Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCDC27	148870	broad.mit.edu	37	1	3669365	3669365	+	Splice_Site	SNP	T	C	C	rs149388135		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3669365T>C	uc001akv.2	+	1	399	c.318_splice	c.e1+2	p.T106_splice		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27											skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		AGGAAGACGGTATGGGGTCCC	0.617													6	10	---	---	---	---	PASS
AJAP1	55966	broad.mit.edu	37	1	4834552	4834552	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4834552C>G	uc001alm.1	+	5	1610	c.1229C>G	c.(1228-1230)TCC>TGC	p.S410C	AJAP1_uc001aln.2_Missense_Mutation_p.S410C	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1	410	Targeting signals.|Cytoplasmic (Potential).				cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TTTGAAATCTCCTGCTGACTG	0.517													31	104	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12383778	12383778	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12383778G>C	uc001atv.2	+	35	8072	c.7931G>C	c.(7930-7932)AGG>ACG	p.R2644T	VPS13D_uc001atw.2_Missense_Mutation_p.R2644T|VPS13D_uc001atx.2_Missense_Mutation_p.R1832T|VPS13D_uc001aty.1_Missense_Mutation_p.R382T	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	2644	UBA.				protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGCTGGCTAGGCTGCAGGAG	0.328													9	184	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16358202	16358202	+	Intron	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16358202C>A	uc001axu.2	+						CLCNKA_uc001axt.2_Intron|CLCNKA_uc001axv.2_Intron|CLCNKA_uc010obw.1_Intron|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010oby.1_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CCTCTGCCTGCAGCTCCCACC	0.627													21	20	---	---	---	---	PASS
FUCA1	2517	broad.mit.edu	37	1	24192068	24192068	+	Missense_Mutation	SNP	G	C	C	rs2228424	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24192068G>C	uc001bie.2	-	2	482	c.437C>G	c.(436-438)CCG>CGG	p.P146R	FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	146					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CACAGGACTCGGCCAGTTTGT	0.512													29	95	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24384007	24384007	+	Silent	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24384007C>G	uc001bin.3	-	37	4324	c.4161G>C	c.(4159-4161)GGG>GGC	p.G1387G	MYOM3_uc001bil.3_Silent_p.G280G|MYOM3_uc001bim.3_Silent_p.G1044G	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1387	Ig-like C2-type 4.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		TGACCTCTGTCCCCCTCACTT	0.557													52	21	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34035025	34035025	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34035025G>C	uc001bxn.1	-	53	8115	c.8086C>G	c.(8086-8088)CGT>GGT	p.R2696G	CSMD2_uc001bxm.1_Missense_Mutation_p.R2694G	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2696	Sushi 17.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATGCACTCACGCACCCTGGAG	0.572													34	34	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35578967	35578967	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35578967G>T	uc001bym.2	+	11	1684	c.1536G>T	c.(1534-1536)AAG>AAT	p.K512N	ZMYM1_uc001byn.2_Missense_Mutation_p.K512N|ZMYM1_uc010ohu.1_Missense_Mutation_p.K493N|ZMYM1_uc001byo.2_Missense_Mutation_p.K152N|ZMYM1_uc009vut.2_Missense_Mutation_p.K437N	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	512	TTF-type.					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AATTCAGAAAGCATGAAAAAA	0.363													9	186	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39757596	39757596	+	Silent	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39757596A>T	uc010ois.1	+	17	2020	c.1815A>T	c.(1813-1815)CGA>CGT	p.R605R	MACF1_uc001cda.1_Silent_p.R513R	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	605					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AACTGGAGCGAGCAGAGTGGG	0.448													34	12	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39823278	39823278	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39823278C>A	uc010oiu.1	+	9	7107	c.6976C>A	c.(6976-6978)CAT>AAT	p.H2326N	MACF1_uc010ois.1_Missense_Mutation_p.H1824N|MACF1_uc001cda.1_Missense_Mutation_p.H1732N|MACF1_uc001cdc.1_Missense_Mutation_p.H911N|MACF1_uc001cdb.1_Missense_Mutation_p.H911N	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3891	Spectrin 1.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTGCAGGATCATAAAGAGTT	0.502													5	47	---	---	---	---	PASS
RPS8	6202	broad.mit.edu	37	1	45241263	45241263	+	5'UTR	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45241263C>G	uc001cmi.2	+	1					SNORD55_uc001cmj.1_5'Flank|SNORD46_uc001cmk.1_5'Flank|SNORD38A_uc009vxi.2_5'Flank|SNORD38B_uc001cml.2_5'Flank	NM_001012	NP_001003	P62241	RS8_HUMAN	ribosomal protein S8						endocrine pancreas development|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CAGCCAGCGCCGAGCGATGGG	0.562													47	167	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45291982	45291982	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45291982G>A	uc010olf.1	-	19	3066	c.3054C>T	c.(3052-3054)CCC>CCT	p.P1018P	PTCH2_uc010olg.1_Silent_p.P716P	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	1018	Helical; (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					GGATCACCACGGGGATGGCAC	0.582									Basal_Cell_Nevus_syndrome				20	51	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54610420	54610420	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54610420A>G	uc001cwv.1	-	2	994	c.146T>C	c.(145-147)CTG>CCG	p.L49P		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	49	CUB 1.					extracellular region				ovary(1)	1						GTAGGGGTACAGTCTAGGGAA	0.567													9	15	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66036306	66036306	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66036306A>T	uc001dci.2	+	4	393	c.191A>T	c.(190-192)TAT>TTT	p.Y64F	LEPR_uc001dcg.2_Missense_Mutation_p.Y64F|LEPR_uc001dch.2_Missense_Mutation_p.Y64F|LEPR_uc009waq.2_Missense_Mutation_p.Y64F|LEPR_uc001dcj.2_Missense_Mutation_p.Y64F|LEPR_uc001dck.2_Missense_Mutation_p.Y64F	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	64	Extracellular (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AATGGACATTATGAGACAGCT	0.383													33	59	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71331390	71331390	+	Intron	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71331390C>A	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	TTGAAGCTCGCAAGTGTTAGT	0.438													20	36	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	72748157	72748157	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72748157C>A	uc001dfw.2	-	1	121	c.21G>T	c.(19-21)GTG>GTT	p.V7V	NEGR1_uc010oqs.1_Silent_p.V7V	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	7					cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AAGCACCCTGCACCAACAGCA	0.642													3	33	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037348	75037348	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037348G>A	uc001dgg.2	-	14	4265	c.4046C>T	c.(4045-4047)ACG>ATG	p.T1349M		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1349	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TGTTTCTGCCGTTTCACCACC	0.532													32	67	---	---	---	---	PASS
AK5	26289	broad.mit.edu	37	1	77987624	77987624	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77987624G>A	uc001dhn.2	+	12	1681	c.1424G>A	c.(1423-1425)CGC>CAC	p.R475H	AK5_uc001dho.2_Missense_Mutation_p.R449H	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1	475					ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						GAGTTCGGACGCAGGGTGAGT	0.527													19	31	---	---	---	---	PASS
GIPC2	54810	broad.mit.edu	37	1	78511862	78511862	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78511862C>A	uc001dik.2	+	1	274	c.84C>A	c.(82-84)GGC>GGA	p.G28G		NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2	28						cytoplasm				ovary(1)	1						CGGGCGCGGGCGGCGGGAGCC	0.721													3	2	---	---	---	---	PASS
CDC14A	8556	broad.mit.edu	37	1	100819406	100819406	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100819406A>T	uc001dtg.3	+	2	626	c.138A>T	c.(136-138)GAA>GAT	p.E46D	CDC14A_uc009web.2_Intron|CDC14A_uc010oui.1_5'UTR|CDC14A_uc001dte.3_Missense_Mutation_p.E46D|CDC14A_uc001dtf.2_Missense_Mutation_p.E46D|CDC14A_uc009wed.1_5'UTR|CDC14A_uc009wee.2_Missense_Mutation_p.E46D|CDC14A_uc009wec.1_Missense_Mutation_p.E46D	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	46	A.				cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TGGTCTATGAAAAGTAAGTTT	0.363													8	6	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109810620	109810620	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109810620G>T	uc001dxa.3	+	17	6317	c.6256G>T	c.(6256-6258)GCC>TCC	p.A2086S		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	2086	Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCGGCTGCTGGCCCACGAGAG	0.657													14	23	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116519279	116519279	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116519279G>A	uc001egb.3	+	1	161	c.31G>A	c.(31-33)GGG>AGG	p.G11R	SLC22A15_uc001ega.2_Missense_Mutation_p.G11R	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	11					ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCAGGCGGTGGGGGAGATGGG	0.711													8	22	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150444718	150444718	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150444718G>T	uc009wlr.2	+	11	3495	c.3294G>T	c.(3292-3294)ATG>ATT	p.M1098I	RPRD2_uc010pcc.1_3'UTR|RPRD2_uc001eup.3_Missense_Mutation_p.M1072I	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	1098							protein binding			ovary(1)	1						ATAGGAGGATGTCAGGGGAGC	0.542													18	26	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150526475	150526475	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150526475C>A	uc001eux.2	+	6	1244	c.1008C>A	c.(1006-1008)GGC>GGA	p.G336G	ADAMTSL4_uc001euw.2_Silent_p.G336G|ADAMTSL4_uc009wlw.2_Silent_p.G336G|ADAMTSL4_uc010pcg.1_Silent_p.G336G	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	336					apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AGCACCCGGGCGCCTGGCTGC	0.692													23	23	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154316910	154316910	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154316910C>T	uc001fex.2	+	20	2174	c.2174C>T	c.(2173-2175)ACG>ATG	p.T725M		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	711	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AAGATGCTGACGGATGACATG	0.562													90	142	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156622070	156622070	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156622070C>A	uc001fpp.2	+	8	1664	c.1328C>A	c.(1327-1329)ACG>AAG	p.T443K	BCAN_uc001fpo.2_Missense_Mutation_p.T443K	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	443	Glu-rich.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTACCGCCCACGGGGTTCTCA	0.333													75	71	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156639207	156639207	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156639207C>A	uc001fpq.2	-	4	4906	c.4773G>T	c.(4771-4773)TGG>TGT	p.W1591C		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1591	Tail.			TSW -> RSS (in Ref. 1; CAA46780).	brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGCCCCTGCCCAAGAGGTCT	0.587													85	59	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158735905	158735905	+	Missense_Mutation	SNP	T	A	A	rs75984757	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158735905T>A	uc010piq.1	-	1	568	c.568A>T	c.(568-570)ACT>TCT	p.T190S		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					GACGTATCAGTGCAAGCCAAA	0.453													96	130	---	---	---	---	PASS
FCRLA	84824	broad.mit.edu	37	1	161680553	161680553	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161680553C>A	uc001gbe.2	+	3	394	c.152C>A	c.(151-153)GCC>GAC	p.A51D	FCRLA_uc001gbd.2_Missense_Mutation_p.A45D|FCRLA_uc001gbf.2_Missense_Mutation_p.A45D|FCRLA_uc001gbg.2_Intron|FCRLA_uc009wuo.2_Intron|FCRLA_uc009wup.2_Missense_Mutation_p.A45D|FCRLA_uc009wuq.2_Intron	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	Fc receptor-like and mucin-like 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell differentiation	cytoplasm|extracellular region					0	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			TCTTCAGCTGCCAGTTTTGAG	0.532													54	61	---	---	---	---	PASS
C1orf110	339512	broad.mit.edu	37	1	162829412	162829412	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162829412G>T	uc001gck.2	-	2	200	c.25C>A	c.(25-27)CAA>AAA	p.Q9K	C1orf110_uc009wux.1_Missense_Mutation_p.Q9K	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512	9											0						TTATACAATTGTCCCCTGACC	0.443													47	52	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165398161	165398161	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165398161G>T	uc001gda.2	-	2	392	c.92C>A	c.(91-93)GCA>GAA	p.A31E		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	31	Modulating (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	GGACAAGGCTGCTGATGGGCT	0.587													54	85	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175372337	175372337	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175372337T>C	uc001gkp.1	-	2	996	c.915A>G	c.(913-915)GGA>GGG	p.G305G	TNR_uc009wwu.1_Silent_p.G305G|TNR_uc010pmz.1_Silent_p.G305G	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	305	Cys-rich.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CCTCACATTGTCCTCGCCCAC	0.617													66	78	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183497094	183497094	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183497094G>A	uc001gqg.2	+	6	610	c.488G>A	c.(487-489)CGA>CAA	p.R163Q	SMG7_uc010pob.1_Missense_Mutation_p.R192Q|SMG7_uc001gqf.2_Missense_Mutation_p.R163Q|SMG7_uc001gqh.2_Missense_Mutation_p.R163Q|SMG7_uc001gqi.2_Missense_Mutation_p.R121Q|SMG7_uc010poc.1_Missense_Mutation_p.R121Q	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	163	TPR 1.			R->E: Abolishes interaction with UPF1; when associated with E-66.	mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TTCTTAGCTCGATACAGAAAC	0.403													4	99	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186316424	186316424	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186316424C>G	uc001grv.2	-	22	3240	c.2943G>C	c.(2941-2943)CAG>CAC	p.Q981H		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	981	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTATACATACCTGTTTTTCCT	0.333			T	NTRK1	papillary thyroid								66	117	---	---	---	---	PASS
CDC73	79577	broad.mit.edu	37	1	193218893	193218893	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193218893G>T	uc001gtb.2	+	16	1694	c.1451G>T	c.(1450-1452)CGT>CTT	p.R484L		NM_024529	NP_078805	Q6P1J9	CDC73_HUMAN	parafibromin	484					cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						GATGAAGTTCGTCTGGATCCA	0.338									Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				39	25	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196285160	196285160	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196285160T>C	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						ATCTAGGCTTTGATAAAAATC	0.383													39	35	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196303136	196303136	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196303136G>T	uc001gtd.1	-	17	1898	c.1838C>A	c.(1837-1839)ACC>AAC	p.T613N	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.T563N|KCNT2_uc001gtf.1_Missense_Mutation_p.T613N|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.T613N|KCNT2_uc001gth.1_Missense_Mutation_p.T134N	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	613	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						AAGAGACAGGGTAGGGCCACT	0.398													5	113	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196963327	196963327	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196963327G>T	uc001gts.3	+	4	676	c.548G>T	c.(547-549)GGA>GTA	p.G183V		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	183	Sushi 3.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						ATAAGAGTTGGATCAGACTCA	0.353													133	152	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200550341	200550341	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200550341T>C	uc010ppk.1	-	20	3762	c.3323A>G	c.(3322-3324)TAT>TGT	p.Y1108C	KIF14_uc010ppj.1_Missense_Mutation_p.Y617C	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	1108	Required for CIT-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						GCCAAAAACATAGTATGTTTT	0.294													104	46	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204380189	204380189	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380189G>A	uc001hav.3	-	1	756	c.351C>T	c.(349-351)GCC>GCT	p.A117A		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	117					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GCGCTGTGGGGGCGGCTGGTT	0.577													98	198	---	---	---	---	PASS
LRRN2	10446	broad.mit.edu	37	1	204588804	204588804	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204588804G>A	uc001hbe.1	-	3	705	c.317C>T	c.(316-318)TCG>TTG	p.S106L	MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.S106L|LRRN2_uc009xbf.1_Missense_Mutation_p.S106L|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor	106	LRR 2.|Extracellular (Potential).				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TCGGGCATCCGAAAAGCTGTT	0.602													123	160	---	---	---	---	PASS
C1orf186	440712	broad.mit.edu	37	1	206239444	206239444	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206239444T>A	uc001hdt.1	-	6	1093	c.454A>T	c.(454-456)AGT>TGT	p.S152C		NM_001007544	NP_001007545	Q6ZWK4	CA186_HUMAN	hypothetical protein LOC440712	152						integral to membrane					0			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TACCAGAAACTGGGCTTGTGT	0.418													63	20	---	---	---	---	PASS
DYRK3	8444	broad.mit.edu	37	1	206809470	206809470	+	Intron	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206809470G>A	uc001hej.2	+						DYRK3_uc001hek.2_Intron|DYRK3_uc001hei.2_Intron	NM_003582	NP_003573	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|central_nervous_system(1)	3	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GAGCCCGGGAGCAATACCTTG	0.498													12	121	---	---	---	---	PASS
FAM71A	149647	broad.mit.edu	37	1	212798339	212798339	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212798339C>A	uc001hjk.2	+	1	524	c.120C>A	c.(118-120)TTC>TTA	p.F40L	uc010pth.1_Intron	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN	hypothetical protein LOC149647	40										skin(3)|ovary(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		ACGATATATTCAAGTATGCAC	0.493													109	46	---	---	---	---	PASS
TGFB2	7042	broad.mit.edu	37	1	218607483	218607483	+	Silent	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218607483G>C	uc001hlm.2	+	3	1223	c.570G>C	c.(568-570)GTG>GTC	p.V190V	TGFB2_uc001hln.2_Silent_p.V218V|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2	190					activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GCAAAGTTGTGAAAACAAGAG	0.453													56	282	---	---	---	---	PASS
NVL	4931	broad.mit.edu	37	1	224420909	224420909	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224420909C>T	uc001hok.2	-	21	2492	c.2449G>A	c.(2449-2451)GAA>AAA	p.E817K	NVL_uc001hol.2_Missense_Mutation_p.E711K|NVL_uc010pvd.1_Missense_Mutation_p.E726K|NVL_uc010pve.1_Missense_Mutation_p.E628K|NVL_uc010pvf.1_RNA	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	817						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		GTACCTTTTTCATTTCCACTC	0.383													14	119	---	---	---	---	PASS
ZNF695	57116	broad.mit.edu	37	1	247151459	247151459	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247151459C>T	uc009xgu.2	-	4	503	c.358G>A	c.(358-360)GAG>AAG	p.E120K	ZNF695_uc001ica.2_RNA|ZNF695_uc001icb.1_RNA|ZNF695_uc009xgt.1_RNA|ZNF695_uc001ibx.2_Missense_Mutation_p.E120K|ZNF695_uc001iby.2_Intron|ZNF695_uc001icc.2_Missense_Mutation_p.E108K	NM_020394	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein SBZF3	120					regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CGTAATTTCTCAAGACAACAT	0.408													6	375	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247599379	247599379	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247599379A>T	uc001icr.2	+	8	2744	c.2606A>T	c.(2605-2607)GAC>GTC	p.D869V	NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Missense_Mutation_p.D869V|NLRP3_uc001icw.2_Missense_Mutation_p.D812V|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Missense_Mutation_p.D847V	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	869	LRR 5.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCCTTGGGAGACTCAGGAGTC	0.473													24	88	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248027998	248027998	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248027998T>C	uc001ido.2	+							NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATCCACGGTGTCACCTCAGGA	0.567													34	16	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248028112	248028112	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248028112G>T	uc001ido.2	+	3	670	c.622G>T	c.(622-624)GAG>TAG	p.E208*		NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	208	Potential.					intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGAGGCGGAGGAGCGAGCGAC	0.632													25	58	---	---	---	---	PASS
OR2L2	26246	broad.mit.edu	37	1	248202041	248202041	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248202041C>T	uc001idw.2	+	1	568	c.472C>T	c.(472-474)CAC>TAC	p.H158Y	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	158	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTCTTGTGCTCACACAGTATA	0.428													152	66	---	---	---	---	PASS
OR2T3	343173	broad.mit.edu	37	1	248637193	248637193	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248637193G>C	uc001iel.1	+	1	542	c.542G>C	c.(541-543)AGT>ACT	p.S181T		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAAATCCTGAGTTTTTTCTGT	0.522													154	63	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685741	248685741	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685741G>A	uc001ien.1	+	1	794	c.794G>A	c.(793-795)AGG>AAG	p.R265K		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCGGCCAATAGGAGATCCAAA	0.443													25	139	---	---	---	---	PASS
OR14I1	401994	broad.mit.edu	37	1	248845393	248845393	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248845393G>T	uc001ieu.1	-	1	213	c.213C>A	c.(211-213)TAC>TAA	p.Y71*		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGACTGAGATGTAGCACAGAT	0.478													30	22	---	---	---	---	PASS
ACP1	52	broad.mit.edu	37	2	272235	272235	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:272235G>C	uc002qwg.2	+	3	257	c.161G>C	c.(160-162)CGG>CCG	p.R54P	ACP1_uc002qwd.2_Missense_Mutation_p.G106R|ACP1_uc002qwe.3_RNA|ACP1_uc002qwh.2_RNA|ACP1_uc002qwf.2_Intron	NM_007099	NP_009030	P24666	PPAC_HUMAN	acid phosphatase 1, soluble isoform b	54						cytoplasm|internal side of plasma membrane|nucleus|soluble fraction	acid phosphatase activity|identical protein binding|non-membrane spanning protein tyrosine phosphatase activity			skin(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)		AACGTGGGCCGGTCCCCAGAC	0.502													8	16	---	---	---	---	PASS
ACP1	52	broad.mit.edu	37	2	272236	272236	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:272236G>T	uc002qwg.2	+	3	258	c.162G>T	c.(160-162)CGG>CGT	p.R54R	ACP1_uc002qwd.2_Missense_Mutation_p.G106V|ACP1_uc002qwe.3_RNA|ACP1_uc002qwh.2_RNA|ACP1_uc002qwf.2_Intron	NM_007099	NP_009030	P24666	PPAC_HUMAN	acid phosphatase 1, soluble isoform b	54						cytoplasm|internal side of plasma membrane|nucleus|soluble fraction	acid phosphatase activity|identical protein binding|non-membrane spanning protein tyrosine phosphatase activity			skin(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)		ACGTGGGCCGGTCCCCAGACC	0.498													7	16	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1947066	1947066	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1947066C>A	uc002qxe.2	-	9	1020	c.193G>T	c.(193-195)GAT>TAT	p.D65Y	MYT1L_uc002qxd.2_Missense_Mutation_p.D65Y	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	65					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGCTGTTTATCTTGTGTTTTT	0.418													11	2	---	---	---	---	PASS
NOL10	79954	broad.mit.edu	37	2	10743288	10743288	+	Intron	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10743288G>T	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		TGAGCCCTGGGAAAGGTCAAA	0.398													6	15	---	---	---	---	PASS
EHD3	30845	broad.mit.edu	37	2	31467261	31467261	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31467261G>A	uc002rnu.2	+	2	957	c.349G>A	c.(349-351)GAT>AAT	p.D117N	EHD3_uc010ymt.1_Missense_Mutation_p.D117N	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	117					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CCTGGTGGTGGATCCCAAGAA	0.552													47	28	---	---	---	---	PASS
FAM98A	25940	broad.mit.edu	37	2	33810284	33810284	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33810284C>T	uc002rpa.1	-	8	1190	c.1116G>A	c.(1114-1116)GGG>GGA	p.G372G	FAM98A_uc010yne.1_Silent_p.G177G|FAM98A_uc010ynd.1_Silent_p.G203G|FAM98A_uc002roz.1_Silent_p.G210G	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940	373	Gly-rich.									ovary(1)	1	all_hematologic(175;0.115)					CTCTTCCTCCCCCTCGGCCAC	0.562													16	134	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39250233	39250233	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39250233T>A	uc002rrk.3	-	10	1377	c.1336A>T	c.(1336-1338)ATG>TTG	p.M446L	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.M60L|SOS1_uc002rrl.2_Missense_Mutation_p.M178L	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	446	PH.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				GTTCCTTCCATTATAAATTCA	0.388									Noonan_syndrome				57	122	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64140347	64140347	+	Intron	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64140347G>A	uc002scq.2	-						VPS54_uc002scp.2_Intron|VPS54_uc002scn.2_Intron|VPS54_uc002sco.2_Intron|VPS54_uc010fct.2_Intron	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0						TTAAACGCAAGAATCCATACC	0.368													20	26	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71892406	71892406	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71892406G>T	uc002sie.2	+	46	5548	c.5172G>T	c.(5170-5172)CAG>CAT	p.Q1724H	DYSF_uc010feg.2_Missense_Mutation_p.Q1755H|DYSF_uc010feh.2_Missense_Mutation_p.Q1731H|DYSF_uc002sig.3_Missense_Mutation_p.Q1710H|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.Q1745H|DYSF_uc010fef.2_Missense_Mutation_p.Q1762H|DYSF_uc010fei.2_Missense_Mutation_p.Q1741H|DYSF_uc010fek.2_Missense_Mutation_p.Q1742H|DYSF_uc010fej.2_Missense_Mutation_p.Q1732H|DYSF_uc010fel.2_Missense_Mutation_p.Q1711H|DYSF_uc010feo.2_Missense_Mutation_p.Q1756H|DYSF_uc010fem.2_Missense_Mutation_p.Q1746H|DYSF_uc010fen.2_Missense_Mutation_p.Q1763H|DYSF_uc002sif.2_Missense_Mutation_p.Q1725H|DYSF_uc010yqy.1_Missense_Mutation_p.Q605H|DYSF_uc010yqz.1_Missense_Mutation_p.Q485H	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1724	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						TAATGTTTCAGGATAAAGAAT	0.557													37	92	---	---	---	---	PASS
C2orf65	130951	broad.mit.edu	37	2	74785924	74785924	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74785924G>T	uc002smy.2	-	11	1629	c.1512C>A	c.(1510-1512)TCC>TCA	p.S504S	C2orf65_uc010ysa.1_Silent_p.S500S|C2orf65_uc010ffp.2_Silent_p.S153S|C2orf65_uc002smx.2_Silent_p.S256S	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	504					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						CTGGCATCTTGGAGGCTCTGC	0.592													87	55	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79254169	79254169	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79254169C>T	uc002snw.2	+	4	290	c.205C>T	c.(205-207)CAG>TAG	p.Q69*	REG3G_uc002snx.2_Nonsense_Mutation_p.Q69*|REG3G_uc010ffu.2_Intron	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	69	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						GCTGGCTTGCCAGAAGCGGCC	0.547													58	166	---	---	---	---	PASS
REEP1	65055	broad.mit.edu	37	2	86481814	86481814	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86481814T>C	uc002srh.3	-						REEP1_uc010ytg.1_Intron|REEP1_uc010yth.1_Intron|REEP1_uc010yti.1_Intron	NM_022912	NP_075063	Q9H902	REEP1_HUMAN	receptor accessory protein 1 isoform 2						cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0						CAGCATATATTACCTTTTCTT	0.398													74	41	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112536327	112536327	+	Silent	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112536327G>C	uc002thi.2	-	45	5557	c.5310C>G	c.(5308-5310)CTC>CTG	p.L1770L		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1770					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						CTGAAGAAAAGAGATCCAGAA	0.383													20	68	---	---	---	---	PASS
INSIG2	51141	broad.mit.edu	37	2	118865897	118865897	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118865897G>A	uc002tlk.2	+	6	883	c.677G>A	c.(676-678)TGA>TAA	p.*226*	INSIG2_uc010yye.1_Silent_p.*118*|INSIG2_uc002tll.2_Missense_Mutation_p.E85K	NM_016133	NP_057217	Q9Y5U4	INSI2_HUMAN	insulin induced protein 2	226					ER-nuclear sterol response pathway	SREBP-SCAP-Insig complex				ovary(1)|central_nervous_system(1)	2						CATCAGGAATGAAGAAGGCAA	0.318													16	68	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122285374	122285374	+	Splice_Site	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122285374C>G	uc002tnc.2	-	5	860	c.470_splice	c.e5+1	p.A157_splice	CLASP1_uc010yyy.1_Splice_Site|CLASP1_uc010yyz.1_Splice_Site_p.A157_splice|CLASP1_uc010yza.1_Splice_Site_p.A157_splice|CLASP1_uc010yzb.1_Splice_Site|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Splice_Site_p.A157_splice	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CCCAGACTTACGCATTGAGTG	0.318													39	24	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128409093	128409093	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128409093T>A	uc010yzn.1	+	4	1479	c.868T>A	c.(868-870)TAC>AAC	p.Y290N	LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.Y290N|GPR17_uc010yzo.1_Missense_Mutation_p.Y262N|GPR17_uc002tpd.2_Missense_Mutation_p.Y262N	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	290	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		CGTGCTGCACTACCGCAGCCA	0.642													33	5	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138373750	138373750	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138373750C>G	uc002tva.1	+	17	3342	c.3342C>G	c.(3340-3342)TGC>TGG	p.C1114W	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AATAGTCATGCGATCCCCACA	0.413													112	17	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138373770	138373770	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138373770G>A	uc002tva.1	+	17	3362	c.3362G>A	c.(3361-3363)AGA>AAA	p.R1121K	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ACAATGCAGAGAAGAACTCGC	0.418													135	18	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149227683	149227683	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149227683G>A	uc002twm.3	+	9	3159	c.2171G>A	c.(2170-2172)GGG>GAG	p.G724E	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.G724E|MBD5_uc002twn.1_Missense_Mutation_p.G165E	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	724						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CCGGGTTGTGGGGCCTCAAAT	0.453													21	67	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163130464	163130464	+	Intron	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163130464C>T	uc002uce.2	-							NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1						detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						TCTGTAGAAACATTTTAATAA	0.294													21	2	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167304128	167304128	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167304128T>G	uc002udu.1	-	11	1508	c.1381A>C	c.(1381-1383)AAG>CAG	p.K461Q	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	461					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TTACCTTCCTTATGTCTGAGA	0.343													103	13	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179449700	179449700	+	Intron	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179449700A>C	uc010zfg.1	-						uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGCATCTACATGAACCAAGA	0.448													140	9	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179509320	179509320	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179509320C>G	uc010zfg.1	-	167	32952	c.32728G>C	c.(32728-32730)GAA>CAA	p.E10910Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_RNA|TTN_uc002umx.1_Missense_Mutation_p.E177Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11837							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGGTTTTTCAGGAACTTTC	0.333													6	24	---	---	---	---	PASS
C2orf69	205327	broad.mit.edu	37	2	200790045	200790045	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200790045T>C	uc010zhb.1	+	2	777	c.594T>C	c.(592-594)AGT>AGC	p.S198S		NM_153689	NP_710156	Q8N8R5	CB069_HUMAN	hypothetical protein LOC205327 precursor	198						extracellular region				central_nervous_system(1)	1						TTAATTTAAGTCAGAATAGTT	0.343													149	6	---	---	---	---	PASS
KLF7	8609	broad.mit.edu	37	2	207988717	207988717	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207988717C>A	uc002vbz.1	-	2	836	c.514G>T	c.(514-516)GCT>TCT	p.A172S	KLF7_uc002vca.1_Missense_Mutation_p.A172S|KLF7_uc010zix.1_Missense_Mutation_p.A144S	NM_003709	NP_003700	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	172					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		GAGCTGAGAGCAGCCTTCTTG	0.612													110	10	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216296604	216296604	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216296604A>T	uc002vfa.2	-	4	765	c.499T>A	c.(499-501)TGT>AGT	p.C167S	FN1_uc002vfb.2_Missense_Mutation_p.C167S|FN1_uc002vfc.2_Missense_Mutation_p.C167S|FN1_uc002vfd.2_Missense_Mutation_p.C167S|FN1_uc002vfe.2_Missense_Mutation_p.C167S|FN1_uc002vff.2_Missense_Mutation_p.C167S|FN1_uc002vfg.2_Missense_Mutation_p.C167S|FN1_uc002vfh.2_Missense_Mutation_p.C167S|FN1_uc002vfi.2_Missense_Mutation_p.C167S|FN1_uc002vfj.2_Missense_Mutation_p.C167S|FN1_uc002vfl.2_Missense_Mutation_p.C167S	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	167	Fibrin- and heparin-binding 1.|Fibronectin type-I 3.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACACACACACTCTAACATG	0.498													222	12	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216296609	216296609	+	Nonsense_Mutation	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216296609A>C	uc002vfa.2	-	4	760	c.494T>G	c.(493-495)TTA>TGA	p.L165*	FN1_uc002vfb.2_Nonsense_Mutation_p.L165*|FN1_uc002vfc.2_Nonsense_Mutation_p.L165*|FN1_uc002vfd.2_Nonsense_Mutation_p.L165*|FN1_uc002vfe.2_Nonsense_Mutation_p.L165*|FN1_uc002vff.2_Nonsense_Mutation_p.L165*|FN1_uc002vfg.2_Nonsense_Mutation_p.L165*|FN1_uc002vfh.2_Nonsense_Mutation_p.L165*|FN1_uc002vfi.2_Nonsense_Mutation_p.L165*|FN1_uc002vfj.2_Nonsense_Mutation_p.L165*|FN1_uc002vfl.2_Nonsense_Mutation_p.L165*	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	165	Fibrin- and heparin-binding 1.|Fibronectin type-I 3.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CACACACTCTAACATGTAACC	0.483													233	15	---	---	---	---	PASS
ZNF142	7701	broad.mit.edu	37	2	219513804	219513804	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219513804G>A	uc002vin.2	-	6	1263	c.827C>T	c.(826-828)ACG>ATG	p.T276M	ZNF142_uc002vil.2_Missense_Mutation_p.T237M|ZNF142_uc010fvt.2_Missense_Mutation_p.T113M|ZNF142_uc002vim.2_Missense_Mutation_p.T113M	NM_001105537	NP_001099007	P52746	ZN142_HUMAN	zinc finger protein 142	276					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGCTGCTGCCGTGTGGCTCTT	0.572											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	60	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220075486	220075486	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220075486C>T	uc002vkc.1	-	16	2480	c.2203G>A	c.(2203-2205)GTC>ATC	p.V735I	ABCB6_uc010fwe.1_Missense_Mutation_p.V689I	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	735	ABC transporter.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAATGGCGACGCGCTGCTTC	0.612													13	46	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220494096	220494096	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220494096G>T	uc002vmp.3	+	4	717	c.448G>T	c.(448-450)GCA>TCA	p.A150S	SLC4A3_uc002vmn.2_Missense_Mutation_p.A150S|SLC4A3_uc002vmo.3_Missense_Mutation_p.A150S|SLC4A3_uc010fwm.2_5'UTR|SLC4A3_uc010fwn.1_5'Flank	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	150	Cytoplasmic.				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAATCTGAGGCAGAACCTGT	0.547													27	3	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231159004	231159004	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231159004C>T	uc002vql.2	+	21	2102	c.1987C>T	c.(1987-1989)CCT>TCT	p.P663S	SP140_uc010zma.1_RNA|SP140_uc002vqn.2_Missense_Mutation_p.P549S|SP140_uc002vqm.2_Missense_Mutation_p.P603S|SP140_uc010fxl.2_Missense_Mutation_p.P636S	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	663					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCTGCCTGATCCTCCAAGAAT	0.363													26	15	---	---	---	---	PASS
DTYMK	1841	broad.mit.edu	37	2	242625274	242625274	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242625274C>T	uc002wbz.1	-	2	178	c.149G>A	c.(148-150)GGC>GAC	p.G50D	DTYMK_uc010zpa.1_Missense_Mutation_p.G50D|DTYMK_uc010zpb.1_RNA|DTYMK_uc002wca.1_RNA	NM_012145	NP_036277	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	50					cell cycle|cell proliferation|nucleobase, nucleoside and nucleotide interconversion	cytosol	ATP binding|nucleoside phosphate kinase activity|thymidylate kinase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CAGAAGTTTGCCGATTTCAGT	0.388													4	120	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14941937	14941937	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14941937C>T	uc003bzc.2	+	8	3292	c.3182C>T	c.(3181-3183)TCC>TTC	p.S1061F	FGD5_uc011avk.1_Missense_Mutation_p.S1061F|FGD5_uc003bzd.2_Missense_Mutation_p.S139F	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1061	DH.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						TGTCCGGACTCCGCCGAGTAC	0.587													9	14	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14941938	14941938	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14941938C>T	uc003bzc.2	+	8	3293	c.3183C>T	c.(3181-3183)TCC>TCT	p.S1061S	FGD5_uc011avk.1_Silent_p.S1061S|FGD5_uc003bzd.2_Silent_p.S139S	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1061	DH.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						GTCCGGACTCCGCCGAGTACG	0.582													9	14	---	---	---	---	PASS
KAT2B	8850	broad.mit.edu	37	3	20082244	20082244	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20082244A>G	uc003cbq.2	+	1	721	c.275A>G	c.(274-276)GAG>GGG	p.E92G		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	92					cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AAGAAACTGGAGAAACTCGGA	0.647													16	3	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35748492	35748492	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35748492T>C	uc003cgb.2	+	10	977	c.713T>C	c.(712-714)TTA>TCA	p.L238S	ARPP21_uc003cga.2_Missense_Mutation_p.L238S|ARPP21_uc011axy.1_Missense_Mutation_p.L238S|ARPP21_uc003cgf.2_Missense_Mutation_p.L74S	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	238						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						TGTGAACATTTAAAAGATGAA	0.333													72	18	---	---	---	---	PASS
ZNF502	91392	broad.mit.edu	37	3	44763952	44763952	+	3'UTR	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44763952A>G	uc011baa.1	+	4					ZNF502_uc003cns.2_3'UTR|ZNF502_uc011bab.1_3'UTR|ZNF502_uc003cnt.2_3'UTR	NM_001134440	NP_001127912	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		TAATGCTGCCATTTAGGTTAT	0.468													64	12	---	---	---	---	PASS
MAP4	4134	broad.mit.edu	37	3	47957950	47957950	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47957950G>C	uc003csb.2	-	7	1893	c.1367C>G	c.(1366-1368)ACC>AGC	p.T456S	MAP4_uc003csc.3_Missense_Mutation_p.T456S|MAP4_uc011bbf.1_Missense_Mutation_p.T433S|MAP4_uc003csf.3_Missense_Mutation_p.T473S	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1	456	12.|17 X 14 AA tandem repeats.				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		GATCACGTTGGTTTCCGGGGG	0.517													51	7	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50403720	50403720	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50403720T>C	uc003daq.2	-	32	2746	c.2708A>G	c.(2707-2709)AAC>AGC	p.N903S	CACNA2D2_uc003dap.2_Missense_Mutation_p.N896S|CACNA2D2_uc003dao.2_5'Flank	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	903	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	ATGGTTCTGGTTTGACAGCAC	0.547													91	23	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97851543	97851543	+	Missense_Mutation	SNP	T	C	C	rs150362159	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851543T>C	uc011bgt.1	+	1	2	c.2T>C	c.(1-3)ATG>ACG	p.M1T		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TGTGAGGACATGGAAGAGGAA	0.398													82	97	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97852069	97852069	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97852069C>G	uc011bgt.1	+	1	528	c.528C>G	c.(526-528)CAC>CAG	p.H176Q		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TAGTACATCACATTTACTGTG	0.318													36	45	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108102447	108102447	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108102447T>C	uc003dxa.1	-	41	5878	c.5821A>G	c.(5821-5823)AAA>GAA	p.K1941E		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1941	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CATACCTTTTTCCCAAACTCT	0.358													30	142	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109049619	109049619	+	Nonsense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109049619G>C	uc003dxq.3	-	5	486	c.431C>G	c.(430-432)TCA>TGA	p.S144*	DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Nonsense_Mutation_p.S144*	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	144						nucleus	protein binding			upper_aerodigestive_tract(1)	1						TTTTTGCAATGATTTCCGGAT	0.403													59	62	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122259335	122259335	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122259335G>A	uc010hri.2	-	8	1999	c.1854C>T	c.(1852-1854)GGC>GGT	p.G618G	PARP9_uc003eff.3_Silent_p.G583G|PARP9_uc011bjs.1_Silent_p.G583G|PARP9_uc003efg.2_Silent_p.G163G|PARP9_uc003efi.2_Silent_p.G583G|PARP9_uc003efh.2_Silent_p.G618G|PARP9_uc003efj.2_Silent_p.G583G	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	618					cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		AGCGCCAAAGGCCTCGCTCCT	0.438													34	42	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122632069	122632069	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122632069C>T	uc003efz.1	-	17	2787	c.2483G>A	c.(2482-2484)GGC>GAC	p.G828D	SEMA5B_uc011bju.1_Missense_Mutation_p.G770D|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.G828D|SEMA5B_uc010hro.1_Missense_Mutation_p.G770D|SEMA5B_uc003efy.1_5'Flank	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	828	Extracellular (Potential).				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		GGAGCCGGAGCCGTCCGCGGG	0.647													11	12	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125856685	125856685	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125856685C>T	uc003eim.1	-	10	1385	c.1195G>A	c.(1195-1197)GAT>AAT	p.D399N	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Missense_Mutation_p.D298N|ALDH1L1_uc003eio.2_Missense_Mutation_p.D101N|ALDH1L1_uc010hsf.1_Missense_Mutation_p.D425N	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	399					10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCCTCCTCATCGTCCCCTCGC	0.557													10	83	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134911454	134911454	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134911454T>A	uc003eqt.2	+	11	2139	c.1919T>A	c.(1918-1920)CTG>CAG	p.L640Q	EPHB1_uc003equ.2_Missense_Mutation_p.L201Q	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	640	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						CGTTTGAAACTGCCAGGCAAG	0.522													17	20	---	---	---	---	PASS
SOX14	8403	broad.mit.edu	37	3	137483941	137483941	+	Silent	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137483941C>G	uc003erm.1	+	1	363	c.315C>G	c.(313-315)CTC>CTG	p.L105L		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	105					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						CGGACCCGCTCAAGGCGGCTG	0.687													39	41	---	---	---	---	PASS
ARMC8	25852	broad.mit.edu	37	3	138014742	138014742	+	3'UTR	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138014742G>A	uc003esa.1	+	23					TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Intron|TXNDC6_uc003ese.1_Intron|ARMC8_uc011bmf.1_3'UTR|ARMC8_uc011bmg.1_3'UTR|ARMC8_uc011bmh.1_3'UTR|ARMC8_uc003esb.1_3'UTR|ARMC8_uc003esc.1_3'UTR|ARMC8_uc003esf.1_3'UTR	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2								binding				0						TGATGGGAGTGCCCCTGGGCA	0.483													11	50	---	---	---	---	PASS
P2RY14	9934	broad.mit.edu	37	3	150931768	150931768	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150931768C>G	uc003eyr.1	-	3	815	c.337G>C	c.(337-339)GGG>CGG	p.G113R	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY14_uc003eys.1_Missense_Mutation_p.G113R	NM_001081455	NP_001074924	Q15391	P2Y14_HUMAN	P2Y14 receptor	113	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled|UDP-activated nucleotide receptor activity			large_intestine(2)|ovary(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGATGAGCCCAAAGAACACA	0.458													33	79	---	---	---	---	PASS
MLF1	4291	broad.mit.edu	37	3	158322912	158322912	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158322912T>C	uc003fcb.2	+	7	865	c.728T>C	c.(727-729)ATT>ACT	p.I243T	MLF1_uc003fbz.2_Missense_Mutation_p.I218T|MLF1_uc003fca.2_Missense_Mutation_p.I218T|MLF1_uc003fbx.2_Missense_Mutation_p.I233T|MLF1_uc003fcc.2_Missense_Mutation_p.I274T|MLF1_uc003fby.2_Missense_Mutation_p.I169T|MLF1_uc010hvx.2_Missense_Mutation_p.I175T	NM_022443	NP_071888	P58340	MLF1_HUMAN	myeloid leukemia factor 1 isoform 1	243					cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding				0		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			AGTCCAGCCATTGAACATGGA	0.333			T	NPM1	AML								68	22	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167016199	167016199	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167016199A>T	uc003fep.2	-	18	2096	c.1773T>A	c.(1771-1773)TAT>TAA	p.Y591*	ZBBX_uc011bpc.1_Nonsense_Mutation_p.Y591*|ZBBX_uc003feq.2_Nonsense_Mutation_p.Y562*	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	591						intracellular	zinc ion binding			ovary(2)	2						CAAGTCCTTGATATTGTTTTG	0.299													55	264	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167240178	167240178	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167240178G>A	uc003fev.1	-	12	1949	c.1643C>T	c.(1642-1644)TCT>TTT	p.S548F	WDR49_uc003feu.1_Missense_Mutation_p.S373F|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	548										large_intestine(1)|ovary(1)|skin(1)	3						TTCCTCCTTAGAAAATAAAGA	0.308													5	185	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168830641	168830641	+	Silent	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168830641A>G	uc003ffi.3	-	8	2216	c.1947T>C	c.(1945-1947)ACT>ACC	p.T649T	MECOM_uc010hwk.1_Silent_p.T672T|MECOM_uc003ffj.3_Silent_p.T714T|MECOM_uc011bpi.1_Silent_p.T650T|MECOM_uc003ffn.3_Silent_p.T649T|MECOM_uc003ffk.2_Silent_p.T649T|MECOM_uc003ffl.2_Silent_p.T809T|MECOM_uc011bpj.1_Silent_p.T837T|MECOM_uc011bpk.1_Silent_p.T639T|MECOM_uc010hwn.2_Silent_p.T837T	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	649					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CAAGTGGGTCAGTTAGTTTTC	0.348													54	208	---	---	---	---	PASS
TNFSF10	8743	broad.mit.edu	37	3	172224300	172224300	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172224300C>A	uc003fid.2	-	5	923	c.828G>T	c.(826-828)GGG>GGT	p.G276G	TNFSF10_uc003fie.2_3'UTR	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	276	Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CTAAAAAGGCCCCAAAAAAAC	0.353													101	39	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180320683	180320683	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180320683G>T	uc003fkk.2	+	2	298	c.166G>T	c.(166-168)GAG>TAG	p.E56*	TTC14_uc003fkl.2_Nonsense_Mutation_p.E56*|TTC14_uc003fkm.2_Nonsense_Mutation_p.E56*	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	56							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTTAAGAAAAGAGAAGAGAGT	0.383													12	81	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180320684	180320684	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180320684A>T	uc003fkk.2	+	2	299	c.167A>T	c.(166-168)GAG>GTG	p.E56V	TTC14_uc003fkl.2_Missense_Mutation_p.E56V|TTC14_uc003fkm.2_Missense_Mutation_p.E56V	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	56							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTAAGAAAAGAGAAGAGAGTT	0.378													14	82	---	---	---	---	PASS
AHSG	197	broad.mit.edu	37	3	186338466	186338466	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186338466G>A	uc003fqk.3	+	7	932	c.851G>A	c.(850-852)GGC>GAC	p.G284D	AHSG_uc003fql.3_Missense_Mutation_p.G285D|AHSG_uc003fqm.3_Missense_Mutation_p.G283D|AHSG_uc010hyp.2_Missense_Mutation_p.G247D	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	284					acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		CCTCCACTTGGCGCACCTGGA	0.637													39	258	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186449324	186449324	+	Intron	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186449324T>G	uc011bsa.1	+						KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	ATATGCTTTTTAAAAACCAGG	0.338													14	63	---	---	---	---	PASS
CLDN1	9076	broad.mit.edu	37	3	190039819	190039819	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190039819G>A	uc003fsh.2	-	1	397	c.177C>T	c.(175-177)ACC>ACT	p.T59T		NM_021101	NP_066924	O95832	CLD1_HUMAN	claudin 1	59	Extracellular (Potential).				calcium-independent cell-cell adhesion|interspecies interaction between organisms	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity			lung(1)	1	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		GGATCTGCCCGGTGCTCTGCG	0.627													173	42	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4190615	4190615	+	Missense_Mutation	SNP	A	T	T	rs147866723		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4190615A>T	uc003ghp.1	-	6	1784	c.1754T>A	c.(1753-1755)ATT>AAT	p.I585N		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	585	Helical; (Potential).				biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTTGACCACAATTATCCAGGG	0.468													11	120	---	---	---	---	PASS
AFAP1	60312	broad.mit.edu	37	4	7844926	7844926	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7844926C>A	uc003gkg.1	-	5	759	c.486G>T	c.(484-486)CGG>CGT	p.R162R	AFAP1_uc011bwk.1_Silent_p.R162R	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1	162	PH 1.					actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						ACCGCTTCTTCCGCAGCAGGA	0.547													30	82	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22438155	22438155	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22438155T>C	uc003gqm.1	-	9	1460	c.1195A>G	c.(1195-1197)AGA>GGA	p.R399G	GPR125_uc010ieo.1_Missense_Mutation_p.R273G|GPR125_uc003gqn.1_Missense_Mutation_p.R173G|GPR125_uc003gqo.2_Missense_Mutation_p.R399G	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	399	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				CTATCACATCTGCGCCAAGCT	0.448													17	24	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	40936686	40936686	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40936686G>A	uc003gvl.2	-	9	1765	c.1135C>T	c.(1135-1137)CCC>TCC	p.P379S	APBB2_uc010ifu.2_5'UTR|APBB2_uc003gvm.2_Missense_Mutation_p.P358S|APBB2_uc003gvn.2_Missense_Mutation_p.P380S|APBB2_uc011byt.1_Missense_Mutation_p.P341S	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	379					cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						TTTAAACTGGGGTCCGGGTTA	0.433													9	25	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46930469	46930469	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46930469C>G	uc003gxg.2	-	9	1577	c.1438G>C	c.(1438-1440)GGA>CGA	p.G480R		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	480	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AGTCTTGATCCAAACACGTGA	0.493													37	63	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	54880075	54880075	+	Intron	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54880075G>T	uc003haa.2	+						CHIC2_uc003haj.1_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TAGACAAGTAGGAAAGTAAAA	0.358			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			23	40	---	---	---	---	PASS
PPAT	5471	broad.mit.edu	37	4	57269556	57269556	+	Silent	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57269556A>G	uc003hbr.2	-	4	616	c.414T>C	c.(412-414)CAT>CAC	p.H138H		NM_002703	NP_002694	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	138	Glutamine amidotransferase type-2.				glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Glutamine(DB00130)|Thioguanine(DB00352)	GACCAATACCATGACGCAGAA	0.453													26	20	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65147199	65147199	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65147199G>A	uc003hcv.2	-	10	1020	c.911C>T	c.(910-912)ACC>ATC	p.T304I	TECRL_uc010ihi.2_RNA	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	304					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						TACCTCATAGGTGTAGTTAGG	0.299													27	17	---	---	---	---	PASS
CENPC1	1060	broad.mit.edu	37	4	68385091	68385091	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68385091A>G	uc003hdd.1	-	6	644	c.461T>C	c.(460-462)TTA>TCA	p.L154S	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Missense_Mutation_p.L154S	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	154					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						GCCAACGGATAAGTAAAATTC	0.353													56	49	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72222840	72222840	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72222840G>T	uc003hfy.2	+	6	783	c.666G>T	c.(664-666)CGG>CGT	p.R222R	SLC4A4_uc010iic.2_Silent_p.R222R|SLC4A4_uc010iib.2_Silent_p.R222R|SLC4A4_uc003hfz.2_Silent_p.R222R|SLC4A4_uc003hgc.3_Silent_p.R178R|SLC4A4_uc003hga.2_Silent_p.R100R|SLC4A4_uc003hgb.3_Silent_p.R178R	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	222	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CCAACCTTCGGTCCCTGGCTG	0.478													56	47	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72631146	72631146	+	Intron	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72631146C>T	uc003hge.2	-						GC_uc003hgd.2_Intron|GC_uc010iie.2_Intron|GC_uc010iif.2_Intron	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor						hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	TGAAGGCACTCACTGATTAGC	0.294													52	62	---	---	---	---	PASS
ANTXR2	118429	broad.mit.edu	37	4	80954705	80954705	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80954705T>A	uc003hlz.3	-	9	1480	c.717A>T	c.(715-717)TTA>TTT	p.L239F	ANTXR2_uc003hly.3_Missense_Mutation_p.L239F|ANTXR2_uc003hlx.1_RNA|ANTXR2_uc010ijn.2_Intron	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2	239	Extracellular (Potential).					endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1						CTCTTCCACTTAAGACAATCT	0.353									Juvenile_Hyaline_Fibromatosis				47	20	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104511076	104511076	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104511076G>T	uc003hxe.1	-	5	1304	c.1161C>A	c.(1159-1161)CTC>CTA	p.L387L		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	387	Cytoplasmic (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TGGTGGTCTTGAGCTCTAGCT	0.493													29	72	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114284526	114284526	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114284526C>G	uc003ibe.3	+	40	10889	c.10789C>G	c.(10789-10791)CAA>GAA	p.Q3597E	ANK2_uc003ibd.3_Missense_Mutation_p.Q1503E|ANK2_uc003ibf.3_Missense_Mutation_p.Q1512E|ANK2_uc011cgc.1_Missense_Mutation_p.Q688E|ANK2_uc003ibg.3_Missense_Mutation_p.Q496E|ANK2_uc003ibh.3_Missense_Mutation_p.Q186E|ANK2_uc011cgd.1_Missense_Mutation_p.Q899E	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3564	Death.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CACTGAGGAGCAAATTCATCA	0.378													29	23	---	---	---	---	PASS
PLRG1	5356	broad.mit.edu	37	4	155467044	155467044	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155467044T>C	uc003iny.2	-	6	499	c.436A>G	c.(436-438)AGT>GGT	p.S146G	PLRG1_uc003inz.2_Missense_Mutation_p.S137G|PLRG1_uc011cil.1_5'UTR	NM_002669	NP_002660	O43660	PLRG1_HUMAN	pleiotropic regulator 1 (PRL1 homolog,	146						catalytic step 2 spliceosome|nuclear speck	protein binding|signal transducer activity|transcription corepressor activity				0	all_hematologic(180;0.215)	Renal(120;0.0854)				CGGTATTCACTTCCACTAGGG	0.428													17	17	---	---	---	---	PASS
PDGFC	56034	broad.mit.edu	37	4	157732119	157732119	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157732119C>A	uc003iph.1	-	3	856	c.365G>T	c.(364-366)CGC>CTC	p.R122L	PDGFC_uc003ipi.1_5'UTR|PDGFC_uc011cis.1_5'UTR|PDGFC_uc011cir.1_5'UTR	NM_016205	NP_057289	Q9NRA1	PDGFC_HUMAN	platelet-derived growth factor C precursor	122	CUB.				central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		ACCACACCAGCGCCCTAATAT	0.373													15	44	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160264516	160264516	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160264516G>T	uc003iqg.3	+	16	3041	c.2731G>T	c.(2731-2733)GCT>TCT	p.A911S		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	911	Ras-GEF.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TGGCCGAATGGCTTCAGTGAA	0.453													31	67	---	---	---	---	PASS
AADAT	51166	broad.mit.edu	37	4	171009536	171009536	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171009536T>C	uc003isr.2	-						AADAT_uc003iss.2_Intron|AADAT_uc003ist.2_Intron	NM_016228	NP_057312	Q8N5Z0	AADAT_HUMAN	kynurenine aminotransferase II						2-oxoglutarate metabolic process|biosynthetic process|glutamate metabolic process|lysine catabolic process	mitochondrial matrix	2-aminoadipate transaminase activity|kynurenine-oxoglutarate transaminase activity|protein homodimerization activity				0		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATGTTAAGTATTGATACTTAC	0.323													17	35	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3599553	3599553	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599553C>A	uc003jde.2	+	2	543	c.491C>A	c.(490-492)GCC>GAC	p.A164D		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	164	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						ATCATGCTGGCCATCATCACC	0.632													20	130	---	---	---	---	PASS
CCT5	22948	broad.mit.edu	37	5	10250467	10250467	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10250467G>T	uc003jeq.2	+	1	186	c.15G>T	c.(13-15)GGG>GGT	p.G5G	FAM173B_uc003jeo.2_5'Flank|FAM173B_uc003jep.2_5'Flank|FAM173B_uc010itr.2_5'Flank|CCT5_uc011cmq.1_5'UTR|CCT5_uc003jer.2_Silent_p.G5G|CCT5_uc010its.2_Silent_p.G5G|CCT5_uc011cmr.1_Silent_p.G5G|CCT5_uc011cms.1_5'Flank|CCT5_uc011cmt.1_5'Flank	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	5					'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						CGTCCATGGGGACCCTCGCCT	0.582													19	24	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24535872	24535872	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24535872C>G	uc003jgr.1	-	4	918	c.586G>C	c.(586-588)GCC>CCC	p.A196P	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	196	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ATGACTCTGGCGCTGTTCCCA	0.453										HNSCC(23;0.051)			36	47	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31317838	31317838	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31317838C>A	uc003jhe.1	+	11	2015	c.1689C>A	c.(1687-1689)ACC>ACA	p.T563T	CDH6_uc003jhd.1_Silent_p.T563T	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	563	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						AGATGAGCACCTATCTCTTGC	0.498													45	37	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31515295	31515295	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31515295G>T	uc003jhg.2	-	7	1449	c.1090C>A	c.(1090-1092)CGT>AGT	p.R364S	RNASEN_uc003jhh.2_Missense_Mutation_p.R327S|RNASEN_uc003jhi.2_Missense_Mutation_p.R327S|RNASEN_uc010iui.1_Missense_Mutation_p.R287S	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	364					gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TCCTCCCAACGAGCTCTCTTC	0.433													91	130	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576589	33576589	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576589C>A	uc003jia.1	-	19	3705	c.3542G>T	c.(3541-3543)AGA>ATA	p.R1181I	ADAMTS12_uc010iuq.1_Missense_Mutation_p.R1096I	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1181	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCCAGGTACTCTGATCTTGGT	0.498										HNSCC(64;0.19)			89	113	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33684122	33684122	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33684122C>A	uc003jia.1	-	4	836	c.673G>T	c.(673-675)GAG>TAG	p.E225*	ADAMTS12_uc010iuq.1_Nonsense_Mutation_p.E225*	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	225					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCCCACTTCTCCCGCCATAGC	0.468										HNSCC(64;0.19)			39	18	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40955555	40955555	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40955555G>T	uc003jmh.2	+	10	1274	c.1160G>T	c.(1159-1161)GGC>GTC	p.G387V	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	387	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TTCATATCTGGCCTTAGTTAC	0.438													67	115	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262353	45262353	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262353C>T	uc003jok.2	-	8	2368	c.2343G>A	c.(2341-2343)CGG>CGA	p.R781R		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	781	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCCTGACTTCCCGGGTCAGGT	0.602													32	34	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79026563	79026563	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79026563G>C	uc003kgc.2	+	2	2047	c.1975G>C	c.(1975-1977)GAG>CAG	p.E659Q		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	659						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATCCACAACTGAGAAGACTTC	0.473													8	30	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90012361	90012361	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90012361G>C	uc003kju.2	+	43	9358	c.9262G>C	c.(9262-9264)GAG>CAG	p.E3088Q	GPR98_uc003kjt.2_Missense_Mutation_p.E794Q|GPR98_uc003kjv.2_Missense_Mutation_p.E688Q	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3088	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTTCCTAAGAGAGCCAACAGC	0.408													3	31	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101834339	101834339	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101834339G>A	uc003knn.2	-	1	382	c.210C>T	c.(208-210)GCC>GCT	p.A70A	SLCO6A1_uc003kno.2_Silent_p.A70A|SLCO6A1_uc003knp.2_Silent_p.A70A|SLCO6A1_uc003knq.2_Silent_p.A70A	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	70	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CTGAGGACTTGGCTTTTTTCC	0.517													126	158	---	---	---	---	PASS
CEP120	153241	broad.mit.edu	37	5	122751802	122751802	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122751802T>A	uc003ktk.2	-	4	305	c.223A>T	c.(223-225)ATC>TTC	p.I75F	CEP120_uc011cwq.1_5'UTR|CEP120_uc010jcz.1_Missense_Mutation_p.I49F	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100	75						centrosome				ovary(1)	1						TGGAGTTTGATAGGAGTACGC	0.353													27	23	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126793018	126793018	+	3'UTR	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126793018G>A	uc003kuh.3	+	26					MEGF10_uc003kui.3_3'UTR	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGACACCAAAGGACCGCTTGG	0.428													21	33	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127730856	127730856	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127730856C>G	uc003kuu.2	-	9	1629	c.1190G>C	c.(1189-1191)GGC>GCC	p.G397A	FBN2_uc003kuv.2_Missense_Mutation_p.G364A	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	397	TB 2.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGTTCCGATGCCCCAGCAGCG	0.562													22	33	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128844943	128844943	+	Intron	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128844943C>T	uc003kvb.1	+						ADAMTS19_uc003kvc.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAGGTAAATGCCTTCTCCTGA	0.358													28	30	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128977662	128977662	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128977662T>C	uc003kvb.1	+						ADAMTS19_uc010jdh.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGGTAAGTCATTTGTGTTGTC	0.398													16	32	---	---	---	---	PASS
SHROOM1	134549	broad.mit.edu	37	5	132161784	132161784	+	Missense_Mutation	SNP	T	A	A	rs10054043		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132161784T>A	uc003kxx.2	-	4	854	c.49A>T	c.(49-51)ACT>TCT	p.T17S	SHROOM1_uc003kxy.1_Missense_Mutation_p.T17S	NM_133456	NP_597713	Q2M3G4	SHRM1_HUMAN	shroom family member 1	17					actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding			pancreas(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGCTGCTAGTGGACGAGGCC	0.711													8	7	---	---	---	---	PASS
PCDHA5	56143	broad.mit.edu	37	5	140202652	140202652	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140202652C>T	uc003lhl.2	+	1	1292	c.1292C>T	c.(1291-1293)TCG>TTG	p.S431L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.S431L|PCDHA5_uc003lhj.1_Missense_Mutation_p.S431L	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	431	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGGGGCTCGCCTTCGCTG	0.642													15	139	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140215062	140215062	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215062C>A	uc003lhq.2	+	1	1094	c.1094C>A	c.(1093-1095)CCA>CAA	p.P365Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.P365Q	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	365	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCCCAACCAGGTACCGTC	0.507													67	141	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725268	140725268	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725268C>T	uc003ljm.1	+	1	1668	c.1668C>T	c.(1666-1668)AAC>AAT	p.N556N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.N316N|PCDHGA3_uc011dap.1_Silent_p.N556N	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	556	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCAGAACGACAACGCGC	0.622													8	231	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140772461	140772461	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140772461G>T	uc003lkd.1	+	1	979	c.81G>T	c.(79-81)GGG>GGT	p.G27G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Silent_p.G27G	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	27					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAAATCGGGAGGGGACAGA	0.607													22	21	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141023886	141023886	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141023886A>G	uc003llk.2	-	17	1813	c.1762T>C	c.(1762-1764)TGG>CGG	p.W588R	FCHSD1_uc010jgg.2_Missense_Mutation_p.W271R|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	588	SH3 2.								FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCCCCTCCAGAAGCCGTCA	0.627													15	27	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148712275	148712275	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148712275C>G	uc003lqh.2	+	17	2124	c.1993C>G	c.(1993-1995)CTG>GTG	p.L665V	AFAP1L1_uc010jgy.2_Missense_Mutation_p.L665V|AFAP1L1_uc003lqi.1_Missense_Mutation_p.L280V	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	665	Potential.						protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTAAAGGCTCTGGAAGAAGC	0.537													55	57	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150897185	150897185	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150897185A>C	uc003lue.3	-	19	11472	c.11459T>G	c.(11458-11460)CTG>CGG	p.L3820R	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.L513R	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3820	Extracellular (Potential).|Laminin G-like.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTTACCTTCAGGGAGACGGA	0.557													34	53	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161580143	161580143	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161580143G>T	uc003lyz.3	+	9	1531	c.1173G>T	c.(1171-1173)ATG>ATT	p.M391I	GABRG2_uc010jjc.2_Missense_Mutation_p.M439I|GABRG2_uc003lyy.3_Missense_Mutation_p.M399I|GABRG2_uc011dej.1_Missense_Mutation_p.M296I	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	391	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		CCATTCAAATGAATAATGCTA	0.478													53	67	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168199835	168199835	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168199835G>T	uc003mab.2	-	14	1830	c.1410C>A	c.(1408-1410)CTC>CTA	p.L470L	SLIT3_uc010jjg.2_Silent_p.L470L|SLIT3_uc010jji.2_Silent_p.L470L|SLIT3_uc003mac.1_Silent_p.L267L	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	470	LRRCT 2.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTTGTTGGCGAGTCGGCGCG	0.612													41	46	---	---	---	---	PASS
CANX	821	broad.mit.edu	37	5	179136000	179136000	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179136000T>C	uc003mkk.2	+	6	645	c.468T>C	c.(466-468)AAT>AAC	p.N156N	CANX_uc011dgp.1_Silent_p.N191N|CANX_uc010jlb.1_Silent_p.N92N|CANX_uc003mkl.2_Silent_p.N156N|CANX_uc011dgq.1_Silent_p.N48N	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor	156	Lumenal (Potential).				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATTTCCAAAATGGAATAGAAT	0.393													38	43	---	---	---	---	PASS
MRPS18B	28973	broad.mit.edu	37	6	30593547	30593547	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30593547G>A	uc003nqo.2	+	7	907	c.750G>A	c.(748-750)GGG>GGA	p.G250G	MRPS18B_uc011dml.1_3'UTR|MRPS18B_uc010jsd.1_Silent_p.G207G|C6orf134_uc003nqr.3_5'Flank|C6orf134_uc003rdc.2_5'Flank|C6orf134_uc003nqs.3_5'Flank|C6orf134_uc003rdd.2_5'Flank|C6orf134_uc003nqu.2_5'Flank|C6orf134_uc003nqt.2_5'Flank|C6orf134_uc011dmm.1_5'Flank|C6orf134_uc003nqv.2_5'Flank	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor	250					translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						CCTCCACTGGGCAGACAGGCC	0.443													4	44	---	---	---	---	PASS
VARS2	57176	broad.mit.edu	37	6	30893877	30893877	+	Intron	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30893877C>T	uc003nsc.1	+						VARS2_uc011dmx.1_Intron|VARS2_uc011dmy.1_Intron|VARS2_uc011dmz.1_Intron|VARS2_uc011dna.1_Intron|VARS2_uc011dnb.1_Intron|VARS2_uc011dnc.1_Intron|VARS2_uc011dnd.1_Intron|VARS2_uc010jsg.1_Intron|VARS2_uc010jsh.1_Intron	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial						valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						TCCTTTTCTCCTCGTCCAGCT	0.602													38	16	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31919166	31919166	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31919166G>A	uc003nyj.3	+	16	2283	c.2005G>A	c.(2005-2007)GTC>ATC	p.V669I	CFB_uc011dor.1_Missense_Mutation_p.V1171I	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	669	Peptidase S1.				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						CTATGACAAAGTCAAGGACAT	0.507													6	87	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43400473	43400473	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400473A>T	uc003ouy.1	+	3	970	c.755A>T	c.(754-756)CAC>CTC	p.H252L	ABCC10_uc003ouz.1_Missense_Mutation_p.H209L	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	252						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CGCCTCCCCCACAGACTGCAG	0.642													12	27	---	---	---	---	PASS
TJAP1	93643	broad.mit.edu	37	6	43466750	43466750	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43466750C>G	uc003ovd.2	+	4	387	c.11C>G	c.(10-12)GCC>GGC	p.A4G	TJAP1_uc003ovf.2_Missense_Mutation_p.A4G|TJAP1_uc003ove.2_Missense_Mutation_p.A4G|TJAP1_uc003ovc.2_Missense_Mutation_p.A4G|TJAP1_uc010jyp.2_5'UTR|TJAP1_uc011dvh.1_Missense_Mutation_p.A4G|TJAP1_uc003ovg.2_5'UTR|TJAP1_uc010jyq.2_Missense_Mutation_p.A4G|TJAP1_uc011dvi.1_Missense_Mutation_p.A4G|TJAP1_uc011dvj.1_5'Flank	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	4						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			ATGACTAGTGCCGCCCCTGCT	0.567													23	22	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51887745	51887745	+	Intron	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51887745T>G	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CAGGCAGCCTTTAAAGACAAA	0.473													30	27	---	---	---	---	PASS
EFHC1	114327	broad.mit.edu	37	6	52288907	52288907	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52288907A>G	uc003pap.3	+	2	442	c.227A>G	c.(226-228)CAA>CGA	p.Q76R	EFHC1_uc011dwv.1_Intron|EFHC1_uc011dww.1_Missense_Mutation_p.Q57R	NM_018100	NP_060570	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	76						axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)					ACTTATGGCCAACCTAAACAA	0.512													20	29	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72892190	72892190	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72892190C>A	uc003pga.2	+	6	1093	c.1016C>A	c.(1015-1017)GCG>GAG	p.A339E	RIMS1_uc011dyb.1_5'UTR|RIMS1_uc003pgc.2_5'UTR|RIMS1_uc003pgb.3_5'UTR	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	339					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GAGGGCAAAGCGGCGGATGAG	0.572													6	9	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84904694	84904694	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84904694T>G	uc010kbp.2	-	10	1032	c.935A>C	c.(934-936)GAG>GCG	p.E312A	KIAA1009_uc003pkj.3_Missense_Mutation_p.E236A|KIAA1009_uc003pkk.2_Missense_Mutation_p.E312A|KIAA1009_uc003pki.3_5'UTR	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	312					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TGTGTTACTCTCAATTTTTTG	0.373													18	15	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97063482	97063482	+	Intron	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97063482C>G	uc003pos.1	+						FHL5_uc003pot.1_Intron	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator							nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AATTCCTTTACAGGTCTCACA	0.284													26	35	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112452297	112452297	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112452297C>T	uc003pvu.2	-	29	4150	c.3841G>A	c.(3841-3843)GTG>ATG	p.V1281M	LAMA4_uc003pvv.2_Missense_Mutation_p.V1274M|LAMA4_uc003pvt.2_Missense_Mutation_p.V1274M	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1281	Laminin G-like 3.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ATGGAGAACACGTCTGACTGA	0.418													31	54	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127797193	127797193	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127797193G>A	uc003qbd.2	-	6	2843	c.1978C>T	c.(1978-1980)CGG>TGG	p.R660W	C6orf174_uc003qbc.2_5'Flank	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	660	Potential.					integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		ACGTTCCTCCGCAGCAGCTCC	0.647													19	38	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128718714	128718714	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128718714G>C	uc003qbk.2	-	2	587	c.220C>G	c.(220-222)CAA>GAA	p.Q74E	PTPRK_uc003qbj.2_Missense_Mutation_p.Q74E|PTPRK_uc010kfc.2_Missense_Mutation_p.Q74E|PTPRK_uc011ebu.1_Missense_Mutation_p.Q74E|PTPRK_uc003qbl.1_Silent_p.P34P|PTPRK_uc011ebv.1_Missense_Mutation_p.Q74E|PTPRK_uc003qbm.3_Missense_Mutation_p.Q3E	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	74	Extracellular (Potential).|MAM.				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTCTCACCTTGGGGCATCTCG	0.413													6	176	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129513893	129513893	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129513893C>A	uc003qbn.2	+	12	1782	c.1677C>A	c.(1675-1677)GAC>GAA	p.D559E	LAMA2_uc003qbo.2_Missense_Mutation_p.D559E	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	559	Laminin IV type A 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCCAGCAGGACGACTTGGACT	0.547													18	34	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495880	134495880	+	Silent	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495880T>G	uc003qen.3	-	1	155	c.66A>C	c.(64-66)GCA>GCC	p.A22A	SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_5'UTR|SGK1_uc011ecu.1_Silent_p.A22A|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	22	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CGATGAGAATTGCCACCATGC	0.537											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	74	---	---	---	---	PASS
MAP7	9053	broad.mit.edu	37	6	136667017	136667017	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136667017C>A	uc003qgz.2	-	17	2462	c.2216G>T	c.(2215-2217)GGT>GTT	p.G739V	MAP7_uc011edf.1_Missense_Mutation_p.G724V|MAP7_uc011edg.1_Missense_Mutation_p.G769V|MAP7_uc010kgu.2_Missense_Mutation_p.G761V|MAP7_uc011edh.1_Missense_Mutation_p.G724V|MAP7_uc010kgv.2_Missense_Mutation_p.G761V|MAP7_uc010kgs.2_Missense_Mutation_p.G593V|MAP7_uc011edi.1_Missense_Mutation_p.G593V|MAP7_uc010kgq.1_Missense_Mutation_p.G645V|MAP7_uc003qha.1_Missense_Mutation_p.G702V	NM_003980	NP_003971	Q14244	MAP7_HUMAN	microtubule-associated protein 7	739					establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		TGTCTGAACACCATCTACCTG	0.488													20	31	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152655215	152655215	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152655215T>C	uc010kiw.2	-	77	13324	c.12722A>G	c.(12721-12723)GAT>GGT	p.D4241G	SYNE1_uc003qot.3_Missense_Mutation_p.D4170G|SYNE1_uc003qou.3_Missense_Mutation_p.D4241G|SYNE1_uc010kiz.2_5'UTR	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4241	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCATGGTAATCTCTTGTTCT	0.403										HNSCC(10;0.0054)			5	110	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152665306	152665306	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152665306C>A	uc010kiw.2	-	74	12737	c.12135G>T	c.(12133-12135)CTG>CTT	p.L4045L	SYNE1_uc003qot.3_Silent_p.L3974L|SYNE1_uc003qou.3_Silent_p.L4045L|SYNE1_uc010kja.1_Silent_p.L750L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4045	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGCACTGCTGCAGGGTGTCTT	0.488										HNSCC(10;0.0054)			51	56	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167754494	167754494	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167754494T>A	uc003qvs.1	+	3	1194	c.1106T>A	c.(1105-1107)CTC>CAC	p.L369H	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	369	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGCTTTGAGCTCTTTGGGTTT	0.448													90	140	---	---	---	---	PASS
TRA2A	29896	broad.mit.edu	37	7	23552617	23552617	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23552617G>C	uc003swi.2	-	4	635	c.421C>G	c.(421-423)CGA>GGA	p.R141G	TRA2A_uc011jzb.1_RNA|TRA2A_uc011jzc.1_Missense_Mutation_p.R40G|TRA2A_uc011jzd.1_Missense_Mutation_p.R40G|TRA2A_uc010kuo.1_RNA	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha	141	RRM.				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						GGTCCATATCGAGAAAATACT	0.418													40	21	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30490872	30490872	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30490872G>A	uc003tav.2	-	6	2684	c.2161C>T	c.(2161-2163)CGG>TGG	p.R721W		NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	721	LRR 2.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TGCAGCTCCCGCACGCCGTAG	0.657													32	30	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30893027	30893027	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30893027G>T	uc003tbt.2	+	12	1706	c.1629G>T	c.(1627-1629)TTG>TTT	p.L543F	FAM188B_uc010kwe.2_Missense_Mutation_p.L514F|AQP1_uc011kac.1_5'UTR	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	543											0						TTCACAGTTTGACCTGCTATG	0.498													8	25	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36698786	36698786	+	Silent	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36698786G>C	uc003tfh.3	-	4	776	c.375C>G	c.(373-375)CTC>CTG	p.L125L	AOAH_uc010kxf.2_Silent_p.L125L|AOAH_uc011kba.1_Silent_p.L93L	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	125					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						GAAGAGGGTAGAGATGACACA	0.458													71	64	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	37311438	37311438	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37311438G>A	uc003tfk.1	-	5	549	c.242C>T	c.(241-243)CCA>CTA	p.P81L	ELMO1_uc011kbc.1_5'UTR|ELMO1_uc010kxg.1_Missense_Mutation_p.P81L	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	81					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TCAACTTACTGGAGATGTGGT	0.358													34	89	---	---	---	---	PASS
URGCP	55665	broad.mit.edu	37	7	43918685	43918685	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43918685T>C	uc003tiw.2	-	6	434	c.377A>G	c.(376-378)AAT>AGT	p.N126S	URGCP_uc003tiu.2_Missense_Mutation_p.N83S|URGCP_uc003tiv.2_Missense_Mutation_p.N51S|URGCP_uc003tix.2_Missense_Mutation_p.N117S|URGCP_uc003tiy.2_Missense_Mutation_p.N83S|URGCP_uc003tiz.2_Missense_Mutation_p.N83S|URGCP_uc011kbj.1_Missense_Mutation_p.N83S	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	126					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						GGCATCAGCATTGAGGGCCTG	0.542													58	62	---	---	---	---	PASS
ZMIZ2	83637	broad.mit.edu	37	7	44796711	44796711	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44796711C>T	uc003tlr.2	+	4	454	c.331C>T	c.(331-333)CGC>TGC	p.R111C	ZMIZ2_uc003tlq.2_Missense_Mutation_p.R79C|ZMIZ2_uc003tls.2_Missense_Mutation_p.R111C|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1	111	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						CGTGTACAGCCGCGGGGGCTA	0.652													16	13	---	---	---	---	PASS
CCT6A	908	broad.mit.edu	37	7	56125742	56125742	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56125742G>A	uc003trl.1	+	6	835	c.671G>A	c.(670-672)AGG>AAG	p.R224K	PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Missense_Mutation_p.R179K|CCT6A_uc011kcu.1_Missense_Mutation_p.R193K|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	224					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ATGAAGAAAAGGGTGGAGGAT	0.398													18	51	---	---	---	---	PASS
KIAA1324L	222223	broad.mit.edu	37	7	86526942	86526942	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86526942G>C	uc011kha.1	-	19	2750	c.2565C>G	c.(2563-2565)TGC>TGG	p.C855W	KIAA1324L_uc003uif.1_Missense_Mutation_p.C615W|KIAA1324L_uc011kgz.1_Missense_Mutation_p.C741W|KIAA1324L_uc003uie.2_Missense_Mutation_p.C688W	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	855	Extracellular (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					TACCTGCTGGGCACTTGCTAA	0.448													20	36	---	---	---	---	PASS
RUNDC3B	154661	broad.mit.edu	37	7	87400022	87400022	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87400022G>T	uc003ujb.2	+	8	1217	c.806G>T	c.(805-807)TGT>TTT	p.C269F	RUNDC3B_uc011khd.1_Missense_Mutation_p.C252F|RUNDC3B_uc011khe.1_Missense_Mutation_p.C252F|RUNDC3B_uc003ujc.2_Missense_Mutation_p.C252F|RUNDC3B_uc003ujd.2_Missense_Mutation_p.C174F	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	269										skin(1)	1	Esophageal squamous(14;0.00164)					TTCAACAAGTGTAAGAGAGTT	0.393													13	38	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103183274	103183274	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103183274C>T	uc003vca.2	-	43	6735	c.6575G>A	c.(6574-6576)CGA>CAA	p.R2192Q	RELN_uc010liz.2_Missense_Mutation_p.R2192Q	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2192					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCACACTTTCGAGATGGTTT	0.393													9	77	---	---	---	---	PASS
PNPLA8	50640	broad.mit.edu	37	7	108155826	108155826	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108155826T>C	uc003vff.1	-	4	517	c.110A>G	c.(109-111)CAT>CGT	p.H37R	PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.H37R|PNPLA8_uc003vfi.1_5'UTR|PNPLA8_uc003vfj.1_Missense_Mutation_p.H37R|PNPLA8_uc003vfk.1_5'UTR	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	37					fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						CCTCCAGTAATGCTTAGGTGA	0.368													30	22	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117450887	117450887	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117450887C>A	uc003vjf.2	-	3	438	c.346G>T	c.(346-348)GCC>TCC	p.A116S		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	116										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTGCAGTGGGCCATGACTGCT	0.512													83	173	---	---	---	---	PASS
SMO	6608	broad.mit.edu	37	7	128845131	128845131	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128845131G>T	uc003vor.2	+	3	905	c.625G>T	c.(625-627)GAC>TAC	p.D209Y	SMO_uc003vos.2_5'Flank	NM_005631	NP_005622	Q99835	SMO_HUMAN	smoothened precursor	209	Extracellular (Potential).				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37						CTGGTACGAGGACGTGGAGGG	0.607			Mis		skin basal cell 								22	22	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135287563	135287563	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135287563C>T	uc003vsw.2	+	18	2554	c.2523C>T	c.(2521-2523)CAC>CAT	p.H841H		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	841					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GGAAAAAACACCTGGAGAAAG	0.338													35	43	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700020	136700020	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700020C>A	uc003vtf.1	+	4	1031	c.408C>A	c.(406-408)ACC>ACA	p.T136T	CHRM2_uc003vtg.1_Silent_p.T136T|CHRM2_uc003vtj.1_Silent_p.T136T|CHRM2_uc003vtk.1_Silent_p.T136T|CHRM2_uc003vtl.1_Silent_p.T136T|CHRM2_uc003vtm.1_Silent_p.T136T|CHRM2_uc003vti.1_Silent_p.T136T|CHRM2_uc003vto.1_Silent_p.T136T|CHRM2_uc003vtn.1_Silent_p.T136T|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	136	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	TCAAGCGGACCACAAAAATGG	0.488													31	74	---	---	---	---	PASS
TAS2R3	50831	broad.mit.edu	37	7	141464890	141464890	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141464890A>G	uc003vwp.1	+	1	994	c.932A>G	c.(931-933)AAG>AGG	p.K311R		NM_016943	NP_058639	Q9NYW6	TA2R3_HUMAN	taste receptor T2R3	311	Cytoplasmic (Potential).				sensory perception of taste		taste receptor activity			central_nervous_system(1)	1	Melanoma(164;0.0171)					CCTGGATCCAAGGGACCCATT	0.507													73	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142161971	142161971	+	Intron	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142161971G>C	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_RNA|uc011krw.1_Missense_Mutation_p.P102A					SubName: Full=V_segment translation product; Flags: Fragment;																		GTCTGGGAGGGAGCAGCCAAC	0.537													78	244	---	---	---	---	PASS
OR2A1	346528	broad.mit.edu	37	7	144015481	144015481	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144015481C>A	uc011kud.1	+	1	246	c.246C>A	c.(244-246)GCC>GCA	p.A82A	OR2A9P_uc003wec.1_Intron	NM_001001802	NP_001001802	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.14)					TGCATCCAGCCAAGCCCATCT	0.562													24	166	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146818253	146818253	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146818253G>A	uc003weu.1	+	6	1453	c.937G>A	c.(937-939)GAG>AAG	p.E313K		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	313	Laminin G-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTTGGACTATGAGGTACATGT	0.423										HNSCC(39;0.1)			16	16	---	---	---	---	PASS
ZNF786	136051	broad.mit.edu	37	7	148771626	148771626	+	Silent	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148771626A>G	uc003wfh.2	-	3	287	c.150T>C	c.(148-150)GAT>GAC	p.D50D	ZNF786_uc011kuk.1_Silent_p.D13D|ZNF786_uc003wfi.2_5'UTR	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	50	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TTGGAAGTCCATCATCTGCAC	0.418													29	25	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149522134	149522134	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149522134G>C	uc010lpk.2	+	97	13921	c.13921G>C	c.(13921-13923)GAG>CAG	p.E4641Q	SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	4641	TSP type-1 23.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACGCTGGAGAGAGGCAGAGGC	0.647													5	22	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151871312	151871312	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151871312G>A	uc003wla.2	-	39	9497	c.9278C>T	c.(9277-9279)ACA>ATA	p.T3093I	MLL3_uc003wkz.2_Missense_Mutation_p.T2154I|MLL3_uc003wky.2_Missense_Mutation_p.T602I	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	3093	Gln-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TATAGGATCTGTAATTGCATC	0.328			N		medulloblastoma								24	59	---	---	---	---	PASS
DEFB105A	245908	broad.mit.edu	37	8	7680953	7680953	+	Intron	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7680953C>G	uc011kwr.1	-						DEFB106A_uc003wru.1_5'Flank	NM_152250	NP_689463	Q8NG35	D105A_HUMAN	defensin, beta 105A precursor						defense response to bacterium	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		ACCCTAAATTCAAAACAAAAT	0.348													24	246	---	---	---	---	PASS
C8orf74	203076	broad.mit.edu	37	8	10532251	10532251	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10532251C>A	uc003wtd.1	+	2	173	c.144C>A	c.(142-144)CTC>CTA	p.L48L	C8orf74_uc003wte.1_RNA	NM_001040032	NP_001035121	Q6P047	CH074_HUMAN	hypothetical protein LOC203076	48											0				COAD - Colon adenocarcinoma(149;0.0811)		TGGACACCCTCTACGAGAGCA	0.572													3	13	---	---	---	---	PASS
ADAMDEC1	27299	broad.mit.edu	37	8	24259568	24259568	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24259568T>C	uc003xdz.2	+	12	1503	c.1283T>C	c.(1282-1284)CTA>CCA	p.L428P	ADAMDEC1_uc010lub.2_Missense_Mutation_p.L349P|ADAMDEC1_uc011lab.1_Missense_Mutation_p.L349P	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	428	Disintegrin.				integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		AACCACCTTCTAGAAGTGGGA	0.373													55	8	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30699552	30699552	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30699552C>T	uc003xil.2	-	1	6982	c.6982G>A	c.(6982-6984)GAT>AAT	p.D2328N		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2328										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ACAGTAGTATCTTGCTGTTGT	0.343													53	17	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30704329	30704329	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30704329G>C	uc003xil.2	-	1	2205	c.2205C>G	c.(2203-2205)AGC>AGG	p.S735R		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	735										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTCCTGTGGTGCTTTCCAAAA	0.388													44	12	---	---	---	---	PASS
GOT1L1	137362	broad.mit.edu	37	8	37794785	37794785	+	Intron	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37794785G>T	uc011lbj.1	-							NM_152413	NP_689626	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1						biosynthetic process|cellular amino acid metabolic process	cytoplasm	pyridoxal phosphate binding|transaminase activity			ovary(1)	1	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCTGAGCGGGGCCCCTCTACC	0.507													15	11	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61766950	61766950	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61766950T>A	uc003xue.2	+	32	7281	c.6804T>A	c.(6802-6804)TTT>TTA	p.F2268L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2268					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAAGAATTTTGATGAAGAAA	0.438													18	42	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68968219	68968219	+	Intron	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68968219G>A	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GGTAGGGTTGGGAGTTTGGGT	0.363													20	70	---	---	---	---	PASS
MRPS28	28957	broad.mit.edu	37	8	80831357	80831357	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80831357C>T	uc003ybp.2	-	3	445	c.422G>A	c.(421-423)CGG>CAG	p.R141Q	MRPS28_uc003ybo.2_Missense_Mutation_p.R50Q|TPD52_uc010lzr.2_RNA	NM_014018	NP_054737	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S28	141						mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)			TAGCCGCAACCGGACCCTGGT	0.373													98	56	---	---	---	---	PASS
FAM82B	51115	broad.mit.edu	37	8	87498812	87498812	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87498812G>T	uc003ydu.2	-	4	556	c.396C>A	c.(394-396)AGC>AGA	p.S132R	FAM82B_uc011lfz.1_Missense_Mutation_p.S132R|FAM82B_uc011lga.1_Missense_Mutation_p.S132R	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	132						microtubule|spindle pole	binding			ovary(1)	1						CTGAGGTTCTGCTAAGCTGAG	0.388													55	47	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885715	88885715	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885715G>T	uc003ydz.2	-	1	582	c.485C>A	c.(484-486)TCG>TAG	p.S162*		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	162										ovary(1)	1						TATGAACAGCGACGCTGGGAG	0.572													77	48	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92375774	92375774	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92375774T>C	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			AGTGTAAGTTTAGTTTTATTT	0.239													29	48	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110491774	110491774	+	Intron	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110491774T>A	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTCTTCTCTTTTCAGTTTAT	0.333										HNSCC(38;0.096)			7	12	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113266518	113266518	+	Silent	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113266518A>T	uc003ynu.2	-	63	10233	c.10074T>A	c.(10072-10074)CCT>CCA	p.P3358P	CSMD3_uc003yns.2_Silent_p.P2560P|CSMD3_uc003ynt.2_Silent_p.P3318P|CSMD3_uc011lhx.1_Silent_p.P3189P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3358	Extracellular (Potential).|Sushi 27.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATCCATGCCGAGGCACACCTG	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			169	306	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131812681	131812681	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131812681G>C	uc003ytd.3	-	15	3307	c.3051C>G	c.(3049-3051)GAC>GAG	p.D1017E	ADCY8_uc010mds.2_Missense_Mutation_p.D886E	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1017	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCTCATCGAAGTCAGCAATGA	0.403										HNSCC(32;0.087)			112	85	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133899251	133899251	+	Missense_Mutation	SNP	A	G	G	rs145429573		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133899251A>G	uc003ytw.2	+	9	1675	c.1634A>G	c.(1633-1635)AAT>AGT	p.N545S		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	545					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGTACTATGAATAAGCCAACT	0.453													46	85	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139691855	139691855	+	Intron	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139691855C>A	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TAGATCTTCACTGACCTTAAC	0.348										HNSCC(7;0.00092)			90	75	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142500381	142500381	+	Intron	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142500381G>A	uc003ywi.2	-						FLJ43860_uc011ljs.1_Intron|FLJ43860_uc010meu.1_Intron	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690								binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CAGCTCCTGGGGTGGGGTGGG	0.642													16	89	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143558643	143558643	+	Intron	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143558643G>T	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCCCAGGTGGGTGGGACCTT	0.726													38	26	---	---	---	---	PASS
GRINA	2907	broad.mit.edu	37	8	145066865	145066865	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145066865C>T	uc003zan.1	+	7	1138	c.972C>T	c.(970-972)CTC>CTT	p.L324L	GRINA_uc003zao.1_Silent_p.L324L|GRINA_uc003zap.1_Silent_p.L324L	NM_001009184	NP_001009184	Q7Z429	GRINA_HUMAN	glutamate receptor, ionotropic, N-methyl	324	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCAGTTCCTCGCAGTGGACA	0.592													9	65	---	---	---	---	PASS
RFX3	5991	broad.mit.edu	37	9	3330525	3330525	+	Intron	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3330525A>C	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CGGCTTTAGAAGAAGAAGAAA	0.343													65	58	---	---	---	---	PASS
ZDHHC21	340481	broad.mit.edu	37	9	14619681	14619681	+	Splice_Site	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14619681C>G	uc003zli.2	-	9	1092	c.622_splice	c.e9-1	p.D208_splice	ZDHHC21_uc003zlg.1_Intron	NM_178566	NP_848661	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21						nitric oxide metabolic process|regulation of nitric-oxide synthase activity	Golgi membrane|integral to membrane	palmitoyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(50;4.31e-06)		ATGTTGTATCCtattaaaaat	0.234													4	77	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414340	20414340	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414340G>A	uc003zoe.2	-	5	763	c.504C>T	c.(502-504)AGC>AGT	p.S168S	MLLT3_uc011lne.1_Silent_p.S136S|MLLT3_uc011lnf.1_Silent_p.S165S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.A130V	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	168	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.144			T	MLL	ALL								5	92	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73442928	73442928	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73442928G>A	uc004aid.2	-	6	1052	c.808C>T	c.(808-810)CGG>TGG	p.R270W	TRPM3_uc004ahu.2_Missense_Mutation_p.R100W|TRPM3_uc004ahv.2_Missense_Mutation_p.R100W|TRPM3_uc004ahw.2_Missense_Mutation_p.R117W|TRPM3_uc004ahx.2_Missense_Mutation_p.R117W|TRPM3_uc004ahy.2_Missense_Mutation_p.R117W|TRPM3_uc004ahz.2_Missense_Mutation_p.R117W|TRPM3_uc004aia.2_Missense_Mutation_p.R117W|TRPM3_uc004aib.2_Missense_Mutation_p.R117W|TRPM3_uc004aic.2_Missense_Mutation_p.R270W|TRPM3_uc010mor.2_Missense_Mutation_p.R270W|TRPM3_uc004aie.2_Missense_Mutation_p.R117W|TRPM3_uc004aif.2_Missense_Mutation_p.R117W|TRPM3_uc004aig.2_Missense_Mutation_p.R117W|TRPM3_uc004aii.2_Missense_Mutation_p.R272W	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	270	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TGGTATGGCCGGACAACCTGC	0.453													4	117	---	---	---	---	PASS
GOLM1	51280	broad.mit.edu	37	9	88655734	88655734	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88655734G>T	uc004aol.2	-	6	715	c.517C>A	c.(517-519)CGA>AGA	p.R173R	GOLM1_uc010mqd.1_RNA|GOLM1_uc004aom.2_Silent_p.R173R	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	173	Potential.|Lumenal (Potential).					Golgi apparatus|integral to plasma membrane					0						TCTTCTATTCGCTCCTCACAC	0.483													69	6	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104324230	104324230	+	Silent	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104324230A>G	uc004bbn.2	+	19	2778	c.2688A>G	c.(2686-2688)ACA>ACG	p.T896T		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	896	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGGAGACCACAAAGAAACCAG	0.388													122	27	---	---	---	---	PASS
OR13F1	138805	broad.mit.edu	37	9	107266756	107266756	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107266756C>A	uc011lvm.1	+	1	213	c.213C>A	c.(211-213)ATC>ATA	p.I71I		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						TTCTGGACATCTGGTACTCCT	0.493													83	26	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119858403	119858403	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119858403C>A	uc004bjs.1	-	5	1297	c.1196G>T	c.(1195-1197)GGG>GTG	p.G399V	ASTN2_uc004bjr.1_Missense_Mutation_p.G399V|ASTN2_uc004bjt.1_Missense_Mutation_p.G348V	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	399	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GCCCGACGTCCCCTTGGCTCT	0.542													24	5	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121930121	121930121	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121930121C>G	uc004bkc.2	-	8	1983	c.1527G>C	c.(1525-1527)GAG>GAC	p.E509D		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	509					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CGAGGCGGATCTCGTTGCTGA	0.557													30	9	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123156817	123156817	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123156817G>C	uc004bkf.2	-	36	5732	c.5551C>G	c.(5551-5553)CGC>GGC	p.R1851G	CDK5RAP2_uc010mvi.2_Missense_Mutation_p.R860G|CDK5RAP2_uc004bke.2_Missense_Mutation_p.R1136G|CDK5RAP2_uc004bkg.2_Missense_Mutation_p.R1772G|CDK5RAP2_uc011lxw.1_Missense_Mutation_p.R1116G|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Missense_Mutation_p.R1116G|CDK5RAP2_uc011lya.1_Missense_Mutation_p.R1116G|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.R1621G	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1851	Interaction with PCNT and AKAP9.				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						TTTTCCTGGCGCTTGCTCAGC	0.478													45	13	---	---	---	---	PASS
WDR85	92715	broad.mit.edu	37	9	140468735	140468735	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140468735C>T	uc004cnk.1	-	5	723	c.565G>A	c.(565-567)GCC>ACC	p.A189T	WDR85_uc004cnl.1_Missense_Mutation_p.A13T|WDR85_uc004cnm.1_5'UTR|WDR85_uc004cnn.1_Intron	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85	189					peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		TGCCATGAGGCCACTTTCTGC	0.547													7	106	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26849102	26849102	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26849102C>A	uc001iss.2	+	12	1545	c.1224C>A	c.(1222-1224)AAC>AAA	p.N408K		NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	408	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						GAACCCTTAACCAGTGGGTCA	0.493													15	79	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26849103	26849103	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26849103C>T	uc001iss.2	+	12	1546	c.1225C>T	c.(1225-1227)CAG>TAG	p.Q409*		NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	409	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						AACCCTTAACCAGTGGGTCAT	0.493													13	79	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26849116	26849116	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26849116G>C	uc001iss.2	+	12	1559	c.1238G>C	c.(1237-1239)GGA>GCA	p.G413A		NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	413	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						TGGGTCATGGGAATACGGATA	0.498													9	66	---	---	---	---	PASS
MKX	283078	broad.mit.edu	37	10	28024303	28024303	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28024303C>T	uc001ity.3	-	4	574	c.349G>A	c.(349-351)GTG>ATG	p.V117M	MKX_uc001itx.3_Missense_Mutation_p.V117M	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox	117	Homeobox; TALE-type.				muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CAATTTGACACCTAAAACAGT	0.358													24	56	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28151364	28151364	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28151364G>T	uc009xky.2	-	18	2896	c.2798C>A	c.(2797-2799)ACA>AAA	p.T933K	ARMC4_uc010qds.1_Missense_Mutation_p.T458K|ARMC4_uc010qdt.1_Missense_Mutation_p.T625K|ARMC4_uc001itz.2_Missense_Mutation_p.T933K	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	933	ARM 8.						binding			ovary(4)|skin(2)	6						GTTACTTACTGTATTTGCCAG	0.244													35	48	---	---	---	---	PASS
C10orf68	79741	broad.mit.edu	37	10	33134467	33134467	+	Intron	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33134467A>G	uc001iwn.3	+						C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron|C10orf68_uc010qei.1_Intron|C10orf68_uc001iwo.3_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						TTTTATTTCTATAGAGACTGA	0.313													31	75	---	---	---	---	PASS
ASAH2	56624	broad.mit.edu	37	10	52005134	52005134	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52005134T>A	uc001jjd.2	-	2	208	c.208A>T	c.(208-210)ACC>TCC	p.T70S	ASAH2_uc009xos.2_Missense_Mutation_p.T70S	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a	70	Lumenal (Potential).				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						GAATGCTGGGTGGCTGTGGAG	0.517													51	29	---	---	---	---	PASS
DKK1	22943	broad.mit.edu	37	10	54074771	54074771	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54074771G>T	uc001jjr.2	+	2	486	c.332G>T	c.(331-333)TGT>TTT	p.C111F	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor	111	DKK-type Cys-1.				negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						GTGCAAATCTGTCTCGCCTGC	0.607											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	24	---	---	---	---	PASS
TSPAN15	23555	broad.mit.edu	37	10	71265996	71265996	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71265996G>T	uc001jpo.1	+	7	860	c.735G>T	c.(733-735)CAG>CAT	p.Q245H		NM_012339	NP_036471	O95858	TSN15_HUMAN	transmembrane 4 superfamily member 15	245	Helical; (Potential).					integral to plasma membrane|membrane fraction					0						TGCTTCCCCAGGTGGGCAGGC	0.557													24	33	---	---	---	---	PASS
NEUROG3	50674	broad.mit.edu	37	10	71332658	71332658	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71332658C>T	uc001jpp.2	-	2	300	c.142G>A	c.(142-144)GAG>AAG	p.E48K		NM_020999	NP_066279	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	48					central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity				0						TCTTCCGCCTCTGCGCAGTTC	0.721													6	20	---	---	---	---	PASS
ECD	11319	broad.mit.edu	37	10	74899087	74899087	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74899087G>A	uc001jtn.2	-	11	1644	c.1401C>T	c.(1399-1401)CAC>CAT	p.H467H	ECD_uc009xqx.2_Silent_p.H500H|ECD_uc009xqy.2_Silent_p.H424H|ECD_uc001jto.2_Silent_p.H166H	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1	467					regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					CTGCTCCCTTGTGGGTTGAGA	0.393													11	67	---	---	---	---	PASS
C10orf12	26148	broad.mit.edu	37	10	98743831	98743831	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98743831G>T	uc001kmv.2	+	1	2791	c.2684G>T	c.(2683-2685)CGC>CTC	p.R895L		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	895										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CTCAATACTCGCCTTCCAGGA	0.433													31	54	---	---	---	---	PASS
SLIT1	6585	broad.mit.edu	37	10	98794309	98794309	+	Intron	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98794309G>T	uc001kmw.2	-						SLIT1_uc009xvh.1_Intron	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CCTGGAAAAGGCAAAGGCATC	0.542													31	65	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107005322	107005322	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107005322G>T	uc001kyi.1	+	21	3118	c.2891G>T	c.(2890-2892)AGC>ATC	p.S964I	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	964	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TTGGACAGCAGCATTTCCTTC	0.448													52	57	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107016620	107016620	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107016620G>A	uc001kyi.1	+	25	3608	c.3381G>A	c.(3379-3381)ATG>ATA	p.M1127I		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1127	Helical; (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCTCAGCCATGCTTATGCTAT	0.428													39	26	---	---	---	---	PASS
PPAPDC1A	196051	broad.mit.edu	37	10	122334709	122334709	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122334709G>T	uc001lev.1	+	6	864	c.512G>T	c.(511-513)AGT>ATT	p.S171I	PPAPDC1A_uc010qtd.1_Missense_Mutation_p.S171I|PPAPDC1A_uc009xzl.1_Missense_Mutation_p.S108I|PPAPDC1A_uc001lew.1_Missense_Mutation_p.V78L|PPAPDC1A_uc001lex.1_Intron|PPAPDC1A_uc001ley.1_Missense_Mutation_p.S50I	NM_001030059	NP_001025230	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain	171					phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		TTCACCGAGAGTGGGCGGGGA	0.577													59	43	---	---	---	---	PASS
C10orf93	255352	broad.mit.edu	37	10	134743117	134743117	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134743117C>A	uc001llt.1	-	9	1134	c.1058G>T	c.(1057-1059)AGG>ATG	p.R353M		NM_173572	NP_775843	Q5SR76	CJ093_HUMAN	hypothetical protein LOC255352	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							binding			pancreas(1)	1		all_cancers(35;1.8e-07)|all_epithelial(44;6.22e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Colorectal(31;0.119)|Glioma(114;0.172)|Melanoma(40;0.175)		Epithelial(32;4.28e-05)|OV - Ovarian serous cystadenocarcinoma(35;4.31e-05)|all cancers(32;5.02e-05)		GGGCCGTGGCCTGGTGAACTG	0.443													85	47	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	135000076	135000076	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135000076C>A	uc001llz.1	+	6	1225	c.1224C>A	c.(1222-1224)GCC>GCA	p.A408A	KNDC1_uc001lma.1_Silent_p.A343A	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	408					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CAGCAGAGGCCCCTGCAGACC	0.672													6	53	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440199	135440199	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440199C>A	uc010qvg.1	-	1	101	c.48G>T	c.(46-48)CAG>CAT	p.Q16H		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	16						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CAGTGGAGCACTGGATGGAGG	0.512													22	348	---	---	---	---	PASS
RASSF7	8045	broad.mit.edu	37	11	563234	563234	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:563234T>A	uc001lqc.2	+	4	903	c.868T>A	c.(868-870)TGC>AGC	p.C290S	C11orf35_uc001lpx.2_5'Flank|RASSF7_uc001lqa.2_Missense_Mutation_p.C290S|RASSF7_uc001lqb.2_Missense_Mutation_p.C290S|RASSF7_uc001lqd.2_Missense_Mutation_p.C290S	NM_003475	NP_003466	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family	290	Potential.				regulation of transcription, DNA-dependent|signal transduction	nucleus	DNA binding|protein binding			skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTCCGTCAGTGCAACCTGCA	0.657													22	2	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068285	5068285	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068285C>A	uc010qyv.1	+	1	530	c.530C>A	c.(529-531)GCC>GAC	p.A177D		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACATAATAGCCCATTCCTAC	0.423													59	10	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023918	6023918	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023918A>T	uc010qzv.1	-	1	461	c.461T>A	c.(460-462)CTC>CAC	p.L154H		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	102	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAACATCTGGAGGAAGCAGGC	0.532													32	11	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974874	49974874	+	Nonsense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974874T>A	uc010rhz.1	+	1	900	c.900T>A	c.(898-900)TGT>TGA	p.C300*		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						GGAAATTGTGTAGTAGGAAAG	0.388													23	6	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55032389	55032389	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032389G>C	uc010rid.1	+	2	144	c.58G>C	c.(58-60)GGA>CGA	p.G20R		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	4						intracellular	zinc ion binding				0						CATGAATTCTGGAATCTCGCA	0.468													170	8	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433053	55433053	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433053G>T	uc001nht.3	+	3	676	c.411G>T	c.(409-411)CGG>CGT	p.R137R	OR4C6_uc010rik.1_Silent_p.R137R	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TGAGTCCACGGGTGTGCTGCC	0.512													7	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143668	56143668	+	IGR	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143668C>T								OR8J1 (14997 upstream) : OR5R1 (41068 downstream)																							CTAACTTGCTCAGACACTCGC	0.453													8	302	---	---	---	---	PASS
LRRC55	219527	broad.mit.edu	37	11	56954748	56954748	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56954748C>G	uc001njl.1	+	2	967	c.820C>G	c.(820-822)CCT>GCT	p.P274A	LRRC55_uc001njm.1_5'Flank	NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	244	LRRCT.					integral to membrane					0						CCGGGGCCCTCCTGAAGTCGA	0.587													45	73	---	---	---	---	PASS
PRG2	5553	broad.mit.edu	37	11	57155270	57155270	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57155270C>A	uc001njz.2	-	4	594	c.567G>T	c.(565-567)CAG>CAT	p.Q189H	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.Q189H|PRG2_uc001nkb.2_Missense_Mutation_p.Q189H|PRG2_uc001nkd.2_Missense_Mutation_p.Q178H|PRG2_uc001nkc.2_Missense_Mutation_p.Q189H|PRG2_uc001nke.2_Missense_Mutation_p.Q469H	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	189	C-type lectin.				defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	GGGACCAGGGCTGGTGAGCAG	0.622													7	13	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958004	57958004	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958004T>C	uc010rka.1	+	1	42	c.42T>C	c.(40-42)CTT>CTC	p.L14L		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				AGTTCTTCCTTACTGCATTTA	0.478													55	68	---	---	---	---	PASS
OR4D11	219986	broad.mit.edu	37	11	59271742	59271742	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59271742G>C	uc001noa.1	+	1	694	c.694G>C	c.(694-696)GGC>CGC	p.G232R		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GGCAGGAGGGGGCAGGAGGAA	0.542													47	182	---	---	---	---	PASS
OR10V1	390201	broad.mit.edu	37	11	59480597	59480597	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59480597G>T	uc001nof.1	-	1	722	c.722C>A	c.(721-723)ACC>AAC	p.T241N		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGAAGAGCAGGTAGAGTAGGC	0.532													37	50	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60184470	60184470	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60184470C>A	uc001npj.2	+	5	2594	c.2029C>A	c.(2029-2031)CTG>ATG	p.L677M	MS4A14_uc001npi.2_Missense_Mutation_p.L565M|MS4A14_uc001npn.2_Missense_Mutation_p.L415M|MS4A14_uc001npk.2_Missense_Mutation_p.L660M|MS4A14_uc001npl.2_Missense_Mutation_p.L415M|MS4A14_uc001npm.2_Missense_Mutation_p.L415M	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	677						integral to membrane	receptor activity			breast(1)	1						CAAGAATCCCCTGACTGGATA	0.428													21	88	---	---	---	---	PASS
SCGB1D1	10648	broad.mit.edu	37	11	61960877	61960877	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61960877A>G	uc001nsz.1	+	3	297	c.250A>G	c.(250-252)ATA>GTA	p.I84V		NM_006552	NP_006543	O95968	SG1D1_HUMAN	lipophilin A precursor	84						extracellular space	binding			skin(1)	1						TCAGGGAAAAATAGCAGAGAA	0.413													36	46	---	---	---	---	PASS
ADRBK1	156	broad.mit.edu	37	11	67046935	67046935	+	Missense_Mutation	SNP	G	A	A	rs71640262		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67046935G>A	uc009yrn.1	+	4	577	c.311G>A	c.(310-312)CGC>CAC	p.R104H	ADRBK1_uc009yrm.1_Missense_Mutation_p.R104H	NM_001619	NP_001610	P25098	ARBK1_HUMAN	beta-adrenergic receptor kinase 1	104	RGS.|N-terminal.				activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CGTGTGGCCCGCAGCCGGGAG	0.597													7	65	---	---	---	---	PASS
RPS6KB2	6199	broad.mit.edu	37	11	67196009	67196009	+	5'UTR	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67196009G>T	uc001old.2	+	1					RPS6KB2_uc001olf.2_5'UTR|RPS6KB2_uc001olg.2_5'UTR|RPS6KB2_uc009yrq.2_5'UTR|RPS6KB2_uc001ole.2_RNA|RPS6KB2_uc001olh.2_RNA|RPS6KB2_uc009yrr.2_5'Flank	NM_003952	NP_003943	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of translational initiation|translation	nucleoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|stomach(1)|lung(1)|salivary_gland(1)	7			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			cgcggggccggcgccgccATG	0.557													10	13	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78381477	78381477	+	Silent	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78381477T>A	uc001ozl.3	-	32	6376	c.5913A>T	c.(5911-5913)TCA>TCT	p.S1971S	ODZ4_uc001ozk.3_Silent_p.S196S|ODZ4_uc009yvb.1_Silent_p.S555S	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1971	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						AGTAGCCCACTGAGCGGATGG	0.542													44	46	---	---	---	---	PASS
CCDC83	220047	broad.mit.edu	37	11	85597249	85597249	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85597249G>T	uc001pbh.1	+	5	862	c.350G>T	c.(349-351)CGC>CTC	p.R117L	CCDC83_uc001pbg.1_Missense_Mutation_p.R117L|CCDC83_uc001pbi.1_RNA|CCDC83_uc001pbj.1_Intron	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	117	Potential.									skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ACAGATATGCGCATGCAAATA	0.333													13	23	---	---	---	---	PASS
CCDC83	220047	broad.mit.edu	37	11	85627158	85627158	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85627158A>G	uc001pbh.1	+	10	1474	c.962A>G	c.(961-963)CAT>CGT	p.H321R	CCDC83_uc001pbg.1_Missense_Mutation_p.H352R|CCDC83_uc001pbi.1_RNA|CCDC83_uc001pbj.1_Missense_Mutation_p.H221R	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	321										skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CATCTTAGTCATGAAAATAGC	0.383													133	116	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95825738	95825738	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95825738C>T	uc001pfw.1	-	2	2742	c.1457G>A	c.(1456-1458)GGT>GAT	p.G486D		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	486					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TGTCTGCTGACCAAAAGAAGG	0.537			T	MECT1|CRTC3	salivary gland mucoepidermoid								51	72	---	---	---	---	PASS
MMP27	64066	broad.mit.edu	37	11	102565727	102565727	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102565727T>A	uc001phd.1	-	7	1027	c.1004A>T	c.(1003-1005)AAC>ATC	p.N335I		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	335	Hemopexin-like 2.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		ATCTCTGGGGTTCTCGTATGC	0.448													4	55	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116744752	116744752	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116744752A>G	uc001ppy.2	-	12	1310	c.1274T>C	c.(1273-1275)CTG>CCG	p.L425P	SIK3_uc001ppz.2_Missense_Mutation_p.L324P|SIK3_uc001pqa.2_Missense_Mutation_p.L377P	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	425						cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						GAGCTTCTGCAGATCTTCCAT	0.453													64	63	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118498595	118498595	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118498595G>A	uc001ptr.1	+	7	1409	c.1056G>A	c.(1054-1056)CTG>CTA	p.L352L	PHLDB1_uc010ryh.1_Silent_p.L351L|PHLDB1_uc001pts.2_Silent_p.L352L|PHLDB1_uc001ptt.2_Silent_p.L352L|PHLDB1_uc001ptu.1_Intron|PHLDB1_uc001ptv.1_Silent_p.L152L|PHLDB1_uc001ptw.1_5'Flank	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	352											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GCCCCCGGCTGGGTGGGCAGC	0.647													12	53	---	---	---	---	PASS
SORL1	6653	broad.mit.edu	37	11	121391474	121391474	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121391474G>A	uc001pxx.2	+	9	1400	c.1320G>A	c.(1318-1320)TCG>TCA	p.S440S		NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	440	Extracellular (Potential).				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ACATGAGATCGGTCATCACCT	0.438													44	38	---	---	---	---	PASS
CHEK1	1111	broad.mit.edu	37	11	125496665	125496665	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125496665T>C	uc009zbo.2	+	2	894	c.2T>C	c.(1-3)ATG>ACG	p.M1T	CHEK1_uc010sbh.1_Missense_Mutation_p.W92R|CHEK1_uc010sbi.1_Missense_Mutation_p.M1T|CHEK1_uc001qcf.3_Missense_Mutation_p.M1T|CHEK1_uc009zbp.2_Missense_Mutation_p.M1T|CHEK1_uc001qcg.3_Missense_Mutation_p.M1T|CHEK1_uc009zbq.2_Missense_Mutation_p.M1T|CHEK1_uc001qci.1_RNA	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	1					cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GGTGGAGTCATGGCAGTGCCC	0.532								Other_conserved_DNA_damage_response_genes			OREG0021478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	64	82	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	275002	275002	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:275002G>A	uc001qhw.1	+	8	2014	c.2008G>A	c.(2008-2010)GAC>AAC	p.D670N	IQSEC3_uc001qhu.1_Missense_Mutation_p.D670N	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	973	Potential.|PH.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		GTTCGTGGAGGACCTGAAGGA	0.597													3	36	---	---	---	---	PASS
SLC6A13	6540	broad.mit.edu	37	12	347143	347143	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:347143G>C	uc001qic.1	-	5	565	c.512C>G	c.(511-513)TCC>TGC	p.S171C	SLC6A13_uc009zdj.1_Missense_Mutation_p.S171C|SLC6A13_uc010sdl.1_Missense_Mutation_p.S79C|SLC6A13_uc010sdm.1_Missense_Mutation_p.S52C	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	171	Extracellular (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			ACCATTCAGGGAGCCGTTGGT	0.517													18	109	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7640453	7640453	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7640453C>T	uc001qsz.3	-	7	1779	c.1651G>A	c.(1651-1653)GAG>AAG	p.E551K	CD163_uc001qta.3_Missense_Mutation_p.E551K|CD163_uc009zfw.2_Missense_Mutation_p.E551K	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	551	SRCR 5.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						AGATGGGACTCATGTCCCTCA	0.522													64	23	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15702086	15702086	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15702086C>A	uc001rcv.1	+	14	2537	c.2363C>A	c.(2362-2364)GCC>GAC	p.A788D	PTPRO_uc001rcw.1_Missense_Mutation_p.A788D|PTPRO_uc001rcx.1_5'UTR|PTPRO_uc001rcy.1_5'UTR|PTPRO_uc001rcz.1_5'UTR|PTPRO_uc001rda.1_5'UTR	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	788	Fibronectin type-III 8.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				CCTGCCACTGCCTACAATTGT	0.433													136	19	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15702087	15702087	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15702087C>A	uc001rcv.1	+	14	2538	c.2364C>A	c.(2362-2364)GCC>GCA	p.A788A	PTPRO_uc001rcw.1_Silent_p.A788A|PTPRO_uc001rcx.1_5'UTR|PTPRO_uc001rcy.1_5'UTR|PTPRO_uc001rcz.1_5'UTR|PTPRO_uc001rda.1_5'UTR	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	788	Fibronectin type-III 8.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				CTGCCACTGCCTACAATTGTA	0.433													139	19	---	---	---	---	PASS
CCDC91	55297	broad.mit.edu	37	12	28544295	28544295	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28544295C>T	uc001riq.2	+	7	729	c.713C>T	c.(712-714)TCT>TTT	p.S238F	CCDC91_uc001rio.2_Missense_Mutation_p.S208F|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rip.1_Missense_Mutation_p.S238F|CCDC91_uc001rir.2_Missense_Mutation_p.S76F|CCDC91_uc009zjl.2_Intron	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner	238	Homodimerization.				protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					CAGTACATTTCTGCAATTGAG	0.368													10	42	---	---	---	---	PASS
C12orf40	283461	broad.mit.edu	37	12	40041652	40041652	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40041652G>A	uc001rmc.2	+	6	610	c.443G>A	c.(442-444)TGC>TAC	p.C148Y	C12orf40_uc009zjv.1_RNA	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	148										ovary(6)	6						ATAGAGAACTGCAGTTTCACT	0.348													36	4	---	---	---	---	PASS
XRCC6BP1	91419	broad.mit.edu	37	12	58347452	58347452	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58347452G>C	uc001sqp.2	+	5	557	c.517G>C	c.(517-519)GGA>CGA	p.G173R		NM_033276	NP_150592	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	173					double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1						GTTACATTTTGGATTAAAACA	0.348													41	8	---	---	---	---	PASS
CPM	1368	broad.mit.edu	37	12	69250352	69250352	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69250352T>C	uc001sup.2	-	9	1258	c.1197A>G	c.(1195-1197)CAA>CAG	p.Q399Q	CPM_uc001sur.2_Silent_p.Q399Q|CPM_uc001suq.2_Silent_p.Q399Q	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor	399					anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TAGAATCCAATTGCCCTTGGA	0.413													63	4	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71955575	71955575	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71955575A>G	uc001swl.2	+	8	848	c.800A>G	c.(799-801)AAC>AGC	p.N267S	LGR5_uc001swm.2_Intron|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	267	LRR 9.|Extracellular (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						TTTCATAGCAACAATATCAGG	0.368													6	18	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132391478	132391478	+	Intron	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132391478C>T	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		AGGTGAGTGCCTTGTGGTGCC	0.577													96	10	---	---	---	---	PASS
KL	9365	broad.mit.edu	37	13	33628177	33628177	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33628177G>A	uc001uus.2	+	2	1101	c.1093G>A	c.(1093-1095)GAC>AAC	p.D365N	KL_uc001uur.1_Missense_Mutation_p.D58N	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	365	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		AGGAACTGCTGACTTTTTTGC	0.413													200	26	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61985741	61985741	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61985741C>A	uc001vid.3	-	2	2855	c.2491G>T	c.(2491-2493)GAG>TAG	p.E831*	PCDH20_uc010thj.1_Nonsense_Mutation_p.E831*	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	804	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGGAGAGGCTCGGGATAACCA	0.428													90	9	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249350	20249350	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249350C>A	uc010tku.1	+	1	869	c.869C>A	c.(868-870)ACA>AAA	p.T290K		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTATTTACACATTGAGAAAC	0.343													35	80	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389688	20389688	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389688C>A	uc010tkw.1	+	1	923	c.923C>A	c.(922-924)CCA>CAA	p.P308Q		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACCTGAGGCCAAGGAGAATT	0.373													54	140	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22192266	22192266	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22192266T>C	uc001wbn.2	+											Homo sapiens mRNA for T cell receptor alpha variable 3, partial cds, clone: SEB 36.																		CATGATTAATTTACAGGTGGG	0.478													61	78	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60069840	60069840	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60069840G>T	uc001xen.1	-	8	2440	c.2231C>A	c.(2230-2232)GCA>GAA	p.A744E	RTN1_uc001xem.1_Missense_Mutation_p.A324E|RTN1_uc001xek.1_Missense_Mutation_p.A176E|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Missense_Mutation_p.A161E	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	744	Reticulon.				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GTCAATCTGTGCCTACATAAA	0.363													26	28	---	---	---	---	PASS
RHOJ	57381	broad.mit.edu	37	14	63757659	63757659	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63757659G>C	uc001xgb.1	+	5	1005	c.562G>C	c.(562-564)GAT>CAT	p.D188H		NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor	188					actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		AGCGGTTTTTGATGAAGCAAT	0.443													88	75	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95690189	95690189	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95690189T>G	uc001yef.2	-	3	264	c.148A>C	c.(148-150)AAC>CAC	p.N50H		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	50	Actin-binding.|CH 1.					integral to membrane	actin binding				0				Epithelial(152;0.193)		AGAGGTGGGTTGCACTTTGAA	0.338													16	36	---	---	---	---	PASS
MIR656	724026	broad.mit.edu	37	14	101532334	101532334	+	5'Flank	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101532334C>G	hsa-mir-656|MI0003678	+																							0						GTACCGCTACCGCCCGGTGGT	0.557													21	23	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106758037	106758037	+	Intron	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106758037C>A	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TCCCTGACCACAGCACTCACA	0.542													71	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22466287	22466287	+	5'Flank	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466287C>A	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		AGAAGCCTTGCAGGAGACCTT	0.552													49	170	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30029502	30029502	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30029502T>A	uc001zcr.2	-	11	1848	c.1373A>T	c.(1372-1374)AAG>ATG	p.K458M	TJP1_uc010azl.2_Missense_Mutation_p.K446M|TJP1_uc001zcq.2_Missense_Mutation_p.K462M|TJP1_uc001zcs.2_Missense_Mutation_p.K458M	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	458	PDZ 3.				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TAAGCCTTCCTTGGCTGCAGG	0.418													59	70	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33961618	33961618	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33961618G>T	uc001zhi.2	+	37	5753	c.5683G>T	c.(5683-5685)GAG>TAG	p.E1895*	RYR3_uc010bar.2_Nonsense_Mutation_p.E1895*	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1895	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GATTCGGGAGGAGCTGTATGA	0.458													33	47	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33961619	33961619	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33961619A>G	uc001zhi.2	+	37	5754	c.5684A>G	c.(5683-5685)GAG>GGG	p.E1895G	RYR3_uc010bar.2_Missense_Mutation_p.E1895G	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1895	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATTCGGGAGGAGCTGTATGAT	0.453													35	46	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33999173	33999173	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33999173C>T	uc001zhi.2	+	43	6607	c.6537C>T	c.(6535-6537)GCC>GCT	p.A2179A	RYR3_uc010bar.2_Silent_p.A2179A	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2179	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGCTTCTGGCCAAAGGATACC	0.478													19	17	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64048842	64048842	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64048842G>A	uc002amp.2	-	5	1475	c.1327C>T	c.(1327-1329)CAG>TAG	p.Q443*	HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Nonsense_Mutation_p.Q443*	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	443	WD 1.|RCC1 2.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AAAGTTGACTGATTATTGGAG	0.433													12	19	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64791889	64791889	+	Nonsense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64791889A>T	uc002ann.2	+	1	271	c.271A>T	c.(271-273)AAA>TAA	p.K91*	ZNF609_uc010bgy.2_Nonsense_Mutation_p.K91*	NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	91						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ATCAAAATCCAAAAGGAGTAA	0.542													51	58	---	---	---	---	PASS
PKM2	5315	broad.mit.edu	37	15	72492913	72492913	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72492913T>C	uc002atx.1	-	10	1632	c.1391A>G	c.(1390-1392)CAC>CGC	p.H464R	GRAMD2_uc002atq.2_5'Flank|GRAMD2_uc010bis.2_5'Flank|PKM2_uc002atr.1_5'UTR|PKM2_uc002ats.1_Missense_Mutation_p.H131R|PKM2_uc002att.1_Missense_Mutation_p.H230R|PKM2_uc002atu.1_Missense_Mutation_p.H230R|PKM2_uc010bit.1_Missense_Mutation_p.H469R|PKM2_uc010uki.1_Missense_Mutation_p.H538R|PKM2_uc002atv.1_Missense_Mutation_p.H499R|PKM2_uc002atw.1_Missense_Mutation_p.H464R|PKM2_uc002aty.1_Missense_Mutation_p.H464R|PKM2_uc010ukj.1_Missense_Mutation_p.H449R|PKM2_uc010ukk.1_Missense_Mutation_p.H390R|PKM2_uc010biu.1_Missense_Mutation_p.H485R	NM_182471	NP_872271	P14618	KPYM_HUMAN	pyruvate kinase, muscle isoform M1	464	Interaction with POU5F1.				glycolysis|programmed cell death	cytosol|nucleus|plasma membrane	ATP binding|magnesium ion binding|potassium ion binding|protein binding|pyruvate kinase activity			breast(1)	1					Pyruvic acid(DB00119)	ACGGTACAGGTGGGCCTGACG	0.622													3	85	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76225414	76225414	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76225414G>T	uc002bbk.2	+	7	1288	c.1183G>T	c.(1183-1185)GCA>TCA	p.A395S	FBXO22_uc002bbl.2_Missense_Mutation_p.A291S|FBXO22OS_uc002bbm.1_RNA	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	395					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						AACAATAATGGCACTCATACA	0.343													48	55	---	---	---	---	PASS
FSD2	123722	broad.mit.edu	37	15	83455327	83455327	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83455327T>C	uc002bjd.2	-	3	838	c.671A>G	c.(670-672)GAA>GGA	p.E224G	FSD2_uc010uol.1_Missense_Mutation_p.E224G|FSD2_uc010uom.1_Missense_Mutation_p.E224G	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing	224	Potential.									central_nervous_system(1)	1						TATCTGCTTTTCCAATTTGTA	0.373													11	22	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84592663	84592663	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84592663A>T	uc002bjz.3	+	17	2219	c.1995A>T	c.(1993-1995)CAA>CAT	p.Q665H	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.Q665H|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.Q665H	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	665						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGGCCATCAAGAAGCCATAG	0.433													21	38	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84592664	84592664	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84592664G>T	uc002bjz.3	+	17	2220	c.1996G>T	c.(1996-1998)GAA>TAA	p.E666*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.E666*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.E666*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	666						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGGCCATCAAGAAGCCATAGC	0.433													21	37	---	---	---	---	PASS
MAN2A2	4122	broad.mit.edu	37	15	91452555	91452555	+	Splice_Site	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91452555A>T	uc010bnz.2	+	9	1312	c.1197_splice	c.e9-2	p.R399_splice	MAN2A2_uc010boa.2_Splice_Site_p.R441_splice|MAN2A2_uc002bqc.2_Splice_Site_p.R399_splice|MAN2A2_uc010uql.1_Splice_Site_p.R103_splice|MAN2A2_uc010uqm.1_Splice_Site_p.G46_splice|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TTCCTGCCCCAGGGCAGCCCT	0.448													40	21	---	---	---	---	PASS
NARFL	64428	broad.mit.edu	37	16	789703	789703	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:789703C>T	uc002cjr.2	-	2	114	c.102G>A	c.(100-102)GCG>GCA	p.A34A	NARFL_uc002cjp.2_5'Flank|NARFL_uc002cjq.2_5'UTR|NARFL_uc002cjs.2_5'UTR|NARFL_uc010brc.1_Silent_p.A34A|NARFL_uc010uur.1_Silent_p.A34A	NM_022493	NP_071938	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	34					iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding				0		Hepatocellular(780;0.0218)				CGCCACTTCCCGCCCTTTTTT	0.572													11	57	---	---	---	---	PASS
SPSB3	90864	broad.mit.edu	37	16	1827785	1827785	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1827785G>A	uc002cmr.2	-	5	717	c.684C>T	c.(682-684)CAC>CAT	p.H228H	SPSB3_uc002cms.2_Silent_p.H100H|SPSB3_uc002cmt.2_Silent_p.H100H|SPSB3_uc002cmu.2_Silent_p.H228H|SPSB3_uc002cmv.2_Silent_p.H100H	NM_080861	NP_543137	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box	228	B30.2/SPRY.				intracellular signal transduction						0						TGAGTGTGCCGTGCCAGGTGT	0.627													28	23	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2816402	2816402	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2816402C>G	uc002crk.2	+	11	6422	c.5873C>G	c.(5872-5874)TCC>TGC	p.S1958C	SRRM2_uc002crj.1_Missense_Mutation_p.S1862C|SRRM2_uc002crl.1_Missense_Mutation_p.S1958C|SRRM2_uc010bsu.1_Missense_Mutation_p.S1862C	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1958	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CGCAGAAGGTCCAGATCCAGG	0.567													17	35	---	---	---	---	PASS
TNFRSF17	608	broad.mit.edu	37	16	12061466	12061466	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12061466A>C	uc002dbv.2	+	3	535	c.317A>C	c.(316-318)AAG>ACG	p.K106T	TNFRSF17_uc010buy.2_3'UTR|TNFRSF17_uc010buz.2_Missense_Mutation_p.K57T	NM_001192	NP_001183	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily,	106	Cytoplasmic (Potential).				cell proliferation|multicellular organismal development	endomembrane system|integral to membrane|plasma membrane					0						GACCTGGAAAAGAGCAGGACT	0.468			T	IL2	intestinal T-cell lymphoma								26	122	---	---	---	---	PASS
GDE1	51573	broad.mit.edu	37	16	19522215	19522215	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19522215C>G	uc002dgh.2	-	3	653	c.489G>C	c.(487-489)GAG>GAC	p.E163D	GDE1_uc002dgi.2_Missense_Mutation_p.E53D	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	163	Lumenal (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						GGTTTAGGCACTCTGCAACAG	0.373													4	278	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20328621	20328621	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20328621T>C	uc002dgv.2	-	9	1422	c.1339A>G	c.(1339-1341)ATG>GTG	p.M447V	GP2_uc002dgw.2_Missense_Mutation_p.M444V|GP2_uc002dgx.2_Missense_Mutation_p.M300V|GP2_uc002dgy.2_Missense_Mutation_p.M297V	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	447	ZP.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						AACATGAACATCTGAACTGAG	0.488													42	56	---	---	---	---	PASS
OTOA	146183	broad.mit.edu	37	16	21712204	21712204	+	Intron	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21712204A>G	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		TTGTCCACCAACTAGATTGGG	0.552													17	46	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24373169	24373169	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24373169C>T	uc002dmf.2	+	4	2133	c.933C>T	c.(931-933)CGC>CGT	p.R311R		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	311					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		CCAACAGGCGCACCACGCCCG	0.562													23	27	---	---	---	---	PASS
SH2B1	25970	broad.mit.edu	37	16	28877797	28877797	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28877797G>T	uc002dri.2	+	4	821	c.382G>T	c.(382-384)GAC>TAC	p.D128Y	uc010vct.1_Intron|SH2B1_uc010vdc.1_Intron|SH2B1_uc002drj.2_Missense_Mutation_p.D128Y|SH2B1_uc002drk.2_Missense_Mutation_p.D128Y|SH2B1_uc002drl.2_Missense_Mutation_p.D128Y|SH2B1_uc010vdd.1_Intron|SH2B1_uc010vde.1_Missense_Mutation_p.D128Y|SH2B1_uc002drm.2_Missense_Mutation_p.D128Y	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1 isoform 1	128	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|Interaction with RAC1 (By similarity).|Required for NGF signaling (By similarity).				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2						ATCATCTGAGGACCTGGCCGG	0.627													21	39	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31088353	31088353	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31088353G>A	uc002eap.2	+	2	997	c.708G>A	c.(706-708)GAG>GAA	p.E236E	ZNF668_uc002eao.2_5'Flank	NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CTGAGGAGGAGCGGCGGTACA	0.597													13	56	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31141588	31141588	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31141588G>T	uc002eay.2	+	8	931	c.913G>T	c.(913-915)GAG>TAG	p.E305*	MYST1_uc002eax.2_Nonsense_Mutation_p.E305*|MYST1_uc002eaz.2_Nonsense_Mutation_p.E147*|MYST1_uc002eba.2_Nonsense_Mutation_p.E89*|MYST1_uc002ebb.2_RNA	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	305					histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						CCTCCTGCAGGAGAAGGAGTC	0.642													34	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33020884	33020884	+	IGR	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33020884C>A								SLC6A10P (124421 upstream) : MIR1826 (944624 downstream)																							CAATAACTCACCGTATCTGCA	0.507													170	174	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47694647	47694647	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47694647G>T	uc002eev.3	+	22	2165	c.2113G>T	c.(2113-2115)GCT>TCT	p.A705S	PHKB_uc002eeu.3_Missense_Mutation_p.A698S	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	705					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CACCCCTAGTGCTCCTGAACT	0.423													57	74	---	---	---	---	PASS
LPCAT2	54947	broad.mit.edu	37	16	55583305	55583305	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55583305G>A	uc002eie.3	+	10	1233	c.1052G>A	c.(1051-1053)CGA>CAA	p.R351Q	LPCAT2_uc002eic.2_Missense_Mutation_p.R81Q	NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	351	Lumenal (Potential).				cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						AAAATTAGCCGAAAATTGAAG	0.358													37	66	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58612662	58612662	+	Missense_Mutation	SNP	T	C	C	rs112226008	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58612662T>C	uc002env.2	-	13	1818	c.1525A>G	c.(1525-1527)ATT>GTT	p.I509V	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.I509V|CNOT1_uc002enx.2_Missense_Mutation_p.I509V|CNOT1_uc002enz.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	509					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CCAAGGAAAATTGGCATCAGA	0.428													49	65	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58633245	58633245	+	5'UTR	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58633245T>A	uc002env.2	-	2					CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_5'UTR|CNOT1_uc002enx.2_5'UTR|CNOT1_uc002enz.1_5'UTR	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GATTCATTGCTGGTTGGGGCG	0.498													55	37	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75269714	75269714	+	Silent	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75269714C>A	uc002fdv.2	-	5	1206	c.1083G>T	c.(1081-1083)GTG>GTT	p.V361V	BCAR1_uc002fdt.2_5'UTR|BCAR1_uc002fdu.2_Silent_p.V151V|BCAR1_uc010cgu.2_Silent_p.V350V|BCAR1_uc010vna.1_Silent_p.V359V|BCAR1_uc010vnb.1_Silent_p.V407V|BCAR1_uc002fdw.2_Silent_p.V361V|BCAR1_uc010vnc.1_Silent_p.V213V|BCAR1_uc010vnd.1_Silent_p.V379V|BCAR1_uc002fdx.2_Silent_p.V379V	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	361	Substrate for kinases (By similarity).				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCACGTCATACACGTCCTCGG	0.726													8	10	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81204619	81204619	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81204619T>C	uc002fgh.1	-	17	2839	c.2839A>G	c.(2839-2841)AGG>GGG	p.R947G	PKD1L2_uc002fgg.1_RNA|PKD1L2_uc002fgi.2_Missense_Mutation_p.R262G|PKD1L2_uc002fgj.2_Missense_Mutation_p.R947G	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	947	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TCCTGCACCCTCTGCACGTCC	0.592													21	19	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578208T>C	uc002gim.2	-	6	835	c.641A>G	c.(640-642)CAT>CGT	p.H214R	TP53_uc002gig.1_Missense_Mutation_p.H214R|TP53_uc002gih.2_Missense_Mutation_p.H214R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H82R|TP53_uc010cng.1_Missense_Mutation_p.H82R|TP53_uc002gii.1_Missense_Mutation_p.H82R|TP53_uc010cnh.1_Missense_Mutation_p.H214R|TP53_uc010cni.1_Missense_Mutation_p.H214R|TP53_uc002gij.2_Missense_Mutation_p.H214R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H121R|TP53_uc002gio.2_Missense_Mutation_p.H82R|TP53_uc010vug.1_Missense_Mutation_p.H175R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	214	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> Y (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H214R(45)|p.0?(7)|p.H214Y(4)|p.H214Q(4)|p.H214D(3)|p.H214fs*5(2)|p.H214fs*33(2)|p.D208fs*1(1)|p.K164_P219del(1)|p.H214H(1)|p.H214fs*7(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.T211_S215delTFRHS(1)|p.H214_S215insX(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACCACACTATGTCGAAAAGT	0.542		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			20	8	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10222449	10222449	+	Silent	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10222449G>C	uc002gmk.1	-	27	3486	c.3396C>G	c.(3394-3396)CTC>CTG	p.L1132L		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1132	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCTTGGCTCTGAGCGTGTGTT	0.557													56	11	---	---	---	---	PASS
MAP2K3	5606	broad.mit.edu	37	17	21201698	21201698	+	Intron	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21201698A>G	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GGGATAGGCCAGACGCCTCAC	0.592													72	150	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35614769	35614769	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35614769C>T	uc002hnm.2	-	14	1762	c.1571G>A	c.(1570-1572)GGA>GAA	p.G524E	ACACA_uc002hnk.2_Missense_Mutation_p.G446E|ACACA_uc002hnl.2_Missense_Mutation_p.G466E|ACACA_uc002hnn.2_Missense_Mutation_p.G524E|ACACA_uc002hno.2_Missense_Mutation_p.G561E|ACACA_uc010cuz.2_Missense_Mutation_p.G524E	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	524	Biotin carboxylation.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CTGAACTGTTCCTGAGCTGGG	0.383													40	27	---	---	---	---	PASS
FBXL20	84961	broad.mit.edu	37	17	37439059	37439059	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37439059C>T	uc010wed.1	-	8	765	c.544G>A	c.(544-546)GTA>ATA	p.V182I	FBXL20_uc002hrt.2_Missense_Mutation_p.V182I|FBXL20_uc010cvu.2_Missense_Mutation_p.V150I	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	182	LRR 5.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			TCCTTGGTTACTTGGTCACAC	0.443													5	161	---	---	---	---	PASS
FAM117A	81558	broad.mit.edu	37	17	47810055	47810055	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47810055T>C	uc002ipk.2	-	2	293	c.224A>G	c.(223-225)GAA>GGA	p.E75G	FAM117A_uc010wlz.1_5'UTR	NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	75										ovary(1)	1						CACTGACTTTTCTGGGGCCAC	0.597													14	10	---	---	---	---	PASS
FTSJ3	117246	broad.mit.edu	37	17	61902894	61902894	+	Splice_Site	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61902894A>G	uc002jbz.2	-	5	478	c.400_splice	c.e5+1	p.A134_splice	FTSJ3_uc002jca.2_Splice_Site_p.A134_splice|PSMC5_uc002jcb.2_5'Flank|PSMC5_uc010ddy.2_5'Flank|PSMC5_uc010ddz.2_5'Flank|PSMC5_uc002jcc.2_5'Flank|PSMC5_uc002jcd.2_5'Flank	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						CACTCCCTGTACCTTGTGAGT	0.567													42	25	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73747062	73747062	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73747062C>A	uc002jpg.2	+	30	3850	c.3663C>A	c.(3661-3663)AGC>AGA	p.S1221R	ITGB4_uc002jph.2_Missense_Mutation_p.S1221R|ITGB4_uc002jpi.3_Missense_Mutation_p.S1221R|ITGB4_uc002jpj.2_Missense_Mutation_p.S1221R	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	1221	Fibronectin type-III 2.|Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TAGTGCCCAGCGAGCCAGGGC	0.632													65	57	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13621229	13621229	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13621229C>T	uc002ksa.2	+	5	963	c.295C>T	c.(295-297)CGC>TGC	p.R99C	C18orf1_uc002ksb.2_Missense_Mutation_p.R99C|C18orf1_uc002kse.2_Missense_Mutation_p.R62C|C18orf1_uc002ksf.2_Missense_Mutation_p.R62C|C18orf1_uc002ksg.1_Missense_Mutation_p.R22C|C18orf1_uc002ksh.1_Missense_Mutation_p.R41C|C18orf1_uc002ksi.1_Missense_Mutation_p.R41C	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1	99	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CTTCATCAACCGCCCGAACCA	0.637													21	77	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25572701	25572701	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25572701C>G	uc002kwg.2	-	9	1721	c.1262G>C	c.(1261-1263)AGA>ACA	p.R421T	CDH2_uc010xbn.1_Missense_Mutation_p.R390T	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	421	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						GCCACTGATTCTGTACACTGC	0.517													91	77	---	---	---	---	PASS
GALNT1	2589	broad.mit.edu	37	18	33234650	33234650	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33234650G>A	uc010dmu.2	+	2	77	c.24G>A	c.(22-24)AAG>AAA	p.K8K	GALNT1_uc002kyz.3_5'UTR|GALNT1_uc002kza.2_Silent_p.K8K|GALNT1_uc002kzb.2_Silent_p.K8K	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	8	Cytoplasmic (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						CATACTGCAAGGTGGTCCTAG	0.338													12	18	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54339771	54339771	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54339771C>T	uc002lgk.1	+	2	236	c.25C>T	c.(25-27)CCC>TCC	p.P9S	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.P9S	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	9										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		CCTTGTTCTACCCATTGTTCT	0.408													8	151	---	---	---	---	PASS
PIGN	23556	broad.mit.edu	37	18	59807680	59807680	+	Silent	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59807680A>T	uc002lii.3	-	12	1444	c.996T>A	c.(994-996)ATT>ATA	p.I332I	PIGN_uc002lij.3_Silent_p.I332I	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	332	Lumenal (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				AGGGAACTCCAATAAGGGAAG	0.303													4	25	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74672689	74672689	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74672689C>T	uc002lmi.2	+	30	5489	c.5291C>T	c.(5290-5292)GCG>GTG	p.A1764V	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1764	C2H2-type 29.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CAGAAGAGTGCGCTGCAGGTG	0.517													8	226	---	---	---	---	PASS
SAFB	6294	broad.mit.edu	37	19	5664451	5664451	+	Splice_Site	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5664451G>T	uc002mcf.2	+	17	2387	c.2334_splice	c.e17+1	p.Q778_splice	SAFB_uc002mcg.2_Splice_Site_p.Q778_splice|SAFB_uc002mce.3_Splice_Site_p.Q777_splice|SAFB_uc010xir.1_Splice_Site_p.Q777_splice|SAFB_uc010xis.1_Splice_Site_p.Q709_splice|SAFB_uc010xit.1_Splice_Site_p.Q620_splice|SAFB_uc010xiu.1_Splice_Site_p.Q577_splice	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		AGAAGGACAGGTAAGTCTGAA	0.458													54	3	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7168116	7168116	+	Intron	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7168116T>A	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTGGAAAAGTTAAAACAAAAG	0.358													43	8	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9058961	9058961	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9058961G>A	uc002mkp.2	-	3	28689	c.28485C>T	c.(28483-28485)ACC>ACT	p.T9495T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9497	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTCATCTGAGGTGATATTCA	0.473													61	247	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10600339	10600339	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10600339T>C	uc002moq.1	-	4	1672	c.1516A>G	c.(1516-1518)ATC>GTC	p.I506V	KEAP1_uc002mop.1_Missense_Mutation_p.I224V|KEAP1_uc002mor.1_Missense_Mutation_p.I506V	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	506	Kelch 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CCGCTTCGGATGGTGTTCATT	0.597													37	5	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13397667	13397667	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13397667A>T	uc010dze.2	-	20	3442	c.3206T>A	c.(3205-3207)ATG>AAG	p.M1069K	CACNA1A_uc010dzc.2_Missense_Mutation_p.M594K|CACNA1A_uc002mwy.3_Missense_Mutation_p.M1068K|CACNA1A_uc010xne.1_Missense_Mutation_p.M597K	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1069	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GTTGTTCTTCATGTTGTCAAT	0.667													30	7	---	---	---	---	PASS
OR7A10	390892	broad.mit.edu	37	19	14952418	14952418	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14952418A>T	uc002mzx.1	-	1	272	c.272T>A	c.(271-273)GTC>GAC	p.V91D		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					ATAGGTGATGACTTTGTTGTG	0.473													63	9	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15354077	15354077	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15354077G>A	uc002nar.2	-	14	3025	c.2803C>T	c.(2803-2805)CTG>TTG	p.L935L		NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	935					interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			ACCTTCTGCAGCTGCTGCAGG	0.478			T	NUT|C15orf55	lethal midline carcinoma of young people								9	3	---	---	---	---	PASS
ANO8	57719	broad.mit.edu	37	19	17435645	17435645	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17435645C>G	uc002ngf.2	-	17	3371	c.3212G>C	c.(3211-3213)GGG>GCG	p.G1071A	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	1071	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(3)	3						CCGGGCCTGCCCGCCCGCCCC	0.711													64	13	---	---	---	---	PASS
GMIP	51291	broad.mit.edu	37	19	19752824	19752824	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19752824T>C	uc002nnd.2	-	3	258	c.141A>G	c.(139-141)TCA>TCG	p.S47S	GMIP_uc010xrb.1_Silent_p.S47S|GMIP_uc010xrc.1_Silent_p.S47S	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	47					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						CTGGGTCTTCTGAGAGTAGAG	0.587													18	3	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37903520	37903520	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37903520G>C	uc002ogi.2	-	6	2598	c.2040C>G	c.(2038-2040)CAC>CAG	p.H680Q	ZNF569_uc002ogh.2_Missense_Mutation_p.H521Q|ZNF569_uc002ogj.2_Missense_Mutation_p.H704Q	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	680	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAATTCTCTGGTGTCTAACAA	0.408													63	150	---	---	---	---	PASS
ARHGEF1	9138	broad.mit.edu	37	19	42410651	42410651	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42410651A>G	uc002orx.2	+	27	2643	c.2534A>G	c.(2533-2535)AAT>AGT	p.N845S	ARHGEF1_uc002ory.2_Missense_Mutation_p.N812S|ARHGEF1_uc002orz.2_Missense_Mutation_p.N683S|ARHGEF1_uc002osa.2_Missense_Mutation_p.N860S|ARHGEF1_uc002osb.2_Intron|ARHGEF1_uc002osc.2_Intron|ARHGEF1_uc002osd.2_Missense_Mutation_p.N504S|ARHGEF1_uc002ose.2_Missense_Mutation_p.N289S	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	845					cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GAGGAAGACAATGGGGCGGGG	0.672													31	45	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43262165	43262165	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43262165A>C	uc002ouo.2	-	3	796	c.698T>G	c.(697-699)CTG>CGG	p.L233R	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.L72R|PSG8_uc002ouh.2_Missense_Mutation_p.L233R|PSG8_uc010ein.2_Missense_Mutation_p.L111R|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Missense_Mutation_p.L72R|PSG8_uc002oul.3_Missense_Mutation_p.L233R|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	233	Ig-like C2-type 1.					extracellular region					0		Prostate(69;0.00899)				GAGGAGATTCAGGGTGAATGG	0.532													207	264	---	---	---	---	PASS
PSG4	5672	broad.mit.edu	37	19	43699232	43699232	+	Silent	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43699232C>T	uc002ovy.2	-	4	1005	c.903G>A	c.(901-903)ACG>ACA	p.T301T	PSG6_uc010xwk.1_Intron|PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Silent_p.T208T|PSG4_uc002ovz.2_Intron	NM_002780	NP_002771	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4 isoform	301	Ig-like C2-type 2.				defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)				TTTCATTTCTCGTGACATTGG	0.478													188	254	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49132810	49132810	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49132810G>A	uc002pjr.2	+	7	2111	c.1745G>A	c.(1744-1746)CGC>CAC	p.R582H	SPHK2_uc010xzt.1_Missense_Mutation_p.R523H|SPHK2_uc002pjs.2_Missense_Mutation_p.R582H|SPHK2_uc002pjt.2_Missense_Mutation_p.R376H|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Missense_Mutation_p.R546H|SPHK2_uc002pjw.2_Missense_Mutation_p.R644H	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	582					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GCGCTGCTGCGCCTTTTCTTG	0.692													3	19	---	---	---	---	PASS
DPRX	503834	broad.mit.edu	37	19	54140202	54140202	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54140202G>T	uc002qcf.1	+	3	587	c.536G>T	c.(535-537)GGC>GTC	p.G179V		NM_001012728	NP_001012746	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	179						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		TTCCATTCTGGCTCTCCTGCC	0.388													62	130	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54779863	54779863	+	Intron	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54779863G>A	uc002qfb.2	-						LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Intron|LILRB2_uc010erj.2_Intron|LILRB2_uc002qfc.2_Intron|LILRB2_uc010yet.1_Intron	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGCATCTGCTGGGGCAGAGCA	0.637													119	105	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55146701	55146701	+	Intron	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55146701T>C	uc002qgj.2	+						LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Intron|LILRB1_uc002qgk.2_Intron|LILRB1_uc002qgm.2_Intron|LILRB1_uc010erq.2_Intron|LILRB1_uc010err.2_Intron	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,						regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GCTCCCATTCTTCCCCCAGGT	0.607										HNSCC(37;0.09)			3	58	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55263688	55263688	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55263688G>A	uc002qgv.2	+	7	859	c.841G>A	c.(841-843)GAG>AAG	p.E281K	KIR2DS4_uc010yfj.1_5'Flank|KIR2DL3_uc002qgx.2_Missense_Mutation_p.E281K|KIR2DL3_uc002qgy.2_Missense_Mutation_p.E183K|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_5'Flank	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	281	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		AATGGACCAAGAGCCTGCAGG	0.512													72	144	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55401161	55401161	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55401161C>T	uc002qhr.1	+	5	993	c.796C>T	c.(796-798)CCG>TCG	p.P266S	FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.P217S|FCAR_uc010esi.1_Missense_Mutation_p.P143S|FCAR_uc002qhu.1_Missense_Mutation_p.P170S|FCAR_uc002qhv.1_Missense_Mutation_p.P244S|FCAR_uc002qhw.1_Missense_Mutation_p.P254S|FCAR_uc002qhx.1_Missense_Mutation_p.P158S|FCAR_uc002qhy.1_Missense_Mutation_p.P232S|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_Missense_Mutation_p.P157S	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	266	Cytoplasmic (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		TGTGGCTGAACCGAGCTGGAG	0.557													147	152	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57641067	57641067	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641067T>C	uc002qny.2	+	4	1380	c.1024T>C	c.(1024-1026)TGT>CGT	p.C342R		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	342					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAAAGATTTCTGTAGTACAAA	0.383													99	87	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58099911	58099911	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58099911G>T	uc002qpg.2	+	3	174	c.77G>T	c.(76-78)TGT>TTT	p.C26F	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_5'UTR|ZIK1_uc002qpi.2_Missense_Mutation_p.C13F|ZIK1_uc002qpj.2_Intron	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	26					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGACAGGGCTGTGTGACCTTT	0.522													74	112	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1902292	1902292	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902292G>A	uc002wfq.2	+	4	1048	c.688G>A	c.(688-690)GTG>ATG	p.V230M	SIRPA_uc010zps.1_Missense_Mutation_p.V210M|SIRPA_uc002wfr.2_Missense_Mutation_p.V230M|SIRPA_uc002wfs.2_Missense_Mutation_p.V230M|SIRPA_uc002wft.2_Missense_Mutation_p.V230M	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	230	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CATCTGCGAGGTGGCCCACGT	0.612													5	94	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1902301	1902301	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902301G>A	uc002wfq.2	+	4	1057	c.697G>A	c.(697-699)GTC>ATC	p.V233I	SIRPA_uc010zps.1_Missense_Mutation_p.V213I|SIRPA_uc002wfr.2_Missense_Mutation_p.V233I|SIRPA_uc002wfs.2_Missense_Mutation_p.V233I|SIRPA_uc002wft.2_Missense_Mutation_p.V233I	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	233	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GGTGGCCCACGTCACCTTGCA	0.617													5	92	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17338980	17338980	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17338980G>T	uc002wpm.2	+	3	611	c.291G>T	c.(289-291)ATG>ATT	p.M97I	PCSK2_uc002wpl.2_Missense_Mutation_p.M78I|PCSK2_uc010zrm.1_Missense_Mutation_p.M62I	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	97					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGGTAAAGATGGCTTTGCAGC	0.373													6	68	---	---	---	---	PASS
DSTN	11034	broad.mit.edu	37	20	17587719	17587719	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17587719T>G	uc002wpr.2	+	4	681	c.426T>G	c.(424-426)GAT>GAG	p.D142E	DSTN_uc002wpq.2_Missense_Mutation_p.D125E|DSTN_uc010gck.2_Missense_Mutation_p.D125E	NM_006870	NP_006861	P60981	DEST_HUMAN	destrin isoform a	142	ADF-H.				actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2						GACCAGAAGATCTCAATCGGG	0.378													5	164	---	---	---	---	PASS
CST1	1469	broad.mit.edu	37	20	23731348	23731348	+	Silent	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23731348G>T	uc002wtp.2	-	1	227	c.156C>A	c.(154-156)ATC>ATA	p.I52I		NM_001898	NP_001889	P01037	CYTN_HUMAN	cystatin SN precursor	52						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Lung NSC(19;0.0676)|all_lung(19;0.148)					TATACTCGCTGATGGCGAAGT	0.572													90	59	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31017235	31017235	+	Splice_Site	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31017235G>A	uc002wxs.2	+	6	991	c.565_splice	c.e6+1	p.G189_splice	ASXL1_uc010geb.2_Splice_Site_p.G131_splice	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TCTGCATCAGGTATGTGTAAA	0.512			F|N|Mis		MDS|CMML								15	64	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36641556	36641556	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36641556G>A	uc002xhl.2	-	3	872	c.663C>T	c.(661-663)ATC>ATT	p.I221I	KIAA0406_uc002xhm.2_Silent_p.I221I	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	221							binding				0		Myeloproliferative disorder(115;0.00874)				AGTCTCCTGTGATAAGCCTGG	0.423													22	148	---	---	---	---	PASS
BPI	671	broad.mit.edu	37	20	36953175	36953175	+	Splice_Site	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36953175G>C	uc002xib.2	+	9	1008	c.946_splice	c.e9-1	p.I316_splice		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein						defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				TCTTGCTACAGATTCCAAAGG	0.443													73	33	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41385134	41385134	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41385134C>T	uc002xkg.2	-	6	1011	c.827G>A	c.(826-828)GGT>GAT	p.G276D	PTPRT_uc010ggj.2_Missense_Mutation_p.G276D	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	276	Extracellular (Potential).|Ig-like C2-type.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTTGGACACACCAGACCCACC	0.582													3	27	---	---	---	---	PASS
DNTTIP1	116092	broad.mit.edu	37	20	44424038	44424038	+	Missense_Mutation	SNP	G	A	A	rs139853820	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44424038G>A	uc002xpk.2	+	4	396	c.328G>A	c.(328-330)GCA>ACA	p.A110T		NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting	110						nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				GGAGGTGGACGCAGAGCAGCT	0.562													13	7	---	---	---	---	PASS
PCIF1	63935	broad.mit.edu	37	20	44569577	44569577	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44569577G>A	uc002xqs.2	+	6	831	c.517G>A	c.(517-519)GAG>AAG	p.E173K		NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1	173						nucleus				skin(1)	1						ACGACCCACTGAGTGAGTCCC	0.597													25	63	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47307609	47307609	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47307609G>A	uc002xtw.1	-	9	1085	c.1062C>T	c.(1060-1062)ACC>ACT	p.T354T		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	354	PH.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CGTTGGTGACGGTATAGCCGT	0.567													24	80	---	---	---	---	PASS
LSM14B	149986	broad.mit.edu	37	20	60701381	60701381	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60701381G>T	uc010gjy.1	+	3	519	c.313G>T	c.(313-315)GCC>TCC	p.A105S	LSM14B_uc002ybt.2_Missense_Mutation_p.A105S|LSM14B_uc010gjx.1_Missense_Mutation_p.A131S|LSM14B_uc002ybv.2_Missense_Mutation_p.A105S|LSM14B_uc010gjz.1_5'UTR|LSM14B_uc010zzz.1_5'UTR	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B	105					multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TTCTGCCTCCGCCTCGCCCTT	0.662													30	14	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22707972	22707972	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22707972C>G	uc002yld.1	+	7	1134	c.885C>G	c.(883-885)TTC>TTG	p.F295L	NCAM2_uc011acb.1_Missense_Mutation_p.F153L|NCAM2_uc011acc.1_Missense_Mutation_p.F320L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	295	Ig-like C2-type 3.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGCAAGCTTTCCTCCAAGTCT	0.373													11	30	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22910202	22910202	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22910202C>A	uc002yld.1	+	18	2687	c.2438C>A	c.(2437-2439)GCT>GAT	p.A813D	NCAM2_uc011acb.1_Missense_Mutation_p.A671D	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	813	Cytoplasmic (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GGGAAAGAAGCTCTAAATCCA	0.328													69	39	---	---	---	---	PASS
PFKL	5211	broad.mit.edu	37	21	45738464	45738464	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45738464G>T	uc002zel.2	+	10	1107	c.1048G>T	c.(1048-1050)GAG>TAG	p.E350*	PFKL_uc002zek.2_Nonsense_Mutation_p.E397*|PFKL_uc002zem.2_5'Flank|PFKL_uc002zen.2_5'Flank	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	350					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		GCCCCTCATGGAGTGCGTGCA	0.701													38	11	---	---	---	---	PASS
KRTAP10-1	386677	broad.mit.edu	37	21	45959214	45959214	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45959214G>C	uc002zfh.1	-	1	865	c.820C>G	c.(820-822)CGC>GGC	p.R274G	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198691	NP_941964	P60331	KR101_HUMAN	keratin associated protein 10-1	274						keratin filament				skin(1)	1						CACGCGGGGCGGCAGAGGAGG	0.731													30	10	---	---	---	---	PASS
MMP11	4320	broad.mit.edu	37	22	24121524	24121524	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24121524G>A	uc002zxx.2	+	2	281	c.259G>A	c.(259-261)GAT>AAT	p.D87N	MMP11_uc002zxy.2_RNA|MMP11_uc002zxz.2_5'Flank	NM_005940	NP_005931	P24347	MMP11_HUMAN	matrix metalloproteinase 11 preproprotein	87					collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|large_intestine(1)	3		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)				CGACCCATCTGATGGGCTGAG	0.697													14	33	---	---	---	---	PASS
MMP11	4320	broad.mit.edu	37	22	24121532	24121532	+	Silent	SNP	G	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24121532G>C	uc002zxx.2	+	2	289	c.267G>C	c.(265-267)CTG>CTC	p.L89L	MMP11_uc002zxy.2_RNA|MMP11_uc002zxz.2_5'Flank	NM_005940	NP_005931	P24347	MMP11_HUMAN	matrix metalloproteinase 11 preproprotein	89					collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|large_intestine(1)	3		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)				CTGATGGGCTGAGTGCCCGCA	0.682													14	31	---	---	---	---	PASS
ADRBK2	157	broad.mit.edu	37	22	26114280	26114280	+	Nonsense_Mutation	SNP	C	T	T	rs148927409		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26114280C>T	uc003abx.3	+	19	1870	c.1723C>T	c.(1723-1725)CAG>TAG	p.Q575*	ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	575	PH.						ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	ATTTCTGACTCAGTGGCAGCG	0.463													4	154	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30891954	30891954	+	Silent	SNP	T	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30891954T>A	uc003aid.2	-	3	235	c.135A>T	c.(133-135)CGA>CGT	p.R45R	SEC14L4_uc011akz.1_Silent_p.R45R|SEC14L4_uc003aie.2_Missense_Mutation_p.E14V|SEC14L4_uc003aif.2_5'UTR	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a	45						integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	GGTCAAAGTTTCGAGCTGCAA	0.507													20	31	---	---	---	---	PASS
PLA2G3	50487	broad.mit.edu	37	22	31535854	31535854	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31535854C>T	uc003aka.2	-	1	616	c.487G>A	c.(487-489)GAT>AAT	p.D163N		NM_015715	NP_056530	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III precursor	163	Phospholipase A2-like.				cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity				0						CCAGCAGAATCTCCAACTCCA	0.353													9	99	---	---	---	---	PASS
SFI1	9814	broad.mit.edu	37	22	32010810	32010810	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32010810G>T	uc003ale.2	+	28	3425	c.3032G>T	c.(3031-3033)CGC>CTC	p.R1011L	SFI1_uc003alf.2_Missense_Mutation_p.R980L|SFI1_uc003alg.2_Missense_Mutation_p.R929L|SFI1_uc011alp.1_Missense_Mutation_p.R917L|SFI1_uc011alq.1_Missense_Mutation_p.R956L|SFI1_uc003alh.2_RNA|SFI1_uc010gwi.2_RNA|SFI1_uc003ali.2_Missense_Mutation_p.R103L|SFI1_uc003alj.2_Missense_Mutation_p.A83S	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	1011					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						CAGCCGCGACGCCCACACTTC	0.662													69	48	---	---	---	---	PASS
SLC5A4	6527	broad.mit.edu	37	22	32644773	32644773	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32644773A>G	uc003ami.2	-	4	331	c.329T>C	c.(328-330)CTG>CCG	p.L110P		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	110	Helical; (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						CCCAAGAATCAGCAACATTAC	0.348													72	107	---	---	---	---	PASS
C1QTNF6	114904	broad.mit.edu	37	22	37578345	37578345	+	Nonsense_Mutation	SNP	G	T	T	rs144359957		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37578345G>T	uc003aqw.1	-	2	1168	c.663C>A	c.(661-663)TAC>TAA	p.Y221*	C1QTNF6_uc003aqx.1_Nonsense_Mutation_p.Y240*|C1QTNF6_uc003aqy.1_Nonsense_Mutation_p.Y240*|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	221	C1q.					collagen					0						CGCGGTCCCCGTAGGCCAGGT	0.592													18	8	---	---	---	---	PASS
C1QTNF6	114904	broad.mit.edu	37	22	37578618	37578618	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37578618G>A	uc003aqw.1	-	2	895	c.390C>T	c.(388-390)GGC>GGT	p.G130G	C1QTNF6_uc003aqx.1_Silent_p.G149G|C1QTNF6_uc003aqy.1_Silent_p.G149G|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	130	C1q.					collagen					0						CCGTCTTGCGGCCCACTGAGA	0.652													35	33	---	---	---	---	PASS
GCAT	23464	broad.mit.edu	37	22	38212584	38212584	+	Silent	SNP	C	G	G	rs149775052		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38212584C>G	uc003atz.2	+	9	1139	c.1119C>G	c.(1117-1119)GTC>GTG	p.V373V	GCAT_uc003aua.1_Silent_p.V399V	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor	373					biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	GCATCTTTGTCATCGGGTTCA	0.602													45	66	---	---	---	---	PASS
ADSL	158	broad.mit.edu	37	22	40754992	40754992	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40754992G>T	uc003ayp.3	+	5	666	c.607G>T	c.(607-609)GGC>TGC	p.G203C	ADSL_uc003ays.3_Missense_Mutation_p.G203C|ADSL_uc003ayq.3_Missense_Mutation_p.G203C|ADSL_uc003ayr.3_5'UTR|ADSL_uc003ayt.3_Missense_Mutation_p.G188C|ADSL_uc010gyb.1_RNA	NM_000026	NP_000017	P30566	PUR8_HUMAN	adenylosuccinate lyase isoform a	203					AMP biosynthetic process|protein tetramerization|purine base metabolic process	cytosol	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity			ovary(1)	1						GGGTACCACTGGCACTCAGGC	0.507													23	22	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43936136	43936136	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43936136C>A	uc003bdy.1	-	28	3965	c.3750G>T	c.(3748-3750)ATG>ATT	p.M1250I	EFCAB6_uc003bdz.1_Missense_Mutation_p.M1098I|EFCAB6_uc010gzi.1_Missense_Mutation_p.M1098I|EFCAB6_uc010gzj.1_3'UTR	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1250					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				CACCAGTGGCCATTGGTGTGG	0.592													18	57	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29935678	29935678	+	Silent	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29935678T>C	uc004dby.2	+	7	1384	c.876T>C	c.(874-876)GAT>GAC	p.D292D		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	292	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTATTGAAGATCTGGATGAAA	0.353													4	40	---	---	---	---	PASS
CCDC22	28952	broad.mit.edu	37	X	49099760	49099760	+	Silent	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49099760G>A	uc004dnd.1	+	6	702	c.546G>A	c.(544-546)GAG>GAA	p.E182E	CCDC22_uc011mna.1_Silent_p.E182E|CCDC22_uc004dnc.1_RNA	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22	182										central_nervous_system(1)	1						AGCCACGGGAGTTCCAGGCGA	0.657													10	1	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53578044	53578044	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53578044T>C	uc004dsp.2	-	65	9605	c.9203A>G	c.(9202-9204)GAC>GGC	p.D3068G	HUWE1_uc004dsn.2_Missense_Mutation_p.D1876G	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3068					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ACGGCGCAGGTCTGAGGGCAG	0.562													6	27	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123514841	123514841	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123514841A>G	uc004euj.2	-	31	7787	c.7723T>C	c.(7723-7725)TTC>CTC	p.F2575L	ODZ1_uc011muj.1_Missense_Mutation_p.F2581L|ODZ1_uc010nqy.2_Missense_Mutation_p.F2582L	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2575	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						AGCTTAATGAAGTAGTGAGTG	0.498													69	7	---	---	---	---	PASS
SMARCA1	6594	broad.mit.edu	37	X	128599711	128599711	+	Splice_Site	SNP	T	G	G			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128599711T>G	uc004eun.3	-	23	2931	c.2818_splice	c.e23-1	p.I940_splice	SMARCA1_uc004eup.3_Splice_Site_p.I928_splice|SMARCA1_uc011muk.1_Splice_Site_p.I940_splice|SMARCA1_uc011mul.1_Splice_Site_p.I928_splice	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated						ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						TCTTGCAATCTGTGTATTTAA	0.323													39	7	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150911633	150911633	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150911633C>T	uc004fey.1	+	7	882	c.658C>T	c.(658-660)CAG>TAG	p.Q220*		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	220	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCACACCCTGCAGTTCAAGCT	0.522													45	5	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151124015	151124015	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151124015G>A	uc004ffi.2	-	8	1016	c.962C>T	c.(961-963)ACC>ATC	p.T321I	GABRE_uc011myd.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	321					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCAACGTGGTCATGGTCAG	0.498													42	8	---	---	---	---	PASS
MFN2	9927	broad.mit.edu	37	1	12058607	12058611	+	Intron	DEL	AAAAC	-	-	rs113209787		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12058607_12058611delAAAAC	uc001atn.3	+						MFN2_uc009vni.2_Intron	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2						blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		tcTATATCCAaaaacaaaacaaaac	0.195													4	5	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39796845	39796856	+	5'UTR	DEL	TTTTTTTTTTTT	-	-	rs71810789		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39796845_39796856delTTTTTTTTTTTT	uc010oiu.1	+	1					MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tctcttttcctttttttttttttttttttttt	0.316													6	3	---	---	---	---	
DRAM2	128338	broad.mit.edu	37	1	111667640	111667640	+	Intron	DEL	A	-	-	rs146295738		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111667640delA	uc001ead.3	-						DRAM2_uc001eae.3_Intron|DRAM2_uc009wfy.2_Intron|DRAM2_uc001eaf.3_Intron	NM_178454	NP_848549	Q6UX65	DRAM2_HUMAN	transmembrane protein 77						apoptosis|induction of apoptosis	Golgi apparatus|integral to membrane|lysosomal membrane					0						GAATAAAAAGAAAAAAAAAAA	0.174													1	5	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145378949	145378950	+	Intron	INS	-	G	G	rs138005187	by1000genomes	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145378949_145378950insG	uc001emp.3	+							NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGAAACGCGCCATTAGTACTG	0.460													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	GCTGCT	GCTGCT	rs3831942		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154842199_154842200insGCTGCT	uc001ffp.2	-	1	555_556	c.241_242insAGCAGC	c.(241-243)CCA>CAGCAGCCA	p.80_81insQQ	KCNN3_uc009wox.1_In_Frame_Ins_p.80_81insQQ	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	80_86						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GGGATGCGGTGgctgctgctgc	0.347													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156325583	156325583	+	IGR	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156325583delT								C1orf182 (8800 upstream) : RHBG (13420 downstream)																							CACCCCCGCCTTTTTTTTTTT	0.119													4	2	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173819743	173819744	+	Intron	INS	-	T	T	rs66665709		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819743_173819744insT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	CTGCATAAATCttttttttttt	0.183													4	2	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28773035	28773035	+	Intron	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28773035delT	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					ACCTTCCACGTGGtttttttt	0.234													4	2	---	---	---	---	
EML4	27436	broad.mit.edu	37	2	42483792	42483792	+	Intron	DEL	A	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42483792delA	uc002rsi.2	+						EML4_uc002rsh.3_Intron|EML4_uc010fap.2_Intron	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						TGAAAGGGGGAAAAACTAACA	0.383			T	ALK	NSCLC								55	24	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131014	54131015	+	Intron	INS	-	T	T	rs72533956		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131014_54131015insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			attaaaaaaaagaacagatatg	0.069													5	4	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73613263	73613263	+	Frame_Shift_Del	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73613263delT	uc002sje.1	+	2	381	c.270delT	c.(268-270)CCTfs	p.P90fs	ALMS1_uc002sjf.1_Frame_Shift_Del_p.P89fs	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	89					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GGATTTTGCCTCCGCTGTCGC	0.697													4	2	---	---	---	---	
INHA	3623	broad.mit.edu	37	2	220439825	220439826	+	Frame_Shift_Ins	INS	-	G	G	rs12720061	byFrequency	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220439825_220439826insG	uc002vmk.1	+	2	822_823	c.678_679insG	c.(676-681)GGAGGGfs	p.G226fs		NM_002191	NP_002182	P05111	INHA_HUMAN	inhibin alpha subunit precursor	226_227					cell cycle arrest|cell surface receptor linked signaling pathway|cell-cell signaling|erythrocyte differentiation|hemoglobin biosynthetic process|induction of apoptosis|negative regulation of B cell differentiation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|regulation of cell proliferation|response to external stimulus|skeletal system development	inhibin A complex|inhibin-betaglycan-ActRII complex	cytokine activity|growth factor activity|hormone activity|signal transducer activity			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CACCCAGTGGAGGGGAGAGAGC	0.683													10	48	---	---	---	---	
SLC9A10	285335	broad.mit.edu	37	3	111887848	111887849	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111887848_111887849delCT	uc003dyu.2	-	25	3334_3335	c.3112_3113delAG	c.(3112-3114)AGTfs	p.S1038fs	SLC9A10_uc011bhu.1_Frame_Shift_Del_p.S301fs|SLC9A10_uc010hqc.2_Frame_Shift_Del_p.S990fs	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	1038					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						AGTTTTGGTACTCATTGGTATA	0.302													58	48	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13867725	13867726	+	Intron	INS	-	AA	AA	rs142362557	by1000genomes	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13867725_13867726insAA	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AAAGAATTGTGAAAAAAAATGT	0.193									Kartagener_syndrome				4	7	---	---	---	---	
MTMR12	54545	broad.mit.edu	37	5	32255973	32255973	+	Intron	DEL	A	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32255973delA	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						GCAGAGTGTTAAGCAGATGGG	0.294													6	5	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140031161	140031161	+	Intron	DEL	A	-	-	rs75532104		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140031161delA	uc003lgq.2	+						IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			actccgtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
FAM71B	153745	broad.mit.edu	37	5	156592474	156592474	+	Intron	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156592474delC	uc003lwn.2	-							NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B							nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AATACTTTTTCCAGGTGGGCC	0.542													137	127	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112682736	112682736	+	IGR	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112682736delC								RFPL4B (10238 upstream) : None (None downstream)																							CATGGAGGTGCTGCTGTCCAG	0.488													13	6	---	---	---	---	
GRM1	2911	broad.mit.edu	37	6	146720553	146720553	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720553delC	uc010khw.1	+	8	2848	c.2378delC	c.(2377-2379)ACCfs	p.T793fs	GRM1_uc010khv.1_Frame_Shift_Del_p.T793fs|GRM1_uc003qll.2_Frame_Shift_Del_p.T793fs|GRM1_uc011edz.1_Frame_Shift_Del_p.T793fs|GRM1_uc011eea.1_Frame_Shift_Del_p.T793fs	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	793	Helical; Name=6; (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	ACCATGTACACCACCTGTATC	0.478													59	35	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159166782	159166783	+	Intron	INS	-	A	A	rs11481135		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159166782_159166783insA	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		agacaattattaaaaaaaaaaa	0.054													4	2	---	---	---	---	
FNDC1	84624	broad.mit.edu	37	6	159651036	159651036	+	Splice_Site	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159651036delG	uc010kjv.2	+	10	1569	c.1369_splice	c.e10+1	p.T457_splice	FNDC1_uc010kjw.1_Intron	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		ATGCCAACAAGTAAGCATTAT	0.488													89	61	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20738238	20738239	+	Intron	INS	-	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20738238_20738239insT	uc003suw.3	+						ABCB5_uc010kuh.2_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGAGAACAAGCTTGTATCAGTC	0.376													7	6	---	---	---	---	
SPAM1	6677	broad.mit.edu	37	7	123599605	123599605	+	Frame_Shift_Del	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123599605delT	uc003vld.2	+	6	1514	c.1112delT	c.(1111-1113)CTAfs	p.L371fs	SPAM1_uc003vle.2_Frame_Shift_Del_p.L371fs|SPAM1_uc011koa.1_Frame_Shift_Del_p.L27fs|SPAM1_uc003vlf.3_Frame_Shift_Del_p.L371fs|SPAM1_uc010lku.2_Frame_Shift_Del_p.L371fs	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	371					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	AACGTCACACTAGCAGCCAAA	0.378													41	48	---	---	---	---	
RP1L1	94137	broad.mit.edu	37	8	10480382	10480382	+	Frame_Shift_Del	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10480382delG	uc003wtc.2	-	2	559	c.330delC	c.(328-330)CCCfs	p.P110fs		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	110					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		TGGGGGTCTTGGGGGGCTTCT	0.652													9	21	---	---	---	---	
PRDM14	63978	broad.mit.edu	37	8	70967745	70967745	+	Intron	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70967745delT	uc003xym.2	-							NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			AAtttttttcttttttttttt	0.164													4	2	---	---	---	---	
SLC26A7	115111	broad.mit.edu	37	8	92364308	92364308	+	Intron	DEL	T	-	-	rs80206690		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92364308delT	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			ACCGTGGCTGTTTTTTTTTAC	0.428													4	2	---	---	---	---	
UBR5	51366	broad.mit.edu	37	8	103358988	103358988	+	Intron	DEL	A	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103358988delA	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ctctcaaaggaaaaaaaaaaa	0.164													6	3	---	---	---	---	
GDA	9615	broad.mit.edu	37	9	74863310	74863310	+	3'UTR	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74863310delC	uc004aiq.2	+	14					GDA_uc011lse.1_3'UTR|GDA_uc011lsf.1_3'UTR|GDA_uc004air.2_Intron|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Intron	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TTCTGCATCTCCCTTGTGCCC	0.468													7	43	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138710242	138710242	+	Intron	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138710242delG	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CGTGAGGGCCGGGGCTGCTTA	0.473													4	2	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70689870	70689871	+	Intron	INS	-	T	T	rs34023657		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70689870_70689871insT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						ctttcctttccttttttttttt	0.000													3	3	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	81058846	81058847	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81058846_81058847delGG	uc001kaf.2	+	16	2278_2279	c.1706_1707delGG	c.(1705-1707)CGGfs	p.R569fs	ZMIZ1_uc001kag.2_Frame_Shift_Del_p.R445fs	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	569					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			TTCCCTGTGCGGGATGGCGTGG	0.649													14	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9682506	9682506	+	IGR	DEL	A	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9682506delA								WEE1 (71195 upstream) : SWAP70 (3122 downstream)																							TCTGGGCTGTaaaaaaaaaaa	0.234													4	3	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	406429	406429	+	Intron	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:406429delC	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TATGACAAGGCCCAAAATGGA	0.328			T 	NUP98	AML								3	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67745601	67745601	+	IGR	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67745601delG								CAND1 (37213 upstream) : DYRK2 (296911 downstream)																							ACTATGGACAGGGACACCATC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47033457	47033458	+	IGR	INS	-	T	T	rs145501666		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47033457_47033458insT								C13orf18 (21132 upstream) : LRCH1 (93838 downstream)																							GTTGCAACACAGTTGTCAAGAG	0.282													15	11	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48947589	48947593	+	Frame_Shift_Del	DEL	AAGTG	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48947589_48947593delAAGTG	uc001vcb.2	+	12	1342_1346	c.1176_1180delAAGTG	c.(1174-1182)GCAAGTGATfs	p.A392fs	RB1_uc010act.1_Frame_Shift_Del_p.A93fs	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	392_394	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TAAATTCAGCAAGTGATCAACCTTC	0.283		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			28	51	---	---	---	---	
HECTD1	25831	broad.mit.edu	37	14	31606036	31606036	+	Intron	DEL	C	-	-	rs10137998		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31606036delC	uc001wrc.1	-						HECTD1_uc001wrd.1_Intron	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ttttttttttctttttttctg	0.109													4	2	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92537088	92537089	+	Intron	INS	-	T	T			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537088_92537089insT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ccacatctagcTTTTTTTTTTT	0.139													4	2	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	34146970	34146970	+	Frame_Shift_Del	DEL	T	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34146970delT	uc001zhi.2	+	98	13934	c.13864delT	c.(13864-13866)TTTfs	p.F4622fs	RYR3_uc010bar.2_Frame_Shift_Del_p.F4617fs	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4622	Helical; Name=M7; (Potential).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTCCCAGTCCTTTCTCTACCT	0.423													183	132	---	---	---	---	
MGA	23269	broad.mit.edu	37	15	42034848	42034848	+	Frame_Shift_Del	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42034848delG	uc010ucy.1	+	15	4871	c.4690delG	c.(4690-4692)GGGfs	p.G1564fs	MGA_uc010ucz.1_Intron|MGA_uc010uda.1_Frame_Shift_Del_p.G180fs	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	1564						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		AACCCTGGCAGGGACACAGAA	0.522													43	34	---	---	---	---	
SPG11	80208	broad.mit.edu	37	15	44878181	44878181	+	Intron	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44878181delG	uc001ztx.2	-						SPG11_uc010bdw.2_5'Flank|SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zty.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ATAAAAAGCTGtttttttttt	0.159													4	2	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26684394	26684395	+	Splice_Site	INS	-	G	G	rs113730440		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26684394_26684395insG	uc002haz.2	-	2	210	c.78_splice	c.e2+1	p.W26_splice	POLDIP2_uc010wag.1_RNA|TMEM199_uc002hba.2_5'Flank|SARM1_uc010wah.1_5'Flank	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AGAGCGGCTTTGCCACCGGGCC	0.762													6	3	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12359740	12359741	+	Intron	INS	-	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12359740_12359741insA	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	aaccccacctcaaaaaaaaaag	0.129													4	2	---	---	---	---	
ZNF440	126070	broad.mit.edu	37	19	11925276	11925276	+	Intron	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11925276delG	uc002msp.1	+							NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGTGTGTGAGGGGGCTGGCG	0.687													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107427	42107428	+	IGR	INS	-	CA	CA	rs71928647		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107427_42107428insCA								CEACAM21 (14231 upstream) : CEACAM4 (17916 downstream)																							gcgcgcgcgcgcacacacacac	0.213													4	2	---	---	---	---	
CEACAM6	4680	broad.mit.edu	37	19	42265121	42265121	+	Intron	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42265121delC	uc002orm.2	+							NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion						cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		ATCAAAGGTGCCACACAGGGC	0.547													137	87	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																							Ttttttttttgttttgttttgt	0.307													1	7	---	---	---	---	
LZTR1	8216	broad.mit.edu	37	22	21341677	21341678	+	Intron	INS	-	A	A	rs149184314		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21341677_21341678insA	uc002zto.2	+						LZTR1_uc002ztn.2_Intron|LZTR1_uc011ahy.1_Intron|LZTR1_uc010gsr.1_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			gactccgtctcaaaaaaaaaaa	0.257													5	4	---	---	---	---	
BRD1	23774	broad.mit.edu	37	22	50169481	50169481	+	Intron	DEL	A	-	-	rs62231968		TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50169481delA	uc003biv.2	-						BRD1_uc011arf.1_Intron|BRD1_uc011arg.1_Intron|BRD1_uc011arh.1_Intron|BRD1_uc003biu.3_Intron	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1						histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCGCCTCCCCACCCCAGCTGT	0.662													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	394540	394541	+	IGR	INS	-	A	A			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:394540_394541insA								PPP2R3B (46913 upstream) : SHOX (190538 downstream)																							gggaaggaaggaaggaaggaag	0.248													3	3	---	---	---	---	
SFRS17A	8227	broad.mit.edu	37	X	1714127	1714154	+	Intron	DEL	TCTGCACCGGACATGAGTGGTGAGCGGT	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1714127_1714154delTCTGCACCGGACATGAGTGGTGAGCGGT	uc004cqa.2	+						SFRS17A_uc010ncx.1_Intron|SFRS17A_uc004cqb.2_Intron|ASMT_uc004cqd.2_5'Flank	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155						B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACTGTCTGGGTCTGCACCGGACATGAGTGGTGAGCGGTGAGCGGTGAG	0.623													8	4	---	---	---	---	
NHS	4810	broad.mit.edu	37	X	17710497	17710497	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17710497delC	uc004cxx.2	+	3	1099	c.761delC	c.(760-762)GCCfs	p.A254fs	NHS_uc011mix.1_Frame_Shift_Del_p.A254fs|NHS_uc004cxy.2_Frame_Shift_Del_p.A77fs|NHS_uc004cxz.2_Frame_Shift_Del_p.A77fs|NHS_uc004cya.2_5'UTR	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	254						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					AGAGCAGCTGCCCCCCTTTCC	0.507													16	49	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	47657945	47657945	+	IGR	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47657945delC								LOC100133957 (138169 upstream) : ZNF81 (38356 downstream)																							TGAGGGGATACCTTGCAGAGT	0.498													1	7	---	---	---	---	
ZMYM3	9203	broad.mit.edu	37	X	70472485	70472485	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70472485delC	uc004dzh.1	-	2	708	c.621delG	c.(619-621)CAGfs	p.Q207fs	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Frame_Shift_Del_p.Q207fs|ZMYM3_uc004dzj.1_Frame_Shift_Del_p.Q207fs|ZMYM3_uc011mpu.1_5'Flank|ZMYM3_uc004dzk.3_Frame_Shift_Del_p.Q207fs|ZMYM3_uc004dzl.3_Frame_Shift_Del_p.Q207fs|ZMYM3_uc004dzm.3_Frame_Shift_Del_p.Q207fs	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	207					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					CAGGTTTGGTCTGAGAACTGT	0.592													3	15	---	---	---	---	
GLRA4	441509	broad.mit.edu	37	X	102968474	102968474	+	Frame_Shift_Del	DEL	G	-	-			TCGA-43-6143-01A-11D-1817-08	TCGA-43-6143-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102968474delG	uc011mse.1	-	8	1478	c.1057delC	c.(1057-1059)CGAfs	p.R353fs	TMEM31_uc004elh.2_Intron	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	353	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						TGCCTTCTTCGAAGTCGTATG	0.517													6	52	---	---	---	---	
