Missense_Mutation_p.T310I|PTGER3_uc001dfl.1_Missense_Mutation_p.T310I|PTGER3_uc009wbm.1_Missense_Mutation_p.T310I|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Missense_Mutation_p.T310I|PTGER3_uc009wbn.1_Missense_Mutation_p.T310I|PTGER3_uc009wbo.2_Missense_Mutation_p.T310I|PTGER3_uc001dfo.2_Missense_Mutation_p.T310I|PTGER3_uc001dfp.1_Missense_Mutation_p.T310I|PTGER3_uc001dfq.2_Missense_Mutation_p.T310I	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	310	Extracellular (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	CTCAACTGATGTCTGATTGAA	0.333													7	37	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74832986	74832986	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74832986A>G	uc001dgf.1	+	12	1275	c.1224A>G	c.(1222-1224)CAA>CAG	p.Q408Q	TNNI3K_uc001dgc.1_Silent_p.Q509Q|TNNI3K_uc001dgd.2_Silent_p.Q509Q|TNNI3K_uc001dge.1_Silent_p.Q509Q	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	408	ANK 10.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						AGAGACCACAAGATGAATTGC	0.348													16	78	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76254853	76254853	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76254853A>T	uc001dgy.1	+	3	192	c.121A>T	c.(121-123)ATG>TTG	p.M41L	RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_5'UTR|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit	41	PFTB 1.				protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						GGAATACTGTATGTCTGAGTA	0.353													11	65	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76280782	76280782	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76280782T>A	uc001dhd.1	+	5	817	c.776T>A	c.(775-777)ATA>AAA	p.I259K		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	259					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						CAGTTATGCATAGCAGAATTC	0.299								MMR					11	57	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78099011	78099011	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78099011G>C	uc001dhq.2	-	5	505	c.29C>G	c.(28-30)ACA>AGA	p.T10R	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.T10R|ZZZ3_uc001dhp.2_Missense_Mutation_p.T10R	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	10					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						TGTTGATCTTGTAACACGAGT	0.403													27	67	---	---	---	---	PASS
IFI44L	10964	broad.mit.edu	37	1	79101166	79101166	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79101166A>T	uc010oro.1	+	5	1047	c.868A>T	c.(868-870)AGA>TGA	p.R290*	IFI44L_uc010orp.1_Nonsense_Mutation_p.R27*|IFI44L_uc010orq.1_Nonsense_Mutation_p.R27*	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	290						cytoplasm					0						TATGCCAGACAGATATCAGGT	0.383													9	63	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79402025	79402025	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79402025A>T	uc001diq.3	-	7	988	c.832T>A	c.(832-834)TAC>AAC	p.Y278N		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	278	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		ATATTTATGTAGTCTCCATCC	0.264													11	90	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86590959	86590959	+	Missense_Mutation	SNP	G	T	T	rs116613844	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86590959G>T	uc001dlj.2	-	3	1102	c.1060C>A	c.(1060-1062)CAT>AAT	p.H354N	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.H354N	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	354					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGATGCGATGAGTGGTCACT	0.408													9	67	---	---	---	---	PASS
RBMXL1	494115	broad.mit.edu	37	1	89449001	89449001	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89449001A>T	uc009wcx.2	-	3	1225	c.509T>A	c.(508-510)CTA>CAA	p.L170Q	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.L170Q	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	170							nucleotide binding|RNA binding				0						GCTGCGAACTAGTCCTGAAGG	0.517													47	150	---	---	---	---	PASS
GBP6	163351	broad.mit.edu	37	1	89834177	89834177	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89834177G>T	uc001dnf.2	+	2	341	c.67G>T	c.(67-69)GTG>TTG	p.V23L	GBP6_uc010ost.1_Intron	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	23							GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		GCAGCTATTGGTGAACCAGCA	0.478													8	58	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94668516	94668516	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94668516C>A	uc001dqj.3	-	10	1281	c.912G>T	c.(910-912)AGG>AGT	p.R304S	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dql.2_Missense_Mutation_p.R304S	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	304	Potential.				Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTATTTCTTTCCTTTGTTTTT	0.308													8	65	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103379256	103379256	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103379256G>T	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTATAAGAGGCAATAAAATA	0.348													14	90	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104114396	104114396	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104114396G>T	uc001duq.2	+						AMY2B_uc010ouo.1_Intron|LOC648740_uc001dur.2_Intron	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor						carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GGTTCAGGTGGGTATGATTCA	0.393													35	82	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111494390	111494390	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111494390T>A	uc001eaa.2	-	2	1372	c.1116A>T	c.(1114-1116)ACA>ACT	p.T372T	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	372					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		GCAGAACATCTGTCCCCTTTT	0.408													23	145	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115399895	115399895	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399895A>T	uc001efr.2	+	4	445	c.236A>T	c.(235-237)CAG>CTG	p.Q79L	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.Q79L|SYCP1_uc009wgw.2_Missense_Mutation_p.Q79L	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	79	Asp/Glu-rich (acidic).				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGCTTGAGCAGGTCAGTTAA	0.308													6	21	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115537564	115537564	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115537564G>C	uc001efr.2	+	32	3064	c.2855G>C	c.(2854-2856)CGG>CCG	p.R952P	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.R952P|SYCP1_uc009wgw.2_Missense_Mutation_p.R927P	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	952					cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAAAATGCGGGAGGACCGT	0.333													15	32	---	---	---	---	PASS
IGSF3	3321	broad.mit.edu	37	1	117150580	117150580	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117150580G>T	uc001egr.1	-	5	1911	c.1206C>A	c.(1204-1206)ATC>ATA	p.I402I	IGSF3_uc001egq.1_Silent_p.I402I|IGSF3_uc001egs.1_Silent_p.I75I	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	402	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGAGGACTATGATGGGGATGT	0.502													4	66	---	---	---	---	PASS
PTGFRN	5738	broad.mit.edu	37	1	117527364	117527364	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117527364G>T	uc001egv.1	+	8	2367	c.2230G>T	c.(2230-2232)GTG>TTG	p.V744L		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	744	Ig-like C2-type 6.|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CAAGGCTCCTGTGCTCCTGTC	0.572													15	31	---	---	---	---	PASS
MAN1A2	10905	broad.mit.edu	37	1	118035780	118035780	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118035780G>T	uc001ehd.1	+	9	1901	c.1180G>T	c.(1180-1182)GTC>TTC	p.V394F	MAN1A2_uc009whg.1_Missense_Mutation_p.V184F	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	394	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		TCATACATCTGTCGGTGGCCT	0.363													11	23	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118574306	118574306	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118574306T>A	uc001ehk.2	-							NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TATGGCAAGGTTCATTTACCT	0.333													17	106	---	---	---	---	PASS
NBPF16	728936	broad.mit.edu	37	1	148753320	148753320	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148753320C>T	uc010pba.1	+	12	1528	c.1337C>T	c.(1336-1338)ACT>ATT	p.T446I	NBPF16_uc009wkt.1_Missense_Mutation_p.T226I	NM_001102663	NP_001096133			hypothetical protein LOC728936												0	all_hematologic(923;0.032)					TGTTATTCGACTCCTTCAGAT	0.473													3	44	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150532529	150532529	+	Intron	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150532529T>C	uc001eux.2	+						ADAMTSL4_uc009wlw.2_Intron|ADAMTSL4_uc010pcg.1_Intron|ADAMTSL4_uc009wlx.2_Intron	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1						apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GCCTCCTCTGTCCCCAGATGA	0.602											OREG0013787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	88	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152275921	152275921	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152275921C>T	uc001ezu.1	-	3	11477	c.11441G>A	c.(11440-11442)CGT>CAT	p.R3814H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3814	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCATTACGTGTTTCTCT	0.577									Ichthyosis				50	355	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732892	152732892	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732892G>T	uc001fal.1	+	2	886	c.828G>T	c.(826-828)GAG>GAT	p.E276D		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	276	Pro-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACGTTTTGAGCCCTGCTCCA	0.592													7	36	---	---	---	---	PASS
SNAPIN	23557	broad.mit.edu	37	1	153631258	153631258	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153631258G>T	uc001fcq.2	+	1	114	c.39G>T	c.(37-39)GGG>GGT	p.G13G		NM_012437	NP_036569	O95295	SNAPN_HUMAN	SNAP-associated protein	13					intracellular protein transport|synaptic vesicle exocytosis	BLOC-1 complex|cell junction|perinuclear region of cytoplasm|synaptic vesicle membrane|synaptosome	SNARE binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGGGGGCAGGGACCCCGGTGG	0.716													3	6	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155735075	155735075	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155735075G>A	uc001flz.2	-	21	4286	c.4189C>T	c.(4189-4191)CCT>TCT	p.P1397S	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.P1397S|GON4L_uc009wrh.1_Missense_Mutation_p.P1397S|GON4L_uc001fma.1_Missense_Mutation_p.P1397S|GON4L_uc001fmb.3_Missense_Mutation_p.P593S|GON4L_uc001fmc.2_Missense_Mutation_p.P1397S|GON4L_uc001fmd.3_Missense_Mutation_p.P1397S|GON4L_uc009wri.2_Missense_Mutation_p.P983S	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	1397					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCTTCATCAGGGGGCTCTTGA	0.488													12	80	---	---	---	---	PASS
OR10K1	391109	broad.mit.edu	37	1	158436059	158436059	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158436059G>T	uc010pij.1	+	1	708	c.708G>T	c.(706-708)AAG>AAT	p.K236N		NM_001004473	NP_001004473	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					GAAGATACAAGACCTTCTCCA	0.453													10	50	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158648278	158648278	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158648278A>G	uc001fst.1	-	6	924	c.725T>C	c.(724-726)GTG>GCG	p.V242A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	242	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGCAGCATTCACCTCATTTTG	0.428													6	46	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158815668	158815668	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158815668G>T	uc001fsz.1	+	5	1062	c.862G>T	c.(862-864)GAC>TAC	p.D288Y		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	288	HIN-200.				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					ATCTGTGTCTGACTTTAATCA	0.343													11	72	---	---	---	---	PASS
LMX1A	4009	broad.mit.edu	37	1	165322360	165322360	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165322360G>A	uc001gcy.1	-	2	437	c.216C>T	c.(214-216)ACC>ACT	p.T72T	LMX1A_uc001gcz.1_Silent_p.T72T	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	72	LIM zinc-binding 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					GGTAGAAGCAGGTGGTCTCCA	0.607													20	39	---	---	---	---	PASS
LRRC52	440699	broad.mit.edu	37	1	165513549	165513549	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165513549G>T	uc001gde.2	+	1	72	c.16G>T	c.(16-18)GGC>TGC	p.G6C	LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor	6						integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CCTTGCTTCAGGCCCTGGCCC	0.557													11	74	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097464	167097464	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097464C>A	uc001geb.1	+	5	3096	c.3096C>A	c.(3094-3096)TCC>TCA	p.S1032S		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1032	Ser-rich.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CCTCAAGTTCCCGAGAGGAGA	0.572													11	31	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173569255	173569255	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173569255C>A	uc001giz.2	-	3	651	c.228_splice	c.e3+1	p.E76_splice	SLC9A11_uc010pmq.1_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						ACATACAGTACCTCAACAGAA	0.353													7	29	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175331949	175331949	+	Intron	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175331949G>C	uc001gkp.1	-						TNR_uc009wwu.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CGTCCCACTGGAGAAGAGAAG	0.493													7	53	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176838113	176838113	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176838113C>A	uc001glc.2	-	22	3726	c.3514G>T	c.(3514-3516)GAG>TAG	p.E1172*	ASTN1_uc001glb.1_Nonsense_Mutation_p.E1172*|ASTN1_uc001gld.1_Nonsense_Mutation_p.E1172*	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	1180					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GTCTGCTGCTCCTTCCCACTA	0.428													6	41	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177249890	177249890	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177249890G>T	uc001glf.2	+	8	1890	c.1578G>T	c.(1576-1578)GAG>GAT	p.E526D	FAM5B_uc001glg.2_Missense_Mutation_p.E421D	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	526						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GCCGCATTGAGGTACACTCCA	0.547													4	18	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250164	177250164	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250164G>C	uc001glf.2	+	8	2164	c.1852G>C	c.(1852-1854)GTG>CTG	p.V618L	FAM5B_uc001glg.2_Missense_Mutation_p.V513L	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	618						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						AAGGACTAACGTGGATGCAGC	0.517													5	19	---	---	---	---	PASS
ACBD6	84320	broad.mit.edu	37	1	180366651	180366651	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180366651C>A	uc001gog.2	-	6	1284	c.663G>T	c.(661-663)CAG>CAT	p.Q221H		NM_032360	NP_115736	Q9BR61	ACBD6_HUMAN	acyl-coenzyme A binding domain containing 6	221						cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1						TCACTCTTACCTGACAGTTAA	0.274													17	137	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181727124	181727124	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181727124C>A	uc001gow.2	+	31	4536	c.4371C>A	c.(4369-4371)ACC>ACA	p.T1457T	CACNA1E_uc009wxs.2_Silent_p.T1345T|CACNA1E_uc001gox.1_Silent_p.T683T|CACNA1E_uc009wxt.2_Silent_p.T683T	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1457	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AACCTCTCACCCGCTACATGC	0.522													6	57	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186076015	186076015	+	Splice_Site	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186076015G>A	uc001grq.1	+	70	11000	c.10771_splice	c.e70-1	p.V3591_splice		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGGTTTTGTAGGTGGAGGATA	0.333													12	70	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186329965	186329965	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186329965T>A	uc001grv.2	-	10	1328	c.1031A>T	c.(1030-1032)GAG>GTG	p.E344V	TPR_uc010pop.1_Missense_Mutation_p.E420V	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	344	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCCTATTTTCTCAAGCATTTC	0.348			T	NTRK1	papillary thyroid								7	35	---	---	---	---	PASS
B3GALT2	8707	broad.mit.edu	37	1	193149618	193149618	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193149618G>C	uc001gtc.3	-	2	1790	c.1075C>G	c.(1075-1077)CCC>GCC	p.P359A	CDC73_uc001gtb.2_Intron	NM_003783	NP_003774	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta	359	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1						AACTCATTGGGAGGGGGTACA	0.413													6	41	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201915297	201915297	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201915297G>A	uc001gxb.2	-	1	420	c.172C>T	c.(172-174)CAG>TAG	p.Q58*	LMOD1_uc010ppu.1_Nonsense_Mutation_p.Q58*	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	58					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						CCCGTGGACTGTTTCTCCGTC	0.572													13	48	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202276493	202276493	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202276493C>A	uc001gxu.2	+	14	1244	c.1244C>A	c.(1243-1245)CCC>CAC	p.P415H	LGR6_uc001gxv.2_Missense_Mutation_p.P363H|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Missense_Mutation_p.P276H	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	415	LRR 14.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						TCCATCCACCCCGAGGCCTTC	0.597													9	38	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203472827	203472827	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203472827C>A	uc001gzu.1	+	7	1094	c.978C>A	c.(976-978)CTC>CTA	p.L326L		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	326						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCCTCGGCTCCCCATCGGCC	0.617													6	21	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205039104	205039104	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205039104G>T	uc001hbr.2	+	18	2615	c.2346G>T	c.(2344-2346)ACG>ACT	p.T782T	CNTN2_uc001hbq.1_Silent_p.T673T|CNTN2_uc001hbs.2_Silent_p.T570T	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	782	Fibronectin type-III 2.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGCCCTACACGCCCTTTGAGG	0.662													8	42	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207741317	207741317	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207741317C>G	uc001hfy.2	+	17	2891	c.2751C>G	c.(2749-2751)ACC>ACG	p.T917T	CR1_uc009xcl.1_Silent_p.T467T|CR1_uc001hfx.2_Silent_p.T1367T|CR1_uc009xck.1_Silent_p.T467T	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	917	Extracellular (Potential).|Sushi 14.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						GAGAGAGCACCATCCGCTGCA	0.537													13	73	---	---	---	---	PASS
HSD11B1	3290	broad.mit.edu	37	1	209880159	209880159	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209880159C>T	uc001hhj.2	+	4	432	c.325C>T	c.(325-327)CTC>TTC	p.L109F	HSD11B1_uc001hhk.2_Missense_Mutation_p.L109F	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	109	Lumenal (Potential).				glucocorticoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|11-beta-hydroxysteroid dehydrogenase|binding			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	NADH(DB00157)	AGCAGGAAAGCTCATGGGTGA	0.527													16	87	---	---	---	---	PASS
TRAF3IP3	80342	broad.mit.edu	37	1	209948944	209948944	+	Silent	SNP	C	A	A	rs113331659		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209948944C>A	uc001hho.2	+	11	1206	c.916C>A	c.(916-918)CGA>AGA	p.R306R	TRAF3IP3_uc001hhl.2_Silent_p.R286R|TRAF3IP3_uc001hhm.1_Silent_p.R306R|TRAF3IP3_uc001hhn.2_Silent_p.R286R|TRAF3IP3_uc009xcr.2_Silent_p.R306R	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	306	Cytoplasmic (Potential).|Potential.					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		TCTCCCTCAGCGATCCCTGGC	0.617													8	39	---	---	---	---	PASS
ATF3	467	broad.mit.edu	37	1	212788546	212788546	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212788546G>A	uc001hjf.2	+	2	316	c.183G>A	c.(181-183)GCG>GCA	p.A61A	ATF3_uc001hjj.2_Silent_p.A61A|ATF3_uc009xdg.1_Intron|ATF3_uc001hjh.2_Silent_p.A61A|ATF3_uc001hji.2_Silent_p.A61A|ATF3_uc010ptg.1_RNA	NM_001030287	NP_001025458	P18847	ATF3_HUMAN	activating transcription factor 3 isoform 1	61						nucleolus	identical protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)		TGTCCTCTGCGCTGGAATCAG	0.478													6	26	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214170585	214170585	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214170585G>T	uc001hkh.2	+	2	979	c.707G>T	c.(706-708)CGC>CTC	p.R236L	PROX1_uc001hkg.1_Missense_Mutation_p.R236L	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	236					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CGAGAGGAGCGCCGACAGCTG	0.498													4	27	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215844535	215844535	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215844535G>T	uc001hku.1	-	64	14299	c.13912C>A	c.(13912-13914)CCA>ACA	p.P4638T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4638	Fibronectin type-III 32.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCAGATGTGGAGGGGGTTGC	0.483										HNSCC(13;0.011)			11	59	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216462640	216462640	+	Silent	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216462640A>T	uc001hku.1	-	11	2340	c.1953T>A	c.(1951-1953)GGT>GGA	p.G651G	USH2A_uc001hkv.2_Silent_p.G651G	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	651	Extracellular (Potential).|Laminin EGF-like 3.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAAGAATGCTACCATTTCTAG	0.403										HNSCC(13;0.011)			12	52	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216741400	216741400	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216741400G>T	uc001hkw.1	-	4	796	c.630C>A	c.(628-630)TAC>TAA	p.Y210*	ESRRG_uc001hky.1_Nonsense_Mutation_p.Y187*|ESRRG_uc009xdp.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hkz.1_Nonsense_Mutation_p.Y148*|ESRRG_uc010puc.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hla.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hlb.1_Nonsense_Mutation_p.Y187*|ESRRG_uc010pud.1_Nonsense_Mutation_p.Y18*|ESRRG_uc001hlc.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hld.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hkx.1_Nonsense_Mutation_p.Y215*|ESRRG_uc009xdo.1_Nonsense_Mutation_p.Y187*|ESRRG_uc001hle.1_Nonsense_Mutation_p.Y187*	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	210					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TCCTGCGCTTGTACTTCTGCC	0.512													7	51	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217842374	217842374	+	Splice_Site	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217842374G>C	uc001hlh.1	+	4	267	c.241_splice	c.e4-1	p.V81_splice	SPATA17_uc009xdr.1_Splice_Site|SPATA17_uc001hli.2_Splice_Site_p.V81_splice	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TTGATTCACAGGTAGCATATT	0.313													15	79	---	---	---	---	PASS
DUSP10	11221	broad.mit.edu	37	1	221912285	221912285	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221912285C>A	uc001hmy.1	-	2	984	c.802G>T	c.(802-804)GTG>TTG	p.V268L	DUSP10_uc001hmx.1_5'Flank|DUSP10_uc001hmz.1_Intron	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	268	Rhodanese.				inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		CCTTTCAACACCAGAGGTTCT	0.507													7	67	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222700356	222700356	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222700356G>T	uc001hnh.1	-	7	1818	c.1760C>A	c.(1759-1761)GCC>GAC	p.A587D		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	587					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		TGGTGCATAGGCACTTGGGTA	0.433													4	14	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222715457	222715457	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222715457C>A	uc001hnh.1	-	3	1073	c.1015G>T	c.(1015-1017)GGC>TGC	p.G339C		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	339					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		AGTTGTCCGCCATTATGGTTT	0.473													5	33	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223178402	223178402	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223178402C>T	uc001hnu.1	+	8	3810	c.3663C>T	c.(3661-3663)AAC>AAT	p.N1221N		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	1221					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		AATTTTTCAACAGCCAAGCAA	0.478													8	52	---	---	---	---	PASS
TP53BP2	7159	broad.mit.edu	37	1	223989849	223989849	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223989849G>A	uc010pvb.1	-	9	1486	c.1194C>T	c.(1192-1194)AAC>AAT	p.N398N	TP53BP2_uc001hod.2_Silent_p.N269N|TP53BP2_uc010puz.1_5'Flank|TP53BP2_uc010pva.1_Silent_p.N37N	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1	392					apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		CAGATCTCATGTTGGGCAGTG	0.493													12	66	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228469829	228469829	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228469829A>T	uc009xez.1	+	31	8437	c.8393A>T	c.(8392-8394)GAG>GTG	p.E2798V	OBSCN_uc001hsn.2_Missense_Mutation_p.E2798V|OBSCN_uc001hsp.1_Missense_Mutation_p.E497V|OBSCN_uc001hsq.1_Missense_Mutation_p.E54V	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2798	Ig-like 27.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GTGGTCCGGGAGGCTGCACCA	0.652													4	9	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228487724	228487724	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228487724A>G	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsq.1_Missense_Mutation_p.Y1366C	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGGGACAGGTACAGCCTGAAG	0.562													6	33	---	---	---	---	PASS
C1orf198	84886	broad.mit.edu	37	1	230979363	230979363	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230979363C>A	uc001hub.2	-	3	708	c.664G>T	c.(664-666)GAA>TAA	p.E222*	C1orf198_uc009xfh.1_Nonsense_Mutation_p.E92*|C1orf198_uc001huc.1_Nonsense_Mutation_p.E5*|C1orf198_uc001hud.1_Nonsense_Mutation_p.E184*	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	222											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				AAGACCTTTTCCCCCTTCTCC	0.627													9	62	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232575113	232575113	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232575113T>A	uc001hvg.2	-	13	3930	c.3772A>T	c.(3772-3774)ATC>TTC	p.I1258F	SIPA1L2_uc001hvf.2_Missense_Mutation_p.I332F	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1258					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCCCCTTTGATGTAGGTCAGC	0.622													5	32	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232579347	232579347	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232579347C>A	uc001hvg.2	-	10	3595	c.3437_splice	c.e10+1	p.G1146_splice	SIPA1L2_uc001hvf.2_Splice_Site_p.G220_splice	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ATGAACAGTACCCGTCGTAGC	0.527													4	18	---	---	---	---	PASS
EDARADD	128178	broad.mit.edu	37	1	236645625	236645625	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236645625G>T	uc001hxu.1	+	6	389	c.324G>T	c.(322-324)CGG>CGT	p.R108R	EDARADD_uc001hxv.1_Silent_p.R98R	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A	108					cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GCTTGCTCCGGGCCCCCACCA	0.488													9	29	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237941988	237941988	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237941988A>G	uc001hyl.1	+	88	11918	c.11798A>G	c.(11797-11799)CAG>CGG	p.Q3933R	RYR2_uc010pya.1_Missense_Mutation_p.Q348R	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3933					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGAATCAACAGAGTTTGGCA	0.448													5	21	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947713	237947713	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947713C>G	uc001hyl.1	+	90	12821	c.12701C>G	c.(12700-12702)GCT>GGT	p.A4234G	RYR2_uc010pya.1_Missense_Mutation_p.A649G	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4234	Helical; Name=M3; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCGAGGATGGCTTTCTTCTCC	0.552													4	11	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240351499	240351499	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240351499C>A	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCTTCCTTTCCAATCTAGAAT	0.353													9	38	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240978064	240978064	+	Missense_Mutation	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240978064T>G	uc001hyv.2	-	12	1127	c.797A>C	c.(796-798)CAA>CCA	p.Q266P	RGS7_uc010pyh.1_Missense_Mutation_p.Q240P|RGS7_uc010pyj.1_Missense_Mutation_p.Q182P|RGS7_uc001hyu.2_Missense_Mutation_p.Q266P|RGS7_uc009xgn.1_Missense_Mutation_p.Q213P|RGS7_uc001hyw.2_Missense_Mutation_p.Q266P|RGS7_uc001hyt.2_Missense_Mutation_p.Q98P	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	266	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TAACTGTATTTGCCAATATTT	0.318													11	71	---	---	---	---	PASS
KMO	8564	broad.mit.edu	37	1	241753539	241753539	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241753539G>A	uc009xgp.2	+	14	1299	c.1234G>A	c.(1234-1236)GTG>ATG	p.V412M	KMO_uc001hyy.2_Missense_Mutation_p.V399M|KMO_uc009xgo.1_Missense_Mutation_p.V412M	NM_003679	NP_003670	O15229	KMO_HUMAN	kynurenine 3-monooxygenase	412					pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			CCATGAGGCTGTGCAGCGTTG	0.318													12	69	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	247902640	247902640	+	IGR	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247902640C>A								OR6F1 (26583 upstream) : OR1C1 (18126 downstream)																							CTGTGTGCCTCACCTCATTGT	0.413													3	31	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248031145	248031145	+	Splice_Site	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248031145A>T	uc001ido.2	+	4	796	c.748_splice	c.e4-2	p.G250_splice	OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTTCCTTTTCAGGGTGTGAGA	0.463													7	29	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436853	248436853	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436853C>A	uc010pzi.1	-	1	264	c.264G>T	c.(262-264)AAG>AAT	p.K88N		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGGAGATGGCCTTACTTCCGG	0.567													16	83	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685066	248685066	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685066T>C	uc001ien.1	+	1	119	c.119T>C	c.(118-120)CTG>CCG	p.L40P		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTGAGCCTTCTGGGGAACACT	0.463													9	52	---	---	---	---	PASS
PGBD2	267002	broad.mit.edu	37	1	249211704	249211704	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249211704G>T	uc001ifh.2	+	3	1068	c.921G>T	c.(919-921)GTG>GTT	p.V307V	PGBD2_uc001ifg.2_Silent_p.V56V|PGBD2_uc009xhd.2_Silent_p.V304V	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	307										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GCTACTTGGTGTGGTTTGAGC	0.542													7	57	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1544421	1544421	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1544421C>T	uc002qww.2	+	16	2765	c.2674C>T	c.(2674-2676)CCC>TCC	p.P892S	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.P835S|TPO_uc002qwr.2_Missense_Mutation_p.P892S|TPO_uc002qwx.2_Missense_Mutation_p.P835S|TPO_uc010yio.1_Missense_Mutation_p.P719S|TPO_uc010yip.1_Missense_Mutation_p.P848S|TPO_uc002qwy.1_Missense_Mutation_p.P188S|TPO_uc002qwz.2_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	892	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CGGAGGAACTCCCGAGCTGAG	0.642													18	45	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1680758	1680758	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1680758C>A	uc002qxa.2	-	8	853	c.789G>T	c.(787-789)GTG>GTT	p.V263V	PXDN_uc002qxb.1_Silent_p.V263V|PXDN_uc002qxc.1_Silent_p.V80V	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	263	Ig-like C2-type 1.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGGTGAAGTACACGGTGTTCC	0.552													3	7	---	---	---	---	PASS
HS1BP3	64342	broad.mit.edu	37	2	20838383	20838383	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20838383T>A	uc002rdw.1	-	4	477	c.436A>T	c.(436-438)ACC>TCC	p.T146S	HS1BP3_uc002rdx.2_Missense_Mutation_p.T146S	NM_022460	NP_071905	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	146					cell communication		phosphatidylinositol binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCTGCTGGTGAGCCCTGCA	0.542													7	25	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26680912	26680912	+	3'UTR	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26680912G>T	uc002rhk.2	-	47					OTOF_uc010yla.1_Missense_Mutation_p.A727E|OTOF_uc002rhh.2_3'UTR|OTOF_uc002rhi.2_3'UTR|OTOF_uc002rhj.2_Missense_Mutation_p.A1230E	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a						cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCCTTCATGCCCCAAGGAG	0.617													7	41	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33567903	33567903	+	Splice_Site	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33567903A>C	uc002ros.2	+	25	3734	c.3734_splice	c.e25-2	p.D1245_splice	LTBP1_uc002rot.2_Splice_Site_p.D919_splice|LTBP1_uc002rou.2_Splice_Site_p.D918_splice|LTBP1_uc002rov.2_Splice_Site_p.D865_splice|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCTTTTTTGCAGATATTGATG	0.418													24	88	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43625176	43625176	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43625176C>G	uc002rsw.3	-	29	4513	c.4161G>C	c.(4159-4161)TTG>TTC	p.L1387F	THADA_uc010far.2_Missense_Mutation_p.L582F|THADA_uc002rsx.3_Missense_Mutation_p.L1387F|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.L1096F|THADA_uc010fat.1_Missense_Mutation_p.L534F	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1387							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GGAGTGTGGACAACAGAGTTC	0.478													11	48	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46386887	46386887	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46386887G>T	uc002rut.2	+	14	2260	c.2063G>T	c.(2062-2064)CGC>CTC	p.R688L		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	688	AGC-kinase C-terminal.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TTCAAACCACGCATTGTAAGT	0.572													19	48	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49189950	49189950	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49189950G>A	uc002rww.2	-	10	2084	c.2010C>T	c.(2008-2010)GGC>GGT	p.G670G	FSHR_uc002rwx.2_Silent_p.G608G|FSHR_uc010fbn.2_Silent_p.G644G	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	670	Cytoplasmic (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	AAGAGCAGTGGCCATTCCTTG	0.438									Gonadal_Dysgenesis_46_XX				13	49	---	---	---	---	PASS
C2orf63	130162	broad.mit.edu	37	2	55436852	55436852	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55436852C>G	uc002ryi.2	-	6	961	c.615G>C	c.(613-615)CAG>CAC	p.Q205H	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.Q83H	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	205	Potential.						binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			CAGCCTTCCTCTGAGCTGGCA	0.328													11	44	---	---	---	---	PASS
FIGLA	344018	broad.mit.edu	37	2	71012642	71012642	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71012642C>G	uc002she.1	-	3	519	c.514G>C	c.(514-516)GGG>CGG	p.G172R		NM_001004311	NP_001004311	Q6QHK4	FIGLA_HUMAN	factor in the germline alpha	172					multicellular organismal development|oocyte development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor complex	DNA binding|transcription factor binding				0						GCCCAAGGCCCTTCCTCTTCA	0.488													15	210	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71797850	71797850	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71797850C>A	uc002sie.2	+	29	3529	c.3153C>A	c.(3151-3153)AGC>AGA	p.S1051R	DYSF_uc010feg.2_Missense_Mutation_p.S1082R|DYSF_uc010feh.2_Missense_Mutation_p.S1037R|DYSF_uc002sig.3_Missense_Mutation_p.S1037R|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.S1051R|DYSF_uc010fef.2_Missense_Mutation_p.S1068R|DYSF_uc010fei.2_Missense_Mutation_p.S1068R|DYSF_uc010fek.2_Missense_Mutation_p.S1069R|DYSF_uc010fej.2_Missense_Mutation_p.S1038R|DYSF_uc010fel.2_Missense_Mutation_p.S1038R|DYSF_uc010feo.2_Missense_Mutation_p.S1083R|DYSF_uc010fem.2_Missense_Mutation_p.S1052R|DYSF_uc010fen.2_Missense_Mutation_p.S1069R|DYSF_uc002sif.2_Missense_Mutation_p.S1052R	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1051	Cytoplasmic (Potential).|Arg-rich.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GGGATCTCAGCCAAATGGAAG	0.637													7	21	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73676776	73676776	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73676776A>T	uc002sje.1	+	10	3236	c.3125A>T	c.(3124-3126)GAG>GTG	p.E1042V	ALMS1_uc002sjf.1_Missense_Mutation_p.E998V|ALMS1_uc002sjg.2_Missense_Mutation_p.E428V|ALMS1_uc002sjh.1_Missense_Mutation_p.E428V	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1040	34 X 47 AA approximate tandem repeat.|11.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CAGAAGACTGAGATACCAGCA	0.468													44	80	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73800227	73800227	+	Missense_Mutation	SNP	G	T	T	rs28730859		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73800227G>T	uc002sje.1	+	18	11337	c.11226G>T	c.(11224-11226)GAG>GAT	p.E3742D	ALMS1_uc002sjf.1_Missense_Mutation_p.E3698D|ALMS1_uc002sjg.2_Missense_Mutation_p.E3128D|ALMS1_uc002sjh.1_Missense_Mutation_p.E3128D	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3740					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GGCCCTCAGAGGAGAGTGAGC	0.393													13	41	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73800228	73800228	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73800228G>T	uc002sje.1	+	18	11338	c.11227G>T	c.(11227-11229)GAG>TAG	p.E3743*	ALMS1_uc002sjf.1_Nonsense_Mutation_p.E3699*|ALMS1_uc002sjg.2_Nonsense_Mutation_p.E3129*|ALMS1_uc002sjh.1_Nonsense_Mutation_p.E3129*	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3741					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GCCCTCAGAGGAGAGTGAGCT	0.393													13	40	---	---	---	---	PASS
MOGS	7841	broad.mit.edu	37	2	74690021	74690021	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74690021C>A	uc010ffj.2	-	4	1058	c.895G>T	c.(895-897)GGC>TGC	p.G299C	MOGS_uc010ffh.2_Missense_Mutation_p.G24C|MOGS_uc010yrt.1_Missense_Mutation_p.G180C|MOGS_uc010ffi.2_Missense_Mutation_p.G193C|MOGS_uc010yru.1_3'UTR	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	299	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0						CCTGGCAAGCCGAGGTAGCGT	0.582													31	124	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89986357	89986357	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89986357G>T	uc010fhm.2	+						uc002stn.1_5'Flank					Parts of antibodies, mostly variable regions.																		TCACCATGAGGCTCCCTGCTC	0.562													9	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90139486	90139486	+	RNA	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90139486G>A	uc010fhm.2	+	18		c.2279G>A								Parts of antibodies, mostly variable regions.																		AGGTTCAGCGGCAGTGGATCT	0.493													41	82	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98411438	98411438	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98411438G>A	uc002syh.3	-	29	3570	c.3341C>T	c.(3340-3342)CCT>CTT	p.P1114L		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1114						integral to membrane				ovary(4)|central_nervous_system(2)	6						TTCCCAGTTAGGTCTGGGTAG	0.348													3	15	---	---	---	---	PASS
RALB	5899	broad.mit.edu	37	2	121050722	121050722	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121050722C>A	uc002tmk.2	+	5	697	c.507C>A	c.(505-507)TTC>TTA	p.F169L	RALB_uc010yys.1_Missense_Mutation_p.F191L|RALB_uc002tml.2_Missense_Mutation_p.F190L|RALB_uc002tmm.2_RNA|RALB_uc010yyt.1_RNA	NM_002881	NP_002872	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	169					apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)				CCCAGGTGTTCTTTGACCTAA	0.343													9	30	---	---	---	---	PASS
SMPD4	55627	broad.mit.edu	37	2	130914946	130914946	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130914946C>A	uc002tqq.1	-	12	1612	c.1092G>T	c.(1090-1092)GAG>GAT	p.E364D	SMPD4_uc002tqo.1_5'UTR|SMPD4_uc002tqp.1_Missense_Mutation_p.E57D|SMPD4_uc010yzy.1_Missense_Mutation_p.E113D|SMPD4_uc010yzz.1_Missense_Mutation_p.E28D|SMPD4_uc002tqr.1_Missense_Mutation_p.E335D|SMPD4_uc002tqs.1_Missense_Mutation_p.E232D|SMPD4_uc002tqt.1_Missense_Mutation_p.E213D|SMPD4_uc010zaa.1_Missense_Mutation_p.E222D|SMPD4_uc010zab.1_Missense_Mutation_p.E262D|SMPD4_uc010zac.1_Missense_Mutation_p.E105D|SMPD4_uc010zad.1_Intron	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	325					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CCAACACATGCTCCTCAGTAG	0.642													3	5	---	---	---	---	PASS
PTPN18	26469	broad.mit.edu	37	2	131128159	131128159	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131128159G>A	uc002trc.2	+	9	820	c.719G>A	c.(718-720)TGC>TAC	p.C240Y	PTPN18_uc002trd.2_Missense_Mutation_p.C219Y|PTPN18_uc002trb.2_Missense_Mutation_p.C133Y|PTPN18_uc002tre.2_5'Flank	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	240	Tyrosine-protein phosphatase.					cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					GGCGTCCTGTGCACCGTGGAT	0.572													17	57	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131521569	131521569	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131521569C>A	uc002trw.2	+	2	2114	c.1924C>A	c.(1924-1926)CAG>AAG	p.Q642K	FAM123C_uc010fmv.2_Missense_Mutation_p.Q642K|FAM123C_uc010fms.1_Missense_Mutation_p.Q642K|FAM123C_uc010fmt.1_Missense_Mutation_p.Q642K|FAM123C_uc010fmu.1_Missense_Mutation_p.Q642K	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	642										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GCCCTGCTCCCAGAAGGAGCC	0.597													4	20	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136552210	136552210	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136552210C>A	uc002tuu.1	-	14	5122	c.5111_splice	c.e14+1	p.R1704_splice		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGTGGACTTACCTGTCTGCAT	0.537													18	34	---	---	---	---	PASS
HNMT	3176	broad.mit.edu	37	2	138759758	138759758	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138759758G>T	uc002tvc.2	+	5	571	c.423G>T	c.(421-423)ATG>ATT	p.M141I	HNMT_uc002tvf.2_Missense_Mutation_p.M141I	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1	141					respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	TTATTCATATGATTCAAGTAA	0.279													4	20	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141093173	141093173	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141093173C>T	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATACTAAGCCATTAACCTAC	0.373										TSP Lung(27;0.18)			28	60	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141108547	141108547	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141108547G>T	uc002tvj.1	-	77	12683	c.11711C>A	c.(11710-11712)CCA>CAA	p.P3904Q		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3904	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTAGTTGAATGGATATATAAA	0.284										TSP Lung(27;0.18)			20	104	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141459804	141459804	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141459804C>A	uc002tvj.1	-	39	7180	c.6208G>T	c.(6208-6210)GAG>TAG	p.E2070*		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2070	Extracellular (Potential).|LDL-receptor class B 22.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCTCCAGTCTCAAGGTCGATT	0.408										TSP Lung(27;0.18)			27	71	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	142012191	142012191	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142012191T>C	uc002tvj.1	-	4	1335	c.363A>G	c.(361-363)CAA>CAG	p.Q121Q	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	121	Extracellular (Potential).|EGF-like 1.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATTCAGCTGTTGGCAATTGG	0.318										TSP Lung(27;0.18)			7	39	---	---	---	---	PASS
GTDC1	79712	broad.mit.edu	37	2	144899453	144899453	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144899453T>A	uc002tvp.2	-	6	796	c.517A>T	c.(517-519)AGC>TGC	p.S173C	GTDC1_uc002tvo.2_Missense_Mutation_p.S173C|GTDC1_uc002tvq.2_Missense_Mutation_p.S173C|GTDC1_uc002tvr.2_Missense_Mutation_p.S173C|GTDC1_uc010fnn.2_Missense_Mutation_p.S173C|GTDC1_uc002tvs.2_Missense_Mutation_p.S141C|GTDC1_uc010fno.2_Missense_Mutation_p.S44C|GTDC1_uc002tvt.1_Missense_Mutation_p.S173C	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	173					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		ACTGACCTGCTCACATCAGGA	0.368													18	58	---	---	---	---	PASS
ACVR2A	92	broad.mit.edu	37	2	148680584	148680584	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148680584G>T	uc002twg.2	+	10	1389	c.1120G>T	c.(1120-1122)GCT>TCT	p.A374S	ACVR2A_uc010zbn.1_Missense_Mutation_p.A266S|ACVR2A_uc002twh.2_Missense_Mutation_p.A374S	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor	374	Cytoplasmic (Potential).|Protein kinase.				activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ATTAGAGGGTGCTATAAACTT	0.408													38	125	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152511897	152511897	+	Intron	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152511897T>C	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGCTAGGAAGTGGGAAAAAAA	0.323													7	20	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160335088	160335088	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160335088C>T	uc002uao.2	-	3	495	c.143G>A	c.(142-144)TGT>TAT	p.C48Y	BAZ2B_uc002uap.2_Missense_Mutation_p.C48Y|BAZ2B_uc002uas.1_Missense_Mutation_p.C48Y|BAZ2B_uc002uau.1_Missense_Mutation_p.C48Y|BAZ2B_uc002uat.3_Missense_Mutation_p.C48Y|BAZ2B_uc010fop.1_Missense_Mutation_p.C48Y	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	48					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						GTATTCACCACATGGGTTGAT	0.358													38	110	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163027560	163027560	+	Missense_Mutation	SNP	C	A	A	rs143485547		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163027560C>A	uc002ucd.2	-	26	2420	c.2212G>T	c.(2212-2214)GGC>TGC	p.G738C	FAP_uc010fpc.2_Missense_Mutation_p.G287C|FAP_uc010zct.1_Missense_Mutation_p.G713C|FAP_uc010fpd.2_Missense_Mutation_p.G217C	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	738	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						GTGGACAGGCCGGATAAGCCG	0.428													22	90	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168101642	168101642	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168101642C>A	uc002udx.2	+	8	3758	c.3740C>A	c.(3739-3741)CCA>CAA	p.P1247Q	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.P1072Q|XIRP2_uc010fpq.2_Missense_Mutation_p.P1025Q|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1072	Xin 20.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GAAAACCAACCAATTGATAAG	0.348													17	35	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	169993938	169993938	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169993938G>A	uc002ues.2	-	76	13797	c.13584C>T	c.(13582-13584)GCC>GCT	p.A4528A		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4528	Cytoplasmic (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CACTGTCTCTGGCTGAGTACA	0.378													16	51	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170127511	170127511	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170127511A>G	uc002ues.2	-	16	2436	c.2223T>C	c.(2221-2223)TCT>TCC	p.S741S	LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	741	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CGACAAAGAAAGAAGGATTCC	0.418													11	34	---	---	---	---	PASS
HOXD12	3238	broad.mit.edu	37	2	176964863	176964863	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176964863C>T	uc010zev.1	+	1	334	c.334C>T	c.(334-336)CGC>TGC	p.R112C	HOXD12_uc010zew.1_Missense_Mutation_p.R112C	NM_021193	NP_067016	P35452	HXD12_HUMAN	homeobox D12	112						nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GCCAGAGGAGCGCGGTCGTAC	0.672													6	14	---	---	---	---	PASS
HOXD10	3236	broad.mit.edu	37	2	176981724	176981724	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176981724C>A	uc002ukj.2	+	1	233	c.163C>A	c.(163-165)CCG>ACG	p.P55T		NM_002148	NP_002139	P28358	HXD10_HUMAN	homeobox D10	55						nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TGGACTGCTCCCGTCTCTGGC	0.488													11	46	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179226430	179226430	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179226430C>T	uc002ulx.2	+	13	1553	c.1175C>T	c.(1174-1176)GCA>GTA	p.A392V	OSBPL6_uc002ulw.2_Missense_Mutation_p.A361V|OSBPL6_uc002uly.2_Missense_Mutation_p.A417V|OSBPL6_uc010zfe.1_Missense_Mutation_p.A361V|OSBPL6_uc002ulz.2_Missense_Mutation_p.A392V|OSBPL6_uc002uma.2_Missense_Mutation_p.A396V	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	392					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TTGAAGTCTGCATTTAATAGC	0.438													21	85	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179588005	179588005	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179588005T>A	uc010zfg.1	-	72	18221	c.17997A>T	c.(17995-17997)CCA>CCT	p.P5999P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P2660P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6926							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGACTTCCCTGGTTCTACAG	0.388													6	26	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179613192	179613192	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613192A>G	uc002unb.2	-	46	14159	c.13935T>C	c.(13933-13935)TAT>TAC	p.Y4645Y	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTTTCTTTATAATGTATTT	0.353													12	141	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182409417	182409417	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182409417T>A	uc002unx.2	-						CERKL_uc002uny.2_Intron|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002unw.2_Intron	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			ACAAAAAGAATTTACTATACC	0.328													9	28	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182774642	182774642	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182774642G>T	uc002uoi.2	+	9	1752	c.1430G>T	c.(1429-1431)GGA>GTA	p.G477V	SSFA2_uc002uoh.2_Missense_Mutation_p.G477V|SSFA2_uc002uoj.2_Missense_Mutation_p.G477V|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.G324V|SSFA2_uc002uol.2_Missense_Mutation_p.G324V	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	477						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AGTACGGAGGGAGAAGCTCCT	0.363													12	31	---	---	---	---	PASS
DUSP19	142679	broad.mit.edu	37	2	183960174	183960174	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183960174G>C	uc002upd.2	+	4	817	c.442G>C	c.(442-444)GTT>CTT	p.V148L	DUSP19_uc010frp.2_Missense_Mutation_p.V97L|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_Missense_Mutation_p.L108F	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1	148	Tyrosine-protein phosphatase.				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						AGTGGTTCTTGTTCATTGTAA	0.333													28	66	---	---	---	---	PASS
GTF3C3	9330	broad.mit.edu	37	2	197629280	197629280	+	3'UTR	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197629280C>T	uc002uts.2	-	18					GTF3C3_uc010zgu.1_3'UTR	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7						TTCTCAGTTGCGGTGCTTTAT	0.413													18	49	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202136259	202136259	+	Nonsense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202136259C>G	uc002uxr.1	+	4	535	c.326C>G	c.(325-327)TCA>TGA	p.S109*	CASP8_uc010ftc.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxo.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxp.1_Nonsense_Mutation_p.S141*|CASP8_uc002uxq.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxs.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxt.1_Nonsense_Mutation_p.S168*|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_Nonsense_Mutation_p.S6*|CASP8_uc002uxv.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxw.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxy.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxx.1_Nonsense_Mutation_p.S109*|CASP8_uc010ftf.2_Nonsense_Mutation_p.S109*|CASP8_uc010fte.1_Nonsense_Mutation_p.S6*	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	109	DED 2.				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						TATCAGATTTCAGAAGAAGTG	0.398										HNSCC(4;0.00038)			14	37	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207170435	207170435	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207170435C>T	uc002vbp.2	+	5	1433	c.1183C>T	c.(1183-1185)CAA>TAA	p.Q395*		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	395							nucleic acid binding|zinc ion binding			ovary(3)	3						GCAAATTGACCAAGAAGATAA	0.398													7	32	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	214794706	214794706	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214794706A>G	uc002veq.2	+	12	1329	c.1237A>G	c.(1237-1239)AGT>GGT	p.S413G	SPAG16_uc010fuz.1_Missense_Mutation_p.S264G|SPAG16_uc002ver.2_Missense_Mutation_p.S359G|SPAG16_uc010zjk.1_Missense_Mutation_p.S319G	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	413	WD 2.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GGCTACTTCAAGTGGTGACAC	0.378													33	86	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217279579	217279579	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217279579A>C	uc002vgc.3	+	3	482	c.152A>C	c.(151-153)CAA>CCA	p.Q51P	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.Q51P|SMARCAL1_uc010fvg.2_Missense_Mutation_p.Q51P	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	51					chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CAGGCCAAGCAAGGCCCATCC	0.512									Schimke_Immuno-Osseous_Dysplasia				24	77	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217279581	217279581	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217279581G>C	uc002vgc.3	+	3	484	c.154G>C	c.(154-156)GGC>CGC	p.G52R	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.G52R|SMARCAL1_uc010fvg.2_Missense_Mutation_p.G52R	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	52					chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GGCCAAGCAAGGCCCATCCCA	0.512									Schimke_Immuno-Osseous_Dysplasia				22	82	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219890788	219890788	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219890788C>T	uc002vjl.1	-	14	2389	c.2305G>A	c.(2305-2307)GGC>AGC	p.G769S		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	769						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCTCAAAGCCAGCGAAATAG	0.592													4	51	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225669970	225669970	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225669970C>A	uc010fwz.1	-	36	4243	c.4004G>T	c.(4003-4005)AGG>ATG	p.R1335M	DOCK10_uc002vob.2_Missense_Mutation_p.R1329M|DOCK10_uc002voa.2_Translation_Start_Site|DOCK10_uc002voc.2_Missense_Mutation_p.R189M	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1335							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CAGGAGACTCCTGGTTTCTGC	0.363													31	107	---	---	---	---	PASS
GPR55	9290	broad.mit.edu	37	2	231775562	231775562	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231775562A>T	uc002vrg.2	-	2	309	c.116T>A	c.(115-117)CTG>CAG	p.L39Q	GPR55_uc002vrf.2_RNA|GPR55_uc010fxs.1_Missense_Mutation_p.L39Q	NM_005683	NP_005674	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	39	Helical; Name=1; (Potential).				activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GATGGCCAGCAGGTTGAGGAG	0.552													13	59	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	233199087	233199087	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233199087G>A	uc010fxz.2	+	18	2443	c.2167G>A	c.(2167-2169)GAG>AAG	p.E723K	DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vso.2_RNA|DIS3L2_uc002vsp.1_5'Flank	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	723							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AGGCTATAGGGAGCGACTAGA	0.652													4	17	---	---	---	---	PASS
CHRNG	1146	broad.mit.edu	37	2	233406092	233406092	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233406092G>A	uc002vsx.1	+	5	380	c.359G>A	c.(358-360)GGT>GAT	p.G120D	CHRNG_uc010fyd.2_Missense_Mutation_p.G120D|CHRNG_uc010fye.1_Intron	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	120	Extracellular (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		AGCGTGGACGGTGTCTTCGAG	0.637													25	76	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	432795	432795	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:432795G>T	uc003bou.2	+	21	2967	c.2696G>T	c.(2695-2697)GGA>GTA	p.G899V	CHL1_uc003bot.2_Missense_Mutation_p.G915V|CHL1_uc003bow.1_Missense_Mutation_p.G899V|CHL1_uc011asi.1_Missense_Mutation_p.G915V	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	899	Fibronectin type-III 3.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AACTCTAAAGGAGCTGGTCCT	0.388													27	19	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13659585	13659585	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13659585C>T	uc011avb.1	+	6	1864	c.1739C>T	c.(1738-1740)GCA>GTA	p.A580V	FBLN2_uc011auz.1_Missense_Mutation_p.A606V|FBLN2_uc011ava.1_Missense_Mutation_p.A580V|FBLN2_uc011avc.1_Missense_Mutation_p.A580V	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	580						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GTTTCAGAGGCAGAGATGGCG	0.607													44	59	---	---	---	---	PASS
TMEM43	79188	broad.mit.edu	37	3	14174420	14174420	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14174420G>T	uc003byk.2	+	6	751	c.497G>T	c.(496-498)GGC>GTC	p.G166V	TMEM43_uc003byl.1_Missense_Mutation_p.G46V	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	166	Lumenal (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1						CGAGAGATTGGCCACAAAAAC	0.448													23	13	---	---	---	---	PASS
SATB1	6304	broad.mit.edu	37	3	18427920	18427920	+	Missense_Mutation	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18427920T>G	uc003cbh.2	-	8	3125	c.1390A>C	c.(1390-1392)ATC>CTC	p.I464L	SATB1_uc003cbi.2_Missense_Mutation_p.I464L|SATB1_uc003cbj.2_Missense_Mutation_p.I464L	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1	464					cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						GGTGTGCTGATGAGGGGGGCA	0.507													17	105	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19554491	19554491	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19554491C>A	uc003cbk.1	+	13	2304	c.2109C>A	c.(2107-2109)AAC>AAA	p.N703K	KCNH8_uc010hex.1_Missense_Mutation_p.N164K	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	703	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						GCAACATCAACAAGCGACTCC	0.343													11	16	---	---	---	---	PASS
TGFBR2	7048	broad.mit.edu	37	3	30713504	30713504	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30713504A>G	uc003ceo.2	+	4	1211	c.829A>G	c.(829-831)AAG>GAG	p.K277E	TGFBR2_uc003cen.2_Missense_Mutation_p.K302E	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	277	Protein kinase.|Cytoplasmic (Potential).	ATP (By similarity).		K->R: Abolishes kinase activity, TGF-beta signaling and interaction with DAXX.	activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						AGTGGCAGTCAAGATCTTTCC	0.493													25	31	---	---	---	---	PASS
CCR4	1233	broad.mit.edu	37	3	32995297	32995297	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32995297T>A	uc003cfg.1	+	2	551	c.383T>A	c.(382-384)GTC>GAC	p.V128D		NM_005508	NP_005499	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	128	Helical; Name=3; (Potential).				chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response	integral to plasma membrane				lung(1)	1						ATATTCTTTGTCATGCTCATG	0.483													77	90	---	---	---	---	PASS
EXOG	9941	broad.mit.edu	37	3	38537942	38537942	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38537942T>A	uc003cih.2	+	1	180	c.84T>A	c.(82-84)GCT>GCA	p.A28A	EXOG_uc010hhg.2_RNA|EXOG_uc011ayq.1_Silent_p.A28A|EXOG_uc003cij.2_5'UTR|EXOG_uc010hhd.2_5'UTR|EXOG_uc010hhe.2_5'UTR|EXOG_uc003cik.2_5'UTR|EXOG_uc010hhf.2_5'UTR|EXOG_uc003cii.2_5'UTR	NM_005107	NP_005098	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	28						mitochondrial inner membrane	endonuclease activity|metal ion binding|nucleic acid binding				0						TAGTGGGCGCTGCGGGAGCTG	0.657											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	22	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38812765	38812765	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38812765C>A	uc003ciq.2	-							NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	TAGAGATATACTCACGCCAGG	0.318													47	61	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40231921	40231921	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40231921C>T	uc003cka.2	+	10	1767	c.1632C>T	c.(1630-1632)CCC>CCT	p.P544P	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Silent_p.P544P|MYRIP_uc010hhw.2_Silent_p.P455P|MYRIP_uc011ayz.1_Silent_p.P357P|uc003ckb.2_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	544	Myosin-binding.|Actin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CATCTTCCCCCAGCGCCCAGC	0.602													3	35	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48677267	48677267	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48677267C>G	uc003cul.2	-	34	10032	c.9751G>C	c.(9751-9753)GCC>CCC	p.A3251P	CELSR3_uc003cuf.1_Missense_Mutation_p.A3349P|CELSR3_uc010hkf.2_Missense_Mutation_p.A541P|CELSR3_uc010hkg.2_Missense_Mutation_p.A1234P	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3251	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TTGAAAGAGGCAAGGATGGAG	0.602													48	57	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49736430	49736430	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49736430G>A	uc003cxh.2	+	10	742	c.656G>A	c.(655-657)GGC>GAC	p.G219D	RNF123_uc010hky.1_5'Flank|RNF123_uc003cxi.2_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	219	B30.2/SPRY.					cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GTATCACTGGGCACTGCCTTT	0.582													43	54	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52557073	52557073	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52557073G>C	uc003dej.2	+	63	7017	c.6943G>C	c.(6943-6945)GGT>CGT	p.G2315R	STAB1_uc003dek.1_Missense_Mutation_p.G330R|STAB1_uc003del.2_Missense_Mutation_p.G202R	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	2315	Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGGCTTCGTGGGTGACGGGAT	0.602													21	43	---	---	---	---	PASS
DCP1A	55802	broad.mit.edu	37	3	53324879	53324879	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53324879T>A	uc003dgs.3	-	8	1484	c.1391A>T	c.(1390-1392)CAG>CTG	p.Q464L	DCP1A_uc003dgt.3_RNA	NM_018403	NP_060873	Q9NPI6	DCP1A_HUMAN	DCP1 decapping enzyme homolog A	464					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		CTGGTTCTGCTGCATAGACTG	0.363													3	5	---	---	---	---	PASS
LRTM1	57408	broad.mit.edu	37	3	54952882	54952882	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54952882G>T	uc003dhl.2	-	3	776	c.642C>A	c.(640-642)GAC>GAA	p.D214E	CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_020678	NP_065729	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	214	Extracellular (Potential).|LRRCT.					integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		CCTTCCAGGTGTCTGGTGATT	0.502													13	16	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74315693	74315693	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74315693C>A	uc003dpm.1	-	21	3005	c.2925G>T	c.(2923-2925)AAG>AAT	p.K975N		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	975	Fibronectin type-III 4.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGTTGTGGCCTTGACTTCAA	0.398													20	165	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97869025	97869025	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97869025C>A	uc003dsg.1	+	1	796	c.796C>A	c.(796-798)CAG>AAG	p.Q266K		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGCATCCCCACAGGCTGATGA	0.433													14	16	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108163597	108163597	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108163597C>T	uc003dxa.1	-	23	2662	c.2605G>A	c.(2605-2607)GCA>ACA	p.A869T		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	869	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TGTAATTGTGCACACTCTTCC	0.433													10	79	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357103	112357103	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357103C>T	uc003dzf.2	-	2	1868	c.1650G>A	c.(1648-1650)AAG>AAA	p.K550K	CCDC80_uc011bhv.1_Silent_p.K550K|CCDC80_uc003dzg.2_Silent_p.K550K|CCDC80_uc003dzh.1_Silent_p.K550K	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	550	Lys-rich.									ovary(2)	2						tcttttttttcttctccttct	0.214													6	27	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113098376	113098376	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113098376C>T	uc003eae.1	-	17	2121	c.2075G>A	c.(2074-2076)AGG>AAG	p.R692K		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	692	Glu-rich.									central_nervous_system(1)	1						TTGTCTCTCCCTCTTTTCAAT	0.328													8	74	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119190305	119190305	+	Intron	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119190305A>T	uc003ecm.2	+						KTELC1_uc011biz.1_Intron|KTELC1_uc011bja.1_Intron	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor							endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		TCAAGGTAAGAGTTAACGAGG	0.443													13	68	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119445084	119445084	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119445084G>T	uc003ede.3	+	7	826	c.749G>T	c.(748-750)TGG>TTG	p.W250L	C3orf15_uc010hqy.1_Missense_Mutation_p.W250L|C3orf15_uc010hqz.2_Missense_Mutation_p.W188L|C3orf15_uc011bjd.1_Missense_Mutation_p.W124L|C3orf15_uc011bje.1_Missense_Mutation_p.W230L|C3orf15_uc010hra.1_Missense_Mutation_p.W11L	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	250						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		AAGCGTGCTTGGGAAGCCTCT	0.542													3	12	---	---	---	---	PASS
GPR156	165829	broad.mit.edu	37	3	119886044	119886044	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119886044C>A	uc011bjf.1	-	9	2280	c.2280G>T	c.(2278-2280)CGG>CGT	p.R760R	GPR156_uc011bjg.1_Silent_p.R756R	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	760	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)		CACAGTAGGGCCGGTGGCAGC	0.567													37	101	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	120976075	120976075	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120976075C>T	uc003eec.3	+	17	1867	c.1727C>T	c.(1726-1728)CCG>CTG	p.P576L	STXBP5L_uc011bji.1_Missense_Mutation_p.P576L	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	576	WD 9.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		ACAAGTCCTCCGTTTCCAGAT	0.388													17	82	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122259607	122259607	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122259607A>T	uc010hri.2	-	8	1727	c.1582T>A	c.(1582-1584)TAT>AAT	p.Y528N	PARP9_uc003eff.3_Missense_Mutation_p.Y493N|PARP9_uc011bjs.1_Missense_Mutation_p.Y493N|PARP9_uc003efg.2_Missense_Mutation_p.Y73N|PARP9_uc003efi.2_Missense_Mutation_p.Y493N|PARP9_uc003efh.2_Missense_Mutation_p.Y528N|PARP9_uc003efj.2_Missense_Mutation_p.Y493N	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	528					cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		TGGGCCTCATACATCTCTTCC	0.453													40	91	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125822661	125822661	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125822661C>A	uc003eim.1	-	23	2872	c.2682G>T	c.(2680-2682)CGG>CGT	p.R894R	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Silent_p.R793R|SLC41A3_uc011bkh.1_5'Flank	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	894	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CTGTCTTGACCCGCAGGTACT	0.577													6	17	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127387446	127387446	+	Intron	SNP	C	G	G	rs116213104	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127387446C>G	uc003ejq.2	+							NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor						leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						GCAGGGTGAGCGAGGGCAGGT	0.632													3	5	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127823761	127823761	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127823761C>A	uc003ekh.2	-	4	472	c.368G>T	c.(367-369)CGA>CTA	p.R123L	RUVBL1_uc003ekf.2_Missense_Mutation_p.R63L|RUVBL1_uc010hss.2_Missense_Mutation_p.R123L	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	123					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		CTCCTTTATTCGCAGCCCTGG	0.473													18	42	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129278510	129278510	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129278510C>A	uc003emx.2	-	32	5350	c.5250G>T	c.(5248-5250)AAG>AAT	p.K1750N	PLXND1_uc003emw.2_5'Flank|PLXND1_uc011blb.1_Missense_Mutation_p.K418N	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1750	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGATTCCCCTCTTCTCAGCCT	0.572													10	89	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129389433	129389433	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389433A>T	uc003emz.3	-	5	1752	c.1251T>A	c.(1249-1251)TAT>TAA	p.Y417*	TMCC1_uc003emy.3_Nonsense_Mutation_p.Y93*|TMCC1_uc011blc.1_Nonsense_Mutation_p.Y238*|TMCC1_uc010htg.2_Nonsense_Mutation_p.Y303*	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	417						integral to membrane				skin(1)	1						CTTCACTACCATATTTTGGGC	0.498													9	35	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130452389	130452389	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130452389T>A	uc003enj.2	-							NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4						fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						AATAAACTCTTACCAGCATAG	0.348													16	23	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133098958	133098958	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133098958G>C	uc003eph.2	+	4	677	c.403G>C	c.(403-405)GGG>CGG	p.G135R	TMEM108_uc003epi.2_Missense_Mutation_p.G135R|TMEM108_uc003epj.1_Missense_Mutation_p.G135R|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Missense_Mutation_p.G86R	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	135	Pro-rich.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4						CCGCCCTCGAGGGCAGGCTGC	0.706													4	24	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133478161	133478161	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133478161C>A	uc003epu.1	+	14	2919	c.1191C>A	c.(1189-1191)ATC>ATA	p.I397I	TF_uc011blt.1_Silent_p.I270I|TF_uc003epw.1_Intron|TF_uc003epv.1_Silent_p.I397I	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	397	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	AAGACTGCATCGCCAAGATCA	0.547													20	39	---	---	---	---	PASS
RBP1	5947	broad.mit.edu	37	3	139258355	139258355	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139258355C>A	uc003eti.2	-	1	317	c.206G>T	c.(205-207)GGG>GTG	p.G69V	RBP1_uc011bmx.1_Missense_Mutation_p.G69V|RBP1_uc010huj.2_RNA|RBP1_uc011bmy.1_Missense_Mutation_p.G69V	NM_002899	NP_002890	P09455	RET1_HUMAN	retinol binding protein 1, cellular isoform a	7						cytoplasm	retinal binding|retinol binding|transporter activity				0					Vitamin A(DB00162)	CTTCCAGTACCCAGTGAAGTC	0.672													6	11	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140397179	140397179	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140397179C>A	uc003eto.1	+	1	299	c.108C>A	c.(106-108)AAC>AAA	p.N36K		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	36	Cys-rich.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						CAGAGCGGAACTGCACCTGCT	0.527													43	109	---	---	---	---	PASS
PCOLCE2	26577	broad.mit.edu	37	3	142557696	142557696	+	Missense_Mutation	SNP	C	A	A	rs138409602		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142557696C>A	uc003evd.2	-	5	822	c.626G>T	c.(625-627)CGA>CTA	p.R209L		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	209	CUB 2.					extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						ATAATCATATCGGCAGTAGTT	0.378													12	45	---	---	---	---	PASS
PAQR9	344838	broad.mit.edu	37	3	142681553	142681553	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142681553T>A	uc003evg.2	-	1	626	c.626A>T	c.(625-627)TAC>TTC	p.Y209F	PAQR9_uc003evf.1_5'Flank	NM_198504	NP_940906	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	209	Helical; (Potential).					integral to membrane	receptor activity				0						CAGGGCGCGGTAGGCGGCGAT	0.652													4	15	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150834175	150834175	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150834175C>A	uc003eyp.2	+	2	188	c.150C>A	c.(148-150)GCC>GCA	p.A50A	MED12L_uc011bnz.1_Silent_p.A50A|MED12L_uc003eym.1_Silent_p.A50A|MED12L_uc003eyn.2_Silent_p.A50A|MED12L_uc003eyo.2_Silent_p.A50A	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	50					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATCAGCCAGCCTTCACTGGAG	0.378													7	16	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151164737	151164737	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151164737C>A	uc011bod.1	-	4	3032	c.3032G>T	c.(3031-3033)GGG>GTG	p.G1011V		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1011					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCTCTGCCTCCCAAAGCGTCT	0.498													23	55	---	---	---	---	PASS
SCHIP1	29970	broad.mit.edu	37	3	159605586	159605586	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159605586G>C	uc003fcs.1	+	5	1152	c.1086G>C	c.(1084-1086)AAG>AAC	p.K362N	SCHIP1_uc003fcq.1_Missense_Mutation_p.K438N|SCHIP1_uc003fcr.1_Missense_Mutation_p.K351N|SCHIP1_uc003fct.1_Missense_Mutation_p.K349N|SCHIP1_uc010hvz.1_Missense_Mutation_p.K322N|SCHIP1_uc003fcu.1_Missense_Mutation_p.K119N|SCHIP1_uc003fcv.1_Missense_Mutation_p.K135N	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1	362						cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CAAGGCAAAAGAAATTGCAAG	0.453													12	89	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168825717	168825717	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168825717A>G	uc003ffi.3	-	9	2306	c.2037T>C	c.(2035-2037)ACT>ACC	p.T679T	MECOM_uc010hwk.1_Intron|MECOM_uc003ffj.3_Silent_p.T744T|MECOM_uc011bpi.1_Intron|MECOM_uc003ffn.3_Silent_p.T679T|MECOM_uc003ffk.2_Intron|MECOM_uc003ffl.2_Intron|MECOM_uc011bpj.1_Silent_p.T867T|MECOM_uc011bpk.1_Silent_p.T669T|MECOM_uc010hwn.2_Intron	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	679					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AACTTACCCAAGTTCTCTGAT	0.308													9	36	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173525560	173525560	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173525560G>A	uc003fio.1	+	4	1007	c.584G>A	c.(583-585)AGT>AAT	p.S195N	NLGN1_uc010hww.1_Missense_Mutation_p.S235N|NLGN1_uc003fip.1_Missense_Mutation_p.S195N	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	212	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TATGATGGAAGTGTCTTGGCA	0.428													13	48	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178919142	178919142	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178919142G>A	uc003fjk.2	+	4	784	c.627G>A	c.(625-627)CTG>CTA	p.L209L		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	209	PI3K-RBD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AGTATACTCTGAAAATCAACC	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			40	74	---	---	---	---	PASS
MFN1	55669	broad.mit.edu	37	3	179076790	179076790	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179076790G>T	uc003fjs.2	+	4	537	c.411G>T	c.(409-411)AAG>AAT	p.K137N	MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Missense_Mutation_p.K165N	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	137	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AGAGTGTGAAGGTATGATCTT	0.343													10	32	---	---	---	---	PASS
DVL3	1857	broad.mit.edu	37	3	183883207	183883207	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183883207C>A	uc003fms.2	+						DVL3_uc011bqw.1_Intron|DVL3_uc003fmt.2_Intron|DVL3_uc003fmu.2_Intron	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3						canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CTGTCTATTCCAGTCCTCGTC	0.567													7	12	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184076563	184076563	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184076563C>A	uc003foi.2	-	3	383	c.259G>T	c.(259-261)GTT>TTT	p.V87F	CLCN2_uc003foh.2_5'Flank|CLCN2_uc010hya.1_Missense_Mutation_p.V87F|CLCN2_uc011brl.1_Missense_Mutation_p.V87F|CLCN2_uc011brm.1_Intron|CLCN2_uc011brn.1_Missense_Mutation_p.V87F|POLR2H_uc003foj.1_5'Flank	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	87	Cytoplasmic (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TCTTCACCAACCCTGGATACT	0.557													3	9	---	---	---	---	PASS
EHHADH	1962	broad.mit.edu	37	3	184910839	184910839	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184910839T>A	uc003fpf.2	-	7	1374	c.1347A>T	c.(1345-1347)CAA>CAT	p.Q449H	EHHADH_uc011brs.1_Missense_Mutation_p.Q353H	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	449	3-hydroxyacyl-CoA dehydrogenase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	GGGAAGAGTATTGGCTGGGAA	0.428													19	45	---	---	---	---	PASS
FGF12	2257	broad.mit.edu	37	3	192078223	192078223	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192078223C>A	uc003fsx.2	-	2	1130	c.304G>T	c.(304-306)GAC>TAC	p.D102Y	FGF12_uc003fsy.2_Missense_Mutation_p.D40Y	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1	102					cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TTACTGTAGTCGCTGTTTTCG	0.433													15	20	---	---	---	---	PASS
KIAA0232	9778	broad.mit.edu	37	4	6826361	6826361	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6826361G>A	uc003gjr.3	+	3	644	c.181G>A	c.(181-183)GTC>ATC	p.V61I	KIAA0232_uc003gjq.3_Missense_Mutation_p.V61I	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778	61							ATP binding			ovary(2)	2						CACTCGGTATGTCCTCAGTCT	0.433													8	52	---	---	---	---	PASS
PSAPL1	768239	broad.mit.edu	37	4	7436386	7436386	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7436386G>T	uc011bwj.1	-	1	315	c.221C>A	c.(220-222)GCT>GAT	p.A74D	SORCS2_uc003gkb.3_Intron|SORCS2_uc011bwi.1_Intron	NM_001085382	NP_001078851	Q6NUJ1	SAPL1_HUMAN	prosaposin-like protein 1	74	Saposin B-type 1.				sphingolipid metabolic process	extracellular region|lysosome					0						CCCATTGCCAGCGGCGGCTGC	0.632													3	9	---	---	---	---	PASS
ACOX3	8310	broad.mit.edu	37	4	8368789	8368789	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8368789C>A	uc010idk.2	-	18	2147	c.2002G>T	c.(2002-2004)GGC>TGC	p.G668C	ACOX3_uc003glc.3_Missense_Mutation_p.G668C|ACOX3_uc003gld.3_3'UTR	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3 isoform a	668					bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1						AGGACAGCGCCCCAGAGGTTT	0.473													8	41	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20530638	20530638	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20530638G>T	uc003gpr.1	+	16	1733	c.1529G>T	c.(1528-1530)TGT>TTT	p.C510F	SLIT2_uc003gps.1_Missense_Mutation_p.C502F	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	510	LRRNT 3.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						CCTGAAAAGTGTCGCTGTGAA	0.423													8	73	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22438203	22438203	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22438203T>A	uc003gqm.1	-	9	1412	c.1147A>T	c.(1147-1149)AGT>TGT	p.S383C	GPR125_uc010ieo.1_Missense_Mutation_p.S257C|GPR125_uc003gqn.1_Missense_Mutation_p.S157C|GPR125_uc003gqo.2_Missense_Mutation_p.S383C	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	383	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				TATATCCCACTGCCATGGGTG	0.458													7	39	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22748957	22748957	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22748957A>G	uc003gqp.3	+	3	416	c.325A>G	c.(325-327)AAA>GAA	p.K109E	GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.K110E	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	109					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						TGATTTGTTAAAAAATGGGGT	0.363													16	116	---	---	---	---	PASS
PGM2	55276	broad.mit.edu	37	4	37848563	37848563	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37848563G>A	uc011byb.1	+	9	1092	c.1019G>A	c.(1018-1020)AGG>AAG	p.R340K	PGM2_uc011bya.1_Missense_Mutation_p.R201K|PGM2_uc011byc.1_Missense_Mutation_p.R180K	NM_018290	NP_060760	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	340					glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1						GGTGAATGGAGGGTGTTTTCA	0.428													23	58	---	---	---	---	PASS
NSUN7	79730	broad.mit.edu	37	4	40776439	40776439	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40776439G>T	uc003gvj.3	+						NSUN7_uc003gvh.2_Intron|NSUN7_uc003gvi.3_Intron	NM_024677	NP_078953			NOL1/NOP2/Sun domain family, member 7												0						AATCAGGTAAGTGTTTAAATC	0.363													10	37	---	---	---	---	PASS
SHISA3	152573	broad.mit.edu	37	4	42403402	42403402	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42403402C>A	uc003gwp.2	+	2	869	c.651C>A	c.(649-651)TTC>TTA	p.F217L		NM_001080505	NP_001073974	A0PJX4	SHSA3_HUMAN	shisa homolog 3 precursor	217	Cytoplasmic (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|skin(1)	2						CCCAGTATTTCGCTTACCCCC	0.612													15	48	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42895622	42895622	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42895622G>T	uc003gwt.2	+	1	339	c.339G>T	c.(337-339)GTG>GTT	p.V113V		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	113					cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						AATACAAAGTGAGTGCTGGCC	0.433													8	72	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46053631	46053631	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46053631G>T	uc003gxb.2	-	8	1093	c.941C>A	c.(940-942)ACA>AAA	p.T314K		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	314	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		ACTCAGGGTTGTCATAGTCAG	0.358													7	29	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46067412	46067412	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46067412A>C	uc003gxb.2	-	4	663	c.511T>G	c.(511-513)TGG>GGG	p.W171G		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	171	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		CCATCATTCCAAATTCGAAGC	0.318													7	47	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47527573	47527573	+	Splice_Site	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47527573G>T	uc003gxk.1	+	5	855	c.691_splice	c.e5-1	p.D231_splice	ATP10D_uc003gxj.3_Splice_Site_p.D231_splice	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						AATATTTTTAGGACTCTGAAG	0.338													7	29	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47527574	47527574	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47527574G>T	uc003gxk.1	+	5	855	c.691G>T	c.(691-693)GAC>TAC	p.D231Y	ATP10D_uc003gxj.3_Missense_Mutation_p.D231Y	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	231	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						ATATTTTTAGGACTCTGAAGT	0.338													7	28	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52883288	52883288	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52883288G>A	uc003gzi.2	-	1	505	c.492C>T	c.(490-492)CCC>CCT	p.P164P		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	164	LRR 3.					integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						ACTCACCCTTGGGAGTGTCAC	0.418													25	66	---	---	---	---	PASS
SCFD2	152579	broad.mit.edu	37	4	54231648	54231648	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54231648A>G	uc003gzu.2	-	1	595	c.461T>C	c.(460-462)TTC>TCC	p.F154S	SCFD2_uc010igm.2_Missense_Mutation_p.F154S	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	154					protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CGGGACATGGAACACCTCGGC	0.587													3	25	---	---	---	---	PASS
LNX1	84708	broad.mit.edu	37	4	54343060	54343060	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54343060C>G	uc003hag.3	-	9	2008	c.1752G>C	c.(1750-1752)TCG>TCC	p.S584S	PDGFRA_uc003haa.2_Intron|LNX1_uc003haf.3_Silent_p.S488S|LNX1_uc003hah.3_RNA	NM_001126328	NP_001119800	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1 isoform a	584	PDZ 3.					cytoplasm	zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGAGTACTATCGAGGATGATG	0.522													22	81	---	---	---	---	PASS
HOPX	84525	broad.mit.edu	37	4	57522051	57522051	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57522051T>A	uc011cad.1	-	2	351	c.116A>T	c.(115-117)GAG>GTG	p.E39V	HOPX_uc003hcc.2_Missense_Mutation_p.E57V|HOPX_uc003hca.2_Missense_Mutation_p.E57V|HOPX_uc003hcb.2_Missense_Mutation_p.E39V|HOPX_uc003hcd.2_RNA|HOPX_uc003hce.2_RNA|HOPX_uc003hbz.2_Missense_Mutation_p.E39V	NM_001145459	NP_001138931	Q9BPY8	HOP_HUMAN	HOP homeobox isoform b	39	Homeobox; atypical.				negative regulation of cell differentiation|trophectodermal cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Glioma(25;0.08)|all_neural(26;0.101)					AAGGCCTGCCTCGGCCGCGAT	0.682													5	12	---	---	---	---	PASS
HOPX	84525	broad.mit.edu	37	4	57522052	57522052	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57522052C>G	uc011cad.1	-	2	350	c.115G>C	c.(115-117)GAG>CAG	p.E39Q	HOPX_uc003hcc.2_Missense_Mutation_p.E57Q|HOPX_uc003hca.2_Missense_Mutation_p.E57Q|HOPX_uc003hcb.2_Missense_Mutation_p.E39Q|HOPX_uc003hcd.2_RNA|HOPX_uc003hce.2_RNA|HOPX_uc003hbz.2_Missense_Mutation_p.E39Q	NM_001145459	NP_001138931	Q9BPY8	HOP_HUMAN	HOP homeobox isoform b	39	Homeobox; atypical.				negative regulation of cell differentiation|trophectodermal cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Glioma(25;0.08)|all_neural(26;0.101)					AGGCCTGCCTCGGCCGCGATG	0.687													5	12	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66467468	66467468	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66467468C>A	uc003hcy.2	-	3	994	c.801G>T	c.(799-801)GTG>GTT	p.V267V	EPHA5_uc003hcx.2_Silent_p.V198V|EPHA5_uc003hcz.2_Silent_p.V267V|EPHA5_uc011cah.1_Silent_p.V267V|EPHA5_uc011cai.1_Silent_p.V267V|EPHA5_uc003hda.2_Silent_p.V267V	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	267	Extracellular (Potential).|Cys-rich.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						GTTCATCGGTCACAGAATGGT	0.527										TSP Lung(17;0.13)			7	18	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69343137	69343137	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69343137C>A	uc003hdz.3	+	8	822	c.758C>A	c.(757-759)CCT>CAT	p.P253H		NM_014058	NP_054777			transmembrane protease, serine 11E																		ACAATAAAACCTTCGAAAATG	0.388													40	150	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70513211	70513211	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70513211G>A	uc003hem.3	-	1	215	c.152C>T	c.(151-153)ACT>ATT	p.T51I	UGT2A1_uc011caq.1_Missense_Mutation_p.T51I|UGT2A1_uc010ihu.2_Missense_Mutation_p.T51I|UGT2A1_uc010iht.2_Missense_Mutation_p.T51I	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	51	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						AACTAGGACAGTCACATTATG	0.388													13	51	---	---	---	---	PASS
SULT1B1	27284	broad.mit.edu	37	4	70599210	70599210	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70599210C>G	uc003hen.2	-	6	816	c.518G>C	c.(517-519)TGG>TCG	p.W173S		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	173					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						ATGAGTAAACCAGGAACCATA	0.294													37	76	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71201257	71201257	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71201257G>A	uc003hff.2	+	1	587	c.501G>A	c.(499-501)AAG>AAA	p.K167K		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	167						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				GCACACTAAAGGACAGCAGTG	0.433													9	48	---	---	---	---	PASS
PROL1	58503	broad.mit.edu	37	4	71275312	71275312	+	Silent	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71275312A>T	uc003hfi.2	+	3	441	c.267A>T	c.(265-267)CCA>CCT	p.P89P		NM_021225	NP_067048	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	89	Pro-rich.				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity			large_intestine(1)	1		all_hematologic(202;0.196)				AACTCTTTCCATTGGAATCTA	0.423													30	189	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71510502	71510502	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71510502C>A	uc011caw.1	+	9	3640	c.3359C>A	c.(3358-3360)CCA>CAA	p.P1120Q		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	1120					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			GAACACAGTCCATTTGAATTC	0.418													11	50	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73003832	73003832	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73003832C>T	uc003hgg.2	+	3	808	c.710C>T	c.(709-711)ACG>ATG	p.T237M	NPFFR2_uc010iig.1_Missense_Mutation_p.T19M|NPFFR2_uc003hgi.2_Missense_Mutation_p.T138M|NPFFR2_uc003hgh.2_Missense_Mutation_p.T135M	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	237	Helical; Name=3; (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TCAGTCTTTACGTTAGTTGCA	0.398													5	22	---	---	---	---	PASS
NAA11	84779	broad.mit.edu	37	4	80246828	80246828	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80246828C>A	uc003hlt.3	-	1	344	c.204G>T	c.(202-204)CCG>CCT	p.P68P		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	alpha-N-acetyltransferase 1B	68	N-acetyltransferase.					cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2						TATGGCCATGCGGGACATCAT	0.582													8	77	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83748545	83748545	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83748545C>A	uc003hnf.2	-	24	3432	c.3268G>T	c.(3268-3270)GCT>TCT	p.A1090S	SEC31A_uc003hnd.2_Missense_Mutation_p.A259S|SEC31A_uc003hne.2_Missense_Mutation_p.A839S|SEC31A_uc011ccl.1_Missense_Mutation_p.A1036S|SEC31A_uc003hnl.2_Missense_Mutation_p.A937S|SEC31A_uc003hng.2_Missense_Mutation_p.A1075S|SEC31A_uc003hnh.2_Missense_Mutation_p.A1090S|SEC31A_uc003hni.2_Missense_Mutation_p.A976S|SEC31A_uc003hnj.2_Missense_Mutation_p.A1051S|SEC31A_uc011ccm.1_Missense_Mutation_p.A1070S|SEC31A_uc011ccn.1_Missense_Mutation_p.A1075S|SEC31A_uc003hnk.2_Missense_Mutation_p.A1051S|SEC31A_uc003hnm.2_Missense_Mutation_p.A1090S	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	1090	Interaction with PDCD6.|Pro-rich.				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				CCAATAGGAGCCCCTGGGGCA	0.443													53	124	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94377048	94377048	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94377048G>T	uc011cdt.1	+	11	2039	c.1781G>T	c.(1780-1782)CGA>CTA	p.R594L	GRID2_uc011cdu.1_Missense_Mutation_p.R499L	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	594	Cytoplasmic (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	AATCCCCCACGATTACAAATG	0.443													22	53	---	---	---	---	PASS
ADH7	131	broad.mit.edu	37	4	100348953	100348953	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100348953C>A	uc003huv.1	-	5	676	c.577G>T	c.(577-579)GGC>TGC	p.G193C		NM_000673	NP_000664	P40394	ADH7_HUMAN	class IV alcohol dehydrogenase, mu or sigma	193					ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity			lung(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	NADH(DB00157)	ACAGCAGCGCCATATCCAGTG	0.408													13	24	---	---	---	---	PASS
EMCN	51705	broad.mit.edu	37	4	101439008	101439008	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101439008C>A	uc003hvr.2	-	1	243	c.64G>T	c.(64-66)GGT>TGT	p.G22C	EMCN_uc011cel.1_Missense_Mutation_p.G22C|EMCN_uc011cem.1_Missense_Mutation_p.G22C	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1	22	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		ACAAAAATACCTGTGCTGTTA	0.443													25	106	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102751316	102751316	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102751316A>C	uc003hvy.3	+	2	696	c.422A>C	c.(421-423)CAG>CCG	p.Q141P	BANK1_uc003hvx.3_Missense_Mutation_p.Q126P|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Missense_Mutation_p.Q111P	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	141	Interaction with ITPR2.				B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCAACTGAACAGGAACCTGAA	0.328													5	48	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115997237	115997237	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115997237C>A	uc003ibu.2	-	2	1635	c.956G>T	c.(955-957)AGG>ATG	p.R319M	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	319	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GACATTCATCCTTGTTCCCTC	0.363													19	47	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123175404	123175404	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123175404C>A	uc003ieh.2	+	36	6022	c.5977C>A	c.(5977-5979)CCT>ACT	p.P1993T	KIAA1109_uc003iel.1_5'Flank|KIAA1109_uc003iek.2_Missense_Mutation_p.P612T	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1993	Poly-Pro.				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GATGCCTCCTCCTCCAGATTC	0.373													15	68	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129809879	129809879	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129809879C>T	uc003igp.2	-	20	2465	c.1959G>A	c.(1957-1959)AGG>AGA	p.R653R	SCLT1_uc003ign.2_Silent_p.R317R|SCLT1_uc003igo.2_Silent_p.R263R|SCLT1_uc003igq.2_Silent_p.R272R|SCLT1_uc010iob.1_Silent_p.R140R	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	653	Potential.					centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						GACTTAGACGCCTTTGAAGTC	0.388													4	74	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134076104	134076104	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134076104C>A	uc003iha.2	+	3	3549	c.2723C>A	c.(2722-2724)TCT>TAT	p.S908Y		NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	908	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		ATAGTAAGCTCTAAGGACAGT	0.423													11	15	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141590948	141590948	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141590948C>T	uc010ioj.2	-	8	1549	c.1277G>A	c.(1276-1278)CGA>CAA	p.R426Q		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	426						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				GCTGCTGGGTCGAGAGTACAC	0.522													5	16	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145628235	145628235	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145628235G>T	uc003ijs.1	+							NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor							cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		TTCCCACAATGTAGAAAAAAT	0.378													14	30	---	---	---	---	PASS
SMAD1	4086	broad.mit.edu	37	4	146436166	146436166	+	Splice_Site	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146436166G>T	uc003ikc.2	+	2	816	c.400_splice	c.e2+1	p.V134_splice	SMAD1_uc003ikd.2_Splice_Site_p.V134_splice|SMAD1_uc010iov.2_Splice_Site_p.V134_splice|SMAD1_uc011cic.1_Splice_Site_p.V134_splice	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1						BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					GAAAGCCCTGGTAAGTGAGTT	0.388													16	104	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151773088	151773088	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151773088C>T	uc010ipj.2	-	23	4248	c.3774G>A	c.(3772-3774)TTG>TTA	p.L1258L	LRBA_uc003ilt.3_5'Flank|LRBA_uc003ilu.3_Silent_p.L1258L	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1258						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GACTGGCCTTCAACTCCAGCC	0.413													6	26	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155156647	155156647	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155156647G>A	uc003inw.2	-	25	7792	c.7792C>T	c.(7792-7794)CAG>TAG	p.Q2598*		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2598					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCAGTTTTCTGGAAGGCTTTG	0.433													16	79	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169227871	169227871	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169227871C>A	uc003irp.2	-	5	557	c.265G>T	c.(265-267)GAT>TAT	p.D89Y		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	89							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TACTCGGCATCCTGTGGAGGA	0.358													13	35	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186510909	186510909	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186510909C>T	uc003iyl.2	-	20	4023	c.3165G>A	c.(3163-3165)AGG>AGA	p.R1055R	SORBS2_uc003iyh.2_Silent_p.R779R|SORBS2_uc011ckw.1_Silent_p.R616R|SORBS2_uc003iyi.2_Silent_p.R686R|SORBS2_uc011ckx.1_Silent_p.R621R|SORBS2_uc003iyk.2_Silent_p.R599R|SORBS2_uc003iym.2_Silent_p.R1155R|SORBS2_uc003iyn.1_Silent_p.R646R|SORBS2_uc011cku.1_Silent_p.R447R|SORBS2_uc011ckv.1_Silent_p.R959R|SORBS2_uc003iyd.2_Silent_p.R754R|SORBS2_uc003iye.2_Silent_p.R628R|SORBS2_uc003iya.2_Silent_p.R575R|SORBS2_uc003iyb.2_Silent_p.R528R|SORBS2_uc003iyc.2_Silent_p.R508R|SORBS2_uc003iyg.2_Silent_p.R1169R|SORBS2_uc003iyf.2_Silent_p.R591R	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	1055	SH3 3.					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CATCTTCATTCCTGGGAGTAT	0.413													27	67	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189020189	189020189	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189020189C>A	uc003izl.2	-	4	507	c.471G>T	c.(469-471)AAG>AAT	p.K157N	TRIML2_uc003izj.1_Translation_Start_Site|TRIML2_uc003izk.1_Translation_Start_Site|TRIML2_uc011cle.1_Missense_Mutation_p.K207N|TRIML2_uc011clf.1_Missense_Mutation_p.K207N	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	157							ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		AGCATCTTACCTTGAGCAATG	0.453													10	31	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190883076	190883076	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190883076G>T	uc003izs.2	+	8	920	c.729G>T	c.(727-729)ACG>ACT	p.T243T		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	243	Bipartite nuclear localization signal (Potential).				rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGCATGAGACGCTTCTGGACA	0.328													24	74	---	---	---	---	PASS
CLPTM1L	81037	broad.mit.edu	37	5	1344486	1344486	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1344486A>G	uc003jch.2	-	2	289	c.243T>C	c.(241-243)GAT>GAC	p.D81D	CLPTM1L_uc003jcg.2_5'Flank	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like	81	Extracellular (Potential).				apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		TGGACTCCACATCAAAGTCTT	0.473													5	59	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1403118	1403118	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1403118C>A	uc003jck.2	-	13	1807	c.1686G>T	c.(1684-1686)TGG>TGT	p.W562C		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	562	Helical; Name=12; (Potential).|Interaction with TGFB1I1.				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	TGGCGATGACCCAGCCCAGCG	0.612													11	43	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1422081	1422081	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1422081C>G	uc003jck.2	-	5	823	c.702G>C	c.(700-702)GGG>GGC	p.G234G		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	234	Extracellular (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	ACCGCGGAGGCCCCAGGTCGT	0.657													71	68	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10411539	10411539	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10411539G>A	uc003jet.1	+	19	1969	c.1786G>A	c.(1786-1788)GCT>ACT	p.A596T	MARCH6_uc011cmu.1_Missense_Mutation_p.A548T|MARCH6_uc003jeu.1_Missense_Mutation_p.A294T|MARCH6_uc011cmv.1_Missense_Mutation_p.A491T	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	596	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						AAATAACAACGCTATTCCTGT	0.458													27	41	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16769217	16769217	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16769217G>A	uc003jft.3	-	10	1494	c.1026C>T	c.(1024-1026)ATC>ATT	p.I342I	MYO10_uc010itx.2_5'Flank	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	342	Myosin head-like.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CACCAGCAGTGATAAATTCTA	0.493													4	16	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24537582	24537582	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24537582C>T	uc003jgr.1	-	3	765	c.433G>A	c.(433-435)GAG>AAG	p.E145K	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	145	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ATCACAAACTCTGACTCTGGC	0.423										HNSCC(23;0.051)			37	72	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31466304	31466304	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31466304C>A	uc003jhg.2	-	18	2810	c.2451G>T	c.(2449-2451)AAG>AAT	p.K817N	RNASEN_uc003jhh.2_Missense_Mutation_p.K780N|RNASEN_uc003jhi.2_Missense_Mutation_p.K780N	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	817	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TCTGTGCCAGCTTCTGTTTGT	0.418													26	45	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37348656	37348656	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37348656C>A	uc003jku.1	-	9	1064	c.946G>T	c.(946-948)GCC>TCC	p.A316S	NUP155_uc003jkt.1_Missense_Mutation_p.A257S|NUP155_uc010iuz.1_Missense_Mutation_p.A316S	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	316					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GACACAGAGGCAACTCTGCTC	0.338													10	69	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41181519	41181519	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41181519C>A	uc003jmk.2	-	7	1079	c.869G>T	c.(868-870)AGT>ATT	p.S290I	C6_uc003jml.1_Missense_Mutation_p.S290I	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	290	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GATATTTTCACTTCTCTTTGA	0.358													22	84	---	---	---	---	PASS
CCDC152	100129792	broad.mit.edu	37	5	42801147	42801147	+	3'UTR	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42801147T>C	uc003jmx.3	+	9					CCDC152_uc011cpr.1_3'UTR|SEPP1_uc011cps.1_RNA|SEPP1_uc011cpt.1_RNA|SEPP1_uc011cpu.1_RNA|SEPP1_uc011cpv.1_RNA|SEPP1_uc003jna.2_RNA	NM_001134848	NP_001128320	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152												0						ACAGAGCTTCTTTTGTAAATC	0.458													13	60	---	---	---	---	PASS
MGC42105	167359	broad.mit.edu	37	5	43277155	43277155	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43277155G>T	uc003jno.2	+							NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						TTTTTTCCTTGCAGAAAAGGT	0.453													21	58	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50683438	50683438	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50683438C>A	uc003jor.2	+	3	881	c.333C>A	c.(331-333)AGC>AGA	p.S111R		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	111	LIM zinc-binding 2.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TGGCCTGCAGCCGCCAGCTCA	0.612													13	35	---	---	---	---	PASS
ITGA1	3672	broad.mit.edu	37	5	52206169	52206169	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52206169G>C	uc003jou.2	+	14	1829	c.1777G>C	c.(1777-1779)GCT>CCT	p.A593P	ITGA1_uc003jov.2_RNA|ITGA1_uc003jow.2_Missense_Mutation_p.A124P	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	593	Extracellular (Potential).|FG-GAP 6.				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CGTGATAGGAGCTCCGCTGGA	0.428													34	23	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52377486	52377486	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52377486T>A	uc003joy.2	+	26	3247	c.3104T>A	c.(3103-3105)GTA>GAA	p.V1035E	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.V959E|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	1035	Extracellular (Potential).				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TCTTCTTCTGTATCTTTCAAA	0.393													7	38	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66479329	66479329	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66479329G>A	uc003juy.2	-	3	1490	c.1342C>T	c.(1342-1344)CAG>TAG	p.Q448*		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	448	Extracellular (Potential).|LRR 15.				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TTCAGAACCTGAAGGAAATGG	0.448													30	38	---	---	---	---	PASS
CCNB1	891	broad.mit.edu	37	5	68470119	68470119	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68470119A>C	uc003jvm.2	+	5	765	c.588A>C	c.(586-588)GAA>GAC	p.E196D	CCNB1_uc011crd.1_Missense_Mutation_p.E196D|CCNB1_uc010ixb.2_Missense_Mutation_p.E196D	NM_031966	NP_114172	P14635	CCNB1_HUMAN	cyclin B1	196					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitotic cell cycle spindle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|mitotic spindle stabilization|positive regulation of attachment of spindle microtubules to kinetochore|positive regulation of mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	condensed nuclear chromosome outer kinetochore|cytosol|microtubule organizing center|nucleoplasm|spindle pole					0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGGGTCGGGAAGTCACTGGAA	0.418													31	41	---	---	---	---	PASS
NUDT12	83594	broad.mit.edu	37	5	102895085	102895085	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102895085T>A	uc003koi.2	-	3	384	c.291A>T	c.(289-291)TTA>TTT	p.L97F	NUDT12_uc011cvb.1_Missense_Mutation_p.L79F	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12	97	ANK 3.					nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		CAGTAGCTAGTAAATTAGCTA	0.383													21	28	---	---	---	---	PASS
KIF3A	11127	broad.mit.edu	37	5	132034944	132034944	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132034944T>C	uc003kxo.2	-	16	2124	c.1970A>G	c.(1969-1971)GAG>GGG	p.E657G	KIF3A_uc003kxm.2_Missense_Mutation_p.E239G|KIF3A_uc003kxn.2_Missense_Mutation_p.E642G|KIF3A_uc011cxf.1_Missense_Mutation_p.E684G|KIF3A_uc003kxp.2_Missense_Mutation_p.E660G	NM_007054	NP_008985	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	657					blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			pancreas(1)	1		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGACTCTCCTCAGTATAGGC	0.433													44	61	---	---	---	---	PASS
SLC23A1	9963	broad.mit.edu	37	5	138716052	138716052	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138716052G>T	uc003leh.2	-	6	589	c.492C>A	c.(490-492)AGC>AGA	p.S164R	SLC23A1_uc003leg.2_Missense_Mutation_p.S168R	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	164	Helical; (Potential).				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CCTCCACCACGCTGGACACCA	0.577													3	7	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604159	140604159	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604159C>A	uc003ljb.2	+	1	1082	c.1082C>A	c.(1081-1083)TCA>TAA	p.S361*	PCDHB14_uc011dal.1_Nonsense_Mutation_p.S208*	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	361	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAATGCCTCAGAGACCCTA	0.408													16	35	---	---	---	---	PASS
PCDHGB1	56104	broad.mit.edu	37	5	140730146	140730146	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140730146G>T	uc003ljo.1	+	1	319	c.319G>T	c.(319-321)GCT>TCT	p.A107S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.A107S	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	107	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAAACGGTCGCTGAAAACCC	0.418													14	23	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140811264	140811264	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140811264G>T	uc003lkt.1	+	1	1107	c.938G>T	c.(937-939)GGA>GTA	p.G313V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.G313V	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	313	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGAGTCAGGATTCTACCAG	0.483													22	53	---	---	---	---	PASS
ADRB2	154	broad.mit.edu	37	5	148206670	148206670	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148206670C>A	uc003lpr.1	+	1	515	c.276C>A	c.(274-276)GCC>GCA	p.A92A	SH3TC2_uc003lpp.1_Intron	NM_000024	NP_000015	P07550	ADRB2_HUMAN	adrenergic, beta-2-, receptor, surface	92	Helical; Name=2.				activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	TTGGGGCCGCCCATATTCTTA	0.542													13	22	---	---	---	---	PASS
SLC36A2	153201	broad.mit.edu	37	5	150722495	150722495	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150722495C>G	uc003lty.2	-	4	524	c.394G>C	c.(394-396)GAA>CAA	p.E132Q	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_5'UTR|SLC36A2_uc010jhv.2_Missense_Mutation_p.E132Q|SLC36A2_uc011dct.1_Missense_Mutation_p.E132Q	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	132	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTTGGCTTCTAGTCCATGC	0.512													3	53	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154394676	154394676	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154394676G>T	uc010jih.1	+	1	1417	c.1257G>T	c.(1255-1257)AGG>AGT	p.R419S		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	419	Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGTTGGAGAGGATCATTTTGA	0.473													19	49	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154395465	154395465	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154395465G>T	uc010jih.1	+	1	2206	c.2046G>T	c.(2044-2046)AGG>AGT	p.R682S		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	682	Interaction with PRC1 (By similarity).|Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ACCGTAAGAGGCAATATGAGC	0.423													17	40	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156908015	156908015	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156908015G>T	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc003lwy.2_Intron	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGAAACTGGGAAGAAAAAGA	0.512													5	17	---	---	---	---	PASS
FABP6	2172	broad.mit.edu	37	5	159661868	159661868	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159661868C>T	uc003lya.1	+	3	413	c.285C>T	c.(283-285)TTC>TTT	p.F95F	FABP6_uc003lxx.1_Silent_p.F144F|FABP6_uc003lxz.1_Silent_p.F144F	NM_001445	NP_001436	P51161	FABP6_HUMAN	gastrotropin isoform 2	95					bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGTGAATTTCCCCAACTATC	0.443													10	22	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168093550	168093550	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168093550C>T	uc003mab.2	-	36	4901	c.4481G>A	c.(4480-4482)CGG>CAG	p.R1494Q	SLIT3_uc010jjg.2_Missense_Mutation_p.R1501Q	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1494	CTCK.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTATTTCCGCCGCTTGCTGCG	0.607													11	7	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168135110	168135110	+	Intron	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168135110G>C	uc003mab.2	-						SLIT3_uc010jjg.2_Missense_Mutation_p.C912W	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGCCCTGGGCAGCAAAACC	0.607													8	23	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168671733	168671733	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168671733T>A	uc003mab.2	-	3	737	c.317A>T	c.(316-318)CAG>CTG	p.Q106L	SLIT3_uc010jjg.2_Missense_Mutation_p.Q106L|SLIT3_uc010jji.2_Missense_Mutation_p.Q106L	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	106	LRR 2.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTCAGGTCCTGGAAGGCGCC	0.423													12	26	---	---	---	---	PASS
CCDC99	54908	broad.mit.edu	37	5	169023621	169023621	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169023621G>T	uc003mae.3	+	8	1227	c.948G>T	c.(946-948)CAG>CAT	p.Q316H	CCDC99_uc010jjj.2_Missense_Mutation_p.Q245H|CCDC99_uc011deq.1_Missense_Mutation_p.Q133H|CCDC99_uc010jjk.2_Missense_Mutation_p.Q42H	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99	316	Potential.				cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGAGCAGCAGGAACGGTTGC	0.348													20	43	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169230220	169230220	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169230220C>A	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTGAGTCCTCCTGATGATGT	0.448													17	27	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179192629	179192629	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179192629G>C	uc003mkm.2	+	2	881	c.618G>C	c.(616-618)GAG>GAC	p.E206D	MAML1_uc003mkn.1_Missense_Mutation_p.E206D	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	206					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCCCAGTGAGTCATTTCCTC	0.527													8	14	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6146013	6146013	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6146013G>T	uc003mwv.2	-						F13A1_uc011dib.1_Intron	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TCACTGAAAGGATGGAAAAGA	0.512													13	41	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7580280	7580280	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7580280A>T	uc003mxp.1	+	23	4136	c.3857A>T	c.(3856-3858)CAG>CTG	p.Q1286L	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1286	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GAGATAATGCAGAAGAAGCAG	0.552													13	40	---	---	---	---	PASS
DTNBP1	84062	broad.mit.edu	37	6	15524752	15524752	+	Intron	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15524752C>G	uc003nbm.2	-						DTNBP1_uc003nbl.2_Intron|DTNBP1_uc003nbn.2_Intron|DTNBP1_uc003nbo.2_Intron|DTNBP1_uc003nbp.2_Missense_Mutation_p.R272S|DTNBP1_uc010jph.2_Missense_Mutation_p.R259S	NM_032122	NP_115498	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1 isoform a						actin cytoskeleton reorganization|cellular membrane organization|neuron projection morphogenesis|post-Golgi vesicle-mediated transport|regulation of dopamine receptor signaling pathway	axon part|BLOC-1 complex|cell junction|dendritic spine|endoplasmic reticulum membrane|endosome membrane|growth cone|melanosome membrane|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|synaptic vesicle membrane|synaptosome	identical protein binding				0	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			GTTTGTCAACCCTACCTAAGG	0.542									Hermansky-Pudlak_syndrome				13	79	---	---	---	---	PASS
HIST1H2BF	8343	broad.mit.edu	37	6	26200040	26200040	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26200040A>G	uc003ngx.2	+	1	254	c.254A>G	c.(253-255)AAC>AGC	p.N85S	HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	NM_003522	NP_003513	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	85					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0		all_hematologic(11;0.196)				GCGCATTACAACAAGCGCTCC	0.627													17	92	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26468327	26468327	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26468327G>T	uc003nib.1	+	8	1346	c.1134G>T	c.(1132-1134)CGG>CGT	p.R378R	BTN2A1_uc003nic.1_3'UTR|BTN2A1_uc003nid.1_Silent_p.R226R|BTN2A1_uc011dko.1_Silent_p.R317R|BTN2A1_uc010jqk.1_Silent_p.R138R	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	378	Cytoplasmic (Potential).|B30.2/SPRY.				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						TCCTAGGCCGGGAGAGCTTCG	0.567													20	52	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28227293	28227293	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28227293T>C	uc003nkt.2	+	1	196	c.144T>C	c.(142-144)CGT>CGC	p.R48R	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	48										upper_aerodigestive_tract(1)|ovary(1)	2						CCCGCGGCCGTGAGGGCCTCA	0.652													14	44	---	---	---	---	PASS
OR12D2	26529	broad.mit.edu	37	6	29365234	29365234	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29365234C>A	uc003nmf.3	+	1	819	c.758C>A	c.(757-759)CCT>CAT	p.P253H		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTCTATGCACCTGTTCTTTTC	0.453													15	134	---	---	---	---	PASS
TRIM10	10107	broad.mit.edu	37	6	30122178	30122178	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30122178C>A	uc003npo.3	-	7	1090	c.1014G>T	c.(1012-1014)TGG>TGT	p.W338C	TRIM10_uc003npn.2_Missense_Mutation_p.W338C	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	338	B30.2/SPRY.					cytoplasm	zinc ion binding				0						GTGAGTTCTGCCATTTGTAGG	0.567													7	33	---	---	---	---	PASS
KIAA1949	170954	broad.mit.edu	37	6	30653372	30653372	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30653372C>A	uc003nra.2	-	2	655	c.424G>T	c.(424-426)GAG>TAG	p.E142*	KIAA1949_uc003nrb.3_Nonsense_Mutation_p.E142*	NM_001134870	NP_001128342	Q6NYC8	PHTNS_HUMAN	phostensin	142						cytoplasm|cytoskeleton	actin binding				0						CTTAGTCTCTCTTCTCTTGAC	0.632													20	123	---	---	---	---	PASS
DDR1	780	broad.mit.edu	37	6	30865331	30865331	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30865331G>C	uc003nrr.2	+	16	2432	c.2173G>C	c.(2173-2175)GGG>CGG	p.G725R	DDR1_uc010jse.2_Missense_Mutation_p.G688R|DDR1_uc003nrq.2_Missense_Mutation_p.G688R|DDR1_uc003nrs.2_Missense_Mutation_p.G725R|DDR1_uc003nrt.2_Missense_Mutation_p.G688R|DDR1_uc011dms.1_Missense_Mutation_p.G706R|DDR1_uc003nru.2_Missense_Mutation_p.G688R|DDR1_uc003nrv.2_Missense_Mutation_p.G731R|DDR1_uc003nrw.1_Missense_Mutation_p.G460R|DDR1_uc003nrz.1_Missense_Mutation_p.G50R	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	725	Cytoplasmic (Potential).|Protein kinase.				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	GGCAGCCGAGGGGGCCCCTGG	0.642													9	19	---	---	---	---	PASS
CCHCR1	54535	broad.mit.edu	37	6	31110428	31110428	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31110428C>A	uc003nsr.3	-	18	2413	c.2290G>T	c.(2290-2292)GTT>TTT	p.V764F	CCHCR1_uc011dne.1_Missense_Mutation_p.V750F|CCHCR1_uc003nsq.3_Missense_Mutation_p.V817F|CCHCR1_uc003nsp.3_Missense_Mutation_p.V853F	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	764					cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						CCTTGACAAACAGCTTCCTCT	0.557													5	43	---	---	---	---	PASS
LTB	4050	broad.mit.edu	37	6	31548597	31548597	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31548597G>C	uc003nuk.2	-	4	632	c.624C>G	c.(622-624)GGC>GGG	p.G208G	LTB_uc003nul.2_3'UTR	NM_002341	NP_002332	Q06643	TNFC_HUMAN	lymphotoxin-beta isoform a	208	Extracellular (Potential).				cell-cell signaling|immune response|positive regulation of interleukin-12 biosynthetic process|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding				0					Infliximab(DB00065)|Simvastatin(DB00641)	GCACCAGGCCGCCGAACCCCA	0.657													5	10	---	---	---	---	PASS
EGFL8	80864	broad.mit.edu	37	6	32134487	32134487	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32134487C>T	uc003oab.1	+	4	292	c.234C>T	c.(232-234)TAC>TAT	p.Y78Y	PPT2_uc003nzy.1_RNA|EGFL8_uc003oac.1_Silent_p.Y78Y	NM_030652	NP_085155	Q99944	EGFL8_HUMAN	NG3 protein precursor	78	EMI.					extracellular region|integral to membrane	calcium ion binding				0						GGACCATGTACCGCGTTATGT	0.637													12	28	---	---	---	---	PASS
RPS10	6204	broad.mit.edu	37	6	34386164	34386164	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34386164T>A	uc003ojm.2	-	5	658	c.438A>T	c.(436-438)TCA>TCT	p.S146S	RPS10_uc003ojn.2_Silent_p.S146S	NM_001014	NP_001005	P46783	RS10_HUMAN	ribosomal protein S10	146					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding				0						ATTCGGTTGCTGACCCAGCCC	0.458													5	27	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34826575	34826575	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34826575A>G	uc003oju.3	+	14	2676	c.2442A>G	c.(2440-2442)GCA>GCG	p.A814A	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	814										ovary(3)	3						AGGATGTAGCAGATGTTCATA	0.507													22	135	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35987385	35987385	+	Missense_Mutation	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35987385T>G	uc003olm.2	-	2	211	c.100A>C	c.(100-102)ACC>CCC	p.T34P	SLC26A8_uc003oln.2_Missense_Mutation_p.T34P|SLC26A8_uc003oll.2_Missense_Mutation_p.T34P	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	34	Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						TGTTGAAAGGTCTCCTCATTG	0.498													9	20	---	---	---	---	PASS
MOCS1	4337	broad.mit.edu	37	6	39880094	39880094	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39880094C>A	uc003opb.2	-	7	1033	c.895G>T	c.(895-897)GGC>TGC	p.G299C	MOCS1_uc003opa.2_Missense_Mutation_p.G299C|MOCS1_uc003opc.2_Missense_Mutation_p.G299C|MOCS1_uc003opd.2_Missense_Mutation_p.G299C|MOCS1_uc003ope.2_Missense_Mutation_p.G212C	NM_005942	NP_005933	Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis-step 1 protein	299	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex|nucleus	4 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|catalytic activity|GTP binding|metal ion binding			ovary(1)|liver(1)|central_nervous_system(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTGATCTGGCCTTGGAAGCCA	0.557													17	56	---	---	---	---	PASS
TREM1	54210	broad.mit.edu	37	6	41250461	41250461	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41250461C>T	uc003oqf.1	-	2	142	c.78G>A	c.(76-78)GAG>GAA	p.E26E	TREM1_uc003oqg.1_Silent_p.E26E	NM_018643	NP_061113	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	26	Extracellular (Potential).|Ig-like V-type.				blood coagulation|humoral immune response|intracellular signal transduction|leukocyte migration	extracellular region|integral to membrane|intracellular|plasma membrane	receptor activity			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)				Glutathione(DB00143)	CATACTTTTCCTCAGTTAATT	0.448													34	90	---	---	---	---	PASS
PGC	5225	broad.mit.edu	37	6	41704721	41704721	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41704721C>A	uc003ora.1	-	9	1085	c.1036G>T	c.(1036-1038)GGA>TGA	p.G346*	TFEB_uc003oqs.1_5'Flank|TFEB_uc003oqt.1_5'Flank|TFEB_uc003oqu.1_5'Flank|TFEB_uc010jxq.1_5'Flank	NM_002630	NP_002621	P20142	PEPC_HUMAN	progastricsin (pepsinogen C) precursor	346					digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GGCTCGACTCCCACGGTGCAG	0.418													7	19	---	---	---	---	PASS
CLIC5	53405	broad.mit.edu	37	6	45917079	45917079	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45917079G>A	uc003oxv.3	-	3	796	c.690C>T	c.(688-690)CAC>CAT	p.H230H	CLIC5_uc003oxu.3_Silent_p.H71H|CLIC5_uc003oxx.2_Silent_p.H71H	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	230					female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						GGAAGGGCGGGTGCGTGCCGG	0.542													22	71	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46801051	46801051	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46801051C>A	uc010jzh.1	+	11	1427	c.1385C>A	c.(1384-1386)TCG>TAG	p.S462*	MEP1A_uc011dwg.1_Nonsense_Mutation_p.S184*|MEP1A_uc011dwh.1_Nonsense_Mutation_p.S490*|MEP1A_uc011dwi.1_Nonsense_Mutation_p.S362*	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	462	MATH.|Extracellular (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			TTCTACAATTCGGAGGGATAT	0.502													24	38	---	---	---	---	PASS
CRISP1	167	broad.mit.edu	37	6	49814390	49814390	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49814390A>G	uc003ozw.2	-						CRISP1_uc003ozx.2_Intron	NM_001131	NP_001122	P54107	CRIS1_HUMAN	acidic epididymal glycoprotein-like 1 isoform 1						fusion of sperm to egg plasma membrane	extracellular space					0	Lung NSC(77;0.0358)					ATCTGAAATGAGAAAACGGGC	0.368													8	45	---	---	---	---	PASS
DEFB112	245915	broad.mit.edu	37	6	50011361	50011361	+	Missense_Mutation	SNP	G	C	C	rs144227676	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50011361G>C	uc011dws.1	-	2	269	c.269C>G	c.(268-270)ACG>AGG	p.T90R		NM_001037498	NP_001032587	Q30KQ8	DB112_HUMAN	beta-defensin 112 precursor	90					defense response to bacterium	extracellular region				central_nervous_system(1)	1	Lung NSC(77;0.042)					ATTTGGGTCCGTAGGGTCACA	0.413													15	46	---	---	---	---	PASS
C6orf142	90523	broad.mit.edu	37	6	54025560	54025560	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54025560G>C	uc003pcg.3	+	7	970	c.857G>C	c.(856-858)AGG>ACG	p.R286T	C6orf142_uc003pcf.2_Missense_Mutation_p.R810T|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Missense_Mutation_p.R821T	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	286						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					TCTCCTTCAAGGTCCCCAAAG	0.244													4	29	---	---	---	---	PASS
KHDRBS2	202559	broad.mit.edu	37	6	62442636	62442636	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62442636C>A	uc003peg.2	-	7	1091	c.844G>T	c.(844-846)GAC>TAC	p.D282Y		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	282					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		TAGGTCTGGTCATCATATTCA	0.383													10	66	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70859619	70859619	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70859619G>A	uc003pfc.1	+	28	2034	c.1917G>A	c.(1915-1917)GAG>GAA	p.E639E	COL19A1_uc010kam.1_Silent_p.E535E	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	639	Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CAGCTGGAGAGCCAGGTATTC	0.388													9	44	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74492421	74492421	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74492421G>T	uc003php.2	+	18	2473	c.2048G>T	c.(2047-2049)AGT>ATT	p.S683I	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.S683I|CD109_uc010kba.2_Missense_Mutation_p.S606I	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	683	Bait region (approximate) (By similarity).					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TTGGGTAGCAGTCCACATGTC	0.353													16	64	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75892940	75892940	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75892940C>G	uc003phs.2	-	10	1883	c.1717G>C	c.(1717-1719)GCA>CCA	p.A573P	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Missense_Mutation_p.A231P	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	573	VWFA 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ACACCAACTGCAAAGATTTCA	0.438													19	66	---	---	---	---	PASS
PRSS35	167681	broad.mit.edu	37	6	84234168	84234168	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84234168C>A	uc003pjz.2	+	2	1171	c.1008C>A	c.(1006-1008)TAC>TAA	p.Y336*	PRSS35_uc010kbm.2_Nonsense_Mutation_p.Y336*	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	336	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		ATCTCCTTTACCAATACTGCG	0.483													10	49	---	---	---	---	PASS
CYB5R4	51167	broad.mit.edu	37	6	84627783	84627783	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84627783A>T	uc003pkf.2	+	6	637	c.505A>T	c.(505-507)AGC>TGC	p.S169C		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	169	CS.				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		TAGTTATCCAAGGTATGCATT	0.303													7	46	---	---	---	---	PASS
MRAP2	112609	broad.mit.edu	37	6	84772676	84772676	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84772676G>T	uc003pkg.3	+	3	382	c.192G>T	c.(190-192)CTG>CTT	p.L64L	MRAP2_uc010kbo.2_Intron	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	64					positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding			skin(2)	2						TTTTTGTGCTGACCTTGCTGA	0.413													13	51	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85446454	85446454	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85446454G>T	uc003pkl.1	-	8	1773	c.1773C>A	c.(1771-1773)ACC>ACA	p.T591T	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	591					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AGCTTCCTAGGGTCCTAGAGT	0.468													5	44	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85457707	85457707	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85457707C>A	uc003pkl.1	-	5	870	c.870G>T	c.(868-870)GGG>GGT	p.G290G	TBX18_uc010kbq.1_Silent_p.G132G	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	290	T-box.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		TTACTCCCTCCCCGGATGGAA	0.453													7	31	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87795487	87795487	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87795487T>A	uc003plj.1	-	4	439	c.338A>T	c.(337-339)TAT>TTT	p.Y113F		NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	113					hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		AGATTTGTGATAATAACAAGT	0.363													6	17	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97063549	97063549	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97063549C>T	uc003pos.1	+	7	1161	c.756C>T	c.(754-756)TGC>TGT	p.C252C	FHL5_uc003pot.1_Silent_p.C252C	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	252	LIM zinc-binding 4.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		GCTTTAACTGCGGGAAATGCT	0.443													14	28	---	---	---	---	PASS
GPR63	81491	broad.mit.edu	37	6	97247021	97247021	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97247021T>A	uc010kcl.2	-	3	1065	c.587A>T	c.(586-588)AAG>ATG	p.K196M	GPR63_uc003pou.2_Missense_Mutation_p.K196M	NM_001143957	NP_001137429	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	196	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		AATCAGAACCTTAGCTCTATA	0.448													17	63	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97610000	97610000	+	Missense_Mutation	SNP	C	T	T	rs149054595		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97610000C>T	uc003ppb.2	-	22	3529	c.3263G>A	c.(3262-3264)CGC>CAC	p.R1088H	C6orf167_uc011eaf.1_Missense_Mutation_p.R1048H	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	1088					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		GGATGCTAAGCGAGGAGGAGG	0.408													5	35	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100838339	100838339	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838339G>T	uc003pqj.3	-	11	2406	c.2199C>A	c.(2197-2199)GGC>GGA	p.G733G	SIM1_uc010kcu.2_Silent_p.G733G	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	733	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AGCCATTACAGCCCAAGGAAT	0.448													14	87	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102074447	102074447	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102074447C>A	uc003pqp.3	+	3	725	c.476C>A	c.(475-477)GCC>GAC	p.A159D	GRIK2_uc003pqn.2_Missense_Mutation_p.A159D|GRIK2_uc003pqo.3_Missense_Mutation_p.A159D|GRIK2_uc010kcw.2_Missense_Mutation_p.A159D	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	159	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	CTCAGCCGTGCCATTTTAGAC	0.463													11	41	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102074448	102074448	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102074448C>A	uc003pqp.3	+	3	726	c.477C>A	c.(475-477)GCC>GCA	p.A159A	GRIK2_uc003pqn.2_Silent_p.A159A|GRIK2_uc003pqo.3_Silent_p.A159A|GRIK2_uc010kcw.2_Silent_p.A159A	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	159	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TCAGCCGTGCCATTTTAGACC	0.458													11	42	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106555270	106555270	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106555270A>C	uc003prd.2	+	7	2621	c.2387A>C	c.(2386-2388)GAT>GCT	p.D796A	PRDM1_uc003pre.2_Missense_Mutation_p.D662A	NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	796					negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GAGTCATCAGATCTACCCCTC	0.453			D|N|Mis|F|S		DLBCL								11	45	---	---	---	---	PASS
NR2E1	7101	broad.mit.edu	37	6	108499422	108499422	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108499422T>C	uc003psg.2	+	5	1374	c.619T>C	c.(619-621)TCC>CCC	p.S207P		NM_003269	NP_003260	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	207	Ligand-binding (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		GCCAGCCTTCTCCACGCTGTC	0.507													11	31	---	---	---	---	PASS
C6orf182	285753	broad.mit.edu	37	6	109476454	109476454	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109476454G>A	uc010kdk.2	+	8	1178	c.601G>A	c.(601-603)GAA>AAA	p.E201K	C6orf182_uc003psv.3_Missense_Mutation_p.E185K|C6orf182_uc003psw.3_Missense_Mutation_p.E201K|C6orf182_uc003psx.3_Missense_Mutation_p.E201K|C6orf182_uc010kdl.2_Missense_Mutation_p.E201K|C6orf182_uc003psy.3_Missense_Mutation_p.E201K	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN	hypothetical protein LOC285753	201	Potential.					microtubule|microtubule organizing center					0		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)		ACATTTAGAAGAAAAACTTAA	0.299													14	47	---	---	---	---	PASS
ZBTB24	9841	broad.mit.edu	37	6	109787067	109787067	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109787067T>A	uc003ptl.1	-	7	2249	c.2081A>T	c.(2080-2082)CAG>CTG	p.Q694L	MICAL1_uc011eaq.1_5'UTR|ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Missense_Mutation_p.Q638L|ZBTB24_uc010kdt.1_RNA	NM_014797	NP_055612	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24 isoform	694					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GCTCTGCTCCTGGCCAAGTGG	0.552													16	45	---	---	---	---	PASS
FYN	2534	broad.mit.edu	37	6	112035579	112035579	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112035579T>A	uc003pvj.2	-	4	655	c.315A>T	c.(313-315)AAA>AAT	p.K105N	FYN_uc003pvi.2_Missense_Mutation_p.K105N|FYN_uc003pvk.2_Missense_Mutation_p.K105N|FYN_uc003pvh.2_Missense_Mutation_p.K105N	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a	105	SH3.				axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	ATTTTTCTCCTTTGTGAAAAC	0.438													4	35	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671182	112671182	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671182G>T	uc003pvx.1	+	3	584	c.272G>T	c.(271-273)CGG>CTG	p.R91L		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	91	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		GAGGAGCTCCGGCATTTTCGG	0.527													6	25	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132179888	132179888	+	Splice_Site	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132179888G>A	uc011ecf.1	+	7	815	c.795_splice	c.e7+1	p.T265_splice	ENPP1_uc003qcy.2_5'Flank	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CATTGTCACCGTAAGCTCTGC	0.318													6	15	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132206213	132206213	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132206213T>A	uc011ecf.1	+							NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AGTAAGAACATATTTCATTAC	0.368													4	29	---	---	---	---	PASS
TAAR6	319100	broad.mit.edu	37	6	132891790	132891790	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132891790C>A	uc011eck.1	+	1	330	c.330C>A	c.(328-330)TGC>TGA	p.C110*		NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	110	Helical; Name=3; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(1)	3	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		TCCACACCTGCTGTGATGTGG	0.488													26	108	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133072503	133072503	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133072503G>T	uc003qdt.2	-	5	992	c.981C>A	c.(979-981)ATC>ATA	p.I327I	VNN2_uc003qds.2_Silent_p.I36I|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Silent_p.I274I	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	327	CN hydrolase.				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		GAAATGGTTTGATGGTGGTGG	0.443													18	70	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135518392	135518392	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135518392A>G	uc003qfc.2	+						MYB_uc003qfh.2_Missense_Mutation_p.I499M|MYB_uc003qfi.2_Missense_Mutation_p.I483M|MYB_uc010kgi.2_Intron|MYB_uc003qfq.2_Missense_Mutation_p.I496M|MYB_uc010kgj.2_Intron|MYB_uc003qfo.2_Intron|MYB_uc003qfu.2_Intron|MYB_uc003qfl.2_Intron|MYB_uc003qfv.2_Intron|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_Intron|MYB_uc003qga.2_Intron|MYB_uc003qgb.2_Intron|MYB_uc010kgk.2_Intron|MYB_uc003qfd.2_Intron|MYB_uc003qfe.2_Intron|MYB_uc003qfg.2_Intron|MYB_uc003qff.2_Intron|MYB_uc003qfj.2_Intron|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_Intron|MYB_uc003qfk.2_Intron|MYB_uc003qfr.2_Intron|MYB_uc003qfs.2_Intron|MYB_uc003qft.2_Intron|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_Intron|MYB_uc003qfb.1_Intron|MYB_uc003qge.1_RNA	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog						blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GCTCCTTCATATTTGCTGACG	0.522			T	NFIB	adenoid cystic carcinoma								7	29	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144835120	144835120	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144835120C>T	uc003qkt.2	+	35	5112	c.5020C>T	c.(5020-5022)CTA>TTA	p.L1674L		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1674	Interaction with SYNM.|Spectrin 12.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGCTGAAGCTCTATTGGATGA	0.378													21	44	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161007565	161007565	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161007565T>C	uc003qtl.2	-	26	4165	c.4045A>G	c.(4045-4047)ACG>GCG	p.T1349A		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3857	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGACATTGCGTCAGGTTGCAG	0.522													12	33	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163985702	163985702	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163985702G>T	uc003qui.2	+						QKI_uc003que.2_3'UTR|QKI_uc003quf.2_Missense_Mutation_p.W313L|QKI_uc003qug.2_Intron|QKI_uc003quh.2_Missense_Mutation_p.W305L|QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TTTATAGAGTGGATTGAAATG	0.373													7	51	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1489875	1489875	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1489875C>A	uc003skj.3	-	2	339	c.192_splice	c.e2+1	p.L64_splice	MICALL2_uc003skl.1_RNA	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1							cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCCACTCACCAGTTTATTG	0.562													30	70	---	---	---	---	PASS
MMD2	221938	broad.mit.edu	37	7	4947082	4947082	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4947082G>A	uc003sno.3	-	7	954	c.758C>T	c.(757-759)GCC>GTC	p.A253V	MMD2_uc003snl.1_RNA|MMD2_uc003snn.3_Missense_Mutation_p.A229V|MMD2_uc010ksq.2_3'UTR	NM_001100600	NP_001094070	Q8IY49	PAQRA_HUMAN	monocyte to macrophage	253	Helical; (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		CCTCCAGATGGCATAGTAGTG	0.547													19	44	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184786	19184786	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184786C>A	uc003suo.1	-	1	259	c.200G>T	c.(199-201)TGC>TTC	p.C67F	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	67	Poly-Glu.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						gtccacttcgcactcctcttc	0.373													5	23	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27285911	27285911	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27285911C>A	uc003szd.1	+	3	1577	c.1091C>A	c.(1090-1092)GCT>GAT	p.A364D	EVX1_uc011jzn.1_Missense_Mutation_p.A182D|EVX1_uc010kuy.1_3'UTR	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1	364	Ala-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						GCGCCCCGGGCTGCCGCCGCC	0.756													4	5	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30831179	30831179	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30831179C>T	uc003tbt.2	+	5	1139	c.1062C>T	c.(1060-1062)CCC>CCT	p.P354P	FAM188B_uc010kwe.2_Silent_p.P325P	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	354											0						GCAGCCAGCCCGCACCTGTCA	0.542													7	21	---	---	---	---	PASS
ANLN	54443	broad.mit.edu	37	7	36447361	36447361	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36447361A>G	uc003tff.2	+	5	1096	c.892A>G	c.(892-894)AAA>GAA	p.K298E	ANLN_uc011kaz.1_Missense_Mutation_p.K210E|ANLN_uc003tfg.2_Missense_Mutation_p.K298E|ANLN_uc010kxe.2_Missense_Mutation_p.K298E	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	298	Interaction with F-actin.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						TTCTCCAGTGAAATCTACTAC	0.353													16	27	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40118369	40118369	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40118369C>G	uc003thh.3	+	11	3230	c.2948C>G	c.(2947-2949)CCT>CGT	p.P983R	CDK13_uc003thi.3_Missense_Mutation_p.P983R|CDK13_uc003thj.2_Missense_Mutation_p.P34R	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	983	Protein kinase.				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						GCCTTGGATCCTAGTAAGCGC	0.448													10	58	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42005485	42005485	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42005485C>T	uc011kbh.1	-	15	3277	c.3186G>A	c.(3184-3186)TCG>TCA	p.S1062S	GLI3_uc011kbg.1_Silent_p.S1003S	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1062					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GACAGGGGGACGAGTGGAAGT	0.642									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				5	34	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48550699	48550699	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48550699T>C	uc003toq.2	+	51	13569	c.13544T>C	c.(13543-13545)GTC>GCC	p.V4515A	ABCA13_uc010kys.1_Missense_Mutation_p.V1590A|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.V245A	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4515	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTGGTTTCCGTCTGCCTGTGT	0.433													6	45	---	---	---	---	PASS
AUTS2	26053	broad.mit.edu	37	7	70255478	70255478	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70255478G>A	uc003tvw.3	+	19	4019	c.3276G>A	c.(3274-3276)AGG>AGA	p.R1092R	AUTS2_uc003tvx.3_Silent_p.R1068R|AUTS2_uc011keg.1_Silent_p.R544R	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	1092										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGCTGGGCAGGGACTTCCTGC	0.627													4	19	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71252799	71252799	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71252799C>A	uc003twa.3	-	6	1148	c.621G>T	c.(619-621)CTG>CTT	p.L207L	CALN1_uc003twb.3_Silent_p.L249L|CALN1_uc003twc.3_Silent_p.L207L	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	207	Helical; Anchor for type IV membrane protein; (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TGGCTGCAATCAGCATGACAC	0.592													4	27	---	---	---	---	PASS
FGL2	10875	broad.mit.edu	37	7	76828528	76828528	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76828528G>T	uc003ugb.2	-	1	623	c.583C>A	c.(583-585)CCC>ACC	p.P195T	CCDC146_uc003ufz.1_Intron|CCDC146_uc003uga.2_Intron	NM_006682	NP_006673	Q14314	FGL2_HUMAN	fibrinogen-like 2 precursor	195					signal transduction	fibrinogen complex	receptor binding			skin(2)	2						TCTTGGCTGGGACACTTTGAA	0.313													13	60	---	---	---	---	PASS
ABCB4	5244	broad.mit.edu	37	7	87049318	87049318	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87049318C>A	uc003uiv.1	-	19	2466	c.2390G>T	c.(2389-2391)AGA>ATA	p.R797I	ABCB4_uc003uiw.1_Missense_Mutation_p.R797I|ABCB4_uc003uix.1_Missense_Mutation_p.R797I	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	797	ABC transmembrane type-1 2.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					TCCTACCTGTCTTAGCATTGC	0.428													20	83	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87170713	87170713	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87170713A>G	uc003uiz.1	-	19	2697	c.2279T>C	c.(2278-2280)CTA>CCA	p.L760P	ABCB1_uc011khc.1_Missense_Mutation_p.L696P	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	760	Helical; (Potential).|ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TCCAAGGGCTAGAAACAATAG	0.299													11	49	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87174183	87174183	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87174183C>A	uc003uiz.1	-	17	2438	c.2020G>T	c.(2020-2022)GGA>TGA	p.G674*	ABCB1_uc011khc.1_Nonsense_Mutation_p.G610*	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	674	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GCTTGTGATCCACGGACACTC	0.408													12	67	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94059648	94059648	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94059648C>T	uc003ung.1	+	52	4515	c.4044C>T	c.(4042-4044)GAC>GAT	p.D1348D	COL1A2_uc011kib.1_Silent_p.D200D	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1348	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CACCTTTGGACATCGGTGGTG	0.358										HNSCC(75;0.22)			25	121	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95125305	95125305	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95125305C>A	uc011kij.1	+	2	423	c.423C>A	c.(421-423)CAC>CAA	p.H141Q	ASB4_uc003unx.2_Missense_Mutation_p.H141Q	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	141	ANK 3.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			TAAGTGGACACACAGCTTTGC	0.468													12	41	---	---	---	---	PASS
SLC25A13	10165	broad.mit.edu	37	7	95751058	95751058	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95751058C>A	uc003uof.3	-	17	1942	c.1751_splice	c.e17-1	p.A584_splice	SLC25A13_uc003uog.3_Splice_Site_p.A585_splice|SLC25A13_uc011kik.1_Splice_Site_p.A476_splice	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	AATACACGAGCTTTAAAAAAA	0.348													10	79	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100345809	100345809	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100345809T>C	uc003uwj.2	+	10	1238	c.1073T>C	c.(1072-1074)GTT>GCT	p.V358A	ZAN_uc003uwk.2_Missense_Mutation_p.V358A|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	358	MAM 2.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTGTGGCAGTTGATGCAACC	0.617													4	29	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100679498	100679498	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100679498A>C	uc003uxp.1	+	3	4854	c.4801A>C	c.(4801-4803)AAA>CAA	p.K1601Q	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1601	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|25.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TATTGACTCCAAAACTCAGGT	0.468													26	126	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100683521	100683521	+	Missense_Mutation	SNP	G	A	A	rs150470478		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100683521G>A	uc003uxp.1	+	3	8877	c.8824G>A	c.(8824-8826)GGT>AGT	p.G2942S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2942	Extracellular (Potential).|47.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCAGTGGCCGGTTCTGAGGC	0.488													47	175	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102944925	102944925	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102944925G>T	uc003vbl.2	+	6	758	c.724G>T	c.(724-726)GCT>TCT	p.A242S	PMPCB_uc010liu.1_Missense_Mutation_p.A242S|PMPCB_uc003vbk.1_Missense_Mutation_p.A242S|PMPCB_uc003vbm.2_Missense_Mutation_p.A151S|PMPCB_uc010liv.2_Missense_Mutation_p.A148S|PMPCB_uc010liw.2_Missense_Mutation_p.A151S|PMPCB_uc011kll.1_Missense_Mutation_p.A137S|PMPCB_uc011klm.1_Missense_Mutation_p.A117S	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit	242					proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						AATAGTGCTTGCTGCTGCTGG	0.343													12	63	---	---	---	---	PASS
SLC26A5	375611	broad.mit.edu	37	7	103014876	103014876	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103014876G>C	uc003vbz.2	-	20	2441	c.2205C>G	c.(2203-2205)CCC>CCG	p.P735P	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Silent_p.P703P|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	735	Cytoplasmic (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						GAGTGGCATTGGGCTCCAAGT	0.498													5	22	---	---	---	---	PASS
TMEM168	64418	broad.mit.edu	37	7	112415234	112415234	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112415234C>A	uc003vgn.2	-	3	1660	c.1268G>T	c.(1267-1269)TGC>TTC	p.C423F	TMEM168_uc010lju.2_Missense_Mutation_p.C423F|TMEM168_uc011kmr.1_Missense_Mutation_p.C39F	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	423						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2						ACTGTACCTGCAGAAGTTGGT	0.343													5	26	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113517826	113517826	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113517826C>A	uc010ljy.1	-	4	3352	c.3321G>T	c.(3319-3321)TGG>TGT	p.W1107C		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	1107					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						CCCAGGATAGCCAGGACAATG	0.343													6	54	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120764491	120764491	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120764491G>T	uc003vjq.3	+	8	1472	c.1025G>T	c.(1024-1026)AGT>ATT	p.S342I	C7orf58_uc003vjr.1_Missense_Mutation_p.S342I|C7orf58_uc003vjs.3_Missense_Mutation_p.S342I|C7orf58_uc003vjt.3_Missense_Mutation_p.S122I|C7orf58_uc010lkk.1_Missense_Mutation_p.S122I	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	342						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GAAGTATTCAGTGAAACATCT	0.338													19	49	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120935621	120935621	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120935621C>G	uc003vjq.3	+	23	3443	c.2996C>G	c.(2995-2997)TCG>TGG	p.S999W		NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	999						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					AATTTTCGATCGCCATATCAT	0.363													12	44	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121731879	121731879	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121731879A>G	uc003vka.2	-	17	1990	c.1894T>C	c.(1894-1896)TAC>CAC	p.Y632H	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.Y632H|AASS_uc011knw.1_Missense_Mutation_p.Y120H	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	632	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	CCACCACAGTAGGAAATATAT	0.333													3	18	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173172	126173172	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173172T>C	uc003vlr.2	-	8	2575	c.2264A>G	c.(2263-2265)TAC>TGC	p.Y755C	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.Y755C|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	755	Helical; Name=5; (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GAGGATACTGTATCCAAGTGA	0.433										HNSCC(24;0.065)			8	17	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126882901	126882901	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126882901C>A	uc003vlr.2	-	1	669	c.358G>T	c.(358-360)GTG>TTG	p.V120L	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.V120L|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	120	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	AATGCCTGCACGAATGTTAGA	0.493										HNSCC(24;0.065)			9	33	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128488892	128488892	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128488892G>T	uc003vnz.3	+	28	4992	c.4783G>T	c.(4783-4785)GAT>TAT	p.D1595Y	FLNC_uc003voa.3_Missense_Mutation_p.D1595Y	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1595	Filamin 14.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GGACAATGGGGATGGCACGTA	0.612													6	35	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137080431	137080431	+	Silent	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137080431T>G	uc003vtt.2	-	33	2995	c.2994A>C	c.(2992-2994)GCA>GCC	p.A998A	DGKI_uc003vtu.2_Silent_p.A667A	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	998	ANK 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						CCTTGTGCAGTGCAGTCTCAC	0.562													3	23	---	---	---	---	PASS
TAS2R5	54429	broad.mit.edu	37	7	141491034	141491034	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141491034G>T	uc003vwr.1	+	1	1018	c.873G>T	c.(871-873)GTG>GTT	p.V291V		NM_018980	NP_061853	Q9NYW4	TA2R5_HUMAN	taste receptor T2R5	291	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste		taste receptor activity				0	Melanoma(164;0.0171)					GGAAGACAGTGTGTGCTCGGA	0.493													12	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142180736	142180736	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142180736C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_RNA|uc011krz.1_Silent_p.Q41Q					SubName: Full=V_segment translation product; Flags: Fragment;																		CCTGGGCACACTGCAGTGTCA	0.507													12	218	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142197581	142197581	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142197581G>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011ksb.1_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		CTAAGCTGCTGGCACAGAGAT	0.522													7	84	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142206504	142206504	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142206504C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		AGCTGTGCAGCACTGTGGACT	0.577													10	36	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142630466	142630466	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142630466G>T	uc003wby.1	-	1	355	c.91C>A	c.(91-93)CAG>AAG	p.Q31K	TRPV5_uc003wbz.2_Missense_Mutation_p.Q31K	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	31	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TCCAGGTGCTGGTCCCAGTCT	0.567													7	52	---	---	---	---	PASS
TAS2R40	259286	broad.mit.edu	37	7	142919978	142919978	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142919978C>G	uc011ksx.1	+	1	807	c.807C>G	c.(805-807)AAC>AAG	p.N269K		NM_176882	NP_795363	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	269	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1	Melanoma(164;0.059)					CCACGTCCAACATCTTTGACA	0.483													10	93	---	---	---	---	PASS
TMEM139	135932	broad.mit.edu	37	7	142983078	142983078	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142983078C>A	uc010lov.2	+	3	167	c.28C>A	c.(28-30)CTG>ATG	p.L10M	CASP2_uc003wco.2_5'Flank|CASP2_uc003wcp.2_5'Flank|CASP2_uc011kta.1_5'Flank|TMEM139_uc003wck.3_Missense_Mutation_p.L10M|TMEM139_uc003wcl.2_Missense_Mutation_p.L10M|TMEM139_uc003wcm.2_Missense_Mutation_p.L10M|TMEM139_uc003wcn.2_Intron	NM_153345	NP_699176	Q8IV31	TM139_HUMAN	transmembrane protein 139 precursor	10						integral to membrane					0	Melanoma(164;0.059)					ACTGGGGAGACTGGAGAAGCC	0.547													12	34	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701614	143701614	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701614C>A	uc003wdt.1	+	1	525	c.525C>A	c.(523-525)AAC>AAA	p.N175K		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	175	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					ATGTCATCAACCACTTCTTCT	0.498													13	39	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147914555	147914555	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147914555C>T	uc003weu.1	+	19	3702	c.3186C>T	c.(3184-3186)TGC>TGT	p.C1062C		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1062	Laminin G-like 4.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGGCGCCCTGCATTCTCCTCT	0.562										HNSCC(39;0.1)			17	66	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149419958	149419958	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149419958C>T	uc003wfz.2	+	7	1082	c.683C>T	c.(682-684)ACA>ATA	p.T228I	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	228										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CACCCCGAGACATCCCCAAGC	0.622													4	24	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150554679	150554679	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150554679T>A	uc003why.1	+	3	5339	c.1121T>A	c.(1120-1122)GTC>GAC	p.V374D	ABP1_uc003whz.1_Missense_Mutation_p.V374D|ABP1_uc003wia.1_Missense_Mutation_p.V374D	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	374					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	TACCTCGATGTCGGCTGGGGC	0.607													7	55	---	---	---	---	PASS
KCNH2	3757	broad.mit.edu	37	7	150645948	150645948	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150645948C>T	uc003wic.2	-	10	2601	c.2588G>A	c.(2587-2589)CGA>CAA	p.R863Q	KCNH2_uc003wib.2_Missense_Mutation_p.R523Q|KCNH2_uc011kux.1_Missense_Mutation_p.R767Q	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	863	Cytoplasmic (Potential).				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	ACTCACATCTCGCAGGTTGAA	0.458													3	19	---	---	---	---	PASS
ACCN3	9311	broad.mit.edu	37	7	150746350	150746350	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150746350G>T	uc003win.2	+	1	746	c.378G>T	c.(376-378)CTG>CTT	p.L126L	ACCN3_uc003wio.2_Silent_p.L126L|ACCN3_uc003wip.2_Silent_p.L126L|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	126	Extracellular (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGCCTTCCTGCGCGCCCTGG	0.692													11	33	---	---	---	---	PASS
FASTK	10922	broad.mit.edu	37	7	150775925	150775925	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150775925G>T	uc003wix.1	-						uc011kvf.1_5'Flank|FASTK_uc003wiw.1_Intron|FASTK_uc003wiy.1_Intron|FASTK_uc003wiz.1_Intron|FASTK_uc003wja.1_Intron	NM_006712	NP_006703	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|regulation of RNA splicing		ATP binding|Fas-activated serine/threonine kinase activity|protein binding			lung(2)|stomach(2)	4			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		ACCCCCTCCAGCACCTGCCAG	0.622													5	24	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2975995	2975995	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2975995A>T	uc011kwk.1	-	42	6749	c.6359T>A	c.(6358-6360)CTA>CAA	p.L2120Q	CSMD1_uc011kwj.1_Missense_Mutation_p.L1512Q|CSMD1_uc010lrg.2_Missense_Mutation_p.L188Q	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2120	Extracellular (Potential).|Sushi 12.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATGGCCTATTAGAATGTACCC	0.468													17	24	---	---	---	---	PASS
SPAG11B	10407	broad.mit.edu	37	8	7308362	7308362	+	3'UTR	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7308362A>T	uc003wrk.2	-	4					SPAG11B_uc003wrg.1_Missense_Mutation_p.L92H|SPAG11B_uc003wrh.1_Intron|SPAG11B_uc003wri.2_3'UTR|SPAG11B_uc003wrj.2_Missense_Mutation_p.L39H|SPAG11B_uc003wrl.2_Missense_Mutation_p.L92H	NM_016512	NP_057596	Q08648	SG11B_HUMAN	sperm associated antigen 11B isoform A						spermatogenesis	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GCAGAAAAAAAGTCTGCAGAT	0.413													4	82	---	---	---	---	PASS
BLK	640	broad.mit.edu	37	8	11421500	11421500	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11421500C>G	uc003wty.2	+	13	1982	c.1401C>G	c.(1399-1401)GGC>GGG	p.G467G	BLK_uc003wtz.2_Silent_p.G396G|BLK_uc003wua.2_Silent_p.G303G	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	467	Protein kinase.				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		TGTACCGCGGCGTCATCGCCG	0.711													6	11	---	---	---	---	PASS
PCM1	5108	broad.mit.edu	37	8	17838119	17838119	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17838119G>A	uc003wyi.3	+	24	4385	c.3963G>A	c.(3961-3963)ATG>ATA	p.M1321I	PCM1_uc011kyh.1_Missense_Mutation_p.M1321I|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Missense_Mutation_p.M58I|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_5'Flank	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	1321	Interaction with HAP1.				centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		GTGCCAGTATGTCTAGCACAT	0.398			T	RET|JAK2	papillary thyroid|CML|MPD								22	46	---	---	---	---	PASS
INTS9	55756	broad.mit.edu	37	8	28654056	28654056	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28654056C>A	uc003xha.2	-						INTS9_uc011lav.1_Intron|INTS9_uc011law.1_Intron|INTS9_uc011lax.1_Intron|INTS9_uc010lvc.2_Intron|INTS9_uc003xhb.2_Intron	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1						snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		GAGACGGTTGCACACCTAGGT	0.418													15	34	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41591591	41591591	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41591591T>A	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			ACCCATTCTGTAAAGAGCAGA	0.517													22	58	---	---	---	---	PASS
HOOK3	84376	broad.mit.edu	37	8	42805523	42805523	+	Intron	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42805523G>A	uc003xpr.2	+						HOOK3_uc010lxq.1_Intron	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein						cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GATTGTTCTTGTTTTCAGAGT	0.368			T	RET	papillary thyroid								30	66	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52258501	52258501	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52258501C>A	uc003xqu.3	-	20	4009	c.3908G>T	c.(3907-3909)AGG>ATG	p.R1303M	PXDNL_uc003xqt.3_Intron	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1303					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCCTCTACTCCTACAGTCTGT	0.428													4	40	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52320778	52320778	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52320778C>T	uc003xqu.3	-	17	3507	c.3406G>A	c.(3406-3408)GAT>AAT	p.D1136N	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1136					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCAGCCGAATCCACGGCCGCA	0.532													19	68	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68334855	68334855	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68334855G>T	uc003xxq.3	-	11	1454	c.1198C>A	c.(1198-1200)CGT>AGT	p.R400S	CPA6_uc003xxr.3_Missense_Mutation_p.R156S	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	400					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			CCAGTGTCACGTAGTTCGAAA	0.383													24	73	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69030786	69030786	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69030786G>T	uc003xxv.1	+	27	3355	c.3328G>T	c.(3328-3330)GAC>TAC	p.D1110Y		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1110					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TGTTTTCAGTGACTGCAACAG	0.423													15	41	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69104759	69104759	+	Missense_Mutation	SNP	C	G	G	rs139672596		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69104759C>G	uc003xxv.1	+	37	4630	c.4603C>G	c.(4603-4605)CGG>GGG	p.R1535G		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1535					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CGGTGTGCATCGGTATGTGAC	0.488													7	23	---	---	---	---	PASS
TERF1	7013	broad.mit.edu	37	8	73921123	73921123	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73921123T>C	uc003xzd.2	+	1	27	c.2T>C	c.(1-3)ATG>ACG	p.M1T	TERF1_uc003xzc.2_RNA|TERF1_uc003xze.2_Missense_Mutation_p.M1T	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1	1					age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding			ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)			CCATTTAACATGGCGGAGGAT	0.642													3	4	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763598	77763598	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763598C>A	uc003yav.2	+	10	4693	c.4306C>A	c.(4306-4308)CAT>AAT	p.H1436N	ZFHX4_uc003yau.1_Missense_Mutation_p.H1481N|ZFHX4_uc003yaw.1_Missense_Mutation_p.H1436N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1436						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCAGGATGACCATGGCCTAGA	0.507										HNSCC(33;0.089)			6	17	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766706	77766706	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766706C>T	uc003yav.2	+	10	7801	c.7414C>T	c.(7414-7416)CTT>TTT	p.L2472F	ZFHX4_uc003yau.1_Missense_Mutation_p.L2517F|ZFHX4_uc003yaw.1_Missense_Mutation_p.L2472F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2472						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATGCACTTCCTTGCTGCTCA	0.483										HNSCC(33;0.089)			34	115	---	---	---	---	PASS
SLC7A13	157724	broad.mit.edu	37	8	87226774	87226774	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87226774C>G	uc003ydq.1	-	4	1379	c.1281G>C	c.(1279-1281)CTG>CTC	p.L427L	SLC7A13_uc003ydr.1_3'UTR	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	427	Helical; Name=12; (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						TGAGAACTAACAGAAGCACGT	0.338													11	37	---	---	---	---	PASS
GDF6	392255	broad.mit.edu	37	8	97156891	97156891	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97156891G>T	uc003yhp.2	-	2	1368	c.1268C>A	c.(1267-1269)ACC>AAC	p.T423N		NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor	423					activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					AGTCAATTTGGTGGGCACGCA	0.607													7	19	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97316352	97316352	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97316352C>T	uc003yht.1	+	7	939	c.837C>T	c.(835-837)GAC>GAT	p.D279D	PTDSS1_uc003yhu.1_Silent_p.D133D	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	279					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GATGGTTTGACCCCAAATCTT	0.448													30	156	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103306322	103306322	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103306322T>A	uc003ykr.1	-	33	4243	c.4210A>T	c.(4210-4212)ACA>TCA	p.T1404S	UBR5_uc003yks.1_Missense_Mutation_p.T1404S	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1404					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTCACTAGTGTACCTAGTAGA	0.313													6	41	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104987671	104987671	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104987671C>A	uc003yls.2	+	14	2439	c.2198C>A	c.(2197-2199)CCT>CAT	p.P733H	RIMS2_uc003ylp.2_Missense_Mutation_p.P955H|RIMS2_uc003ylw.2_Missense_Mutation_p.P747H|RIMS2_uc003ylq.2_Missense_Mutation_p.P747H|RIMS2_uc003ylr.2_Missense_Mutation_p.P794H|RIMS2_uc003ylt.2_Missense_Mutation_p.P340H	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1017					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCAGGGTCTCCTCATCGAGTA	0.423										HNSCC(12;0.0054)			12	35	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105405189	105405189	+	Silent	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105405189A>C	uc003yly.3	-	8	1395	c.1266T>G	c.(1264-1266)GCT>GCG	p.A422A	DPYS_uc010mcf.1_5'UTR	NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	422					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGAAGTTAACAGCCTGATGAT	0.393													14	71	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113301596	113301596	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113301596G>A	uc003ynu.2	-	57	9305	c.9146C>T	c.(9145-9147)TCA>TTA	p.S3049L	CSMD3_uc003yns.2_Missense_Mutation_p.S2251L|CSMD3_uc003ynt.2_Missense_Mutation_p.S3009L|CSMD3_uc011lhx.1_Missense_Mutation_p.S2880L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3049	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGTGGTACCTGAACAATGAGG	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			32	87	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113697736	113697736	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113697736G>T	uc003ynu.2	-	15	2540	c.2381C>A	c.(2380-2382)GCT>GAT	p.A794D	CSMD3_uc003yns.2_Missense_Mutation_p.A66D|CSMD3_uc003ynt.2_Missense_Mutation_p.A754D|CSMD3_uc011lhx.1_Missense_Mutation_p.A690D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	794	Extracellular (Potential).|CUB 4.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGGCACCTCAGCCCCAGTAAA	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			14	69	---	---	---	---	PASS
EXT1	2131	broad.mit.edu	37	8	118812099	118812099	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118812099A>G	uc003yok.1	-	11	2866	c.2093T>C	c.(2092-2094)TTT>TCT	p.F698S		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	698	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TCGCTGGGCAAAGTGGTCAGG	0.522			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				13	28	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133153497	133153497	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133153497C>A	uc003ytj.2	-	10	1569	c.1344G>T	c.(1342-1344)CTG>CTT	p.L448L	KCNQ3_uc010mdt.2_Silent_p.L448L	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	448					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CATCTACATTCAGAGGGGTAA	0.443													29	92	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133645013	133645013	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133645013C>T	uc003ytk.2	-	5	700	c.626G>A	c.(625-627)CGT>CAT	p.R209H	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	209						cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGTGTACCAACGTCCATCAAA	0.378													27	210	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133961149	133961149	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133961149C>A	uc003ytw.2	+	27	5403	c.5362C>A	c.(5362-5364)CAG>AAG	p.Q1788K	TG_uc010mdw.2_Missense_Mutation_p.Q547K|TG_uc011ljb.1_Missense_Mutation_p.Q157K	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	1788	Type IIIB.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGAGAGCCACCAGGTGATATT	0.473													28	103	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139151241	139151241	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139151241T>A	uc003yuy.2	-	18	4060	c.3889A>T	c.(3889-3891)AGC>TGC	p.S1297C	FAM135B_uc003yux.2_Missense_Mutation_p.S1198C|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1297										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTTTTTTGGCTTAGTTGGTAG	0.443										HNSCC(54;0.14)			9	49	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139180304	139180304	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139180304A>G	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGGGGAGCACATGGCAGGGTG	0.582										HNSCC(54;0.14)			18	62	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143425749	143425749	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143425749C>A	uc003ywk.2	-	4	441	c.323G>T	c.(322-324)GGG>GTG	p.G108V	TSNARE1_uc011lju.1_Missense_Mutation_p.G108V|TSNARE1_uc003ywj.2_Missense_Mutation_p.G108V|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	108					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCCATGGGGCCCAGCAGCCGA	0.672													4	3	---	---	---	---	PASS
FAM83H	286077	broad.mit.edu	37	8	144809011	144809011	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144809011C>A	uc003yzk.2	-	5	2689	c.2620G>T	c.(2620-2622)GCT>TCT	p.A874S	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	874					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCAGGGTAAGCCGAGGTGGGG	0.622													8	24	---	---	---	---	PASS
PLAA	9373	broad.mit.edu	37	9	26923353	26923353	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26923353G>T	uc003zqd.2	-						PLAA_uc003zqe.2_Intron	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TCACTGTAAGGAAAAATAAAC	0.328													13	33	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32630258	32630258	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630258C>A	uc003zrg.1	-	1	5410	c.5320G>T	c.(5320-5322)GAA>TAA	p.E1774*		NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1774					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCAGCATCTTCCTCATCATCT	0.453													22	63	---	---	---	---	PASS
C9orf24	84688	broad.mit.edu	37	9	34382827	34382827	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34382827G>T	uc003zuh.1	-	3	539	c.321C>A	c.(319-321)TAC>TAA	p.Y107*	C9orf24_uc003zug.1_5'Flank|C9orf24_uc003zuf.1_5'Flank|C9orf24_uc003zui.1_5'Flank	NM_032596	NP_115985	Q8NCR6	CI024_HUMAN	testes development-related NYD-SP22 isoform 1	107										ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		TCCATGTGTTGTACCAGTCAC	0.493													40	62	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78804654	78804654	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78804654G>T	uc004ajz.2	+	20	3156	c.2618G>T	c.(2617-2619)TGC>TTC	p.C873F	PCSK5_uc004aka.2_RNA|PCSK5_uc004akb.2_Missense_Mutation_p.C147F	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	873	PLAC.				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						GGAGCCATTTGCAAGGATGGT	0.403													9	17	---	---	---	---	PASS
GNAQ	2776	broad.mit.edu	37	9	80537167	80537167	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80537167C>T	uc004akw.2	-	2	272	c.231G>A	c.(229-231)AAG>AAA	p.K77K		NM_002072	NP_002063	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein),	77					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity			eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193						GATACACCAGCTTGGTGAAGC	0.473			Mis		uveal melanoma								38	81	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85622342	85622342	+	Intron	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85622342G>A	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						CATTTGATCTGCGGACTTACT	0.348													20	86	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85622343	85622343	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85622343C>A	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ATTTGATCTGCGGACTTACTG	0.343													20	85	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90503468	90503468	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90503468C>A	uc004app.3	+	4	4101	c.4066C>A	c.(4066-4068)CCT>ACT	p.P1356T		NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	1356						integral to membrane				ovary(3)	3						GGAGAATGTGCCTTCCTGCTG	0.602													5	27	---	---	---	---	PASS
LOC286238	286238	broad.mit.edu	37	9	91262379	91262379	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91262379C>A	uc010mql.1	-	2	397	c.264G>T	c.(262-264)ATG>ATT	p.M88I		NM_001100111	NP_001093581			hypothetical protein LOC286238												0						CACAGGGAAGCATGTCCCGTG	0.433													18	61	---	---	---	---	PASS
GABBR2	9568	broad.mit.edu	37	9	101065634	101065634	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101065634C>A	uc004ays.2	-	16	2457	c.2301G>T	c.(2299-2301)AAG>AAT	p.K767N		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	767	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	AATCTTCTTTCTTCTGATTCT	0.527													17	33	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	112030678	112030678	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112030678C>T	uc004bdz.1	-	3	742	c.447G>A	c.(445-447)CAG>CAA	p.Q149Q	EPB41L4B_uc004bea.2_Silent_p.Q149Q	NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	149	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						TACTTTTCATCTGCTTTTTTA	0.353													4	26	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113251936	113251936	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113251936C>G	uc010mtz.2	-	9	2261	c.1924G>C	c.(1924-1926)GTT>CTT	p.V642L	SVEP1_uc010mua.1_Missense_Mutation_p.V642L|SVEP1_uc004beu.2_Missense_Mutation_p.V642L	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	642	HYR 1.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						TTACCAATAACCTTGATATGG	0.259													4	25	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	117020846	117020846	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117020846C>A	uc011lxl.1	+	28	3167	c.3167C>A	c.(3166-3168)CCA>CAA	p.P1056Q	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1056	Pro-rich.|Collagen-like 7.|Triple-helical region.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						CGAGGCCCACCAGGCATGAGG	0.627													6	17	---	---	---	---	PASS
OR5C1	392391	broad.mit.edu	37	9	125551984	125551984	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125551984C>A	uc011lzd.1	+	1	773	c.773C>A	c.(772-774)ACA>AAA	p.T258K		NM_001001923	NP_001001923	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						ATGTACGGGACACTCATTTTC	0.602													11	48	---	---	---	---	PASS
PBX3	5090	broad.mit.edu	37	9	128510846	128510846	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128510846G>T	uc004bqb.2	+	2	334	c.218G>T	c.(217-219)TGT>TTT	p.C73F	PBX3_uc004bqc.2_5'UTR|PBX3_uc004bqd.2_5'UTR|PBX3_uc011lzw.1_5'UTR	NM_006195	NP_006186	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3 isoform 1	73					anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GCCCTGAACTGTCACAGAATG	0.478													20	102	---	---	---	---	PASS
LRSAM1	90678	broad.mit.edu	37	9	130217333	130217333	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130217333G>T	uc004brb.1	+	4	474	c.129G>T	c.(127-129)GAG>GAT	p.E43D	LRSAM1_uc010mxk.1_Missense_Mutation_p.E43D|LRSAM1_uc004brc.1_Missense_Mutation_p.E43D|LRSAM1_uc004brd.1_Missense_Mutation_p.E43D	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif	43	LRR 1.				negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0						AGCTCTCAGAGGTAAACTGAG	0.423													4	128	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133962940	133962940	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133962940G>T	uc004caa.1	+	26	4406	c.4308G>T	c.(4306-4308)ACG>ACT	p.T1436T	LAMC3_uc010mze.1_Silent_p.T124T	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1436	Domain II and I.|Potential.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CGCAAGCCACGCTCCAACAGG	0.657													8	65	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134015981	134015981	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134015981C>T	uc004cag.2	+	11	1289	c.1178C>T	c.(1177-1179)TCA>TTA	p.S393L	NUP214_uc004cah.2_Missense_Mutation_p.S393L|NUP214_uc004caf.1_Missense_Mutation_p.S393L	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	393					carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		ATGTTACTTTCAACAGATGGT	0.378			T	DEK|SET|ABL1	AML|T-ALL								6	104	---	---	---	---	PASS
C9orf171	389799	broad.mit.edu	37	9	135447886	135447886	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135447886A>G	uc004cbn.2	+	7	1000	c.952A>G	c.(952-954)ACC>GCC	p.T318A	C9orf171_uc004cbo.2_Missense_Mutation_p.T282A	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799	318										ovary(4)|large_intestine(1)	5						GGGCAACTACACCCACCCCTA	0.597													5	7	---	---	---	---	PASS
SDCCAG3	10807	broad.mit.edu	37	9	139301958	139301958	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139301958C>A	uc004chi.2	-	5	663	c.458G>T	c.(457-459)GGC>GTC	p.G153V	SDCCAG3_uc004chj.2_Missense_Mutation_p.G130V|SDCCAG3_uc004chk.2_Missense_Mutation_p.G80V	NM_001039707	NP_001034796	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	153						cytoplasm					0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		GCCATACCCGCCGGTTTGGGA	0.532													3	13	---	---	---	---	PASS
LCN8	138307	broad.mit.edu	37	9	139649901	139649901	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139649901C>T	uc004cjb.1	-	4	643	c.294G>A	c.(292-294)ATG>ATA	p.M98I	LCN8_uc004cja.2_RNA	NM_178469	NP_848564	Q6JVE9	LCN8_HUMAN	lipocalin 8	121					transport	extracellular region	binding			pancreas(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		TGCCCCGCCACATCAGGGACA	0.652													3	12	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140611315	140611315	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140611315A>T	uc011mfc.1	+	3	360	c.323A>T	c.(322-324)CAC>CTC	p.H108L	EHMT1_uc004coa.2_Missense_Mutation_p.H108L|EHMT1_uc004cob.1_Missense_Mutation_p.H77L	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	108					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AAGCAAAACCACGTCACTGCC	0.542													12	63	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	21903765	21903765	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21903765A>T	uc001iqs.2	+	7	863	c.515A>T	c.(514-516)CAG>CTG	p.Q172L	MLLT10_uc001iqt.2_Missense_Mutation_p.Q172L|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Missense_Mutation_p.Q172L|MLLT10_uc001ira.2_5'Flank|MLLT10_uc001iqz.2_5'UTR	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	172	Interaction with FSTL3.|Self-association.|PHD-type 2.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						TTCAGCGCTCAGTTTGCCGGA	0.338			T	MLL|PICALM|CDK6	AL								21	53	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26463077	26463077	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26463077A>G	uc001isn.2	+	30	4244	c.3884A>G	c.(3883-3885)TAT>TGT	p.Y1295C	MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1295					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						AGGTCAATTTATCAAAATGCA	0.448													19	53	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28224093	28224093	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28224093C>T	uc009xky.2	-	16	2439	c.2341G>A	c.(2341-2343)GGA>AGA	p.G781R	ARMC4_uc010qds.1_Missense_Mutation_p.G306R|ARMC4_uc010qdt.1_Missense_Mutation_p.G473R|ARMC4_uc001itz.2_Missense_Mutation_p.G781R	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	781	ARM 5.						binding			ovary(4)|skin(2)	6						CAGCATTCTCCCAAGGCCCCA	0.458													28	61	---	---	---	---	PASS
ZNF438	220929	broad.mit.edu	37	10	31138162	31138162	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31138162T>C	uc010qdz.1	-	7	1607	c.1172A>G	c.(1171-1173)GAT>GGT	p.D391G	ZNF438_uc001ivn.2_Missense_Mutation_p.D342G|ZNF438_uc010qdy.1_Missense_Mutation_p.D381G|ZNF438_uc001ivo.3_5'UTR|ZNF438_uc009xlg.2_Missense_Mutation_p.D391G|ZNF438_uc001ivp.3_Missense_Mutation_p.D381G|ZNF438_uc010qea.1_Missense_Mutation_p.D391G|ZNF438_uc010qeb.1_Missense_Mutation_p.D391G|ZNF438_uc010qec.1_5'UTR	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	391					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				CAAAATTTCATCTGGTACCTT	0.373													29	101	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38305892	38305892	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38305892G>A	uc001izh.2	+	3	281	c.103G>A	c.(103-105)GCT>ACT	p.A35T	ZNF33A_uc001izg.2_Missense_Mutation_p.A35T|ZNF33A_uc010qev.1_Missense_Mutation_p.A42T|ZNF33A_uc001izi.1_Missense_Mutation_p.A35T|ZNF33A_uc001izj.2_RNA	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	35	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						TAGTCAGAGGGCTCTGTATAG	0.453													23	52	---	---	---	---	PASS
MBL2	4153	broad.mit.edu	37	10	54529061	54529061	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54529061G>T	uc001jjt.2	-	3	384	c.319C>A	c.(319-321)CTG>ATG	p.L107M		NM_000242	NP_000233	P11226	MBL2_HUMAN	soluble mannose-binding lectin precursor	107					acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding			ovary(1)	1						GAGGCAGCCAGGCTACTATCA	0.403													15	85	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582009	55582009	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582009G>A	uc001jju.1	-	33	5872	c.5477C>T	c.(5476-5478)CCT>CTT	p.P1826L	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P1823L|PCDH15_uc010qhw.1_Missense_Mutation_p.P1786L|PCDH15_uc010qhx.1_Missense_Mutation_p.P1757L|PCDH15_uc010qhy.1_Missense_Mutation_p.P1833L|PCDH15_uc010qhz.1_Missense_Mutation_p.P1828L|PCDH15_uc010qia.1_Missense_Mutation_p.P1806L|PCDH15_uc010qib.1_Missense_Mutation_p.P1803L	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1826	Poly-Pro.|Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tggagggcaaggaatagaagg	0.269										HNSCC(58;0.16)			10	50	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55755403	55755403	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55755403A>G	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Silent_p.S958S	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AATGCCTTCTACTTACAGGAG	0.388										HNSCC(58;0.16)			19	51	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55892716	55892716	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55892716G>T	uc001jju.1	-	15	2231	c.1836C>A	c.(1834-1836)AGC>AGA	p.S612R	PCDH15_uc010qhq.1_Missense_Mutation_p.S617R|PCDH15_uc010qhr.1_Missense_Mutation_p.S612R|PCDH15_uc010qhs.1_Missense_Mutation_p.S624R|PCDH15_uc010qht.1_Missense_Mutation_p.S619R|PCDH15_uc010qhu.1_Missense_Mutation_p.S612R|PCDH15_uc001jjv.1_Missense_Mutation_p.S590R|PCDH15_uc010qhv.1_Missense_Mutation_p.S612R|PCDH15_uc010qhw.1_Missense_Mutation_p.S575R|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Missense_Mutation_p.S617R|PCDH15_uc010qhz.1_Missense_Mutation_p.S612R|PCDH15_uc010qia.1_Missense_Mutation_p.S590R|PCDH15_uc010qib.1_Missense_Mutation_p.S590R|PCDH15_uc001jjw.2_Missense_Mutation_p.S612R	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	612	Cadherin 5.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AGCGAGGAGGGCTTTGATTAT	0.408										HNSCC(58;0.16)			9	33	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61029743	61029743	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61029743C>T	uc001jkn.2	-	8	853	c.719G>A	c.(718-720)CGA>CAA	p.R240Q	FAM13C_uc001jko.2_Missense_Mutation_p.R240Q|FAM13C_uc010qid.1_Missense_Mutation_p.R157Q|FAM13C_uc010qie.1_Missense_Mutation_p.R157Q|FAM13C_uc010qif.1_Missense_Mutation_p.R262Q|FAM13C_uc001jkp.2_Missense_Mutation_p.R157Q	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	240										ovary(2)	2						GATGGAGCATCGTGGCGACAG	0.527													10	35	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61115641	61115641	+	Intron	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61115641T>A	uc001jkn.2	-						FAM13C_uc001jko.2_Intron|FAM13C_uc010qid.1_Intron|FAM13C_uc010qie.1_Intron|FAM13C_uc010qif.1_Intron	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1											ovary(2)	2						CAATGGTGGCTTTTACCTGAG	0.313													21	46	---	---	---	---	PASS
PPP3CB	5532	broad.mit.edu	37	10	75239135	75239135	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75239135C>G	uc001jue.2	-	2	361	c.226G>C	c.(226-228)GAG>CAG	p.E76Q	PPP3CB_uc001juf.2_Missense_Mutation_p.E76Q|PPP3CB_uc001jug.2_Missense_Mutation_p.E76Q|PPP3CB_uc001jui.2_Missense_Mutation_p.E76Q|PPP3CB_uc001juh.2_5'UTR	NM_021132	NP_066955	P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta	76	Catalytic.									skin(1)	1	Prostate(51;0.0119)					GCAGCACCCTCATTGATAATT	0.393													38	129	---	---	---	---	PASS
TSPAN14	81619	broad.mit.edu	37	10	82271915	82271915	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82271915G>T	uc001kcj.3	+	6	573	c.466G>T	c.(466-468)GCA>TCA	p.A156S	TSPAN14_uc009xss.2_Missense_Mutation_p.A33S|TSPAN14_uc001kci.3_Missense_Mutation_p.A139S	NM_030927	NP_112189	Q8NG11	TSN14_HUMAN	tetraspanin 14 isoform 1	156						integral to membrane				ovary(1)|central_nervous_system(1)	2			Colorectal(32;0.229)			GTGCTGTGGCGCATATGGCCC	0.577													5	44	---	---	---	---	PASS
OBFC1	79991	broad.mit.edu	37	10	105657461	105657461	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105657461C>A	uc001kxl.2	-	6	673	c.598G>T	c.(598-600)GAC>TAC	p.D200Y	OBFC1_uc001kxm.2_Missense_Mutation_p.D200Y|OBFC1_uc001kxn.2_RNA	NM_024928	NP_079204	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold	200					positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding			ovary(1)	1		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CTGGGGAGGTCCAGGGCGCCT	0.463													6	51	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115365538	115365538	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115365538C>A	uc001laj.2	-	34	4062	c.3898G>T	c.(3898-3900)GGA>TGA	p.G1300*	NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Nonsense_Mutation_p.G1265*|NRAP_uc001lal.3_Nonsense_Mutation_p.G1300*	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1300	Nebulin 34.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCTATATCTCCAGAGGCCCGG	0.463													61	226	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118321144	118321144	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118321144A>G	uc001lcm.2	+	12	1373	c.1330A>G	c.(1330-1332)AAA>GAA	p.K444E		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	444	PLAT.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	AAATGTTGGAAAACAGTAAGT	0.363													14	36	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124339201	124339201	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124339201T>C	uc001lgk.1	+	10	893	c.787T>C	c.(787-789)TGG>CGG	p.W263R	DMBT1_uc001lgl.1_Missense_Mutation_p.W263R|DMBT1_uc001lgm.1_Missense_Mutation_p.W263R|DMBT1_uc009xzz.1_Missense_Mutation_p.W263R|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Missense_Mutation_p.W115R	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	263	SRCR 2.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGATGACTACTGGGACACCAA	0.612													41	155	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124339203	124339203	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124339203G>A	uc001lgk.1	+	10	895	c.789G>A	c.(787-789)TGG>TGA	p.W263*	DMBT1_uc001lgl.1_Nonsense_Mutation_p.W263*|DMBT1_uc001lgm.1_Nonsense_Mutation_p.W263*|DMBT1_uc009xzz.1_Nonsense_Mutation_p.W263*|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Nonsense_Mutation_p.W115*	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	263	SRCR 2.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGACTACTGGGACACCAATG	0.617													42	157	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124353098	124353098	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124353098G>A	uc001lgk.1	+	21	2620	c.2514G>A	c.(2512-2514)CGG>CGA	p.R838R	DMBT1_uc001lgl.1_Silent_p.R828R|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Silent_p.R838R|DMBT1_uc010qtx.1_Intron	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	838					epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCCAGTCCCGGCCGACACCCA	0.517													37	152	---	---	---	---	PASS
TNNI2	7136	broad.mit.edu	37	11	1861789	1861789	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1861789T>A	uc010qxe.1	+	3	111	c.89T>A	c.(88-90)CTG>CAG	p.L30Q	TNNI2_uc010qxc.1_Missense_Mutation_p.L28Q|TNNI2_uc010qxd.1_Missense_Mutation_p.L28Q	NM_001145841	NP_001139313	P48788	TNNI2_HUMAN	fast-twitch skeletal muscle troponin I isoform	30	Involved in binding TNC.				muscle filament sliding|positive regulation of transcription, DNA-dependent|skeletal muscle contraction	cytosol|nucleus|troponin complex	actin binding|troponin T binding				0		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCACGGAGCTGGAGAAGGAG	0.677													8	17	---	---	---	---	PASS
NAP1L4	4676	broad.mit.edu	37	11	2981043	2981043	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2981043C>A	uc001lxc.2	-	9	844	c.703G>T	c.(703-705)GAT>TAT	p.D235Y	NAP1L4_uc009ydt.2_RNA|NAP1L4_uc010qxm.1_Missense_Mutation_p.D235Y|NAP1L4_uc010qxn.1_Missense_Mutation_p.D235Y	NM_005969	NP_005960	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	235					nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		GAAAAGGGATCAGCCTTATCT	0.373													4	27	---	---	---	---	PASS
OR52K2	119774	broad.mit.edu	37	11	4470671	4470671	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4470671C>T	uc001lyz.1	+	1	102	c.102C>T	c.(100-102)TGC>TGT	p.C34C		NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K,	34	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCCTTTCTGCTTAGCATATA	0.512													30	74	---	---	---	---	PASS
OR51G1	79324	broad.mit.edu	37	11	4945209	4945209	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4945209A>T	uc010qyr.1	-	1	361	c.361T>A	c.(361-363)TCC>ACC	p.S121T		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	121	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGTCAATGGACATGGATAAC	0.502													4	32	---	---	---	---	PASS
OR51B6	390058	broad.mit.edu	37	11	5373146	5373146	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5373146A>T	uc010qzb.1	+	1	409	c.409A>T	c.(409-411)ACC>TCC	p.T137S	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTGACCAACACCCAGGTAAT	0.478													7	65	---	---	---	---	PASS
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5626790	5626790	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5626790T>A	uc001mbf.2	+	4	1071	c.827T>A	c.(826-828)CTG>CAG	p.L276Q	HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.L222Q|TRIM6_uc010qzj.1_Missense_Mutation_p.L73Q|TRIM6_uc001mbc.1_Missense_Mutation_p.L248Q|TRIM6_uc001mbe.2_Missense_Mutation_p.L73Q|TRIM6_uc010qzk.1_Missense_Mutation_p.L73Q|TRIM6_uc010qzl.1_Missense_Mutation_p.L73Q|TRIM6_uc001mbd.2_Missense_Mutation_p.L276Q|TRIM6_uc001mbg.1_Missense_Mutation_p.L73Q|TRIM6_uc009yep.1_Missense_Mutation_p.L73Q	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	276						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		ACAATGGAGCTGCTGCAGGTA	0.507											OREG0003723	type=REGULATORY REGION|Gene=TRIM6|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	19	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5799597	5799597	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5799597C>A	uc010qzn.1	-	1	268	c.268G>T	c.(268-270)GCA>TCA	p.A90S	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ATGCAGAGTGCATTGGGTAGA	0.448													10	44	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862836	5862836	+	Missense_Mutation	SNP	C	A	A	rs145073549	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862836C>A	uc010qzq.1	-	1	292	c.292G>T	c.(292-294)GGC>TGC	p.G98C	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAAGGTAGCCTCCAAAAGAT	0.468													30	82	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5878459	5878459	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5878459G>T	uc010qzr.1	-	1	474	c.474C>A	c.(472-474)AGC>AGA	p.S158R	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATGTACAGGCTCCTCAGGA	0.507													46	87	---	---	---	---	PASS
OR6A2	8590	broad.mit.edu	37	11	6816427	6816427	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6816427G>T	uc001mes.1	-	1	713	c.513C>A	c.(511-513)CTC>CTA	p.L171L		NM_003696	NP_003687	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A,	171	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACAGTAAGAGAGGCCAGAAA	0.488													7	52	---	---	---	---	PASS
OR2D2	120776	broad.mit.edu	37	11	6913409	6913409	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6913409C>A	uc010rau.1	-	1	323	c.323G>T	c.(322-324)GGG>GTG	p.G108V		NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTGGGTACACCCAAAAATGAG	0.473													17	38	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7981912	7981912	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7981912A>G	uc001mfv.1	-	2	1264	c.1247T>C	c.(1246-1248)CTA>CCA	p.L416P		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	416	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TTCAGCTGCTAGGGAGCACAG	0.547													10	56	---	---	---	---	PASS
GALNTL4	374378	broad.mit.edu	37	11	11348656	11348656	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11348656T>C	uc001mjo.2	-	9	1910	c.1489A>G	c.(1489-1491)ATC>GTC	p.I497V		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	497	Lumenal (Potential).|Ricin B-type lectin.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CCATGGCAGATGTACATGATG	0.517													5	38	---	---	---	---	PASS
COPB1	1315	broad.mit.edu	37	11	14480146	14480146	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14480146C>A	uc001mli.2	-	21	3041	c.2734G>T	c.(2734-2736)GAG>TAG	p.E912*	COPB1_uc001mlg.2_Nonsense_Mutation_p.E912*|COPB1_uc001mlh.2_Nonsense_Mutation_p.E912*	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	912					COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						ATTGGCTTCTCAATGCTGACA	0.433													9	61	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16036565	16036565	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16036565T>A	uc001mme.2	-	13	1727	c.1694A>T	c.(1693-1695)CAG>CTG	p.Q565L	SOX6_uc001mmd.2_Missense_Mutation_p.Q528L|SOX6_uc001mmf.2_Missense_Mutation_p.Q525L|SOX6_uc001mmg.2_Missense_Mutation_p.Q552L	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	552					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						TCCCGTTAACTGGGGCCCCAA	0.458													4	57	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18731979	18731979	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18731979G>A	uc009yht.2	-	17	2786	c.2596C>T	c.(2596-2598)CTC>TTC	p.L866F	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	864	Fibronectin type-III 2.									ovary(4)|large_intestine(2)|kidney(1)	7						TCCTCCAGGAGACCATCCACA	0.532													7	35	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20660004	20660004	+	Splice_Site	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20660004G>C	uc001mqd.2	+	13	2143	c.1870_splice	c.e13-1	p.G624_splice	SLC6A5_uc009yic.2_Splice_Site_p.G389_splice	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter						synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	TCTCCTGTTAGGGTGGAATTT	0.458													15	106	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30034104	30034104	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30034104G>T	uc001msk.2	-	2	1274	c.122C>A	c.(121-123)GCA>GAA	p.A41E		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	41						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AACAGCAGCTGCTGCAGCTGC	0.667													11	52	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43348117	43348117	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43348117G>C	uc010rfh.1	+	7	984	c.811G>C	c.(811-813)GGT>CGT	p.G271R	API5_uc010rfg.1_Missense_Mutation_p.G260R|API5_uc001mxf.2_Missense_Mutation_p.G271R|API5_uc010rfi.1_Missense_Mutation_p.G217R|API5_uc001mxg.2_Missense_Mutation_p.G145R	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	271					anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						CCCTAACCTCGGTACCTTGAC	0.368													14	103	---	---	---	---	PASS
EXT2	2132	broad.mit.edu	37	11	44146495	44146495	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44146495C>T	uc001mxz.2	+	5	1234	c.900C>T	c.(898-900)TGC>TGT	p.C300C	EXT2_uc010rfo.1_Silent_p.C328C|EXT2_uc001mxy.2_Silent_p.C313C|EXT2_uc009ykt.2_Silent_p.C300C|EXT2_uc001mya.2_Silent_p.C333C	NM_207122	NP_997005	Q93063	EXT2_HUMAN	exostosin 2 isoform 2	300	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5						GTAAGCGCTGCCACAAGCACC	0.493			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				15	63	---	---	---	---	PASS
MDK	4192	broad.mit.edu	37	11	46404190	46404190	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46404190A>C	uc001nco.2	+	4	520	c.298A>C	c.(298-300)ACC>CCC	p.T100P	MDK_uc009ykz.1_Missense_Mutation_p.T100P|MDK_uc001ncp.2_Missense_Mutation_p.T100P|MDK_uc009yla.2_Missense_Mutation_p.T44P|MDK_uc009ylb.2_Intron|MDK_uc001ncq.2_Missense_Mutation_p.T100P|MDK_uc001ncr.2_RNA|MDK_uc001ncs.2_Missense_Mutation_p.T100P	NM_001012334	NP_001012334	P21741	MK_HUMAN	midkine	100					adrenal gland development|cell differentiation|nervous system development|positive regulation of cell division|response to wounding|signal transduction	extracellular region	growth factor activity|heparin binding				0				GBM - Glioblastoma multiforme(35;0.0252)|Lung(87;0.14)		GGGCACAGGCACCAAAGTCCG	0.557													3	23	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46908042	46908042	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46908042C>A	uc001ndn.3	-	17	2404	c.2258G>T	c.(2257-2259)CGT>CTT	p.R753L		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	753	Extracellular (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		GCTGATTCGACGGATGTCCAT	0.522													14	33	---	---	---	---	PASS
MYBPC3	4607	broad.mit.edu	37	11	47355296	47355296	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47355296G>A	uc001nfa.3	-	28	3057	c.3002C>T	c.(3001-3003)CCC>CTC	p.P1001L		NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1000	Ig-like C2-type 6.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		CTGAGGCCGGGGCTTGCCCTG	0.652													9	11	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55405832	55405832	+	5'Flank	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55405832C>T	uc010rij.1	+							NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						CTACACTGGACCATGGAAAAA	0.308													16	188	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606660	55606660	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606660A>C	uc010rio.1	+	1	433	c.433A>C	c.(433-435)ATG>CTG	p.M145L		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				ACTCTGTGCCATGCTGGTGGT	0.453													8	72	---	---	---	---	PASS
OR8J1	219477	broad.mit.edu	37	11	56127828	56127828	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56127828G>A	uc010rjh.1	+	1	106	c.106G>A	c.(106-108)GGG>AGG	p.G36R		NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GGTGCTCTATGGGCTGACCAT	0.498													12	90	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468225	56468225	+	Missense_Mutation	SNP	G	C	C	rs148651508		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468225G>C	uc010rjn.1	+	1	362	c.362G>C	c.(361-363)CGC>CCC	p.R121P		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTTATGACCGCTACGTGGCC	0.527													19	116	---	---	---	---	PASS
P2RX3	5024	broad.mit.edu	37	11	57114588	57114588	+	Splice_Site	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57114588A>G	uc001nju.2	+	3	332	c.256_splice	c.e3-2	p.G86_splice		NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3						positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						TCTCCTCCCAAGGGCACCTCG	0.318													3	36	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60183135	60183135	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60183135G>T	uc001npj.2	+	5	1259	c.694G>T	c.(694-696)GAA>TAA	p.E232*	MS4A14_uc001npi.2_Nonsense_Mutation_p.E120*|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Nonsense_Mutation_p.E215*|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	232						integral to membrane	receptor activity			breast(1)	1						TGTGCCAGATGAACAAAAGCA	0.398													33	47	---	---	---	---	PASS
MS4A8B	83661	broad.mit.edu	37	11	60482507	60482507	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60482507C>T	uc001npv.2	+	6	751	c.548C>T	c.(547-549)GCG>GTG	p.A183V		NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	183	Helical; (Potential).					integral to membrane	receptor activity				0						CCTGGAATGGCGATTTCTGGC	0.318													11	79	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62766531	62766531	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62766531G>T	uc001nwo.2	-	5	759	c.623C>A	c.(622-624)GCC>GAC	p.A208D	SLC22A8_uc001nwn.1_5'UTR|SLC22A8_uc001nwp.2_Missense_Mutation_p.A208D|SLC22A8_uc009yom.2_Missense_Mutation_p.A85D|SLC22A8_uc010rmm.1_Missense_Mutation_p.A117D|SLC22A8_uc009yon.2_Missense_Mutation_p.A208D	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	208	Cytoplasmic (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						CGACATGATGGCCCGCATCCG	0.607													24	44	---	---	---	---	PASS
EIF1AD	84285	broad.mit.edu	37	11	65767038	65767038	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65767038C>A	uc001ogm.1	-	4	590	c.305G>T	c.(304-306)TGG>TTG	p.W102L	EIF1AD_uc001ogn.1_Missense_Mutation_p.W102L|BANF1_uc001ogo.2_5'Flank|BANF1_uc001ogp.2_5'Flank	NM_032325	NP_115701	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A	102						nucleus	translation initiation factor activity				0						GACCACCTACCAAAACCCCTC	0.537													7	62	---	---	---	---	PASS
RBM4	5936	broad.mit.edu	37	11	66411341	66411341	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66411341C>T	uc009yrj.2	+	3	1321	c.833C>T	c.(832-834)CCG>CTG	p.P278L	RBM4_uc009yrk.2_Missense_Mutation_p.P253L|RBM4_uc001oiw.1_Missense_Mutation_p.P278L|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Missense_Mutation_p.P278L|RBM4_uc001oiz.1_Missense_Mutation_p.P278L	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	278	Interaction with TNPO3.				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		CACCTGTTGCCGACCTCAGGA	0.433													4	39	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67171784	67171784	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67171784C>A	uc001ola.2	+	2	140	c.111C>A	c.(109-111)GCC>GCA	p.A37A	PPP1CA_uc009yro.1_5'Flank|PPP1CA_uc001okt.1_5'Flank|PPP1CA_uc001oku.1_5'Flank|PPP1CA_uc001okv.1_5'Flank|PPP1CA_uc001okw.1_5'Flank|PPP1CA_uc001okx.1_Intron|PPP1CA_uc001oky.2_5'Flank|TBC1D10C_uc001okz.2_Silent_p.A37A|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	37						intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			ATCGCCAGGCCGACCGCTATG	0.677													6	26	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68838835	68838835	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68838835C>T	uc001oos.2	+	10	1023	c.907C>T	c.(907-909)CTG>TTG	p.L303L	TPCN2_uc009ysk.1_RNA|TPCN2_uc001oor.2_Silent_p.L218L|TPCN2_uc010rqg.1_Silent_p.L303L|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	303	Helical; Name=S6 of repeat I; (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AAGCCTGTTTCTGATGAACCT	0.612													4	17	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70176310	70176310	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70176310G>T	uc001opo.2	+	8	1160	c.962G>T	c.(961-963)AGA>ATA	p.R321I	PPFIA1_uc001opn.1_Missense_Mutation_p.R321I|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	321	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			ATGGAAGAGAGAATCACTACT	0.378													14	48	---	---	---	---	PASS
OR2AT4	341152	broad.mit.edu	37	11	74800671	74800671	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74800671G>A	uc010rro.1	-	1	88	c.88C>T	c.(88-90)CTC>TTC	p.L30F		NM_001005285	NP_001005285	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT,	30	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AACACAGGGAGGAAGAAGGTC	0.532													17	26	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76257279	76257279	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76257279A>T	uc001oxl.2	+	20	3855	c.3712A>T	c.(3712-3714)ATG>TTG	p.M1238L	C11orf30_uc001oxm.2_Missense_Mutation_p.M1140L|C11orf30_uc010rsb.1_Missense_Mutation_p.M1253L|C11orf30_uc010rsc.1_Missense_Mutation_p.M1239L|C11orf30_uc001oxn.2_Missense_Mutation_p.M1239L|C11orf30_uc010rsd.1_Missense_Mutation_p.M1147L|C11orf30_uc010rse.1_Missense_Mutation_p.M485L|C11orf30_uc001oxp.2_Intron	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	1238					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						AGGCCAGTTCATGCGTATTCA	0.448													5	42	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76257281	76257281	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76257281G>T	uc001oxl.2	+	20	3857	c.3714G>T	c.(3712-3714)ATG>ATT	p.M1238I	C11orf30_uc001oxm.2_Missense_Mutation_p.M1140I|C11orf30_uc010rsb.1_Missense_Mutation_p.M1253I|C11orf30_uc010rsc.1_Missense_Mutation_p.M1239I|C11orf30_uc001oxn.2_Missense_Mutation_p.M1239I|C11orf30_uc010rsd.1_Missense_Mutation_p.M1147I|C11orf30_uc010rse.1_Missense_Mutation_p.M485I|C11orf30_uc001oxp.2_Intron	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	1238					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						GCCAGTTCATGCGTATTCAGA	0.448													3	44	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76372296	76372296	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76372296G>T	uc001oxq.3	-	3	584	c.341C>A	c.(340-342)GCG>GAG	p.A114E	LRRC32_uc001oxr.3_Missense_Mutation_p.A114E|LRRC32_uc010rsf.1_Missense_Mutation_p.A114E	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	114	LRR 3.|Extracellular (Potential).					integral to plasma membrane					0						AGCACTCAGCGCAGTGGCCAT	0.677													12	31	---	---	---	---	PASS
TSKU	25987	broad.mit.edu	37	11	76507479	76507479	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76507479G>T	uc001oxt.2	+	2	991	c.819G>T	c.(817-819)GAG>GAT	p.E273D		NM_015516	NP_056331	Q8WUA8	TSK_HUMAN	tsukushin precursor	273	LRR 9.					extracellular region					0	Ovarian(111;0.112)					CAGGAGCTGAGGTGTTTTCAG	0.662													28	40	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92258043	92258043	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92258043C>A	uc001pdj.3	+	2	3553	c.3536C>A	c.(3535-3537)TCC>TAC	p.S1179Y		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1179	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACTCCAGTTCCAATGAAAAA	0.388										TCGA Ovarian(4;0.039)			11	13	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92532911	92532911	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92532911C>G	uc001pdj.3	+	9	6749	c.6732C>G	c.(6730-6732)AGC>AGG	p.S2244R		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2244	Cadherin 20.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGTTGTTAGCCCTTTGGATT	0.443										TCGA Ovarian(4;0.039)			3	6	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102592148	102592148	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102592148C>G	uc001phe.2	-	4	705	c.606G>C	c.(604-606)TGG>TGC	p.W202C	MMP8_uc010rut.1_Missense_Mutation_p.W137C|MMP8_uc010ruu.1_Missense_Mutation_p.W179C	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	202					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		AGGTGTTGGTCCATGTTTCTT	0.373													10	38	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108057295	108057295	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108057295C>A	uc001pjz.3	-	8	742	c.640G>T	c.(640-642)GAA>TAA	p.E214*	NPAT_uc001pka.2_Nonsense_Mutation_p.E9*	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	214	Interaction with MIZF.				positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CTCTGAGATTCACTGAAACAC	0.318													21	37	---	---	---	---	PASS
ANKK1	255239	broad.mit.edu	37	11	113266824	113266824	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113266824G>T	uc001pny.2	+	5	812	c.718G>T	c.(718-720)GCA>TCA	p.A240S		NM_178510	NP_848605	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	240	Protein kinase.						ATP binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|ovary(1)|breast(1)	8		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CCGAGTGGCGGCAGGCATGCG	0.597													11	27	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119031262	119031262	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119031262G>A	uc001pvs.2	+	14	1947	c.1611G>A	c.(1609-1611)GTG>GTA	p.V537V	ABCG4_uc009zar.2_Silent_p.V537V	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	537	ABC transmembrane type-2.|Helical; Name=5; (Potential).				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCACTTTTGTGGGCCCAGTTA	0.567													77	141	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124412845	124412845	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124412845C>T	uc010sam.1	-	1	706	c.706G>A	c.(706-708)GCC>ACC	p.A236T		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		GTACTAAAGGCTTTGGACCTG	0.453													3	19	---	---	---	---	PASS
CCDC15	80071	broad.mit.edu	37	11	124829068	124829068	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124829068G>A	uc001qbm.3	+	3	494	c.235G>A	c.(235-237)GCT>ACT	p.A79T		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	79	Potential.					centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		AAAACAAGAAGCTTTGAAACA	0.299													4	6	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	464404	464404	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:464404G>A	uc001qif.1	-	7	1153	c.790C>T	c.(790-792)CGA>TGA	p.R264*	KDM5A_uc001qie.1_Nonsense_Mutation_p.R264*|KDM5A_uc010sdn.1_Nonsense_Mutation_p.R223*|KDM5A_uc010sdo.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	264					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TTTCGTCTTCGGGTGACCTCA	0.269			T 	NUP98	AML								10	78	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	862973	862973	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:862973G>C	uc001qio.3	+	1	749	c.242G>C	c.(241-243)CGC>CCC	p.R81P	WNK1_uc001qin.2_Missense_Mutation_p.R81P|WNK1_uc001qip.3_Missense_Mutation_p.R81P	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	81					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CGCTTCTTCCGCCGGAGCGTC	0.672													12	30	---	---	---	---	PASS
C12orf32	83695	broad.mit.edu	37	12	2997321	2997321	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2997321G>T	uc001qlh.2	+	3	581	c.413G>T	c.(412-414)GGG>GTG	p.G138V	TULP3_uc010sef.1_Intron|TULP3_uc009zec.1_5'Flank|TULP3_uc010seg.1_5'Flank|TULP3_uc001qlj.2_5'Flank|TULP3_uc010seh.1_5'Flank|TULP3_uc010sei.1_5'Flank|C12orf32_uc010see.1_Missense_Mutation_p.G124V|C12orf32_uc001qli.2_5'UTR	NR_027363				RecName: Full=Uncharacterized protein C12orf32;												0			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CAAAGCTGTGGGAACATGTCA	0.498													38	51	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6703658	6703658	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6703658C>G	uc001qpo.2	-	15	2444	c.2280G>C	c.(2278-2280)CAG>CAC	p.Q760H	CHD4_uc001qpn.2_Missense_Mutation_p.Q753H|CHD4_uc001qpp.2_Missense_Mutation_p.Q757H	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	760	Helicase ATP-binding.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						AGACTGCTGTCTGTACAGTTT	0.483													17	41	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7647932	7647932	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7647932C>A	uc001qsz.3	-	6	1293	c.1165G>T	c.(1165-1167)GAG>TAG	p.E389*	CD163_uc001qta.3_Nonsense_Mutation_p.E389*|CD163_uc009zfw.2_Nonsense_Mutation_p.E389*	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	389	SRCR 4.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						CTCTGAATCTCCACCTCAACT	0.493													14	33	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8083956	8083956	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8083956C>A	uc001qtr.2	-	4	657	c.395G>T	c.(394-396)GGA>GTA	p.G132V	SLC2A3_uc001qts.2_Missense_Mutation_p.G132V	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	132	Helical; Name=4; (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		TGTGCAGAGTCCGCAGAAGAG	0.537													8	18	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21355512	21355512	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21355512C>A	uc001req.3	+	10	1327	c.1223C>A	c.(1222-1224)GCC>GAC	p.A408D		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	408	Helical; Name=9; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	GTTGGAATTGCCAAATTCTCA	0.333													13	28	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46240701	46240701	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46240701G>T	uc001ros.1	+	12	1561	c.1561G>T	c.(1561-1563)GAG>TAG	p.E521*	ARID2_uc001ror.2_Nonsense_Mutation_p.E521*|ARID2_uc009zkg.1_5'UTR|ARID2_uc009zkh.1_Nonsense_Mutation_p.E148*	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	521					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AATAGATAGTGAGAAGTTTGC	0.363													58	50	---	---	---	---	PASS
AQP5	362	broad.mit.edu	37	12	50355822	50355822	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50355822G>T	uc001rvo.2	+	1	544	c.22G>T	c.(22-24)GTG>TTG	p.V8L		NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5	8	Cytoplasmic (Potential).				carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						GGTGTGCTCCGTGGCCTTCCT	0.373													11	12	---	---	---	---	PASS
ACCN2	41	broad.mit.edu	37	12	50472763	50472763	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50472763G>A	uc001rvw.2	+	7	1280	c.1051G>A	c.(1051-1053)GAC>AAC	p.D351N	ACCN2_uc001rvv.2_Missense_Mutation_p.D351N|ACCN2_uc009zln.2_Missense_Mutation_p.D142N|ACCN2_uc009zlo.2_Missense_Mutation_p.D351N	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal	351	Extracellular (By similarity).				calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	TCCTGCTCTGGGTGAGCGCCC	0.577													16	108	---	---	---	---	PASS
HIGD1C	613227	broad.mit.edu	37	12	51347861	51347861	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51347861C>T	uc010smw.1	+	1	80	c.80C>T	c.(79-81)CCC>CTC	p.P27L		NM_001109619	NP_001103089	A8MV81	HIG1C_HUMAN	HIG1 domain family, member 1C	27	HIG1.|Helical; (Potential).					integral to membrane					0						AGAGACTCCCCCTTTGTCCCT	0.343													20	33	---	---	---	---	PASS
KRT5	3852	broad.mit.edu	37	12	52913994	52913994	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52913994G>A	uc001san.2	-	1	250	c.87C>T	c.(85-87)CGC>CGT	p.R29R	KRT5_uc009zmh.2_Silent_p.R29R	NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5	29	Head.				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGAAGCTGGTGCGGGAGACAG	0.662													21	16	---	---	---	---	PASS
KRT2	3849	broad.mit.edu	37	12	53044194	53044194	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53044194G>C	uc001sat.2	-	2	762	c.729C>G	c.(727-729)CTC>CTG	p.L243L		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	243	Coil 1B.|Rod.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		TTTCTGCAGTGAGCCCATCCA	0.488													40	72	---	---	---	---	PASS
OR6C76	390326	broad.mit.edu	37	12	55820349	55820349	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55820349T>C	uc010spm.1	+	1	312	c.312T>C	c.(310-312)CTT>CTC	p.L104L		NM_001005183	NP_001005183	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTATCTTCCTTGGCTCAACGG	0.408													23	155	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58127845	58127845	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58127845G>C	uc001spq.2	-	5	1513	c.1513C>G	c.(1513-1515)CGA>GGA	p.R505G	AGAP2_uc001spp.2_Missense_Mutation_p.R505G|AGAP2_uc001spr.2_Missense_Mutation_p.R169G	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	505	G domain.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						AGGCCTCCTCGTCCCTCCCCG	0.587													12	17	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63987866	63987866	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63987866C>A	uc001srp.1	-	16	1761	c.1580_splice	c.e16+1	p.R527_splice		NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GATATAATTACCTTAGATAAA	0.234													11	12	---	---	---	---	PASS
WIF1	11197	broad.mit.edu	37	12	65462643	65462643	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65462643C>A	uc001ssk.2	-	4	584	c.439G>T	c.(439-441)GTG>TTG	p.V147L		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	147	WIF.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		AATGCTGCCACCCCATCCTGT	0.363			T	HMGA2	pleomorphic salivary gland adenoma								16	38	---	---	---	---	PASS
LEMD3	23592	broad.mit.edu	37	12	65637157	65637157	+	Intron	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65637157G>C	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AAACTAACTTGTTTTTTGTAG	0.234													18	36	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71960207	71960207	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71960207A>G	uc001swl.2	+	9	929	c.881A>G	c.(880-882)CAA>CGA	p.Q294R	LGR5_uc001swm.2_Missense_Mutation_p.Q270R|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	294	Extracellular (Potential).|LRR 10.					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						AATCCCATCCAGTTTGTTGGG	0.279													16	24	---	---	---	---	PASS
KCNC2	3747	broad.mit.edu	37	12	75444456	75444456	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75444456C>A	uc001sxg.1	-	3	1873	c.1329G>T	c.(1327-1329)ATG>ATT	p.M443I	KCNC2_uc009zry.2_Missense_Mutation_p.M443I|KCNC2_uc001sxe.2_Missense_Mutation_p.M443I|KCNC2_uc001sxf.2_Missense_Mutation_p.M443I|KCNC2_uc010stw.1_Missense_Mutation_p.M443I	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	443					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						TTTGGGGGTACATATCCCCAT	0.512													15	23	---	---	---	---	PASS
KCNC2	3747	broad.mit.edu	37	12	75444506	75444506	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75444506C>G	uc001sxg.1	-	3	1823	c.1279G>C	c.(1279-1281)GGG>CGG	p.G427R	KCNC2_uc009zry.2_Missense_Mutation_p.G427R|KCNC2_uc001sxe.2_Missense_Mutation_p.G427R|KCNC2_uc001sxf.2_Missense_Mutation_p.G427R|KCNC2_uc010stw.1_Missense_Mutation_p.G427R	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	427					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						CACCAGAACCCAATGGGAATG	0.512													18	21	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78513396	78513396	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78513396C>G	uc001syp.2	+	15	3593	c.3420C>G	c.(3418-3420)CGC>CGG	p.R1140R	NAV3_uc001syo.2_Silent_p.R1140R|NAV3_uc010sub.1_Silent_p.R640R|NAV3_uc009zsf.2_Silent_p.R148R	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1140	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GCTTGCCCCGCCCTTCAAAAT	0.522										HNSCC(70;0.22)			20	25	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78515843	78515843	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78515843G>T	uc001syp.2	+	16	4046	c.3873G>T	c.(3871-3873)CCG>CCT	p.P1291P	NAV3_uc001syo.2_Silent_p.P1291P|NAV3_uc010sub.1_Silent_p.P791P|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1291	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TGGAGTCACCGTCGTCCGGTA	0.537										HNSCC(70;0.22)			11	29	---	---	---	---	PASS
RMST	196475	broad.mit.edu	37	12	97885682	97885682	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97885682G>T	uc001tey.1	+						RMST_uc001tez.1_5'Flank|RMST_uc001tfa.1_5'Flank|MIR1251_hsa-mir-1251|MI0006386_5'Flank	NR_024037				Homo sapiens C23up NCRMS mRNA, partial sequence; alternatively spliced.												0						CCATGGGTCAGCTATGTGGAC	0.463													10	26	---	---	---	---	PASS
CHST11	50515	broad.mit.edu	37	12	105151514	105151514	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105151514A>G	uc001tkx.1	+	4	1283	c.992A>G	c.(991-993)TAC>TGC	p.Y331C	CHST11_uc001tky.2_Missense_Mutation_p.Y326C|uc001tkz.2_5'Flank	NM_018413	NP_060883	Q9NPF2	CHSTB_HUMAN	carbohydrate sulfotransferase 11	331	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0						ACGCAGCTGTACGAAGTCTAC	0.433													15	34	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115117336	115117336	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115117336C>A	uc001tvt.1	-	4	1802	c.838G>T	c.(838-840)GCT>TCT	p.A280S	TBX3_uc001tvu.1_Missense_Mutation_p.A260S	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	280	T-box; second part.				anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GCAGTCACAGCGATGAATTCA	0.418													27	60	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116549311	116549311	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116549311T>A	uc001tvw.2	-	3	372	c.317A>T	c.(316-318)GAA>GTA	p.E106V		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	106					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GAGTCCTTCTTCCACAACTGa	0.328													9	36	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121666570	121666570	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121666570G>A	uc001tzr.2	+	7	952	c.648G>A	c.(646-648)TCG>TCA	p.S216S	P2RX4_uc010szr.1_RNA|P2RX4_uc010szs.1_RNA|P2RX4_uc009zxc.2_Silent_p.S189S|P2RX4_uc001tzs.2_Silent_p.S232S|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Silent_p.S115S	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	216	Extracellular (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCTCAAGTCGTGCATTTATG	0.473													28	57	---	---	---	---	PASS
ATP6V0A2	23545	broad.mit.edu	37	12	124212412	124212412	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124212412G>A	uc001ufr.2	+	6	852	c.604G>A	c.(604-606)GTG>ATG	p.V202M	ATP6V0A2_uc001ufq.1_Missense_Mutation_p.V202M	NM_012463	NP_036595	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	202	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		GTACACCATCGTGTCCTATGC	0.433													19	34	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124950785	124950785	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124950785G>C	uc010tba.1	-	5	756	c.639C>G	c.(637-639)CCC>CCG	p.P213P	NCOR2_uc010tay.1_Silent_p.P213P|NCOR2_uc010taz.1_Silent_p.P213P|NCOR2_uc010tbb.1_Silent_p.P213P|NCOR2_uc010tbc.1_Silent_p.P213P|NCOR2_uc001ugj.1_Silent_p.P213P|NCOR2_uc001ugk.1_Silent_p.P213P	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	213	Potential.				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCGGTGACACGGGCTTCTCAG	0.682													19	49	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124950837	124950837	+	Intron	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124950837G>A	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTGTTGCTGTGGGGAGAGGCA	0.721													9	23	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19755891	19755891	+	5'UTR	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19755891G>A	uc009zzj.2	-	1						NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TTACCATGTTGAGCTCCTCCG	0.662													12	24	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19755893	19755893	+	5'UTR	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19755893G>T	uc009zzj.2	-	1						NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACCATGTTGAGCTCCTCCGCT	0.657													12	23	---	---	---	---	PASS
N6AMT2	221143	broad.mit.edu	37	13	21331602	21331602	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21331602C>A	uc001uno.1	-	2	217	c.136G>T	c.(136-138)GAG>TAG	p.E46*	N6AMT2_uc009zzr.1_Nonsense_Mutation_p.E46*|N6AMT2_uc001unp.2_RNA	NM_174928	NP_777588	Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2	46							methyltransferase activity|nucleic acid binding				0		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		ACCCAATTCTCTTCTATTATT	0.413													19	48	---	---	---	---	PASS
PABPC3	5042	broad.mit.edu	37	13	25670683	25670683	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25670683A>C	uc001upy.2	+	1	408	c.347A>C	c.(346-348)TAT>TCT	p.Y116S		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	116	RRM 2.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAGCACTGTATGATACAGTT	0.393													25	62	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26152955	26152955	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26152955T>A	uc001uqk.2	+	21	1927	c.1785T>A	c.(1783-1785)GAT>GAA	p.D595E	ATP8A2_uc010tdi.1_Missense_Mutation_p.D555E|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.D105E	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	555	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TTTTATAGGATAATGTGATTT	0.373													6	26	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38137489	38137489	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38137489C>T	uc001uwo.3	-	23	2610	c.2492G>A	c.(2491-2493)AGG>AAG	p.R831K	POSTN_uc010tet.1_Missense_Mutation_p.R332K|POSTN_uc001uwp.3_Missense_Mutation_p.R774K|POSTN_uc001uwr.2_Missense_Mutation_p.R776K|POSTN_uc001uwq.2_Missense_Mutation_p.R746K	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1	831					cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ACGACCTTCCCTTAATCGTCT	0.303													10	37	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39264710	39264710	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39264710G>T	uc001uwv.2	+	1	3538	c.3229G>T	c.(3229-3231)GTA>TTA	p.V1077L		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1077	Extracellular (Potential).|CSPG 7.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACAGTTGATAGTAATGGAAGG	0.418													32	51	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67802410	67802410	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67802410C>T	uc001vik.2	-	2	855	c.163G>A	c.(163-165)GCC>ACC	p.A55T	PCDH9_uc001vil.2_Missense_Mutation_p.A55T|PCDH9_uc010thl.1_Missense_Mutation_p.A55T|PCDH9_uc001vin.3_Missense_Mutation_p.A55T	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	55	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GTCCCTGTGGCAGCATTGATG	0.448													16	38	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72147095	72147095	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72147095G>T	uc010thn.1	-	5	1599	c.1176C>A	c.(1174-1176)AGC>AGA	p.S392R	DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	444					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CTGGAGGTAGGCTGACAGGAA	0.458													6	21	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76427226	76427226	+	Splice_Site	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76427226A>T	uc001vjv.2	+	25	4426	c.3666_splice	c.e25-2	p.R1222_splice	LMO7_uc010thv.1_Splice_Site_p.R1173_splice|LMO7_uc010thw.1_Splice_Site_p.R1099_splice	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTTGTGTTTCAGAGGCGAATC	0.363													7	20	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454000	84454000	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454000C>A	uc001vlk.2	-	1	2529	c.1643G>T	c.(1642-1644)GGT>GTT	p.G548V		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	548	LRRCT 2.|Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CACTTCGGAACCCAAGCGTTC	0.532													7	14	---	---	---	---	PASS
TGDS	23483	broad.mit.edu	37	13	95228567	95228567	+	Splice_Site	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95228567C>T	uc001vlw.2	-	11	1103	c.982_splice	c.e11+1	p.I328_splice	TGDS_uc001vlx.2_Splice_Site	NM_014305	NP_055120	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase						cellular metabolic process		coenzyme binding|dTDP-glucose 4,6-dehydratase activity|protein binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TCAAAACATACTTGTTTTCTT	0.338													11	33	---	---	---	---	PASS
DZIP1	22873	broad.mit.edu	37	13	96277157	96277157	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96277157C>T	uc001vmk.2	-	8	1689	c.837G>A	c.(835-837)GAG>GAA	p.E279E	DZIP1_uc001vml.2_Silent_p.E279E	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	279	Potential.				germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			AAAAGTCTTCCTCTTTTGTTT	0.279													6	14	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404367	20404367	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404367T>A	uc001vwj.1	+	1	542	c.542T>A	c.(541-543)CTT>CAT	p.L181H		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TTTTGTGACCTTCCCTTGGTG	0.478													15	172	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20444303	20444303	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20444303C>A	uc010tkx.1	+	1	626	c.626C>A	c.(625-627)ACC>AAC	p.T209N		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	209	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTCTAGTGACCAAGTTAGCC	0.428													24	203	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21793152	21793152	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21793152C>G	uc001wag.2	+	14	2138	c.2138C>G	c.(2137-2139)ACT>AGT	p.T713S	RPGRIP1_uc001wah.2_Missense_Mutation_p.T355S|RPGRIP1_uc001wai.2_Intron|RPGRIP1_uc001waj.1_Missense_Mutation_p.T178S|RPGRIP1_uc001wak.2_Missense_Mutation_p.T188S|RPGRIP1_uc010aim.2_Missense_Mutation_p.T96S|RPGRIP1_uc001wal.2_Missense_Mutation_p.T72S|RPGRIP1_uc001wam.2_Missense_Mutation_p.T30S	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	713					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GAACACAGCACTCTTGCTGCA	0.522													11	89	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23869455	23869455	+	Intron	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23869455A>G	uc001wjv.2	-						MYH6_uc010akp.1_Missense_Mutation_p.W531R	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6						adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGGTGAGGCCAAGGAGGCACC	0.547													11	31	---	---	---	---	PASS
NRL	4901	broad.mit.edu	37	14	24551685	24551685	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24551685G>T	uc001wlo.2	-	2	504	c.373C>A	c.(373-375)CAC>AAC	p.H125N	NRL_uc001wlp.2_Missense_Mutation_p.H125N|NRL_uc001wlq.2_Missense_Mutation_p.H125N	NM_006177	NP_006168	P54845	NRL_HUMAN	neural retina leucine zipper	125					response to stimulus|transcription from RNA polymerase II promoter|visual perception	nucleus	leucine zipper domain binding|sequence-specific DNA binding				0				GBM - Glioblastoma multiforme(265;0.0181)		ACCTGGACGTGCTGGGCTCCT	0.642													11	76	---	---	---	---	PASS
PSME2	5721	broad.mit.edu	37	14	24612869	24612869	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24612869C>T	uc001wmj.2	-	10	629	c.564G>A	c.(562-564)CGG>CGA	p.R188R	FAM158A_uc001wmi.2_5'Flank|PSME2_uc001wmk.2_Silent_p.R111R	NM_002818	NP_002809	Q9UL46	PSME2_HUMAN	proteasome activator subunit 2	188					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome activator complex					0				GBM - Glioblastoma multiforme(265;0.00839)		GCACCAAGGCCCGGTAATCCA	0.537													13	57	---	---	---	---	PASS
TGM1	7051	broad.mit.edu	37	14	24724340	24724340	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24724340C>A	uc001wod.2	-	12	1889	c.1765G>T	c.(1765-1767)GTG>TTG	p.V589L	TGM1_uc010tog.1_Missense_Mutation_p.V147L	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	589					cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	TGCCCCATCACCGCGTCCTGT	0.582													9	45	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29237218	29237218	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29237218C>A	uc001wqe.2	+	1	932	c.733C>A	c.(733-735)CAC>AAC	p.H245N		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	245	Fork-head.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	p.H245H(1)		ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GGTGCCGCGCCACTACGACGA	0.622													8	30	---	---	---	---	PASS
SCFD1	23256	broad.mit.edu	37	14	31099693	31099693	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31099693A>T	uc001wqm.1	+	3	167	c.143A>T	c.(142-144)TAT>TTT	p.Y48F	SCFD1_uc001wqn.1_5'UTR|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_5'UTR|SCFD1_uc010amf.1_5'UTR|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_5'UTR|SCFD1_uc010ame.1_5'UTR	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	48					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		GTACTCATTTATGACAGATTT	0.318													19	50	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735261	52735261	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735261T>C	uc001wzq.2	+	1	831	c.729T>C	c.(727-729)TGT>TGC	p.C243C		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	243	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CCAGGGACTGTGCCGAGCCGC	0.687													26	49	---	---	---	---	PASS
GPR137C	283554	broad.mit.edu	37	14	53100290	53100290	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53100290G>C	uc001wzu.3	+	5	910	c.910G>C	c.(910-912)GGA>CGA	p.G304R	GPR137C_uc001wzt.3_Missense_Mutation_p.G320R	NM_001099652	NP_001093122	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	304	Helical; (Potential).					integral to membrane					0	Breast(41;0.0716)					TATAGTATTTGGAATGGTCCT	0.388													14	24	---	---	---	---	PASS
C14orf118	55668	broad.mit.edu	37	14	76620929	76620929	+	Missense_Mutation	SNP	G	T	T	rs140112317		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76620929G>T	uc001xsh.2	+	2	309	c.223G>T	c.(223-225)GAC>TAC	p.D75Y	C14orf118_uc001xsi.2_Missense_Mutation_p.D75Y|C14orf118_uc001xsj.1_Missense_Mutation_p.D75Y|C14orf118_uc001xsk.1_Missense_Mutation_p.D75Y|C14orf118_uc001xsl.2_RNA	NM_017926	NP_060396	Q9NWQ4	CN118_HUMAN	hypothetical protein LOC55668 isoform 1	75										ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.0172)		GGCCACTAAGGACTGTCGAGA	0.532													9	51	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77327101	77327101	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77327101G>A	uc001xsx.2	+	11	1284	c.1170G>A	c.(1168-1170)CTG>CTA	p.L390L	C14orf166B_uc010asn.1_Silent_p.L150L|C14orf166B_uc001xsw.2_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	390											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		ACCCGCAGCTGGACGTGGTAT	0.532													9	40	---	---	---	---	PASS
TMEM63C	57156	broad.mit.edu	37	14	77706032	77706032	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77706032G>C	uc001xtf.2	+	12	1105	c.893G>C	c.(892-894)CGC>CCC	p.R298P	TMEM63C_uc010asq.1_Missense_Mutation_p.R298P	NM_020431	NP_065164	Q9P1W3	TM63C_HUMAN	transmembrane protein 63C	298						integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		CCCTGTGCCCGCCTGTGCTTC	0.622													2	7	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81046777	81046777	+	Intron	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81046777G>A	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TCTGTAATAAGAAAGTAAAAT	0.363													4	33	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81562988	81562988	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81562988T>A	uc001xvd.1	+	7	707	c.551T>A	c.(550-552)CTG>CAG	p.L184Q	TSHR_uc001xvb.1_Missense_Mutation_p.L184Q|TSHR_uc001xvc.2_Missense_Mutation_p.L184Q|TSHR_uc010tvs.1_Missense_Mutation_p.L184Q	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	184	Extracellular (Potential).|LRR 4.				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TGTAGGAAGCTGTACAACAAT	0.438			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						10	27	---	---	---	---	PASS
ZC3H14	79882	broad.mit.edu	37	14	89061173	89061173	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89061173G>T	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron|ZC3H14_uc001xxc.2_Nonsense_Mutation_p.E33*|ZC3H14_uc001xxb.2_Nonsense_Mutation_p.E35*	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						TTCACTGAATGAGCTAGACAA	0.383													16	60	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89105221	89105221	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89105221T>C	uc001xxg.2	-	32	4454	c.4268A>G	c.(4267-4269)GAT>GGT	p.D1423G	EML5_uc001xxf.2_Missense_Mutation_p.D210G|EML5_uc001xxh.1_Missense_Mutation_p.D554G	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1415	WD 20.					cytoplasm|microtubule				ovary(3)	3						CAGAATATCATCATTATGTTC	0.328													5	1	---	---	---	---	PASS
TTC8	123016	broad.mit.edu	37	14	89310141	89310141	+	Intron	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89310141T>C	uc010ath.2	+						TTC8_uc010atg.1_Intron|TTC8_uc001xxl.2_Intron|TTC8_uc010ati.2_Intron|TTC8_uc001xxm.2_Intron|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Intron|TTC8_uc001xxj.2_Intron|TTC8_uc001xxk.2_Intron	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B						cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						GACACTTTTTTCTTCACAGGC	0.279									Bardet-Biedl_syndrome				4	10	---	---	---	---	PASS
TTC8	123016	broad.mit.edu	37	14	89336410	89336410	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89336410A>G	uc010ath.2	+	11	1099	c.965A>G	c.(964-966)AAC>AGC	p.N322S	TTC8_uc001xxl.2_Missense_Mutation_p.N67S|TTC8_uc010ati.2_Missense_Mutation_p.N108S|TTC8_uc001xxm.2_Missense_Mutation_p.N266S|TTC8_uc010atj.2_Missense_Mutation_p.N41S|TTC8_uc001xxi.2_Missense_Mutation_p.N306S|TTC8_uc001xxj.2_Missense_Mutation_p.N296S|TTC8_uc001xxk.2_Missense_Mutation_p.N266S	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B	332	TPR 4.				cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						TAGGAAATGAACAATATGTCA	0.294									Bardet-Biedl_syndrome				11	41	---	---	---	---	PASS
GOLGA5	9950	broad.mit.edu	37	14	93273305	93273305	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93273305G>T	uc001yaz.1	+	3	951	c.769G>T	c.(769-771)GAA>TAA	p.E257*		NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5	257	Cytoplasmic (Potential).|Potential.				Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		AGAGACTCAAGAAGGTAGAGG	0.284			T	RET	papillary thyroid								9	21	---	---	---	---	PASS
SERPINA9	327657	broad.mit.edu	37	14	94935745	94935745	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94935745G>T	uc001ydf.2	-	2	648	c.487C>A	c.(487-489)CAG>AAG	p.Q163K	SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Missense_Mutation_p.Q14K|SERPINA9_uc001ydg.2_Missense_Mutation_p.Q127K|SERPINA9_uc001ydh.1_Missense_Mutation_p.Q163K|SERPINA9_uc001ydi.1_Missense_Mutation_p.Q127K	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	145					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		AAATTTGCCTGCAGCTGCAGC	0.522													12	100	---	---	---	---	PASS
SERPINA12	145264	broad.mit.edu	37	14	94964318	94964318	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94964318G>T	uc001ydj.2	-	3	1213	c.417C>A	c.(415-417)TTC>TTA	p.F139L		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	139					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		TCTGGTCAATGAACAGCGTGT	0.468													11	79	---	---	---	---	PASS
SERPINA5	5104	broad.mit.edu	37	14	95053730	95053730	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95053730C>T	uc001ydm.2	+	3	241	c.31C>T	c.(31-33)CTT>TTT	p.L11F	SERPINA5_uc010ave.2_Missense_Mutation_p.L11F|SERPINA5_uc001ydn.1_Missense_Mutation_p.L11F	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	11					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GTGCCTGGTGCTTCTCAGCCC	0.612													23	59	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95679563	95679563	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95679563T>C	uc001yef.2	-	6	717	c.601A>G	c.(601-603)ACG>GCG	p.T201A		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	201	Actin-binding.|CH 2.					integral to membrane	actin binding				0				Epithelial(152;0.193)		TACTTTCTCGTTTTCCTCTGC	0.507													13	48	---	---	---	---	PASS
TCL6	27004	broad.mit.edu	37	14	96135883	96135883	+	Intron	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96135883T>C	uc001yeq.2	+						TCL6_uc001yep.1_Intron|TCL6_uc001yes.2_3'UTR|TCL6_uc001yet.1_Intron|TCL6_uc001yeu.2_Intron|TCL6_uc001yev.2_3'UTR|TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_Intron|TCL1B_uc010avj.2_Intron|TCL6_uc010avk.1_5'Flank	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		tcctgttttctacaggttaga	0.000			T	TRA@	T-ALL								6	18	---	---	---	---	PASS
CYP46A1	10858	broad.mit.edu	37	14	100173916	100173916	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100173916G>A	uc001ygo.2	+	7	594	c.594G>A	c.(592-594)GGG>GGA	p.G198G	CYP46A1_uc001ygn.1_Silent_p.G160G|CYP46A1_uc001ygp.2_Silent_p.G45G	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46	198					bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				CAGCTTTTGGGATGGAGACCA	0.572													11	68	---	---	---	---	PASS
CDC42BPB	9578	broad.mit.edu	37	14	103416104	103416104	+	Silent	SNP	G	A	A	rs145375683		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103416104G>A	uc001ymi.1	-	26	3679	c.3447C>T	c.(3445-3447)CTC>CTT	p.L1149L	CDC42BPB_uc001ymj.1_Silent_p.L251L	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1149	PH.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ACGCAGACCTGAGATCCAAGA	0.498													18	25	---	---	---	---	PASS
GPR132	29933	broad.mit.edu	37	14	105518189	105518189	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105518189C>A	uc001yqd.2	-	4	1184	c.285G>T	c.(283-285)CTG>CTT	p.L95L	GPR132_uc001yqc.2_5'UTR|GPR132_uc001yqe.2_Silent_p.L86L	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	95	Helical; Name=2; (Potential).				response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		CCCAGAGTGGCAGCGTGCCTG	0.612													24	120	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106641665	106641665	+	RNA	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106641665G>C	uc010tyt.1	-	1021		c.24336C>G								Parts of antibodies, mostly variable regions.												0						CTCTGCCCTGGAGCTTCTGTG	0.552													33	162	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369506	22369506	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369506A>T	uc010tzu.1	+	1	931	c.931A>T	c.(931-933)AAA>TAA	p.K311*	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TATTTTGTGTAAAGAGAAGTG	0.343													3	27	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23889445	23889445	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23889445G>A	uc001ywj.3	-	1	1731	c.1636C>T	c.(1636-1638)CTC>TTC	p.L546F		NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TTTCCAAAGAGACCGTTTGTC	0.458													10	16	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24921123	24921123	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24921123C>A	uc001ywo.2	+	1	583	c.109C>A	c.(109-111)CGG>AGG	p.R37R		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	37			R -> Q (in a colorectal cancer sample; somatic mutation).		cell differentiation|multicellular organismal development|spermatogenesis			p.R37Q(1)		ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CCCGCCCGGTCGGGCTCACTC	0.711													5	13	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26806186	26806186	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26806186C>G	uc001zaz.2	-	8	1115	c.973G>C	c.(973-975)GCC>CCC	p.A325P	GABRB3_uc010uae.1_Missense_Mutation_p.A240P|GABRB3_uc001zba.2_Missense_Mutation_p.A325P|GABRB3_uc001zbb.2_Missense_Mutation_p.A381P	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	325	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TTGACAAAGGCATACTCCAGA	0.483													18	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	27890489	27890489	+	IGR	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27890489C>A								GABRG3 (112355 upstream) : OCA2 (109536 downstream)																							CAGTGTGAAGCTGATCGTTGT	0.428													33	64	---	---	---	---	PASS
GREM1	26585	broad.mit.edu	37	15	33022978	33022978	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33022978C>T	uc001zhe.1	+	2	246	c.87C>T	c.(85-87)TCC>TCT	p.S29S	GREM1_uc001zhd.1_Intron|GREM1_uc010uby.1_Silent_p.S29S	NM_013372	NP_037504	O60565	GREM1_HUMAN	gremlin-1 precursor	29					negative regulation of BMP signaling pathway|nervous system development|regulation of epithelial to mesenchymal transition	extracellular space	cytokine activity				0		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		AGAAAGGGTCCCAAGGTGCCA	0.627													10	13	---	---	---	---	PASS
GREM1	26585	broad.mit.edu	37	15	33022979	33022979	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33022979C>G	uc001zhe.1	+	2	247	c.88C>G	c.(88-90)CAA>GAA	p.Q30E	GREM1_uc001zhd.1_Intron|GREM1_uc010uby.1_Missense_Mutation_p.Q30E	NM_013372	NP_037504	O60565	GREM1_HUMAN	gremlin-1 precursor	30					negative regulation of BMP signaling pathway|nervous system development|regulation of epithelial to mesenchymal transition	extracellular space	cytokine activity				0		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		GAAAGGGTCCCAAGGTGCCAT	0.632													9	13	---	---	---	---	PASS
DUOX1	53905	broad.mit.edu	37	15	45456010	45456010	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45456010A>G	uc001zus.1	+	34	4773	c.4427A>G	c.(4426-4428)CAG>CGG	p.Q1476R	DUOX1_uc001zut.1_Missense_Mutation_p.Q1476R|DUOX1_uc010bee.1_Missense_Mutation_p.Q856R	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor	1476	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CGGCACTTCCAGAAGGTTCTG	0.562											OREG0023103	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	50	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48726794	48726794	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48726794C>T	uc001zwx.1	-	54	6941	c.6613G>A	c.(6613-6615)GAA>AAA	p.E2205K	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2205	EGF-like 37; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GATGTACCTTCACATGTCATC	0.418													17	38	---	---	---	---	PASS
SHC4	399694	broad.mit.edu	37	15	49148138	49148138	+	Intron	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49148138A>T	uc001zxb.1	-						SHC4_uc010uey.1_Intron|SHC4_uc010uez.1_Intron	NM_203349	NP_976224	Q6S5L8	SHC4_HUMAN	rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		ACAACAATAAAACATTACATA	0.403													18	34	---	---	---	---	PASS
SLC27A2	11001	broad.mit.edu	37	15	50474976	50474976	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50474976G>T	uc001zxw.2	+	1	584	c.352G>T	c.(352-354)GTG>TTG	p.V118L	SLC27A2_uc010bes.2_Missense_Mutation_p.V118L	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	118	Helical; (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		GCCGGCCTACGTGTGGCTGTG	0.667													19	78	---	---	---	---	PASS
CGNL1	84952	broad.mit.edu	37	15	57744498	57744498	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57744498G>T	uc002aeg.2	+						CGNL1_uc010bfw.2_Intron	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1							myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GTAAGTTCTGGGCTGAGAGCC	0.468													7	7	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62228845	62228845	+	Silent	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62228845A>T	uc002agz.2	-	48	5780	c.5706T>A	c.(5704-5706)ACT>ACA	p.T1902T	VPS13C_uc002aha.2_Silent_p.T1859T|VPS13C_uc002ahb.1_Silent_p.T1902T|VPS13C_uc002ahc.1_Silent_p.T1859T	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	1902					protein localization					ovary(2)	2						TCACTCTTACAGTCTCCTGCA	0.363													7	16	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63000967	63000967	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63000967G>T	uc002alb.3	+	18	2439	c.2439G>T	c.(2437-2439)GAG>GAT	p.E813D		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	813					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GTGTCACCGAGAGCATCTTCA	0.592													5	13	---	---	---	---	PASS
FEM1B	10116	broad.mit.edu	37	15	68570955	68570955	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68570955A>G	uc002arg.2	+	1	815	c.200A>G	c.(199-201)GAA>GGA	p.E67G		NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	67	ANK 1.				apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0						TTGCTCTTAGAACATTACCGG	0.602													9	21	---	---	---	---	PASS
THAP10	56906	broad.mit.edu	37	15	71184576	71184576	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71184576G>A	uc002asv.2	-	1	178	c.36C>T	c.(34-36)AAC>AAT	p.N12N	LRRC49_uc002asu.2_Intron|LRRC49_uc002asw.2_5'Flank|LRRC49_uc002asx.2_5'Flank|LRRC49_uc010ukf.1_5'Flank	NM_020147	NP_064532	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	12	THAP-type.						DNA binding|metal ion binding			ovary(1)|skin(1)	2						ACTTGGTGGTGTTGCCGCAGT	0.711													4	6	---	---	---	---	PASS
C15orf27	123591	broad.mit.edu	37	15	76430220	76430220	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76430220G>C	uc002bbq.2	+	3	366	c.211G>C	c.(211-213)GAT>CAT	p.D71H	C15orf27_uc010bkp.2_5'UTR|C15orf27_uc002bbr.2_5'UTR	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	71						integral to membrane					0						TCTGGACGAAGATTACCAAAG	0.448													14	24	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79382708	79382708	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79382708C>A	uc002beq.2	-	1	508	c.133G>T	c.(133-135)GCG>TCG	p.A45S	RASGRF1_uc002bep.2_Missense_Mutation_p.A45S|RASGRF1_uc002ber.3_Missense_Mutation_p.A45S	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	45	PH 1.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						TGCAGCAGCGCGAACCACTTG	0.647													47	63	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83936916	83936916	+	Silent	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83936916A>G	uc002bjt.1	-	2	256	c.168T>C	c.(166-168)TGT>TGC	p.C56C	BNC1_uc010uos.1_Silent_p.C44C	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	56					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TGCATTGGTCACACTGACGGT	0.448													12	28	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85383912	85383912	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85383912C>G	uc002ble.2	+	5	2175	c.2008C>G	c.(2008-2010)CAC>GAC	p.H670D		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	670					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCAGCCCACACACTCCTTGAC	0.632													15	26	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89401963	89401963	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89401963T>C	uc010upo.1	+	12	6521	c.6147T>C	c.(6145-6147)ACT>ACC	p.T2049T	ACAN_uc010upp.1_Silent_p.T2049T|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	2049					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTGAACCAACTATTTCTCAGG	0.507													4	15	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1639764	1639764	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1639764C>A	uc002cmb.2	-	7	1014	c.652G>T	c.(652-654)GAT>TAT	p.D218Y		NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	218										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				CCCTTCTCATCCACATAGTGC	0.537													27	48	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2161421	2161421	+	Silent	SNP	G	A	A	rs148021876	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2161421G>A	uc002cos.1	-	15	3956	c.3747C>T	c.(3745-3747)GAC>GAT	p.D1249D	PKD1_uc002cot.1_Silent_p.D1249D	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1249	PKD 7.|Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCACGGTGCCGTCCCCCATGT	0.706													5	21	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2806447	2806447	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2806447G>T	uc002crk.2	+	2	631	c.82G>T	c.(82-84)GGC>TGC	p.G28C	SRRM2_uc002crj.1_Intron|SRRM2_uc002crl.1_Missense_Mutation_p.G28C|SRRM2_uc010bsu.1_Intron	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	28						Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CCTGGTGCGGGGCCGCCGGGG	0.711													7	18	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3613666	3613666	+	Silent	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3613666A>T	uc010btn.2	-	5	1683	c.1272T>A	c.(1270-1272)GGT>GGA	p.G424G		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	424	NACHT.				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CGAGGTCTACACCAAACGCCT	0.587													5	17	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3900414	3900414	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3900414T>C	uc002cvv.2	-	2	886	c.682A>G	c.(682-684)ACT>GCT	p.T228A	CREBBP_uc002cvw.2_Missense_Mutation_p.T228A	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	228	Interaction with SRCAP.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ATGGCTGGAGTAGGGTACGGC	0.592			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				18	48	---	---	---	---	PASS
ANKS3	124401	broad.mit.edu	37	16	4747987	4747987	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4747987G>A	uc002cxj.1	-	15	2096	c.1801C>T	c.(1801-1803)CCC>TCC	p.P601S	ANKS3_uc010uxr.1_Missense_Mutation_p.P124S|ANKS3_uc002cxh.1_RNA|ANKS3_uc002cxi.1_Missense_Mutation_p.P528S|ANKS3_uc002cxk.2_Missense_Mutation_p.P472S|ANKS3_uc002cxl.2_Missense_Mutation_p.P428S|ANKS3_uc010uxs.1_Missense_Mutation_p.P528S	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	601											0						CCAGCTGGGGGGACGGCTAGG	0.617													3	4	---	---	---	---	PASS
SEC14L5	9717	broad.mit.edu	37	16	5046873	5046873	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5046873C>T	uc002cye.2	+	8	978	c.798C>T	c.(796-798)CAC>CAT	p.H266H		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	266						integral to membrane|intracellular	transporter activity				0						AAGATGAGCACATCCTTCGGT	0.493													4	13	---	---	---	---	PASS
ALG1	56052	broad.mit.edu	37	16	5127927	5127927	+	Missense_Mutation	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5127927A>C	uc002cym.2	+	6	690	c.649A>C	c.(649-651)AAG>CAG	p.K217Q	ALG1_uc002cyj.2_Missense_Mutation_p.K106Q|ALG1_uc002cyn.2_Missense_Mutation_p.K217Q|ALG1_uc010bue.2_Missense_Mutation_p.K106Q|ALG1_uc010uxy.1_Missense_Mutation_p.K106Q	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase	217	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)				CGTCTACGACAAGCCCGCATC	0.567													22	72	---	---	---	---	PASS
A2BP1	54715	broad.mit.edu	37	16	7568385	7568385	+	Silent	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7568385C>G	uc002cys.2	+	5	1252	c.264C>G	c.(262-264)ACC>ACG	p.T88T	A2BP1_uc010buf.1_Silent_p.T88T|A2BP1_uc002cyr.1_Silent_p.T88T|A2BP1_uc002cyt.2_Silent_p.T88T|A2BP1_uc010uxz.1_Silent_p.T131T|A2BP1_uc010uya.1_Silent_p.T124T|A2BP1_uc002cyv.1_Silent_p.T88T|A2BP1_uc010uyb.1_Silent_p.T88T|A2BP1_uc002cyw.2_Silent_p.T108T|A2BP1_uc002cyy.2_Silent_p.T108T|A2BP1_uc002cyx.2_Silent_p.T108T|A2BP1_uc010uyc.1_Silent_p.T108T	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	88					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TCTCTGGCACCGCCACAGTAA	0.652													20	77	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11145375	11145375	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11145375G>A	uc002dao.2	+	18	2102	c.1872G>A	c.(1870-1872)AAG>AAA	p.K624K	CLEC16A_uc002dan.3_Silent_p.K606K	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	624										ovary(1)|central_nervous_system(1)	2						TCTAGATGAAGCCCATGAACG	0.572													25	91	---	---	---	---	PASS
CPPED1	55313	broad.mit.edu	37	16	12758889	12758889	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12758889T>A	uc002dca.3	-	4	910	c.799A>T	c.(799-801)ATT>TTT	p.I267F	CPPED1_uc002dcb.3_Missense_Mutation_p.I125F|CPPED1_uc002dbz.3_RNA	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	267							hydrolase activity|metal ion binding				0						TGGCATCCAATGGCAGATGAC	0.557													3	55	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14327998	14327998	+	Intron	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14327998A>T	uc010uza.1	+						MKL2_uc002dcg.2_Intron|MKL2_uc002dch.2_Intron|MKL2_uc010uzb.1_Intron	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						TGCCTTTTCCACCAGTTTGCT	0.438													20	91	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20331035	20331035	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20331035A>G	uc002dgv.2	-	7	1006	c.923T>C	c.(922-924)ATC>ACC	p.I308T	GP2_uc002dgw.2_Missense_Mutation_p.I305T|GP2_uc002dgx.2_Missense_Mutation_p.I161T|GP2_uc002dgy.2_Missense_Mutation_p.I158T	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	308	ZP.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						GTCTCTGATGATGAAATCATT	0.433													48	135	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20451701	20451701	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20451701T>A	uc002dhe.2	+	14	1839	c.1692T>A	c.(1690-1692)TCT>TCA	p.S564S		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	564					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						AGACGGTTTCTGGAAAGATCC	0.438													9	30	---	---	---	---	PASS
USP31	57478	broad.mit.edu	37	16	23079561	23079561	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23079561C>A	uc002dll.2	-	16	3865	c.3865G>T	c.(3865-3867)GGA>TGA	p.G1289*	USP31_uc002dlk.2_Nonsense_Mutation_p.G561*|USP31_uc010vca.1_Nonsense_Mutation_p.G592*|USP31_uc010bxm.2_Nonsense_Mutation_p.G577*	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	1289					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		TGCTCTTTTCCCGTTGTATTT	0.547													50	198	---	---	---	---	PASS
C16orf82	162083	broad.mit.edu	37	16	27078255	27078255	+	5'UTR	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27078255G>C	uc010vcm.1	+	1						NM_001145545	NP_001139017	Q7Z2V1	TNT_HUMAN	hypothetical protein LOC162083												0						CTTATATACGGAGTCACCTCT	0.572													9	29	---	---	---	---	PASS
PRRT2	112476	broad.mit.edu	37	16	29824892	29824892	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29824892G>T	uc002due.3	+	2	818	c.517G>T	c.(517-519)GAG>TAG	p.E173*	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|uc002duc.1_5'Flank|PRRT2_uc002dud.2_Nonsense_Mutation_p.E173*|PRRT2_uc002duf.1_Nonsense_Mutation_p.E173*|C16orf53_uc002dug.3_5'Flank	NM_145239	NP_660282	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	173	Extracellular (Potential).|Pro-rich.				response to biotic stimulus	integral to membrane					0						GATTCTGTCTGAGAGTGTAGG	0.627													14	27	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31374500	31374500	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31374500G>T	uc002ebu.1	+	14	1582	c.1515G>T	c.(1513-1515)TGG>TGT	p.W505C	ITGAX_uc002ebt.2_Missense_Mutation_p.W505C|ITGAX_uc010vfk.1_Missense_Mutation_p.W155C	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	505	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAAGGTGGTGGTGTGATGCTG	0.637													23	73	---	---	---	---	PASS
MIR1826	100302162	broad.mit.edu	37	16	33965529	33965529	+	RNA	SNP	C	A	A	rs437324	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33965529C>A	hsa-mir-1826|MI0008194	+			c.22C>A																				0						ACACTTCGAACGCAATTGCAG	0.572													8	19	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49670792	49670792	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49670792C>A	uc002efs.2	-	5	2569	c.2271G>T	c.(2269-2271)TGG>TGT	p.W757C	ZNF423_uc010vgn.1_Missense_Mutation_p.W640C	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	757	C2H2-type 18.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGCGGAAGTCCCAGTTGCAGG	0.587													9	29	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49671126	49671126	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49671126C>A	uc002efs.2	-	5	2235	c.1937G>T	c.(1936-1938)AGC>ATC	p.S646I	ZNF423_uc010vgn.1_Missense_Mutation_p.S529I	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	646	C2H2-type 14.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GGTCTGGAAGCTCTCAAAGTT	0.582													13	23	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50347964	50347964	+	Silent	SNP	C	T	T	rs149953515	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50347964C>T	uc002egd.1	+	22	3115	c.2847C>T	c.(2845-2847)CAC>CAT	p.H949H		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	949	Cytoplasmic (Potential).|Guanylate cyclase 2.				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	CCTCAGGGCACGAGAACCAGG	0.552													7	28	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51174144	51174144	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51174144C>A	uc010vgs.1	-	2	2020	c.1989G>T	c.(1987-1989)TTG>TTT	p.L663F	SALL1_uc010vgr.1_Missense_Mutation_p.L566F|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	663					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ACATGAGCGGCAACAAAGGGT	0.602													22	44	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51175307	51175307	+	Nonsense_Mutation	SNP	G	A	A	rs104894537		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175307G>A	uc010vgs.1	-	2	857	c.826C>T	c.(826-828)CGA>TGA	p.R276*	SALL1_uc010vgr.1_Nonsense_Mutation_p.R179*|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	276					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GCAGATGTTCGTAAAGTACCT	0.502													23	78	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52480035	52480035	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52480035C>A	uc002egw.2	-	5	948	c.777G>T	c.(775-777)GTG>GTT	p.V259V	TOX3_uc010vgt.1_Silent_p.V254V|TOX3_uc010vgu.1_Silent_p.V259V	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	259	HMG box.				apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						CATATGCTGACACTGGCTTCT	0.448													12	59	---	---	---	---	PASS
IRX5	10265	broad.mit.edu	37	16	54967505	54967505	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54967505C>T	uc002ehv.2	+	3	1172	c.1172C>T	c.(1171-1173)CCT>CTT	p.P391L	IRX5_uc002ehw.2_Missense_Mutation_p.P325L	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	391					response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding				0						GCGCAGTGTCCTTTTCCAGGC	0.697													4	21	---	---	---	---	PASS
BBS2	583	broad.mit.edu	37	16	56535369	56535369	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56535369C>T	uc002ejd.2	-	10	1355	c.1121G>A	c.(1120-1122)CGG>CAG	p.R374Q	BBS2_uc010ccg.2_3'UTR	NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2 protein	374					adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1						GATTATGCCCCGATGCCCATC	0.498									Bardet-Biedl_syndrome				21	67	---	---	---	---	PASS
GPR56	9289	broad.mit.edu	37	16	57695777	57695777	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57695777G>T	uc002emb.2	+	14	2143	c.1851G>T	c.(1849-1851)CTG>CTT	p.L617L	GPR56_uc002ema.1_Silent_p.L442L|GPR56_uc002emc.2_Silent_p.L611L|GPR56_uc002emf.2_Silent_p.L611L|GPR56_uc010vhs.1_Silent_p.L617L|GPR56_uc002emd.2_Silent_p.L611L|GPR56_uc002eme.2_Silent_p.L611L|GPR56_uc010vht.1_Silent_p.L616L|GPR56_uc002emg.3_Silent_p.L611L|GPR56_uc010vhu.1_Silent_p.L436L	NM_005682	NP_005673	Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56 isoform a	617	Helical; Name=6; (Potential).				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity				0						GCCTCAGCCTGGTCCTTGGCC	0.577													16	39	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57732937	57732937	+	Splice_Site	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57732937G>T	uc002emi.2	+	3	467	c.378_splice	c.e3+1	p.P126_splice	CCDC135_uc002emj.2_Splice_Site_p.P126_splice|CCDC135_uc002emk.2_Splice_Site_p.P126_splice	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						TGAAGTGCCCGTAAGGCTGGC	0.642													26	95	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61891022	61891022	+	Splice_Site	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61891022C>G	uc002eog.1	-	4	919	c.667_splice	c.e4+1	p.A223_splice	CDH8_uc002eoh.2_Intron	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AGGCCACAAACCTGTTTCAGG	0.388													15	51	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64982512	64982512	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64982512C>T	uc002eoi.2	-						CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Silent_p.T691T|CDH11_uc010vin.1_Intron	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GAAGTCTTACCGTAAGTGTGG	0.428			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			8	27	---	---	---	---	PASS
SLC38A8	146167	broad.mit.edu	37	16	84075715	84075715	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84075715G>A	uc002fhg.1	-	1	48	c.48C>T	c.(46-48)CAC>CAT	p.H16H		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	16					amino acid transport|sodium ion transport	integral to membrane					0						CCGTGGCAGGGTGAGGCTTTT	0.622													7	61	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3667152	3667152	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3667152G>T	uc002fwo.3	-							NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CTGGAGTTGGGGCTGACTTAC	0.562													12	21	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5041503	5041503	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5041503T>A	uc002gau.1	+	21	3243	c.1013T>A	c.(1012-1014)GTG>GAG	p.V338E	USP6_uc002gav.1_Missense_Mutation_p.V338E|USP6_uc010ckz.1_5'UTR|uc002gbd.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	338					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						GATGACACCGTGCTCAAGCAT	0.582			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								31	69	---	---	---	---	PASS
DLG4	1742	broad.mit.edu	37	17	7097029	7097029	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7097029T>A	uc002get.3	-	17	2878	c.1677A>T	c.(1675-1677)CGA>CGT	p.R559R	DLG4_uc010vtm.1_RNA|DLG4_uc010vtn.1_Silent_p.R456R|DLG4_uc010cly.2_Silent_p.R513R|DLG4_uc010vto.1_Silent_p.R556R	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	516					axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						CCGAGTCTTCTCGACCTGGTG	0.617													4	9	---	---	---	---	PASS
ATP1B2	482	broad.mit.edu	37	17	7556735	7556735	+	Silent	SNP	C	G	G	rs141966039		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7556735C>G	uc002gif.1	+	2	739	c.156C>G	c.(154-156)ACC>ACG	p.T52T		NM_001678	NP_001669	P14415	AT1B2_HUMAN	Na+/K+ -ATPase beta 2 subunit	52	Helical; Signal-anchor for type II membrane protein; (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	p.0?(2)|p.?(1)		central_nervous_system(1)|pancreas(1)	2		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)		GGTTCCTCACCGCCATGTTCA	0.562													31	63	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	A	A	rs28934576	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577120C>A	uc002gim.2	-	8	1012	c.818G>T	c.(817-819)CGT>CTT	p.R273L	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141L|TP53_uc010cng.1_Missense_Mutation_p.R141L|TP53_uc002gii.1_Missense_Mutation_p.R141L|TP53_uc010cnh.1_Missense_Mutation_p.R273L|TP53_uc010cni.1_Missense_Mutation_p.R273L|TP53_uc002gij.2_Missense_Mutation_p.R273L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			7	17	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10353910	10353910	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10353910C>T	uc002gmn.2	-	30	4152	c.4041G>A	c.(4039-4041)CTG>CTA	p.L1347L	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1347	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						ACTGTTCCCGCAGCAGGTCAC	0.542													17	42	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11583238	11583238	+	Missense_Mutation	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11583238T>C	uc002gne.2	+	18	3586	c.3518T>C	c.(3517-3519)ATT>ACT	p.I1173T	DNAH9_uc010coo.2_Missense_Mutation_p.I467T	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1173	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAGCAGACTATTGAATTGCTG	0.408													10	53	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11726142	11726142	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11726142A>T	uc002gne.2	+	48	9105	c.9037A>T	c.(9037-9039)AAA>TAA	p.K3013*	DNAH9_uc010coo.2_Nonsense_Mutation_p.K2307*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3013	AAA 4 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTCGATTAGCAAATTCATGGC	0.443													30	45	---	---	---	---	PASS
MAP2K3	5606	broad.mit.edu	37	17	21205556	21205556	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21205556G>A	uc002gys.2	+	6	766	c.501G>A	c.(499-501)GGG>GGA	p.G167G	MAP2K3_uc002gyt.2_Silent_p.G138G|MAP2K3_uc002gyu.2_Silent_p.G138G	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	167	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ACATCCTTGGGGAGATTGCTG	0.572													6	31	---	---	---	---	PASS
FLJ40504	284085	broad.mit.edu	37	17	26603915	26603915	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26603915A>T	uc002has.3	-	3	656	c.560T>A	c.(559-561)CTG>CAG	p.L187Q		NM_173624	NP_775895			SubName: Full=Putative uncharacterized protein FLJ40504; SubName: Full=cDNA FLJ40504 fis, clone TESTI2045509, highly similar to KERATIN, TYPE I CYTOSKELETAL 18;												0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		GTCGATCTGCAGAACAATGTG	0.522													14	43	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27939299	27939299	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27939299C>T	uc002hei.2	+						ANKRD13B_uc002heh.2_Intron|ANKRD13B_uc002hej.2_Intron|ANKRD13B_uc002hek.2_5'Flank	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B												0						TTGGTGAGACCGCACGGCCAT	0.622													12	38	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29195408	29195408	+	Silent	SNP	A	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29195408A>C	uc002hfs.1	+	12	3637	c.3291A>C	c.(3289-3291)GGA>GGC	p.G1097G	ATAD5_uc002hft.1_Silent_p.G994G	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1097					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				ATCTGAAGGGAAAAAGAGATG	0.299													14	21	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520778	33520778	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520778C>A	uc002hjd.2	-	1	635	c.549G>T	c.(547-549)GGG>GGT	p.G183G		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	183						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		CACCCGTGGTCCCCTCCTGTA	0.592													23	91	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36499258	36499258	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36499258C>A	uc002hpz.2	-	1	436	c.415G>T	c.(415-417)GAG>TAG	p.E139*		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	139	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GGGTCCCCCTCGGCCACGCTG	0.617													12	62	---	---	---	---	PASS
RPL23	9349	broad.mit.edu	37	17	37009248	37009248	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37009248G>T	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_Intron|SNORA21_uc002hqz.1_RNA	NM_000978	NP_000969	P62829	RL23_HUMAN	ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						TTAAAAGGGGGAGTATAGCAA	0.488													11	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39502362	39502362	+	IGR	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39502362G>A								KRTAP17-1 (30415 upstream) : KRT33A (9 downstream)																							CCTCCTGGTTGTGGGGCCTCT	0.512													16	50	---	---	---	---	PASS
KRT37	8688	broad.mit.edu	37	17	39579038	39579038	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39579038G>C	uc002hwp.1	-	3	771	c.724C>G	c.(724-726)CAC>GAC	p.H242D	uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	242	Rod.|Coil 1B.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				ACCTGCTCGTGGTTGCTCTTG	0.687													4	17	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40642586	40642586	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40642586A>T	uc002hzr.2	+	11	1272	c.1105A>T	c.(1105-1107)AAG>TAG	p.K369*	ATP6V0A1_uc002hzq.2_Nonsense_Mutation_p.K369*|ATP6V0A1_uc002hzs.2_Nonsense_Mutation_p.K376*|ATP6V0A1_uc010wgj.1_Nonsense_Mutation_p.K326*|ATP6V0A1_uc010wgk.1_Nonsense_Mutation_p.K326*|ATP6V0A1_uc010cyg.2_Nonsense_Mutation_p.K15*|ATP6V0A1_uc010wgl.1_Nonsense_Mutation_p.K228*	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	369	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CAAAACCAACAAGTTTACCTA	0.383													28	105	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41215391	41215391	+	Splice_Site	SNP	C	T	T	rs80358137		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41215391C>T	uc002icq.2	-	18	5385	c.5153_splice	c.e18-1	p.W1718_splice	BRCA1_uc010whp.1_Splice_Site_p.W567_splice|BRCA1_uc010whl.1_Splice_Site_p.W614_splice|BRCA1_uc010whm.1_Splice_Site_p.W28_splice|BRCA1_uc002icp.3_Splice_Site_p.W1647_splice|BRCA1_uc002icu.2_Splice_Site_p.W614_splice|BRCA1_uc010cyx.2_Splice_Site_p.W1671_splice|BRCA1_uc002ict.2_Splice_Site_p.W1739_splice|BRCA1_uc010whn.1_Splice_Site_p.W209_splice|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGGGTCACCCCTAAAGAGATC	0.368			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			10	18	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42475947	42475947	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42475947C>A	uc002igw.1	-	8	3562	c.3498G>T	c.(3496-3498)TTG>TTT	p.L1166F	GPATCH8_uc002igv.1_Missense_Mutation_p.L1088F|GPATCH8_uc010wiz.1_Missense_Mutation_p.L1088F	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1166						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CCCCCCTTTCCAAGCCAGACT	0.537													44	124	---	---	---	---	PASS
MYCBPAP	84073	broad.mit.edu	37	17	48596332	48596332	+	Intron	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48596332T>C	uc010wmr.1	+						MYCBPAP_uc002iqx.2_Intron|MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CCTCTCTCTCTAGAACACCTA	0.572													12	16	---	---	---	---	PASS
SPATA20	64847	broad.mit.edu	37	17	48629453	48629453	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48629453G>T	uc002irf.2	+	13	1962	c.1821G>T	c.(1819-1821)CAG>CAT	p.Q607H	SPATA20_uc002irc.2_Missense_Mutation_p.Q274H|SPATA20_uc002ire.2_Missense_Mutation_p.Q563H|SPATA20_uc002ird.2_Missense_Mutation_p.Q623H|SPATA20_uc002irg.2_RNA	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	607					cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGGACACACAGGACAAGCTCT	0.652													5	30	---	---	---	---	PASS
SPATA20	64847	broad.mit.edu	37	17	48629454	48629454	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48629454G>T	uc002irf.2	+	13	1963	c.1822G>T	c.(1822-1824)GAC>TAC	p.D608Y	SPATA20_uc002irc.2_Missense_Mutation_p.D275Y|SPATA20_uc002ire.2_Missense_Mutation_p.D564Y|SPATA20_uc002ird.2_Missense_Mutation_p.D624Y|SPATA20_uc002irg.2_RNA	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	608					cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GGACACACAGGACAAGCTCTT	0.657													5	31	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901800	51901800	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901800C>A	uc002iua.2	+	1	1562	c.1406C>A	c.(1405-1407)GCA>GAA	p.A469E	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	469	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CTGGAAGGGGCAGAGATTAAC	0.498													10	30	---	---	---	---	PASS
OR4D2	124538	broad.mit.edu	37	17	56247027	56247027	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56247027G>A	uc010wnp.1	+	1	11	c.11G>A	c.(10-12)GGG>GAG	p.G4E		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						ATGGAAACAGGGAACCTCACG	0.488													25	96	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56349029	56349029	+	Missense_Mutation	SNP	G	A	A	rs145497027		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56349029G>A	uc002ivu.1	-	11	2194	c.2017C>T	c.(2017-2019)CGG>TGG	p.R673W		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	673					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	TCACCATCCCGGAGCTTCCTG	0.637													8	30	---	---	---	---	PASS
CSHL1	1444	broad.mit.edu	37	17	61987690	61987690	+	Intron	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61987690C>T	uc002jda.1	-						CSHL1_uc002jcz.1_Intron|CSHL1_uc002jdb.1_Intron|CSHL1_uc002jdc.1_Intron|CSHL1_uc002jdd.1_Intron|CSHL1_uc002jde.2_Intron|CSHL1_uc002jdf.2_Intron|CSHL1_uc002jdg.2_Intron|CSHL1_uc002jdh.2_Intron	NM_022579	NP_072101	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1							extracellular region	hormone activity|metal ion binding				0						CTAAGTTCTGCAGGGGAAGGA	0.622													15	45	---	---	---	---	PASS
CSHL1	1444	broad.mit.edu	37	17	61987801	61987801	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61987801C>A	uc002jda.1	-	3	347	c.285G>T	c.(283-285)ATG>ATT	p.M95I	CSHL1_uc002jcz.1_Missense_Mutation_p.M72I|CSHL1_uc002jdb.1_Missense_Mutation_p.M1I|CSHL1_uc002jdc.1_Missense_Mutation_p.M12I|CSHL1_uc002jdd.1_Missense_Mutation_p.M33I|CSHL1_uc002jde.2_Missense_Mutation_p.W193L|CSHL1_uc002jdf.2_Missense_Mutation_p.M12I|CSHL1_uc002jdg.2_Missense_Mutation_p.W165L|CSHL1_uc002jdh.2_Missense_Mutation_p.M1I	NM_022579	NP_072101	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	95						extracellular region	hormone activity|metal ion binding				0						GCGTTTCCTCCATGTTGGAGG	0.557													34	86	---	---	---	---	PASS
GH1	2688	broad.mit.edu	37	17	61995183	61995183	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61995183G>A	uc002jdj.2	-	4	455	c.393C>T	c.(391-393)GCC>GCT	p.A131A	GH1_uc002jdi.2_Silent_p.A116A|GH1_uc002jdk.2_Silent_p.A91A|GH1_uc002jdl.2_Intron|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Intron	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	131					glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						TGCTGTCAGAGGCGCCGTACA	0.617													20	50	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62049162	62049162	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62049162C>A	uc002jds.1	-	4	608	c.531G>T	c.(529-531)CTG>CTT	p.L177L		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	177	Helical; Name=S2 of repeat I; (Potential).|I.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AGCCTCGGGCCAGTATCTTGA	0.612													7	14	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63185418	63185418	+	Silent	SNP	T	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63185418T>C	uc002jfe.2	+	10	779	c.669T>C	c.(667-669)GTT>GTC	p.V223V	RGS9_uc010dem.2_Silent_p.V220V|RGS9_uc002jfd.2_Silent_p.V220V|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_5'UTR	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	223	G protein gamma.				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						AAACAGTCGTTGCTGTCAAAA	0.348													11	52	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67008107	67008107	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67008107C>A	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					AAGACTTTAACTCTTCTTACT	0.388													9	41	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74391933	74391933	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74391933G>A	uc002jrm.3	-	15	2884	c.2819C>T	c.(2818-2820)TCT>TTT	p.S940F	UBE2O_uc002jrn.3_3'UTR|UBE2O_uc002jrl.3_Missense_Mutation_p.S544F	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	940							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						TTTCTTAAAAGAATGATTTGC	0.542													36	48	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77073871	77073871	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77073871G>T	uc002jwv.2	+	3	349	c.341G>T	c.(340-342)CGC>CTC	p.R114L	ENGASE_uc002jwu.1_Missense_Mutation_p.R114L|ENGASE_uc010wtz.1_5'UTR|ENGASE_uc002jww.2_5'Flank	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	114						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						CTGGCGTGTCGCCAGCCCCCT	0.582													16	42	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77079880	77079880	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77079880A>T	uc002jwv.2	+	10	1297	c.1289A>T	c.(1288-1290)CAG>CTG	p.Q430L	ENGASE_uc002jww.2_Missense_Mutation_p.Q136L	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	430						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						CTGAGCGCCCAGGAGATCCAG	0.662													19	64	---	---	---	---	PASS
CABYR	26256	broad.mit.edu	37	18	21739691	21739691	+	3'UTR	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21739691A>G	uc002kux.2	+	5					CABYR_uc010xbb.1_3'UTR|CABYR_uc002kuy.2_Missense_Mutation_p.N266S|CABYR_uc002kuz.2_Intron|CABYR_uc002kva.2_3'UTR|CABYR_uc002kvb.2_Missense_Mutation_p.N168S|CABYR_uc002kvc.2_Missense_Mutation_p.N266S|CABYR_uc010dlw.2_Intron	NM_012189	NP_036321	O75952	CABYR_HUMAN	calcium-binding tyrosine						ciliary or flagellar motility|signal transduction|sperm capacitation	cytoplasm|cytoskeleton|flagellum|motile cilium|nucleus	calcium ion binding|cAMP-dependent protein kinase regulator activity|enzyme binding|protein heterodimerization activity|SH3 domain binding				0	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					GTAGGCTCAAATGTTCAGGAA	0.468													6	75	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25585835	25585835	+	Silent	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25585835T>A	uc002kwg.2	-	6	1284	c.825A>T	c.(823-825)ACA>ACT	p.T275T	CDH2_uc010xbn.1_Silent_p.T244T	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	275	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						CCTCAGGAACTGTCCCATTCC	0.388													54	87	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28923448	28923448	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28923448G>A	uc002kwp.2	+	12	1935	c.1723G>A	c.(1723-1725)GGT>AGT	p.G575S	DSG1_uc010xbp.1_5'Flank	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	575	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TGATTGTGGAGGTGCTCCTCG	0.478													17	94	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31324241	31324241	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31324241C>T	uc010dmg.1	+	12	4484	c.4429C>T	c.(4429-4431)CAC>TAC	p.H1477Y	ASXL3_uc002kxq.2_Missense_Mutation_p.H1184Y	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1477					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						CATCGTTGACCACAGCACCAC	0.532											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	34	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33722805	33722805	+	Silent	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33722805A>T	uc002kzk.1	+	8	682	c.672A>T	c.(670-672)CTA>CTT	p.L224L	ELP2_uc010xcg.1_Silent_p.L289L|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Silent_p.L198L|ELP2_uc010xch.1_Silent_p.L263L|ELP2_uc002kzn.1_Silent_p.L198L|ELP2_uc002kzo.1_Silent_p.L154L	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	224	WD 5.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						ATCTTTTCCTAGCAAGCTGTT	0.264													7	33	---	---	---	---	PASS
FHOD3	80206	broad.mit.edu	37	18	34322742	34322742	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34322742C>A	uc002kzt.1	+	18	3323	c.3226C>A	c.(3226-3228)CAG>AAG	p.Q1076K	FHOD3_uc002kzs.1_Missense_Mutation_p.Q1093K|FHOD3_uc010dmz.1_Missense_Mutation_p.Q808K|FHOD3_uc010dnb.1_Missense_Mutation_p.Q72K	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1076	FH2.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGGAATAGACCAGTTGGAGAA	0.388													31	142	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42530417	42530417	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42530417G>A	uc010dni.2	+	4	1408	c.1112G>A	c.(1111-1113)GGT>GAT	p.G371D		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	371						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAAAGGGAAGGTTATTCCGCA	0.453									Schinzel-Giedion_syndrome				5	38	---	---	---	---	PASS
PSTPIP2	9050	broad.mit.edu	37	18	43577752	43577752	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43577752C>A	uc002lbp.3	-	9	701	c.605G>T	c.(604-606)CGA>CTA	p.R202L	PSTPIP2_uc002lbq.3_Missense_Mutation_p.R202L	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting	202						membrane				ovary(1)	1						CCACTCTTCTCGGACCTTATC	0.567													7	31	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44560078	44560078	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44560078G>T	uc002lcr.1	-	1	1911	c.1558C>A	c.(1558-1560)CCT>ACT	p.P520T	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	520	Activation domain (By similarity).				regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						TGGCAGGCAGGCCTGGAGCCC	0.617													14	65	---	---	---	---	PASS
FECH	2235	broad.mit.edu	37	18	55221491	55221491	+	Splice_Site	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55221491C>A	uc002lgq.3	-	9	1194	c.1077_splice	c.e9+1	p.E359_splice	FECH_uc002lgp.3_Splice_Site_p.E365_splice|FECH_uc002lgr.3_Splice_Site_p.E217_splice	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor						generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				GGTGCATTTACCTCCTTGGCT	0.373													27	121	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59854895	59854895	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59854895G>T	uc002lil.2	+	1	372	c.157G>T	c.(157-159)GGC>TGC	p.G53C	PIGN_uc002lii.3_5'Flank|PIGN_uc002lij.3_5'Flank|KIAA1468_uc002lik.1_Missense_Mutation_p.G53C|KIAA1468_uc010xel.1_Missense_Mutation_p.G53C	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	53							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TGGCTCTGCGGGCTCGCTGTC	0.687													9	40	---	---	---	---	PASS
TNFRSF11A	8792	broad.mit.edu	37	18	60028957	60028957	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60028957G>A	uc002lin.2	+	7	699	c.661G>A	c.(661-663)GCG>ACG	p.A221T	TNFRSF11A_uc010dpv.2_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	221	Helical; (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				GCTTCTCTTCGCGTCTGTGGC	0.413									Paget_Disease_of_Bone				31	159	---	---	---	---	PASS
PHLPP1	23239	broad.mit.edu	37	18	60609017	60609017	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60609017G>C	uc002lis.2	+	12	1669	c.1491G>C	c.(1489-1491)GAG>GAC	p.E497D		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	1009					apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						TTTCCGAAGAGACAAACAGTA	0.448													5	16	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61306466	61306466	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61306466G>A	uc002ljf.2	-	7	807	c.721C>T	c.(721-723)CTA>TTA	p.L241L	SERPINB4_uc002lje.2_Silent_p.L220L|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	241					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						ATCATGCTTAGATCTTTGCCT	0.423													4	69	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61310792	61310792	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61310792G>C	uc002ljf.2	-	2	106	c.20C>G	c.(19-21)GCC>GGC	p.A7G	SERPINB4_uc002lje.2_Missense_Mutation_p.A7G|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	7					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						CTTGGTGTTGGCTTCACTGAG	0.393													22	107	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76754395	76754395	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76754395G>A	uc002lmt.2	+	2	2404	c.2404G>A	c.(2404-2406)GAG>AAG	p.E802K	SALL3_uc010dra.2_Missense_Mutation_p.E409K	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	802				DDDMDE -> NDNLDK (in Ref. 2; CAB65124).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGACATGGACGAGAACTCCAT	0.677													4	13	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76754397	76754397	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76754397G>A	uc002lmt.2	+	2	2406	c.2406G>A	c.(2404-2406)GAG>GAA	p.E802E	SALL3_uc010dra.2_Silent_p.E409E	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	802				DDDMDE -> NDNLDK (in Ref. 2; CAB65124).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ACATGGACGAGAACTCCATGG	0.682													4	12	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76755125	76755125	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76755125C>A	uc002lmt.2	+	2	3134	c.3134C>A	c.(3133-3135)CCC>CAC	p.P1045H	SALL3_uc010dra.2_Missense_Mutation_p.P580H	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1045					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCTCTAGGTCCCAGCCAAAGC	0.537													5	36	---	---	---	---	PASS
FAM108A1	81926	broad.mit.edu	37	19	1881263	1881263	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1881263G>A	uc002lug.2	-	2	709	c.303C>T	c.(301-303)TGC>TGT	p.C101C	FAM108A1_uc002lud.2_Silent_p.C101C|FAM108A1_uc002lue.2_Silent_p.C101C|FAM108A1_uc002luf.2_Silent_p.C101C	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2	101						extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACATACATGCAGGAGACGC	0.662													5	31	---	---	---	---	PASS
THOP1	7064	broad.mit.edu	37	19	2799758	2799758	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2799758G>C	uc002lwj.2	+	5	713	c.558G>C	c.(556-558)ACG>ACC	p.T186T	THOP1_uc010xgz.1_Silent_p.T65T	NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1	186					proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGAGGACACGACCTTCCTGC	0.612													3	33	---	---	---	---	PASS
ZNRF4	148066	broad.mit.edu	37	19	5456269	5456269	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5456269G>C	uc002mca.3	+	1	844	c.767G>C	c.(766-768)TGG>TCG	p.W256S		NM_181710	NP_859061	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4 precursor	256	Helical; (Potential).					integral to membrane	zinc ion binding			large_intestine(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		ACCGTGTCCTGGGTGCTGGGC	0.682													10	23	---	---	---	---	PASS
ZNF121	7675	broad.mit.edu	37	19	9677404	9677404	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9677404T>A	uc010xkp.1	-	4	617	c.385A>T	c.(385-387)ACA>TCA	p.T129S	ZNF121_uc010dwt.2_Missense_Mutation_p.T129S|ZNF121_uc010xkq.1_Missense_Mutation_p.T129S	NM_001008727	NP_001008727	P58317	ZN121_HUMAN	zinc finger protein 121	129	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GCATGGCTTGTGGAGTAAGTA	0.368													10	27	---	---	---	---	PASS
KANK2	25959	broad.mit.edu	37	19	11289130	11289130	+	Intron	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11289130G>C	uc010dxv.2	-						KANK2_uc002mqm.2_Missense_Mutation_p.P479A|KANK2_uc002mqo.3_Intron|KANK2_uc002mqp.1_Intron	NM_015493	NP_056308	Q63ZY3	KANK2_HUMAN	ankyrin repeat domain 25 isoform 1												0						CCGCCTGGAGGGGAGGACAGC	0.677													7	12	---	---	---	---	PASS
ZNF763	284390	broad.mit.edu	37	19	12089327	12089327	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12089327G>T	uc002msw.2	+	4	743	c.588G>T	c.(586-588)GGG>GGT	p.G196G	ZNF763_uc010xmf.1_Silent_p.G216G|ZNF763_uc002msv.2_Silent_p.G199G|ZNF763_uc010xmg.1_Silent_p.G74G	NM_001012753	NP_001012771	Q0D2J5	ZN763_HUMAN	zinc finger protein 763	196					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						TGCACAGTGGGGATGGACCTT	0.403													64	58	---	---	---	---	PASS
SYCE2	256126	broad.mit.edu	37	19	13011312	13011312	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13011312C>T	uc002mvr.2	-	4	472	c.457G>A	c.(457-459)GTG>ATG	p.V153M		NM_001105578	NP_001099048	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	153					cell division	central element					0						ACAGTCTCCACGCTGTGGCAG	0.527													11	48	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15574963	15574963	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15574963C>A	uc002nbe.2	-	2	293	c.207G>T	c.(205-207)CGG>CGT	p.R69R		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	69					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CAGATAGGACCCGACGGAATA	0.682													24	10	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839146	15839146	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839146C>A	uc002nbm.2	+	1	313	c.293C>A	c.(292-294)GCC>GAC	p.A98D		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CTGGCCTGTGCCAGTCAGATG	0.632													27	33	---	---	---	---	PASS
ABHD8	79575	broad.mit.edu	37	19	17405196	17405196	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17405196G>A	uc002ngb.3	-	4	1290	c.1050C>T	c.(1048-1050)GGC>GGT	p.G350G		NM_024527	NP_078803	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	350							hydrolase activity				0						AGACCTCGTCGCCCTCGGGCC	0.612													9	108	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21240824	21240824	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21240824G>A	uc002npj.2	+	5	1820	c.1710G>A	c.(1708-1710)ATG>ATA	p.M570I	ZNF430_uc002npk.2_Missense_Mutation_p.M569I	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	570					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						CCCTACAAATGTGAAGATTGT	0.393													15	16	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22574527	22574527	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22574527G>T	uc002nqt.2	-	4	1632	c.1510C>A	c.(1510-1512)CAC>AAC	p.H504N		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	504	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GTAGTAAGGTGTGAGGACTGG	0.383													94	37	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22952052	22952052	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22952052C>T	uc010xrh.1	-	2	141	c.141G>A	c.(139-141)CAG>CAA	p.Q47Q		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TATATAAATTCTGCTGAGCCA	0.383													80	39	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039578	31039578	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039578C>G	uc002nsu.1	+	4	3190	c.3052C>G	c.(3052-3054)CTT>GTT	p.L1018V	ZNF536_uc010edd.1_Missense_Mutation_p.L1018V	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1018					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GCTCATGGCCCTTCATCTCCA	0.572													56	18	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33587209	33587209	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33587209G>T	uc002nug.1	+	7	1023	c.709G>T	c.(709-711)GCT>TCT	p.A237S		NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	237						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					GCATGGTCTAGCTTACAAGGG	0.463													117	78	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37905157	37905157	+	Missense_Mutation	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37905157T>G	uc002ogi.2	-	6	961	c.403A>C	c.(403-405)AAT>CAT	p.N135H	ZNF569_uc002ogh.2_5'UTR|ZNF569_uc002ogj.2_Missense_Mutation_p.N159H	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCATAGAGATTGTGTCTGGAA	0.313													56	47	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38912755	38912755	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38912755C>A	uc002oir.2	-	2	276	c.62G>T	c.(61-63)CGA>CTA	p.R21L	RASGRP4_uc010efz.1_5'Flank|RASGRP4_uc010ega.1_5'Flank|RASGRP4_uc010xua.1_Missense_Mutation_p.R21L|RASGRP4_uc010xub.1_Missense_Mutation_p.R21L|RASGRP4_uc010xuc.1_Missense_Mutation_p.R21L|RASGRP4_uc010xud.1_Missense_Mutation_p.R21L|RASGRP4_uc010xue.1_Missense_Mutation_p.R21L|RASGRP4_uc010egb.2_Missense_Mutation_p.R21L	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	21					activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGCCGGCCTCGCCCTCCTAT	0.617													22	15	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39019676	39019676	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39019676G>T	uc002oit.2	+	76	11250	c.11120G>T	c.(11119-11121)CGC>CTC	p.R3707L	RYR1_uc002oiu.2_Missense_Mutation_p.R3702L|RYR1_uc002oiv.1_Missense_Mutation_p.R622L|RYR1_uc010xuf.1_Missense_Mutation_p.R627L	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3707					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CACTTCAGCCGCACTGCCCTG	0.522													9	13	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41354554	41354554	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41354554G>A	uc002opl.3	-	3	479	c.458C>T	c.(457-459)GCG>GTG	p.A153V	CYP2A6_uc010ehe.1_5'UTR|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	153					coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	GAGGAAGCCCGCCTCCTCCTG	0.706													5	62	---	---	---	---	PASS
CCDC97	90324	broad.mit.edu	37	19	41825636	41825636	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41825636C>T	uc002oqg.2	+	3	782	c.660C>T	c.(658-660)CTC>CTT	p.L220L	CYP2F1_uc010xvw.1_Intron	NM_052848	NP_443080	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	220											0						CTTGCCCGCTCTCCAACTTGC	0.522													35	19	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43258691	43258691	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43258691G>T	uc002ouo.2	-	5	1135	c.1037C>A	c.(1036-1038)TCA>TAA	p.S346*	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Nonsense_Mutation_p.S185*|PSG8_uc002ouh.2_Nonsense_Mutation_p.S346*|PSG8_uc010ein.2_Nonsense_Mutation_p.S224*|PSG8_uc002ouj.3_Nonsense_Mutation_p.S128*|PSG8_uc002ouk.3_Nonsense_Mutation_p.S185*|PSG8_uc002oul.3_Nonsense_Mutation_p.S346*|PSG8_uc002oum.3_Nonsense_Mutation_p.S253*|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Nonsense_Mutation_p.S253*	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	346	Ig-like C2-type 3.					extracellular region					0		Prostate(69;0.00899)				GACTTCTCCTGAACGGTAATA	0.478													109	62	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43683099	43683099	+	Intron	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43683099G>T	uc002ovu.2	-						PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Intron|PSG5_uc002ovx.2_Intron|PSG5_uc002ovv.2_Missense_Mutation_p.P214H|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				ACATTCATAGGGTCCTGCAAT	0.502													156	135	---	---	---	---	PASS
SLC8A2	6543	broad.mit.edu	37	19	47951365	47951365	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47951365G>A	uc002pgx.2	-	4	1742	c.1464C>T	c.(1462-1464)GGC>GGT	p.G488G	SLC8A2_uc010xyq.1_Silent_p.G244G|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Silent_p.G488G	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	488	Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CCTGCGCGTCGCCCACGCGCA	0.692													6	12	---	---	---	---	PASS
CD37	951	broad.mit.edu	37	19	49842171	49842171	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49842171C>A	uc002pnd.2	+	6	783	c.662C>A	c.(661-663)GCA>GAA	p.A221E	uc002pnb.1_Intron|CD37_uc002pnc.2_RNA|CD37_uc010yam.1_Missense_Mutation_p.A221E|CD37_uc010yan.1_Missense_Mutation_p.A153E|CD37_uc002pnf.3_Missense_Mutation_p.A193E|CD37_uc002pne.2_Missense_Mutation_p.A153E	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A	221	Extracellular (Potential).					integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		GCTGTCCCTGCAGAGAGCCAC	0.622													25	20	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51021570	51021570	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021570C>A	uc002pss.2	-	3	1537	c.1400G>T	c.(1399-1401)GGC>GTC	p.G467V		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	467	Gly-rich.|Extracellular (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		gccgcccccgccgctgccggt	0.408													11	11	---	---	---	---	PASS
KLK11	11012	broad.mit.edu	37	19	51527457	51527457	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51527457G>A	uc002pvd.1	-	4	515	c.403C>T	c.(403-405)CCC>TCC	p.P135S	KLK11_uc002pvb.1_Missense_Mutation_p.P128S|KLK11_uc002pve.1_5'UTR|KLK11_uc002pvf.1_Missense_Mutation_p.P103S|KLK11_uc002pvc.3_Missense_Mutation_p.P103S|KLK11_uc010eom.2_3'UTR	NM_144947	NP_659196	Q9UBX7	KLK11_HUMAN	kallikrein 11 isoform 2 precursor	135	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		TCTTTGTTGGGGAGGCTGTTG	0.607													42	33	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51918210	51918210	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51918210T>A	uc002pwo.2	-	8	2099	c.1483A>T	c.(1483-1485)ACC>TCC	p.T495S	SIGLEC10_uc002pwp.2_Missense_Mutation_p.T437S|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Intron|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	495	Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GAGCTGGGGGTGACCTCGAAG	0.701													29	22	---	---	---	---	PASS
HAS1	3036	broad.mit.edu	37	19	52217094	52217094	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52217094C>A	uc002pxo.1	-	5	1358	c.1323G>T	c.(1321-1323)GTG>GTT	p.V441V	HAS1_uc010epc.1_Silent_p.V41V|HAS1_uc010epd.1_3'UTR|HAS1_uc002pxn.1_Silent_p.V448V|HAS1_uc002pxp.1_Silent_p.V440V	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	441	Helical; Name=4; (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGGCCAGTGCCACGCCCTGCA	0.701													20	10	---	---	---	---	PASS
ZNF615	284370	broad.mit.edu	37	19	52505063	52505063	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52505063C>A	uc002pye.1	-						ZNF615_uc002pyf.1_Intron|ZNF615_uc002pyg.1_Intron|ZNF615_uc002pyh.1_Intron|ZNF615_uc010epi.1_Intron|ZNF615_uc010ydg.1_Intron	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TCCTCTCACTCACCAGAACAG	0.517													17	18	---	---	---	---	PASS
ZNF611	81856	broad.mit.edu	37	19	53208581	53208581	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53208581C>A	uc002pzz.2	-	7	2044	c.1727G>T	c.(1726-1728)AGT>ATT	p.S576I	ZNF611_uc010eqc.2_Missense_Mutation_p.S506I|ZNF611_uc010ydo.1_Missense_Mutation_p.S506I|ZNF611_uc010ydr.1_Missense_Mutation_p.S507I|ZNF611_uc010ydp.1_Missense_Mutation_p.S576I|ZNF611_uc010ydq.1_Missense_Mutation_p.S576I|ZNF611_uc002qaa.3_Missense_Mutation_p.S506I	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	576	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TGACCTGTGACTGAAGGTCTT	0.433													216	115	---	---	---	---	PASS
ZNF667	63934	broad.mit.edu	37	19	56953880	56953880	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56953880G>A	uc002qnd.2	-	5	646	c.484C>T	c.(484-486)CAT>TAT	p.H162Y	ZNF667_uc010etl.2_5'UTR|ZNF667_uc002qne.2_Missense_Mutation_p.H162Y|ZNF667_uc010etm.2_Missense_Mutation_p.H105Y	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	162	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		ATGTTCTGATGAAGTTTAAGA	0.373													102	54	---	---	---	---	PASS
ZNF543	125919	broad.mit.edu	37	19	57840469	57840469	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57840469G>C	uc002qoi.1	+	4	1984	c.1639G>C	c.(1639-1641)GGC>CGC	p.G547R		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	547	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTTTAATCGCGGCTCATCCCT	0.463													37	40	---	---	---	---	PASS
TCF15	6939	broad.mit.edu	37	20	590488	590488	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:590488C>A	uc002wdz.2	-	1	423	c.394G>T	c.(394-396)GAC>TAC	p.D132Y		NM_004609	NP_004600	Q12870	TCF15_HUMAN	basic helix-loop-helix transcription factor 15	132					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Breast(17;0.231)				TCGGCCGAGTCGCCCAGCAGC	0.542													3	5	---	---	---	---	PASS
TCF15	6939	broad.mit.edu	37	20	590489	590489	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:590489G>C	uc002wdz.2	-	1	422	c.393C>G	c.(391-393)GGC>GGG	p.G131G		NM_004609	NP_004600	Q12870	TCF15_HUMAN	basic helix-loop-helix transcription factor 15	131					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Breast(17;0.231)				CGGCCGAGTCGCCCAGCAGCA	0.537													3	5	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1552405	1552405	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1552405G>A	uc010gai.2	-	3	811	c.712C>T	c.(712-714)CCT>TCT	p.P238S	SIRPB1_uc002wfk.3_Intron	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	238	Ig-like C1-type 1.|Extracellular (Potential).				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						CCACGAAGAGGGTCCCCCTGC	0.617													31	25	---	---	---	---	PASS
CENPB	1059	broad.mit.edu	37	20	3766827	3766827	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3766827C>A	uc002wjk.2	-	1	511	c.304G>T	c.(304-306)GAG>TAG	p.E102*	CDC25B_uc010zqk.1_5'Flank|CDC25B_uc010zql.1_5'Flank|CDC25B_uc010zqm.1_5'Flank	NM_001810	NP_001801	P07199	CENPB_HUMAN	centromere protein B	102	HTH CENPB-type.|H-T-H motif.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|satellite DNA binding				0						AGCGCCTTCTCCTTGAGGATG	0.667													26	40	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9523318	9523318	+	Missense_Mutation	SNP	T	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9523318T>G	uc002wnl.2	-	10	2464	c.1919A>C	c.(1918-1920)GAG>GCG	p.E640A	PAK7_uc002wnk.2_Missense_Mutation_p.E640A|PAK7_uc002wnj.2_Missense_Mutation_p.E640A|PAK7_uc010gby.1_Intron	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	640	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			GTAGGGGGGCTCGCCATCAAT	0.527													35	42	---	---	---	---	PASS
NKX2-4	644524	broad.mit.edu	37	20	21376611	21376611	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21376611C>A	uc010gcz.2	-	2	1013	c.1003G>T	c.(1003-1005)GCC>TCC	p.A335S		NM_033176	NP_149416	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	335					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						Tccccggcggccgcgtccagg	0.577													4	12	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898728	30898728	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898728G>C	uc002wxq.2	+	2	1315	c.1148G>C	c.(1147-1149)CGG>CCG	p.R383P	KIF3B_uc010ztv.1_Intron|KIF3B_uc010ztw.1_Intron	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	383	Potential.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CGAGAGAAGCGGAGGGAAGGT	0.443													5	19	---	---	---	---	PASS
C20orf114	92747	broad.mit.edu	37	20	31894774	31894774	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31894774C>A	uc002wyw.1	+	15	1537	c.1376C>A	c.(1375-1377)GCT>GAT	p.A459D	C20orf114_uc002wyx.1_RNA	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor	459						extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						TTCGAGGCAGCTGAGTCCTCA	0.463													22	61	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33874999	33874999	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33874999G>A	uc010zux.1	-	4	1701	c.1583C>T	c.(1582-1584)ACC>ATC	p.T528I	EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Missense_Mutation_p.T183I	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	528										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TGAGTTGGGGGTAACCCCAGA	0.647													13	45	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33875022	33875022	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33875022C>T	uc010zux.1	-	4	1678	c.1560G>A	c.(1558-1560)GTG>GTA	p.V520V	EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Silent_p.V175V	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	520										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CAGGGTCTCCCACTTCTCGGG	0.642													16	46	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33876313	33876313	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33876313C>T	uc010zux.1	-	3	875	c.757G>A	c.(757-759)GAG>AAG	p.E253K	FAM83C_uc002xcb.1_Missense_Mutation_p.E77K	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	253										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			ACGAACTTCTCCAGGGCCTGC	0.632													10	41	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34430532	34430532	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34430532G>C	uc002xek.1	+	3	232	c.121G>C	c.(121-123)GGA>CGA	p.G41R	PHF20_uc002xei.1_Missense_Mutation_p.G41R|PHF20_uc010gfo.1_Missense_Mutation_p.G41R|PHF20_uc002xej.1_5'UTR|PHF20_uc002xel.1_5'UTR	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	41					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					CTACGAGGAAGGAAAAGTACT	0.403													6	118	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36989406	36989406	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36989406C>A	uc002xic.1	+	6	672	c.637C>A	c.(637-639)CTC>ATC	p.L213I		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	213					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				ACAGCCTTATCTCCAAACTCT	0.418													26	93	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40739007	40739007	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40739007G>A	uc002xkg.2	-	23	3404	c.3220C>T	c.(3220-3222)CCC>TCC	p.P1074S	PTPRT_uc010ggj.2_Missense_Mutation_p.P1093S|PTPRT_uc010ggi.2_Missense_Mutation_p.P277S	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1074	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GCTTCCGGGGGGTTGAGGAAC	0.468													7	30	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40827935	40827935	+	Missense_Mutation	SNP	G	T	T	rs145661499	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40827935G>T	uc002xkg.2	-	16	2620	c.2436C>A	c.(2434-2436)AGC>AGA	p.S812R	PTPRT_uc010ggj.2_Missense_Mutation_p.S831R|PTPRT_uc010ggi.2_Missense_Mutation_p.S15R	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	812	Cytoplasmic (Potential).				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGCGGCTGGCGCTGAGCTTGG	0.577													76	193	---	---	---	---	PASS
SERINC3	10955	broad.mit.edu	37	20	43135617	43135617	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43135617C>A	uc002xme.2	-	6	768	c.634G>T	c.(634-636)GCC>TCC	p.A212S	SERINC3_uc002xmf.1_Missense_Mutation_p.A212S|SERINC3_uc010ggs.1_Missense_Mutation_p.A205S|SERINC3_uc010zwp.1_Missense_Mutation_p.A157S	NM_198941	NP_945179	Q13530	SERC3_HUMAN	tumor differentially expressed protein 1	212	Helical; (Potential).					integral to membrane|plasma membrane	protein binding			skin(3)	3		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			ATATAAAAGGCGCTTGTGAAA	0.378													11	30	---	---	---	---	PASS
UBE2C	11065	broad.mit.edu	37	20	44444350	44444350	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44444350G>T	uc002xpm.2	+	4	467	c.387G>T	c.(385-387)AGG>AGT	p.R129S	UBE2C_uc002xpl.2_Intron|UBE2C_uc002xpn.2_Missense_Mutation_p.R90S|UBE2C_uc002xpo.2_Missense_Mutation_p.R100S|UBE2C_uc002xpp.2_Intron|UBE2C_uc002xpq.2_Missense_Mutation_p.R90S	NM_007019	NP_008950	O00762	UBE2C_HUMAN	ubiquitin-conjugating enzyme E2C isoform 1	129					activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|exit from mitosis|free ubiquitin chain polymerization|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|positive regulation of exit from mitosis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|protein K48-linked ubiquitination|spindle organization	anaphase-promoting complex|cytosol|nucleoplasm	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Myeloproliferative disorder(115;0.0122)				ATGATGTCAGGACCATTCTGC	0.552													25	74	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44642296	44642296	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44642296G>T	uc002xqz.2	+	10	1630	c.1611G>T	c.(1609-1611)GGG>GGT	p.G537G		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	537	Hemopexin-like 1.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	GCTTTCTCAGGAAGTACTGGC	0.677											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	21	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44666000	44666000	+	Silent	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44666000C>A	uc010zxl.1	+	6	733	c.657C>A	c.(655-657)ATC>ATA	p.I219I	SLC12A5_uc002xra.2_Silent_p.I196I|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Silent_p.I196I	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	219	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCATGTACATCCTGGGCACCA	0.473													8	24	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48252856	48252856	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48252856T>A	uc002xuu.3	-	9	1354	c.1160A>T	c.(1159-1161)GAG>GTG	p.E387V		NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	387	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CTCTCAGTACTCGTTCACCTG	0.478													4	59	---	---	---	---	PASS
CTCFL	140690	broad.mit.edu	37	20	56098119	56098119	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56098119C>A	uc010gix.1	-						CTCFL_uc010giw.1_Intron|CTCFL_uc002xym.2_Intron|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Intron|CTCFL_uc010gjb.1_Intron|CTCFL_uc010gjc.1_Intron|CTCFL_uc010gjd.1_Intron|CTCFL_uc010gje.2_Intron|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Intron|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Intron|CTCFL_uc010gjk.1_Intron|CTCFL_uc010gjl.1_Intron	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein						cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GATGAACTGGCCTACCCTTTG	0.388													20	74	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415487	57415487	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415487A>G	uc002xzt.2	+	1	693	c.326A>G	c.(325-327)TAC>TGC	p.Y109C	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GAGTTCGACTACGAGACCGAG	0.617			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			3	88	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60348181	60348181	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60348181C>G	uc002ybn.1	+	4	533	c.519C>G	c.(517-519)ATC>ATG	p.I173M	CDH4_uc002ybp.1_Missense_Mutation_p.I99M	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	173	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACTGGGTCATCCCGCCCATCA	0.706													5	16	---	---	---	---	PASS
SLCO4A1	28231	broad.mit.edu	37	20	61291766	61291766	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61291766C>T	uc002ydb.1	+	4	1095	c.890C>T	c.(889-891)ACG>ATG	p.T297M	SLCO4A1_uc002ydc.1_RNA	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	297	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			TTCCACAGGACGGAGCTGACC	0.687													20	19	---	---	---	---	PASS
YTHDF1	54915	broad.mit.edu	37	20	61833927	61833927	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61833927G>A	uc002yeh.2	-	4	1659	c.1365C>T	c.(1363-1365)CCC>CCT	p.P455P	YTHDF1_uc011aaq.1_Silent_p.P405P	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	455	YTH.									ovary(2)	2						CGTAGTCCACGGGGGACTTCA	0.567													10	76	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62192207	62192207	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62192207G>A	uc002yfm.2	-	16	8114	c.7222C>T	c.(7222-7224)CGG>TGG	p.R2408W	PRIC285_uc002yfl.1_Missense_Mutation_p.R1839W	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	2408					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			AACAGAGACCGGTCCAGACCC	0.637													9	63	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10933867	10933867	+	Missense_Mutation	SNP	A	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10933867A>T	uc002yip.1	-	17	1380	c.1012T>A	c.(1012-1014)TGT>AGT	p.C338S	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.C320S|TPTE_uc002yir.1_Missense_Mutation_p.C300S|TPTE_uc010gkv.1_Missense_Mutation_p.C200S	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	338	Phosphatase tensin-type.	Potential.			signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCTCCTTTACAGTGAATCGCT	0.328													33	164	---	---	---	---	PASS
KRTAP27-1	643812	broad.mit.edu	37	21	31709432	31709432	+	Silent	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31709432G>T	uc002ynx.1	-	1	581	c.555C>A	c.(553-555)CTC>CTA	p.L185L		NM_001077711	NP_001071179	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	185						intermediate filament				ovary(2)	2						AAGATTCCAGGAGTTGTGGCT	0.468													20	31	---	---	---	---	PASS
KRTAP21-2	337978	broad.mit.edu	37	21	32119426	32119426	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32119426C>A	uc011adh.1	-	1	95	c.95G>T	c.(94-96)GGA>GTA	p.G32V		NM_181617	NP_853648	Q3LI59	KR212_HUMAN	keratin associated protein 21-2	32						intermediate filament					0						agagccgtatccacagccata	0.095													17	26	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33044451	33044451	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33044451G>T	uc002ypd.2	-	20	3131	c.2705C>A	c.(2704-2706)CCT>CAT	p.P902H	SFRS15_uc002ype.2_Missense_Mutation_p.P880H|SFRS15_uc010glu.2_Missense_Mutation_p.P887H	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	902						nucleus	nucleotide binding|RNA binding				0						CATTCCATGAGGTGGAGGCAT	0.652													14	25	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43531513	43531513	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43531513C>A	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Missense_Mutation_p.N655K|UMODL1_uc002zag.1_Missense_Mutation_p.N727K|C21orf128_uc002zak.2_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						GCCATAGGAACACTATCGGGG	0.692													12	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	17395387	17395387	+	IGR	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17395387G>C								HSFYL1 (85162 upstream) : GAB4 (47442 downstream)																							GGCTCTCCAGGAGTGACAGGC	0.473													14	23	---	---	---	---	PASS
HIRA	7290	broad.mit.edu	37	22	19384447	19384447	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19384447G>A	uc002zpf.1	-	7	737	c.517C>T	c.(517-519)CAT>TAT	p.H173Y	HIRA_uc011agx.1_Missense_Mutation_p.H39Y|HIRA_uc010grn.1_Missense_Mutation_p.H173Y|HIRA_uc010gro.1_Missense_Mutation_p.H129Y|HIRA_uc010grp.2_RNA	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	173	WD 4.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					AAGCCAGAATGACCTCTCAGA	0.488													11	51	---	---	---	---	PASS
CDC45	8318	broad.mit.edu	37	22	19502550	19502550	+	Silent	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19502550G>C	uc002zpr.2	+	15	1495	c.1419G>C	c.(1417-1419)CTG>CTC	p.L473L	CDC45_uc011agz.1_3'UTR|CDC45_uc011aha.1_Silent_p.L505L|CDC45_uc002zps.2_Silent_p.L473L|CDC45_uc002zpt.2_Silent_p.L427L	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like	473					DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1						GCAAACACCTGCTCAAGTCCT	0.607													8	22	---	---	---	---	PASS
ZNF74	7625	broad.mit.edu	37	22	20760522	20760522	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20760522A>G	uc010gsm.2	+	6	1411	c.1199A>G	c.(1198-1200)CAC>CGC	p.H400R	ZNF74_uc002zsg.2_Missense_Mutation_p.H329R|ZNF74_uc002zsh.2_Missense_Mutation_p.H400R|ZNF74_uc002zsi.2_Missense_Mutation_p.H329R|ZNF74_uc010gsn.2_Missense_Mutation_p.H329R	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	400	C2H2-type 6.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TTCACCTGCCACTCATCCCTC	0.632													9	39	---	---	---	---	PASS
GNAZ	2781	broad.mit.edu	37	22	23438181	23438181	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23438181G>T	uc002zwu.1	+	2	836	c.299G>T	c.(298-300)CGC>CTC	p.R100L	RTDR1_uc002zwt.2_Intron	NM_002073	NP_002064	P19086	GNAZ_HUMAN	guanine nucleotide binding protein, alpha z	100						endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity			kidney(1)|skin(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		AACCCCGACCGCGCCTACGAC	0.647													41	121	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26422991	26422991	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26422991T>A	uc003abz.1	+	43	7301	c.7051T>A	c.(7051-7053)TGC>AGC	p.C2351S	MYO18B_uc003aca.1_Missense_Mutation_p.C2232S|MYO18B_uc010guy.1_Missense_Mutation_p.C2233S|MYO18B_uc010guz.1_Missense_Mutation_p.C2231S|MYO18B_uc011aka.1_Missense_Mutation_p.C1505S|MYO18B_uc011akb.1_Missense_Mutation_p.C1864S|MYO18B_uc010gva.1_Missense_Mutation_p.C334S|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2351						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTCAGTTCCTGCGAGTCCCT	0.562													16	65	---	---	---	---	PASS
SEC14L2	23541	broad.mit.edu	37	22	30805173	30805173	+	Intron	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30805173C>A	uc003ahr.2	+						SEC14L2_uc003ahq.2_Intron|SEC14L2_uc011akx.1_Intron|SEC14L2_uc003ahs.2_Intron|SEC14L2_uc011aky.1_Intron|SEC14L2_uc003aht.2_RNA|SEC14L2_uc003ahu.3_5'Flank|SEC14L2_uc010gvv.2_5'Flank|SEC14L2_uc010gvw.1_5'Flank|MTP18_uc010gvx.1_5'Flank|MTP18_uc003ahv.1_5'Flank|MTP18_uc010gvy.1_5'Flank	NM_012429	NP_036561	O76054	S14L2_HUMAN	SEC14-like 2 isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transporter activity|vitamin E binding				0					Vitamin E(DB00163)	CTGTTCCCTGCAGTTGGGGAG	0.517													22	26	---	---	---	---	PASS
FAM9B	171483	broad.mit.edu	37	X	8998330	8998330	+	Missense_Mutation	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8998330G>A	uc011mhu.1	-	4	342	c.253C>T	c.(253-255)CAT>TAT	p.H85Y	FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Intron	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	85						nucleus					0		Hepatocellular(5;0.219)				CTCAAAGCATGTTTACTTTTG	0.279													4	5	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23018431	23018431	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23018431A>G	uc004daj.2	+	1	345	c.257A>G	c.(256-258)AAC>AGC	p.N86S		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	86	KH.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						CAGATCATAAACGGGGAATCT	0.338													7	16	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31462722	31462722	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31462722G>T	uc004dda.1	-	60	9204	c.8960C>A	c.(8959-8961)CCT>CAT	p.P2987H	DMD_uc004dcq.1_Missense_Mutation_p.P258H|DMD_uc004dcr.1_Missense_Mutation_p.P527H|DMD_uc004dcs.1_Missense_Mutation_p.P527H|DMD_uc004dct.1_Missense_Mutation_p.P527H|DMD_uc004dcu.1_Missense_Mutation_p.P527H|DMD_uc004dcv.1_Missense_Mutation_p.P527H|DMD_uc004dcw.2_Missense_Mutation_p.P1643H|DMD_uc004dcx.2_Missense_Mutation_p.P1646H|DMD_uc004dcz.2_Missense_Mutation_p.P2864H|DMD_uc004dcy.1_Missense_Mutation_p.P2983H|DMD_uc004ddb.1_Missense_Mutation_p.P2979H	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2987	Spectrin 22.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTCTTTCAGAGGCGCAATTTC	0.458													38	19	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32408279	32408279	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32408279G>C	uc004dda.1	-	31	4497	c.4253C>G	c.(4252-4254)ACA>AGA	p.T1418R	DMD_uc004dcw.2_Missense_Mutation_p.T74R|DMD_uc004dcx.2_Missense_Mutation_p.T77R|DMD_uc004dcz.2_Missense_Mutation_p.T1295R|DMD_uc004dcy.1_Missense_Mutation_p.T1414R|DMD_uc004ddb.1_Missense_Mutation_p.T1410R|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1418	Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTCATGACTTGTCAAATCAGA	0.388													35	15	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41010252	41010252	+	Missense_Mutation	SNP	G	C	C			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41010252G>C	uc004dfb.2	+	13	2338	c.1705G>C	c.(1705-1707)GCA>CCA	p.A569P	USP9X_uc004dfc.2_Missense_Mutation_p.A569P	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	569					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						GGTTATTCCCGCACTGAAACA	0.318													5	7	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50119073	50119073	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50119073C>G	uc010njr.1	-	25	3424	c.3364G>C	c.(3364-3366)GGC>CGC	p.G1122R		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	1122					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CTGTCTTGGCCGTAAAATATA	0.433													7	6	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53674517	53674517	+	Missense_Mutation	SNP	A	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53674517A>G	uc004dsp.2	-	6	547	c.145T>C	c.(145-147)TGC>CGC	p.C49R		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	49					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TATAACTCGCACTGGAGAGGG	0.483													26	35	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54785033	54785033	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54785033C>A	uc004dtj.2	-	8	1504	c.1474G>T	c.(1474-1476)GCC>TCC	p.A492S		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	492					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						GGGAAAACGGCCCAAGGGGAG	0.622													5	8	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54957141	54957141	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54957141C>A	uc004dtq.2	+	12	4091	c.3984C>A	c.(3982-3984)GAC>GAA	p.D1328E	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Missense_Mutation_p.D859E|TRO_uc004dtw.2_Missense_Mutation_p.D931E|TRO_uc004dtx.2_Missense_Mutation_p.D711E	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1328	52; approximate.|62 X 10 AA approximate tandem repeats.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						CCAGCTTCGACAGAGGACTGA	0.567													18	15	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412889	63412889	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412889C>A	uc004dvo.2	-	2	551	c.278G>T	c.(277-279)AGC>ATC	p.S93I		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	93					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GTGGGTCTTGCTCTTGCTGAG	0.537													19	27	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70349258	70349258	+	Missense_Mutation	SNP	C	G	G			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70349258C>G	uc004dyy.2	+	26	3869	c.3670C>G	c.(3670-3672)CTC>GTC	p.L1224V	MED12_uc011mpq.1_Missense_Mutation_p.L1224V|MED12_uc004dyz.2_Missense_Mutation_p.L1224V|MED12_uc004dza.2_Missense_Mutation_p.L1071V|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1224					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GTTTGCTGTTCTCAAGGCTGT	0.562											OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	11	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71825207	71825207	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71825207C>A	uc004eax.3	-	25	3030	c.2729G>T	c.(2728-2730)GGC>GTC	p.G910V	PHKA1_uc004eay.3_Missense_Mutation_p.G910V|PHKA1_uc011mqi.1_Missense_Mutation_p.G851V	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	910					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					AGCAAAGAGGCCAGGCTGGGT	0.423													14	16	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73065916	73065916	+	RNA	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73065916T>A	uc004ebm.1	-	1		c.6673A>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						GGGCACTCCCTGCCGGAAGGG	0.512													22	22	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83723923	83723923	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83723923C>A	uc004eek.1	-	3	917	c.808G>T	c.(808-810)GTT>TTT	p.V270F	HDX_uc011mqv.1_Missense_Mutation_p.V270F|HDX_uc004eel.1_Missense_Mutation_p.V212F	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	270						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TAATCGCTAACTGCCAATGAA	0.453													26	40	---	---	---	---	PASS
ZNF711	7552	broad.mit.edu	37	X	84510709	84510709	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84510709C>A	uc004eeo.2	+	4	871	c.524C>A	c.(523-525)GCA>GAA	p.A175E	ZNF711_uc004eep.2_Missense_Mutation_p.A175E|ZNF711_uc004eeq.2_Missense_Mutation_p.A175E	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	175					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						GTGATTCAAGCAGCTGGAGGT	0.403													19	30	---	---	---	---	PASS
HNRNPH2	3188	broad.mit.edu	37	X	100667656	100667656	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100667656G>T	uc004ehm.2	+	2	850	c.680G>T	c.(679-681)GGG>GTG	p.G227V	HNRNPH2_uc004ehn.2_Missense_Mutation_p.G227V	NM_019597	NP_062543	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2	227					nuclear mRNA splicing, via spliceosome	actin cytoskeleton|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						AGAGGAGCTGGGTTTGAAAGG	0.522													15	20	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101097735	101097735	+	Missense_Mutation	SNP	C	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097735C>A	uc011mrk.1	-	3	390	c.30G>T	c.(28-30)ATG>ATT	p.M10I	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	10					mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ACCATTTCCTCATGTTTTCAT	0.308													73	61	---	---	---	---	PASS
ATG4A	115201	broad.mit.edu	37	X	107380351	107380351	+	Silent	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107380351C>T	uc004enr.2	+	7	621	c.498C>T	c.(496-498)TCC>TCT	p.S166S	ATG4A_uc004ent.2_Silent_p.S166S|ATG4A_uc004ens.2_Silent_p.S82S|ATG4A_uc011msl.1_Silent_p.S82S|ATG4A_uc010npi.2_Intron|ATG4A_uc004enu.2_Silent_p.S82S	NM_052936	NP_443168	Q8WYN0	ATG4A_HUMAN	autophagy-related cysteine endopeptidase 2	166					autophagy|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity			pancreas(1)	1						AATGGAATTCCTTGGCTGTTT	0.378													20	31	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110491218	110491218	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110491218T>A	uc004epc.1	-	11	1655	c.1487A>T	c.(1486-1488)GAA>GTA	p.E496V	CAPN6_uc011msu.1_Missense_Mutation_p.E241V	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	496					microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						CAGAGTCAGTTCCCTAGAACA	0.433													24	83	---	---	---	---	PASS
DCX	1641	broad.mit.edu	37	X	110653371	110653371	+	Missense_Mutation	SNP	C	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110653371C>T	uc004epd.2	-	2	671	c.499G>A	c.(499-501)GAC>AAC	p.D167N	DCX_uc011msv.1_Missense_Mutation_p.D167N|DCX_uc004epe.2_Missense_Mutation_p.D86N|DCX_uc004epf.2_Missense_Mutation_p.D86N|DCX_uc004epg.2_Missense_Mutation_p.D86N	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	167	Doublecortin 1.		D -> H (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						CGCGTCAGGTCAGCCAGCAAG	0.517													34	22	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125685530	125685530	+	Silent	SNP	C	T	T	rs138224583	byFrequency	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685530C>T	uc004eul.2	-	1	1313	c.1062G>A	c.(1060-1062)CGG>CGA	p.R354R		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	354	WD 4.									skin(3)|ovary(1)	4						AGCTCAGCGACCGCACGCCTG	0.622													12	16	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131212472	131212472	+	Missense_Mutation	SNP	G	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131212472G>T	uc004ewn.2	-	12	1751	c.1573C>A	c.(1573-1575)CCC>ACC	p.P525T	FRMD7_uc011muy.1_Missense_Mutation_p.P510T	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	525					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ATTGCAGTGGGCTCTACATAG	0.498													51	80	---	---	---	---	PASS
MAGEA11	4110	broad.mit.edu	37	X	148798397	148798397	+	Silent	SNP	G	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148798397G>A	uc004fdq.2	+	5	1353	c.1251G>A	c.(1249-1251)CTG>CTA	p.L417L	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Silent_p.L388L	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	417	MAGE.					cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ACCCATCCCTGTATGAAGATG	0.557													42	23	---	---	---	---	PASS
IDH3G	3421	broad.mit.edu	37	X	153053588	153053588	+	Missense_Mutation	SNP	T	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153053588T>A	uc004fip.2	-	6	535	c.349A>T	c.(349-351)AAC>TAC	p.N117Y	IDH3G_uc004fio.2_Missense_Mutation_p.N59Y|IDH3G_uc004fiq.2_Missense_Mutation_p.N117Y|IDH3G_uc010num.2_Missense_Mutation_p.N59Y|IDH3G_uc004fir.2_Missense_Mutation_p.N59Y|IDH3G_uc004fit.1_Missense_Mutation_p.N117Y|IDH3G_uc004fis.2_Missense_Mutation_p.N59Y|IDH3G_uc004fiu.2_5'Flank	NM_004135	NP_004126	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma isoform	117					carbohydrate metabolic process|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleolus	ATP binding|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)				NADH(DB00157)	GTTTCGATGTTGCCTACAAAA	0.587													52	39	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153692517	153692517	+	Missense_Mutation	SNP	C	G	G	rs144165306		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153692517C>G	uc004flm.2	+	8	1862	c.1689C>G	c.(1687-1689)CAC>CAG	p.H563Q		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	563	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCACCCTGCACAACGTGCCAG	0.697													3	3	---	---	---	---	PASS
NEXN	91624	broad.mit.edu	37	1	78401842	78401846	+	Intron	DEL	TACAG	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78401842_78401846delTACAG	uc001dic.3	+						NEXN_uc001dia.3_Intron|NEXN_uc009wcb.1_Intron|NEXN_uc001dib.3_Intron|NEXN_uc001did.1_Intron|NEXN_uc001dif.1_Intron|NEXN_uc001dig.3_Intron	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)						regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		CATTGGTATATACAGTAATCTGGGA	0.263													3	3	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205033255	205033255	+	Intron	DEL	G	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205033255delG	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron|CNTN2_uc001hbs.2_Intron	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			gaggggcggagggggggcgcg	0.000													4	7	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766820	206766823	+	Intron	DEL	GAGC	-	-	rs141098886		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766820_206766823delGAGC	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagagagcgcgagagaga	0.211													3	3	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107029409	107029409	+	Intron	DEL	G	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107029409delG	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						ATCTAGTCACGGCCTACTCAT	0.338													9	5	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160634565	160634566	+	Intron	DEL	CC	-	-	rs35013477		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160634565_160634566delCC	uc002ubb.3	-						LY75_uc010fos.2_Intron|CD302_uc002uba.2_Intron|CD302_uc010zco.1_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TAAAAATAAACCCTTTTATTAG	0.233													4	4	---	---	---	---	
NUP35	129401	broad.mit.edu	37	2	183993328	183993328	+	Intron	DEL	A	-	-	rs71407008		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183993328delA	uc002upf.2	+						NUP35_uc010zfs.1_Intron|NUP35_uc010zft.1_Intron|NUP35_uc002upg.2_Intron	NM_138285	NP_612142	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	intermediate filament cytoskeleton|nuclear membrane|nuclear pore|plasma membrane					0						ctgatgagctaaaaaaaaaaa	0.000													3	3	---	---	---	---	
SCN11A	11280	broad.mit.edu	37	3	38936458	38936458	+	Intron	DEL	G	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38936458delG	uc011ays.1	-						SCN11A_uc010hhn.1_5'Flank	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	TTGAGCACCTGGGAATGGGGT	0.413													31	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	131245445	131245445	+	IGR	DEL	T	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131245445delT								MRPL3 (23616 upstream) : CPNE4 (8139 downstream)																							GCTGCCTTCCTTAGGCGTGGT	0.607													4	2	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6998263	6998263	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6998263delA	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron|TBC1D14_uc010idh.2_Intron|TBC1D14_uc011bwh.1_5'Flank	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						GTCTTCCAGTAAAAAAAAAAA	0.224													3	3	---	---	---	---	
CORIN	10699	broad.mit.edu	37	4	47645067	47645067	+	Intron	DEL	G	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47645067delG	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Frame_Shift_Del_p.Q685fs	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						AGATGAACTTGGTCAGTAAAA	0.398													14	7	---	---	---	---	
PET112L	5188	broad.mit.edu	37	4	152625233	152625233	+	Intron	DEL	T	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152625233delT	uc003iml.2	-						PET112L_uc003imm.3_Intron	NM_004564	NP_004555	O75879	GATB_HUMAN	PET112-like precursor							mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CAGAATGATCTTTTTTTTTTT	0.343													4	2	---	---	---	---	
NPR3	4883	broad.mit.edu	37	5	32739289	32739289	+	Intron	DEL	G	-	-	rs58981865		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32739289delG	uc003jhv.2	+						NPR3_uc010iuo.2_Intron|NPR3_uc011cnz.1_Intron|NPR3_uc003jhu.2_Intron	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase						osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	GTGTGTGTGTGTTTTTTTTTT	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103837943	103837944	+	IGR	INS	-	TTCC	TTCC			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103837943_103837944insTTCC								NUDT12 (939453 upstream) : RAB9BP1 (597231 downstream)																							tcttcctttctttccttccttc	0.000													4	2	---	---	---	---	
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139818271	139818271	+	Intron	DEL	G	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139818271delG	uc003lfs.1	+						ANKHD1_uc003lfq.1_Intron|ANKHD1_uc003lfr.2_Intron|ANKHD1_uc003lfp.2_Intron|ANKHD1_uc003lfo.2_Intron|ANKHD1_uc010jfk.2_Intron	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein							cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAATTTTGGTTAAATATA	0.303													15	7	---	---	---	---	
MYO6	4646	broad.mit.edu	37	6	76551241	76551241	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76551241delA	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ccctgtctctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27498404	27498405	+	IGR	INS	-	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27498404_27498405insT								EVX1 (212212 upstream) : HIBADH (66658 downstream)																							AGCACTGCCGCGGGACCCTCTG	0.584													48	26	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99578706	99578706	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99578706delA	uc003usi.2	+											RecName: Full=Putative zinc-alpha-2-glycoprotein-like 2; Flags: Precursor;																		cttagtttacagtgaaaacaa	0.164													3	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2967922	2967923	+	Intron	INS	-	TT	TT			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2967922_2967923insTT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAAGCTAAATATTTGACTCCAA	0.386													3	4	---	---	---	---	
ZFHX4	79776	broad.mit.edu	37	8	77761870	77761871	+	Frame_Shift_Ins	INS	-	A	A			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77761870_77761871insA	uc003yav.2	+	8	4020_4021	c.3633_3634insA	c.(3631-3636)AGCAACfs	p.S1211fs	ZFHX4_uc003yau.1_Frame_Shift_Ins_p.S1256fs|ZFHX4_uc003yaw.1_Frame_Shift_Ins_p.S1211fs	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1211_1212	C2H2-type 9.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACGTCCTCAGCAACAAAATGCA	0.490										HNSCC(33;0.089)			57	27	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6639010	6639011	+	Intron	INS	-	A	A	rs78066890		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6639010_6639011insA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	ctctgtctcagaaaaaaaaaaa	0.158													3	3	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	429920	429920	+	Intron	DEL	G	-	-	rs113989093		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:429920delG	uc001ifp.2	-						DIP2C_uc009xhj.1_Intron	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AAAAAAAAAAGACTCCACAGC	0.463													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134062759	134062759	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134062759delC	uc001qhd.1	-	16	2476	c.1870delG	c.(1870-1872)GTGfs	p.V624fs	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	624					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ACCGGGACCACCCCCCGCAAC	0.542													73	32	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2656822	2656823	+	Intron	DEL	TG	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2656822_2656823delTG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	gtatatatgttgtgtgtgtgtg	0.366													4	3	---	---	---	---	
PDE3A	5139	broad.mit.edu	37	12	20799291	20799291	+	Intron	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20799291delC	uc001reh.1	+							NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TAATATTTGTCCTAGAAAGTT	0.343													2	5	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54970511	54970512	+	Intron	INS	-	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54970511_54970512insT	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GAGGGCAGGGGTGAGAACTTGT	0.545													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56775571	56775571	+	IGR	DEL	A	-	-	rs151012928		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56775571delA								APOF (18988 upstream) : TIMELESS (34586 downstream)																							actccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95724166	95724166	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95724166delA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	TATGGATGTTAAGAGACTGTC	0.393													22	14	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70489883	70489884	+	Intron	INS	-	T	T			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70489883_70489884insT	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ATCCTGATTGGTGTTCTCTGCG	0.589													43	20	---	---	---	---	
DISP2	85455	broad.mit.edu	37	15	40659933	40659933	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40659933delC	uc001zlk.1	+	8	1709	c.1620delC	c.(1618-1620)TTCfs	p.F540fs		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	540	SSD.				smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TGGCCTACTTCCCCTTCGTCA	0.617													29	15	---	---	---	---	
EME2	197342	broad.mit.edu	37	16	1823398	1823402	+	Frame_Shift_Del	DEL	GCAGG	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1823398_1823402delGCAGG	uc002cmq.1	+	1	170_174	c.170_174delGCAGG	c.(169-174)CGCAGGfs	p.R57fs	NME3_uc002cmm.2_5'Flank|NME3_uc010brv.2_5'Flank|MRPS34_uc002cmn.2_5'Flank|MRPS34_uc002cmo.2_5'Flank|MRPS34_uc002cmp.1_5'Flank|EME2_uc010brw.1_Frame_Shift_Del_p.R57fs	NM_001010865	NP_001010865	A4GXA9	EME2_HUMAN	essential meiotic endonuclease 1 homolog 2	57_58					DNA recombination|DNA repair	nucleus	DNA binding|endonuclease activity			lung(1)|central_nervous_system(1)|pancreas(1)	3						GCGGGTGAGCGCAGGGCGGCTGCCG	0.737								Direct_reversal_of_damage|Homologous_recombination					8	10	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54535794	54535795	+	IGR	INS	-	AAGG	AAGG			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54535794_54535795insAAGG								IRX3 (215416 upstream) : IRX5 (429316 downstream)																							aagaaggaaggaaggaaggaag	0.040													4	6	---	---	---	---	
VPS53	55275	broad.mit.edu	37	17	504888	504888	+	Intron	DEL	T	-	-	rs117255969	by1000genomes	TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:504888delT	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CTACATGCACTTTCAGATAAA	0.502													10	11	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20279655	20279655	+	Intron	DEL	T	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20279655delT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						tctgtctctcttttttttttt	0.119													3	3	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26680546	26680547	+	Intron	INS	-	A	A	rs11454138		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680546_26680547insA	uc002haz.2	-						POLDIP2_uc010wag.1_Intron	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		gactccatatcaaaaaaaaaaa	0.248													4	2	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3094393	3094393	+	Intron	DEL	C	-	-	rs80021124		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3094393delC	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						AAAAAAAAAACCACACAATGG	0.234													11	5	---	---	---	---	
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CAGTACCTGACCCCCCCCCCG	0.657													4	4	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
MAST3	23031	broad.mit.edu	37	19	18218266	18218277	+	Intron	DEL	CAGTGTGTAGAG	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18218266_18218277delCAGTGTGTAGAG	uc002nhz.3	+							NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase								ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						agggctgagccagtgtgtagagtgagcgggaa	0.193													13	24	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45767900	45767900	+	Intron	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45767900delC	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_5'Flank			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTAGGAGGGGCCCTTTCTCCC	0.493													50	60	---	---	---	---	
HSPA12B	116835	broad.mit.edu	37	20	3728663	3728663	+	Intron	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3728663delC	uc002wjd.2	+						HSPA12B_uc010zqi.1_Intron|HSPA12B_uc002wje.2_Intron|HSPA12B_uc010zqj.1_Intron	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding				0						CAGGGCCATTCCCTCCCCAGC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49466848	49466849	+	IGR	INS	-	TTCC	TTCC	rs72159977		TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49466848_49466849insTTCC								FAM19A5 (319106 upstream) : C22orf34 (341327 downstream)																							tcgttccttcgttccttccttc	0.109													4	2	---	---	---	---	
HDHD1A	8226	broad.mit.edu	37	X	7023887	7023887	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7023887delA	uc004crv.2	-						HDHD1A_uc011mhm.1_Intron|HDHD1A_uc011mhn.1_Intron|HDHD1A_uc010ndl.2_Intron|HDHD1A_uc011mho.1_Intron	NM_012080	NP_036212	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain						nucleotide metabolic process		metal ion binding|phosphatase activity				0		Colorectal(8;0.0114)|Medulloblastoma(8;0.184)				TATCTGCAGGAAAAAAAAAAG	0.383													4	2	---	---	---	---	
CXorf23	256643	broad.mit.edu	37	X	19953721	19953721	+	Intron	DEL	A	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19953721delA	uc004czp.2	-						CXorf23_uc010nfn.2_Intron|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Intron	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643							mitochondrion				lung(1)|skin(1)	2						atctactggtaaaaaaaaaaa	0.209													4	3	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			7	5	---	---	---	---	
IGSF1	3547	broad.mit.edu	37	X	130419676	130419676	+	Intron	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130419676delC	uc004ewd.2	-						IGSF1_uc004ewe.3_Intron|IGSF1_uc004ewf.2_Intron|IGSF1_uc004ewg.2_Intron	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						AACAAACTCTCCCCTGGAAGG	0.468													16	15	---	---	---	---	
F9	2158	broad.mit.edu	37	X	138633269	138633269	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138633269delC	uc004fas.1	+	6	598	c.569delC	c.(568-570)ACCfs	p.T190fs	F9_uc004fat.1_Frame_Shift_Del_p.T152fs	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	190					blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	TCTAAGCTCACCCGTGCTGAG	0.368													35	33	---	---	---	---	
MAGEA4	4103	broad.mit.edu	37	X	151093042	151093042	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-5668-01A-01D-1632-08	TCGA-43-5668-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151093042delC	uc004fez.2	+	3	1062	c.906delC	c.(904-906)TACfs	p.Y302fs	MAGEA4_uc004ffa.2_Frame_Shift_Del_p.Y302fs|MAGEA4_uc004ffb.2_Frame_Shift_Del_p.Y302fs|MAGEA4_uc004ffc.2_Frame_Shift_Del_p.Y302fs|MAGEA4_uc004ffd.2_Frame_Shift_Del_p.Y302fs	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	302	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GCATTGCCTACCCATCCCTGC	0.572													42	40	---	---	---	---	
