Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GABRD	2563	broad.mit.edu	37	1	1960983	1960983	+	Intron	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1960983C>A	uc001aip.2	+							NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta							cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CCACCTGTGCCCGGCAGGCAT	0.662													9	41	---	---	---	---	PASS
TAS1R1	80835	broad.mit.edu	37	1	6639480	6639480	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6639480C>T	uc001ant.2	+	6	2362	c.2362C>T	c.(2362-2364)CTG>TTG	p.L788L	TAS1R1_uc001anu.2_Silent_p.L534L|TAS1R1_uc001anv.2_Silent_p.T319T|TAS1R1_uc001anw.2_3'UTR|ZBTB48_uc009vmc.1_5'Flank|ZBTB48_uc001anx.2_5'Flank|ZBTB48_uc009vmd.1_5'Flank	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	788	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CGGCAAGTACCTGCCTGCGGC	0.582													11	55	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10165736	10165736	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10165736G>A	uc001aqs.3	+	6	1456	c.743G>A	c.(742-744)GGC>GAC	p.G248D	UBE4B_uc001aqr.3_Missense_Mutation_p.G248D|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	248					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CTAAACACTGGCTCCAATCCA	0.507													35	113	---	---	---	---	PASS
EXOSC10	5394	broad.mit.edu	37	1	11137693	11137693	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11137693C>A	uc001asa.2	-	15	1815	c.1765G>T	c.(1765-1767)GGA>TGA	p.G589*	EXOSC10_uc001asb.2_Nonsense_Mutation_p.G589*	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1	589					CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		TTCTTCACTCCGGCTGCAACT	0.507													16	55	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22176642	22176642	+	Silent	SNP	C	T	T	rs141160393		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22176642C>T	uc001bfj.2	-	57	7378	c.7338G>A	c.(7336-7338)TCG>TCA	p.S2446S	HSPG2_uc009vqd.2_Silent_p.S2447S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2446	Ig-like C2-type 10.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CGGCCACTTGCGAAGACGATG	0.662													32	96	---	---	---	---	PASS
CLIC4	25932	broad.mit.edu	37	1	25124287	25124287	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25124287A>G	uc001bjo.2	+	2	412	c.127A>G	c.(127-129)ATG>GTG	p.M43V	CLIC4_uc001bjn.2_RNA|CLIC4_uc001bjp.1_Missense_Mutation_p.M23V	NM_013943	NP_039234	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	43	Required for insertion into the membrane (Probable).|Helical; Note=After insertion into the membrane; (Potential).				cellular response to calcium ion|establishment or maintenance of apical/basal cell polarity|keratinocyte differentiation|negative regulation of cell migration|regulation of cytoskeleton organization	actin cytoskeleton|apical part of cell|cell surface|cell-cell junction|centrosome|chloride channel complex|cytoplasmic vesicle membrane|cytosol|microvillus|midbody|mitochondrion|nuclear matrix|perinuclear region of cytoplasm|soluble fraction	voltage-gated chloride channel activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		GAGGCTCTTCATGATTCTTTG	0.408													24	84	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45500116	45500116	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45500116A>T	uc001cnd.2	-	11	2545	c.2317T>A	c.(2317-2319)TCT>ACT	p.S773T		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	773							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TCGCCTGCAGAAGCTGAGTTT	0.537													34	129	---	---	---	---	PASS
LRRC42	115353	broad.mit.edu	37	1	54433427	54433427	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54433427G>C	uc001cwj.1	+	8	1302	c.1102G>C	c.(1102-1104)GAG>CAG	p.E368Q	LRRC42_uc001cwl.1_Missense_Mutation_p.E368Q|LRRC42_uc001cwk.1_Missense_Mutation_p.E368Q|LRRC42_uc009vzm.1_Missense_Mutation_p.E364Q	NM_052940	NP_443172	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	368											0						GTTCTATAAAGAGAAAGCCCC	0.507													23	65	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79383662	79383662	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79383662C>G	uc001diq.3	-	11	1691	c.1535G>C	c.(1534-1536)GGC>GCC	p.G512A		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	512	Helical; Name=3; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAGATGTATGCCTTCAATGCA	0.378													42	173	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92430225	92430225	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92430225A>T	uc001dok.3	+	3	583	c.234A>T	c.(232-234)ACA>ACT	p.T78T	BRDT_uc001dol.3_Silent_p.T78T|BRDT_uc010osz.1_Silent_p.T78T|BRDT_uc009wdf.2_Silent_p.T5T|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Silent_p.T78T	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	78	Bromo 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		ATTTAAATACAATTAAGAAGC	0.264													20	59	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103481245	103481245	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103481245A>T	uc001dul.2	-	12	1785	c.1467T>A	c.(1465-1467)CCT>CCA	p.P489P	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Silent_p.P501P|COL11A1_uc001dun.2_Silent_p.P450P|COL11A1_uc009weh.2_Silent_p.P373P	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	489	Triple-helical region (interrupted).				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACATAGTACCAGGAGGACCAG	0.353													4	20	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110765934	110765934	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110765934C>T	uc001dzh.2	+	2	1084	c.1027C>T	c.(1027-1029)CTG>TTG	p.L343L	KCNC4_uc001dzf.2_Silent_p.L343L|KCNC4_uc009wfr.2_Silent_p.L343L|KCNC4_uc001dzg.2_Silent_p.L343L|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	343					synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCGCGACGTGCTGGGCTTCCT	0.642													9	43	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112318854	112318854	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112318854A>T	uc001ebu.1	-	8	2293	c.1813T>A	c.(1813-1815)TGC>AGC	p.C605S	KCND3_uc001ebv.1_Missense_Mutation_p.C586S	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	605	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		GATGTTTTGCAGTTTGGTCTC	0.577													18	56	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158390635	158390635	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158390635C>G	uc010pii.1	-	1	22	c.22G>C	c.(22-24)GTG>CTG	p.V8L		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TCTCTCACCACAGTCTCATTG	0.502													16	77	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908929	158908929	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908929G>A	uc001ftb.2	+	4	716	c.471G>A	c.(469-471)GAG>GAA	p.E157E	PYHIN1_uc001fta.3_Silent_p.E157E|PYHIN1_uc001ftc.2_Silent_p.E148E|PYHIN1_uc001ftd.2_Silent_p.E157E|PYHIN1_uc001fte.2_Silent_p.E148E	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	157					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					TGTCCAAAGAGCAGACTCGGC	0.478													26	99	---	---	---	---	PASS
POGK	57645	broad.mit.edu	37	1	166818285	166818285	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166818285G>T	uc001gdt.1	+	5	589	c.469G>T	c.(469-471)GAT>TAT	p.D157Y	POGK_uc010ple.1_Missense_Mutation_p.D72Y|POGK_uc010plf.1_Missense_Mutation_p.D39Y	NM_017542	NP_060012	Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	157					multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						TCTGCCTCGGGATATCACAGA	0.557													59	83	---	---	---	---	PASS
LHX4	89884	broad.mit.edu	37	1	180199735	180199735	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180199735T>G	uc001goe.1	+	1	294	c.71T>G	c.(70-72)ATG>AGG	p.M24R		NM_033343	NP_203129	Q969G2	LHX4_HUMAN	LIM homeobox protein 4	24						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GGTGTGCCGATGCAACGTAAG	0.637													21	37	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186330008	186330008	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186330008C>A	uc001grv.2	-	10	1285	c.988G>T	c.(988-990)GAG>TAG	p.E330*	TPR_uc010pop.1_Nonsense_Mutation_p.E406*	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	330	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGCTCCACCTCTAGAAGATGA	0.323			T	NTRK1	papillary thyroid								32	77	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190423959	190423959	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190423959A>T	uc001gse.1	-	2	294	c.62T>A	c.(61-63)ATA>AAA	p.I21K	FAM5C_uc010pot.1_5'UTR	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	21						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ACTCAGTGCTATCCACTCCCA	0.512													38	36	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196965150	196965150	+	Splice_Site	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196965150A>T	uc001gts.3	+	6	919	c.791_splice	c.e6-2	p.E264_splice		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor						complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						ACATTTTCTTAGAACAAGTGA	0.343													47	191	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197021778	197021778	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197021778A>G	uc001gtt.1	-	9	1585	c.1541T>C	c.(1540-1542)TTA>TCA	p.L514S		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	514	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCTAGTACATAAAGGATATTT	0.318													20	107	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197522157	197522157	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197522157C>A	uc001guf.3	-	16	1573	c.1235G>T	c.(1234-1236)TGT>TTT	p.C412F	DENND1B_uc010ppe.1_Missense_Mutation_p.C392F|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Missense_Mutation_p.C382F	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2	412						clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						TTTACCTCCACAAAAGCCACC	0.343													41	105	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202273705	202273705	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202273705C>A	uc001gxu.2	+	11	1017	c.1017C>A	c.(1015-1017)GGC>GGA	p.G339G	LGR6_uc001gxv.2_Silent_p.G287G|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Silent_p.G200G|LGR6_uc009xac.1_RNA	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	339	LRR 11.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						CCCGCGCAGGCATCCGGCTGC	0.642													14	70	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210273513	210273513	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210273513A>T	uc009xcv.2	+	6	943	c.871A>T	c.(871-873)AAC>TAC	p.N291Y	SYT14_uc001hhs.3_Missense_Mutation_p.N336Y|SYT14_uc001hht.3_Missense_Mutation_p.N291Y|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Missense_Mutation_p.N336Y|SYT14_uc010pso.1_Missense_Mutation_p.N253Y	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	291	Cytoplasmic (Potential).|C2 1.					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		CCCAACATATAACAGGACAGG	0.443													32	133	---	---	---	---	PASS
NVL	4931	broad.mit.edu	37	1	224473776	224473776	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224473776C>A	uc001hok.2	-	15	1894	c.1851G>T	c.(1849-1851)GGG>GGT	p.G617G	NVL_uc001hol.2_Silent_p.G511G|NVL_uc010pvd.1_Silent_p.G526G|NVL_uc010pve.1_Silent_p.G428G|NVL_uc010pvf.1_RNA	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	617						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		CAAGGAGGACCCCAGCTGGAG	0.453													33	98	---	---	---	---	PASS
NVL	4931	broad.mit.edu	37	1	224475586	224475586	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224475586G>C	uc001hok.2	-	14	1728	c.1685C>G	c.(1684-1686)TCA>TGA	p.S562*	NVL_uc001hol.2_Nonsense_Mutation_p.S456*|NVL_uc010pvd.1_Nonsense_Mutation_p.S471*|NVL_uc010pve.1_Nonsense_Mutation_p.S373*|NVL_uc010pvf.1_RNA	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	562						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		GGGTTGGACTGAGGATAGAGC	0.498													25	114	---	---	---	---	PASS
KMO	8564	broad.mit.edu	37	1	241755248	241755248	+	Intron	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241755248C>G	uc009xgp.2	+							NM_003679	NP_003670	O15229	KMO_HUMAN	kynurenine 3-monooxygenase						pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TTCTTGCTGTCTTACAGGTGA	0.368													5	307	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241912978	241912978	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241912978A>T	uc001hzf.1	+	8	1007	c.854A>T	c.(853-855)CAG>CTG	p.Q285L	WDR64_uc001hzg.1_Missense_Mutation_p.Q31L	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	565	WD 8.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AAACACCAGCAGCTGGTCCTG	0.522													52	92	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614764	247614764	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614764C>A	uc010pyx.1	-	1	521	c.521G>T	c.(520-522)GGG>GTG	p.G174V		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CACCTGCCGCCCGCAGAATGG	0.597													16	47	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655105	247655105	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655105G>A	uc001icz.1	+	1	676	c.676G>A	c.(676-678)GCT>ACT	p.A226T		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	226					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CAGCCGCGGTGCTGAGGATGA	0.567													37	172	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655166	247655166	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655166A>T	uc001icz.1	+	1	737	c.737A>T	c.(736-738)CAC>CTC	p.H246L		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	246					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TTCTCACCTCACAGTGGTCTC	0.542													35	173	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247920976	247920976	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247920976G>T	uc010pza.1	-	1	733	c.733C>A	c.(733-735)CTG>ATG	p.L245M		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ACCACTGACAGGTGGCAGCTG	0.507													22	40	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525461	248525461	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525461C>A	uc001ieh.1	+	1	579	c.579C>A	c.(577-579)CCC>CCA	p.P193P		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATTCACTCCCATCACCATGA	0.517													81	314	---	---	---	---	PASS
ASAP2	8853	broad.mit.edu	37	2	9474892	9474892	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9474892G>T	uc002qzh.2	+	8	1052	c.712G>T	c.(712-714)GTG>TTG	p.V238L	ASAP2_uc002qzi.2_Missense_Mutation_p.V238L	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	238					regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						ACTCAAAGCCGTGGAAAGCCT	0.393													33	98	---	---	---	---	PASS
MYCN	4613	broad.mit.edu	37	2	16082411	16082411	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16082411G>T	uc002rci.2	+	2	525	c.225G>T	c.(223-225)CCG>CCT	p.P75P	MYCNOS_uc002rch.1_5'Flank|MYCN_uc010yjr.1_Silent_p.P67P	NM_005378	NP_005369	P04198	MYCN_HUMAN	v-myc myelocytomatosis viral related oncogene,	75					regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			CCGAGCCCCCGAGCTGGGTCA	0.711			A		neuroblastoma								3	13	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21232599	21232599	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21232599G>A	uc002red.2	-	26	7269	c.7141C>T	c.(7141-7143)CTA>TTA	p.L2381L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2381					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACTTGTTGTAGGACATTGCTT	0.323													16	69	---	---	---	---	PASS
MTA3	57504	broad.mit.edu	37	2	42909590	42909590	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42909590C>A	uc002rso.1	+	10	1254	c.584C>A	c.(583-585)GCC>GAC	p.A195D	MTA3_uc002rsp.1_Missense_Mutation_p.A195D|MTA3_uc002rsq.2_Missense_Mutation_p.A251D|MTA3_uc002rsr.2_Missense_Mutation_p.A251D	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	251	ELM2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TTGAGCAGTGCCATTAGTGTC	0.398													5	26	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46228648	46228648	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46228648C>T	uc002rut.2	+	7	1126	c.929C>T	c.(928-930)CCA>CTA	p.P310L		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	310					activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			GGCGTTACCCCAGACAAAATC	0.522													24	85	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50463932	50463932	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50463932G>T	uc010fbp.2	-	2	1243	c.436C>A	c.(436-438)CAT>AAT	p.H146N	NRXN1_uc002rxb.3_Missense_Mutation_p.H853N|NRXN1_uc010fbq.2_Missense_Mutation_p.H1221N|NRXN1_uc002rxe.3_Missense_Mutation_p.H1181N|NRXN1_uc002rxc.1_RNA	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	146	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	p.H146L(1)		ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTTACTATATGCAGTTCTAGG	0.398													17	83	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746492	77746492	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746492G>A	uc002snr.2	-	3	918	c.503C>T	c.(502-504)TCA>TTA	p.S168L	LRRTM4_uc002snq.2_Missense_Mutation_p.S168L|LRRTM4_uc002sns.2_Missense_Mutation_p.S168L|LRRTM4_uc002snt.2_Missense_Mutation_p.S169L	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	168	LRR 5.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		AGTCTTTAGTGAGTTAGATCT	0.403													20	124	---	---	---	---	PASS
UXS1	80146	broad.mit.edu	37	2	106739541	106739541	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106739541T>G	uc002tdm.2	-	9	727	c.629A>C	c.(628-630)GAA>GCA	p.E210A	UXS1_uc002tdl.2_Missense_Mutation_p.E42A|UXS1_uc002tdn.2_Missense_Mutation_p.E215A|UXS1_uc002tdo.2_Missense_Mutation_p.E153A|UXS1_uc010ywh.1_Missense_Mutation_p.E54A	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	210	Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						AGGGTGGACTTCAGGATCTAC	0.443													31	148	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125204397	125204397	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125204397G>A	uc002tno.2	+	6	1165	c.801G>A	c.(799-801)CAG>CAA	p.Q267Q	CNTNAP5_uc010flu.2_Silent_p.Q267Q	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	267	Laminin G-like 1.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGATGACCAGCACTGGCACT	0.612													23	86	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125671718	125671718	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125671718G>T	uc002tno.2	+	24	4138	c.3774G>T	c.(3772-3774)ATG>ATT	p.M1258I	CNTNAP5_uc010flu.2_Missense_Mutation_p.M1259I	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1258	Helical; (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCGGCATCATGACCCGGTTCC	0.453													34	198	---	---	---	---	PASS
CYP27C1	339761	broad.mit.edu	37	2	127961052	127961052	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127961052A>T	uc002tod.2	-	2	205	c.74T>A	c.(73-75)GTT>GAT	p.V25D		NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,	25						membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		GTCAGCAATAACTTGGTTGAC	0.408													85	304	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133542459	133542459	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133542459G>A	uc002ttp.2	-	14	2299	c.1925C>T	c.(1924-1926)TCA>TTA	p.S642L	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	642							protein binding				0						CCTAGTCTCTGAAGGGATGGG	0.443													22	140	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141108479	141108479	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141108479C>A	uc002tvj.1	-	77	12751	c.11779G>T	c.(11779-11781)GAT>TAT	p.D3927Y		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3927	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAATATACATCCATCCCTGTT	0.338										TSP Lung(27;0.18)			60	108	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152422331	152422331	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152422331C>T	uc010fnx.2	-	87	13248	c.13057G>A	c.(13057-13059)GTC>ATC	p.V4353I	NEB_uc002txr.2_Missense_Mutation_p.V776I	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	4353	Nebulin 119.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCTCTGTAGACATTCTGAGAG	0.448													4	22	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163031404	163031404	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163031404C>G	uc002ucd.2	-	22	2150	c.1942G>C	c.(1942-1944)GCT>CCT	p.A648P	FAP_uc010fpc.2_Missense_Mutation_p.A197P|FAP_uc010zct.1_Missense_Mutation_p.A623P|FAP_uc010fpd.2_Missense_Mutation_p.A127P	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	648	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						GAGACTGGAGCCACTGCTATA	0.403													22	104	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168104375	168104375	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168104375G>A	uc002udx.2	+	8	6491	c.6473G>A	c.(6472-6474)AGC>AAC	p.S2158N	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S1983N|XIRP2_uc010fpq.2_Missense_Mutation_p.S1936N|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Splice_Site	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1983					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GATACACAAAGCTCCAAGCCC	0.403													34	68	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179406233	179406233	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179406233T>A	uc010zfg.1	-	299	90091	c.89867A>T	c.(89866-89868)GAG>GTG	p.E29956V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E23651V|TTN_uc010zfi.1_Missense_Mutation_p.E23584V|TTN_uc010zfj.1_Missense_Mutation_p.E23459V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30883							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCGTCATCCTCTGGTGGGTA	0.473													14	40	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179406234	179406234	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179406234C>T	uc010zfg.1	-	299	90090	c.89866G>A	c.(89866-89868)GAG>AAG	p.E29956K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E23651K|TTN_uc010zfi.1_Missense_Mutation_p.E23584K|TTN_uc010zfj.1_Missense_Mutation_p.E23459K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30883							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCGTCATCCTCTGGTGGGTAC	0.473													14	39	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182344882	182344882	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182344882G>T	uc002unu.2	+	6	1406	c.643G>T	c.(643-645)GCC>TCC	p.A215S	ITGA4_uc010zfl.1_Missense_Mutation_p.A215S	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	215	FG-GAP 3.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	TGTGATGGGGGCCCCAGGATC	0.338													41	58	---	---	---	---	PASS
ZC3H15	55854	broad.mit.edu	37	2	187368899	187368899	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187368899G>A	uc002upo.2	+	6	900	c.675G>A	c.(673-675)GAG>GAA	p.E225E		NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response	225	Potential.					cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			AGAAAGAAGAGAAAGAAGATG	0.363													33	154	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187702112	187702112	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187702112C>G	uc002upu.1	-	5	704	c.664G>C	c.(664-666)GAA>CAA	p.E222Q		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	222					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			CTCTCTTTTTCTGCTGCAGCT	0.388													32	199	---	---	---	---	PASS
STK17B	9262	broad.mit.edu	37	2	197021277	197021277	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197021277C>T	uc002utk.2	-	3	545	c.221G>A	c.(220-222)CGA>CAA	p.R74Q	STK17B_uc010fsh.2_Missense_Mutation_p.R74Q	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B	74	Protein kinase.				apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			AATTTCTGCTCGACAATCCTG	0.358													7	221	---	---	---	---	PASS
PGAP1	80055	broad.mit.edu	37	2	197757926	197757926	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197757926T>C	uc002utw.2	-	8	1085	c.971A>G	c.(970-972)CAC>CGC	p.H324R	PGAP1_uc002utx.2_Missense_Mutation_p.H150R|PGAP1_uc002uty.1_Missense_Mutation_p.H324R|PGAP1_uc010zgv.1_RNA|PGAP1_uc010fsj.2_Missense_Mutation_p.H150R	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN	GPI deacylase	324	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity			ovary(3)|central_nervous_system(1)	4						TCTTATAAAGTGGTGATACAA	0.289													15	87	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	206988912	206988912	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206988912G>C	uc002vbe.2	-	19	2308	c.2181C>G	c.(2179-2181)TGC>TGG	p.C727W	NDUFS1_uc010ziq.1_Missense_Mutation_p.C741W|NDUFS1_uc010zir.1_Missense_Mutation_p.C691W|NDUFS1_uc010zis.1_Missense_Mutation_p.C670W|NDUFS1_uc010zit.1_Missense_Mutation_p.C616W|NDUFS1_uc010ziu.1_Missense_Mutation_p.C611W	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	727					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	AGAAGCTTCAGCATATGGATG	0.403													50	78	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215896613	215896613	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215896613G>A	uc002vew.2	-	9	1213	c.993C>T	c.(991-993)TCC>TCT	p.S331S	ABCA12_uc002vev.2_Silent_p.S13S|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	331					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTATATTATCGGAGTCACCTG	0.348													22	242	---	---	---	---	PASS
PNKD	25953	broad.mit.edu	37	2	219206245	219206245	+	Intron	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219206245G>T	uc002vhn.2	+						PNKD_uc002vhq.2_Intron	NM_015488	NP_056303	Q8N490	PNKD_HUMAN	myofibrillogenesis regulator 1 isoform 1							membrane|mitochondrion|nucleus	hydroxyacylglutathione hydrolase activity|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCTGTCTCTGCTGTCCTGCA	0.592													9	8	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	233990506	233990506	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233990506C>A	uc010zmo.1	+	4	554	c.401C>A	c.(400-402)ACT>AAT	p.T134N	INPP5D_uc010zmp.1_Missense_Mutation_p.T133N	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	134					apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		ATCCCGCTGACTGCCAGCTCC	0.587													10	35	---	---	---	---	PASS
UGT1A9	54600	broad.mit.edu	37	2	234580890	234580890	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234580890A>C	uc002vus.2	+	1	347	c.310A>C	c.(310-312)AGT>CGT	p.S104R	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.S104R	NM_021027	NP_066307	O60656	UD19_HUMAN	UDP glycosyltransferase 1 family, polypeptide A9	104					drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(3)|breast(1)|skin(1)	5		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)	ACAAGTACGAAGTATATATTC	0.348													44	178	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237246993	237246993	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237246993G>A	uc002vvz.1	-	17	2171	c.1989C>T	c.(1987-1989)CCC>CCT	p.P663P	IQCA1_uc002vwb.2_Silent_p.P671P|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Silent_p.P622P	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	663							ATP binding			ovary(1)	1						TCAGGATTTGGGGAAGGTGTT	0.403													23	115	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	240111549	240111549	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240111549G>T	uc002vyk.3	-	4	1111	c.319C>A	c.(319-321)CAG>AAG	p.Q107K	HDAC4_uc010fyz.1_Missense_Mutation_p.Q102K|HDAC4_uc010zoa.1_Missense_Mutation_p.Q102K|HDAC4_uc010fza.2_Missense_Mutation_p.Q107K|HDAC4_uc002vyl.1_RNA|HDAC4_uc010fyy.2_Missense_Mutation_p.Q59K	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	107	Potential.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TCGTGGAGCTGCGCCTCGTGC	0.687													14	31	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241715339	241715339	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241715339T>A	uc002vzy.2	-	11	1033	c.887A>T	c.(886-888)AAG>ATG	p.K296M	KIF1A_uc010fzk.2_Missense_Mutation_p.K296M|KIF1A_uc002vzz.1_Missense_Mutation_p.K296M	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	296	Kinesin-motor.				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CTTCTTTTTCTTGTTCTGTGG	0.562													10	52	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47374703	47374703	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47374703C>T	uc003crd.2	+	5	783	c.657C>T	c.(655-657)TAC>TAT	p.Y219Y	KLHL18_uc003crc.2_Silent_p.Y219Y|KLHL18_uc011bav.1_Silent_p.Y107Y|KLHL18_uc010hjq.1_Silent_p.Y70Y	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	219	BACK.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GGGGTCCCTACCTGCCTGAGC	0.577													18	35	---	---	---	---	PASS
MAPKAPK3	7867	broad.mit.edu	37	3	50677815	50677815	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50677815A>T	uc003day.1	+	5	834	c.238A>T	c.(238-240)AAG>TAG	p.K80*	MAPKAPK3_uc003daz.1_Nonsense_Mutation_p.K80*|MAPKAPK3_uc003dba.1_Nonsense_Mutation_p.K80*|MAPKAPK3_uc010hlr.1_Nonsense_Mutation_p.K80*	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	80	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		TGACAGCCCCAAGGCCCGGCA	0.468													51	182	---	---	---	---	PASS
RBM15B	29890	broad.mit.edu	37	3	51431014	51431014	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51431014G>C	uc003dbd.2	+	1	2284	c.2184G>C	c.(2182-2184)TTG>TTC	p.L728F		NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	728	Interaction with Epstein-Barr virus BMLF1.|SPOC.				interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTCTGGTGTTGAAAAACAGCT	0.522													79	76	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56680635	56680635	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56680635C>T	uc003did.3	-	14	2231	c.2130G>A	c.(2128-2130)TTG>TTA	p.L710L	C3orf63_uc003dic.3_Silent_p.L314L|C3orf63_uc003die.3_Silent_p.L710L	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	710										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		GCTTCCTCTTCAAGACAGTTT	0.358													49	156	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188809	98188809	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188809T>G	uc003dsm.2	+	1	389	c.389T>G	c.(388-390)CTG>CGG	p.L130R		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TGCAACCCACTGCAGTACCAC	0.468													58	427	---	---	---	---	PASS
C3orf26	84319	broad.mit.edu	37	3	99895187	99895187	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99895187C>T	uc003dtl.2	+	9	827	c.684C>T	c.(682-684)AGC>AGT	p.S228S		NM_032359	NP_115735	Q9BQ75	CC026_HUMAN	hypothetical protein LOC84319	228							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1						TTAATTTGAGCCCCTTAAAAT	0.408													4	157	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100976537	100976537	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100976537G>C	uc003duq.1	-	10	1192	c.989C>G	c.(988-990)TCC>TGC	p.S330C	IMPG2_uc011bhe.1_Missense_Mutation_p.S193C	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	330	Extracellular (Potential).|SEA 1.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CACCTTGTTGGAGTGAAGGCT	0.433													64	300	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108698408	108698408	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108698408T>A	uc003dxl.2	-	24	2518	c.2431A>T	c.(2431-2433)AGC>TGC	p.S811C	MORC1_uc011bhn.1_Missense_Mutation_p.S790C	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	811					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						ACAGGTGTGCTTTGAGAAGAC	0.403													24	289	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119133513	119133513	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119133513T>C	uc003ecj.3	+	12	3269	c.2737T>C	c.(2737-2739)TGG>CGG	p.W913R		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	913					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						GGAACCCCAGTGGGTGACGAG	0.587													32	335	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123036947	123036947	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123036947G>A	uc003egh.1	-	11	2274	c.2274C>T	c.(2272-2274)GAC>GAT	p.D758D	ADCY5_uc003egg.1_Silent_p.D391D|ADCY5_uc003egi.1_Silent_p.D317D	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	758	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		CAAATCGGTCGTCTACCTGCT	0.602													11	71	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123049852	123049852	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123049852A>G	uc003egh.1	-	5	1530	c.1530T>C	c.(1528-1530)TGT>TGC	p.C510C	ADCY5_uc003egg.1_Silent_p.C143C|ADCY5_uc003egi.1_Silent_p.C69C	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	510	Guanylate cyclase 1.|Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		TAATACGTAAACAGTGATTCT	0.453													17	87	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127379640	127379640	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127379640G>T	uc003ejq.2	+	3	793	c.769G>T	c.(769-771)GAC>TAC	p.D257Y		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	257	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						GACTCCGGGGGACCAGGACTC	0.637													27	78	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145806374	145806374	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145806374T>A	uc003evs.1	-	9	1510	c.1004A>T	c.(1003-1005)AAA>ATA	p.K335I	PLOD2_uc003evq.1_5'Flank|PLOD2_uc011bnm.1_Missense_Mutation_p.K280I|PLOD2_uc003evr.1_Missense_Mutation_p.K335I	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	335					protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	AATACTTACTTTGTTATGAAT	0.289													6	58	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128108	147128108	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128108G>T	uc003ewe.2	+	1	928	c.209G>T	c.(208-210)GGC>GTC	p.G70V		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	70					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CAGGCGCCAGGCTACGCGGCT	0.677													20	19	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128132	147128132	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128132G>T	uc003ewe.2	+	1	952	c.233G>T	c.(232-234)GGC>GTC	p.G78V		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	78					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GCGGCCCTGGGCCATCACCAT	0.687													10	31	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160146715	160146715	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160146715T>A	uc003fdh.2	+	18	2893	c.2780T>A	c.(2779-2781)ATC>AAC	p.I927N	IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Missense_Mutation_p.I902N|SMC4_uc003fdj.2_Missense_Mutation_p.I927N|SMC4_uc010hwd.2_Missense_Mutation_p.I927N|SMC4_uc003fdl.2_Missense_Mutation_p.I630N	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes	927	Potential.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAAGTAGCAATCAAGACTGCT	0.368													47	168	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160146716	160146716	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160146716C>A	uc003fdh.2	+	18	2894	c.2781C>A	c.(2779-2781)ATC>ATA	p.I927I	IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Silent_p.I902I|SMC4_uc003fdj.2_Silent_p.I927I|SMC4_uc010hwd.2_Silent_p.I927I|SMC4_uc003fdl.2_Silent_p.I630I	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes	927	Potential.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGTAGCAATCAAGACTGCTG	0.368													46	169	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			37	103	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179447977	179447977	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179447977G>T	uc003fkh.2	+	9	1170	c.1089G>T	c.(1087-1089)GCG>GCT	p.A363A	USP13_uc003fkf.2_Silent_p.A363A	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	363					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CATTTTCTAGGTATGTAGGAA	0.363													56	270	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185146681	185146681	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185146681G>T	uc010hyf.2	+	3	578	c.312G>T	c.(310-312)ACG>ACT	p.T104T	MAP3K13_uc011brt.1_Intron|MAP3K13_uc003fph.3_5'UTR|MAP3K13_uc011bru.1_Intron|MAP3K13_uc003fpi.2_Silent_p.T104T|MAP3K13_uc010hyg.2_5'UTR	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	104					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			ACAGCAACACGGTGGACGGAG	0.517													67	87	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189526287	189526287	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189526287C>G	uc003fry.2	+	4	640	c.551C>G	c.(550-552)TCG>TGG	p.S184W	TP63_uc003frx.2_Missense_Mutation_p.S184W|TP63_uc003frz.2_Missense_Mutation_p.S184W|TP63_uc010hzc.1_Missense_Mutation_p.S184W|TP63_uc003fsa.2_Missense_Mutation_p.S90W|TP63_uc003fsb.2_Missense_Mutation_p.S90W|TP63_uc003fsc.2_Missense_Mutation_p.S90W|TP63_uc003fsd.2_Missense_Mutation_p.S90W|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Missense_Mutation_p.S65W	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	184			S -> L (in head and neck cancer).		anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTCCAGCAGTCGAGCACCGCC	0.627									Hay-Wells_syndrome	HNSCC(45;0.13)			47	128	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5630331	5630331	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5630331C>A	uc003gij.2	-	12	1895	c.1841G>T	c.(1840-1842)AGC>ATC	p.S614I	EVC2_uc011bwb.1_Missense_Mutation_p.S54I|EVC2_uc003gik.2_Missense_Mutation_p.S534I	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	614						integral to membrane				large_intestine(3)|ovary(2)	5						TGCAGCGGTGCTCAGAAGGCC	0.468													30	119	---	---	---	---	PASS
AFAP1	60312	broad.mit.edu	37	4	7844858	7844858	+	Intron	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7844858T>C	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						CGATTCCAAATGTCTTACCAG	0.498													22	77	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13603309	13603309	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13603309A>C	uc003gmz.1	-	10	5332	c.5215T>G	c.(5215-5217)TTT>GTT	p.F1739V	BOD1L_uc010idr.1_Missense_Mutation_p.F1076V	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1739							DNA binding			ovary(5)|breast(1)	6						CAGATCACAAAGTTATCACTT	0.512													66	230	---	---	---	---	PASS
CCKAR	886	broad.mit.edu	37	4	26483347	26483347	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26483347C>A	uc003gse.1	-	5	1353	c.1200G>T	c.(1198-1200)GTG>GTT	p.V400V		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	400	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	CCTCCTCCCCCACCTCTCCCC	0.627													30	106	---	---	---	---	PASS
LIMCH1	22998	broad.mit.edu	37	4	41684398	41684398	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41684398T>C	uc003gvu.3	+	21	2668	c.2614T>C	c.(2614-2616)TGG>CGG	p.W872R	LIMCH1_uc003gvv.3_Missense_Mutation_p.W872R|LIMCH1_uc003gvw.3_Missense_Mutation_p.W871R|LIMCH1_uc003gvx.3_Missense_Mutation_p.W884R|LIMCH1_uc003gwe.3_Missense_Mutation_p.W795R|LIMCH1_uc003gvy.3_Missense_Mutation_p.W700R|LIMCH1_uc003gwa.3_Missense_Mutation_p.W712R|LIMCH1_uc003gvz.3_Missense_Mutation_p.W1256R|LIMCH1_uc011byu.1_Missense_Mutation_p.W705R|LIMCH1_uc003gwc.3_Missense_Mutation_p.W717R|LIMCH1_uc003gwd.3_Missense_Mutation_p.W705R|LIMCH1_uc011byv.1_Missense_Mutation_p.W622R|LIMCH1_uc011byw.1_Missense_Mutation_p.W171R	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	872					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						AGACAGAAGATGGAAGAAATC	0.388													19	39	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42119669	42119669	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42119669C>G	uc003gwn.2	-	6	2051	c.1471G>C	c.(1471-1473)GTC>CTC	p.V491L	BEND4_uc003gwm.2_3'UTR	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	491	BEN.										0						GCGTGACCGACAGCGTCGCTG	0.522													4	13	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48514564	48514564	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48514564C>T	uc003gyh.1	-	57	8684	c.8079G>A	c.(8077-8079)CAG>CAA	p.Q2693Q	FRYL_uc003gyf.1_Silent_p.Q89Q|FRYL_uc003gyg.1_Silent_p.Q1389Q	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2693					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CAGACAGCATCTGATTGACGT	0.502													17	90	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68938072	68938072	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68938072C>G	uc003hdt.1	-	5	532	c.483G>C	c.(481-483)TTG>TTC	p.L161F	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	161	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TGTTTATGGTCAAAGACAATT	0.318													13	163	---	---	---	---	PASS
UGT2B28	54490	broad.mit.edu	37	4	70155405	70155405	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70155405A>G	uc003hej.2	+	4	1027	c.1025A>G	c.(1024-1026)AAT>AGT	p.N342S	UGT2B28_uc010ihr.2_Intron	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	342					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	TTTGATGGGAATAAACCAGAT	0.373													45	170	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73957392	73957392	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73957392T>C	uc003hgp.2	-	29	6070	c.5953A>G	c.(5953-5955)ACA>GCA	p.T1985A	ANKRD17_uc003hgo.2_Missense_Mutation_p.T1872A|ANKRD17_uc003hgq.2_Missense_Mutation_p.T1734A|ANKRD17_uc003hgr.2_Missense_Mutation_p.T1984A	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1985	Ser-rich.|Thr-rich.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGCCATTTGTAGATGTACCA	0.468													85	552	---	---	---	---	PASS
ARHGAP24	83478	broad.mit.edu	37	4	86896082	86896082	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86896082G>T	uc003hpk.2	+	7	1223	c.774G>T	c.(772-774)GTG>GTT	p.V258V	ARHGAP24_uc003hpl.2_Silent_p.V163V|ARHGAP24_uc010ikf.2_Silent_p.V173V|ARHGAP24_uc003hpm.2_Silent_p.V165V	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	258	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GTTTGCCAGTGGTAAATTACA	0.313													28	76	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100503108	100503108	+	Silent	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100503108C>G	uc003hvc.3	+	3	364	c.108C>G	c.(106-108)CTC>CTG	p.L36L	MTTP_uc011cej.1_Silent_p.L63L|MTTP_uc003hvb.2_Silent_p.L36L	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	36	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	TGTACAAGCTCACGTACTCCA	0.458													48	125	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104640781	104640781	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104640781C>T	uc003hxe.1	-	1	195	c.52G>A	c.(52-54)GGT>AGT	p.G18S		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	18	Extracellular (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GCGTCTGCACCCACGCCTCCA	0.687													10	24	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113540013	113540013	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113540013A>G	uc003iau.2	-	6	1396	c.1185T>C	c.(1183-1185)GAT>GAC	p.D395D	C4orf21_uc003iaw.2_Silent_p.D395D	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TCCAGGATGGATCATTATTAC	0.333													42	134	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073364	134073364	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073364G>T	uc003iha.2	+	1	2895	c.2069G>T	c.(2068-2070)GGG>GTG	p.G690V	PCDH10_uc003igz.2_Missense_Mutation_p.G690V	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	690	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		ggcgggggcgggagcggaggc	0.587													11	29	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073527	134073527	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073527G>A	uc003iha.2	+	1	3058	c.2232G>A	c.(2230-2232)AAG>AAA	p.K744K	PCDH10_uc003igz.2_Silent_p.K744K	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	744	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		AAAAAGAGAAGAAGCTCAACA	0.607													14	66	---	---	---	---	PASS
DCLK2	166614	broad.mit.edu	37	4	151114287	151114287	+	Intron	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151114287C>G	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					TTTTTGTTCTCAGGTTACTTG	0.323													46	165	---	---	---	---	PASS
SH3D19	152503	broad.mit.edu	37	4	152058934	152058934	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152058934T>C	uc010ipl.1	-	15	2696	c.1606A>G	c.(1606-1608)AAC>GAC	p.N536D	SH3D19_uc003imb.2_Missense_Mutation_p.N291D|SH3D19_uc003imc.2_Missense_Mutation_p.N477D|SH3D19_uc003ime.2_Missense_Mutation_p.N513D|SH3D19_uc010ipm.2_Missense_Mutation_p.N513D	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a	536	SH3 2.				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TTTCTACAGTTCCCTCTGTAC	0.353													29	114	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156618161	156618161	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156618161C>G	uc003iov.2	+	4	678	c.142C>G	c.(142-144)CAA>GAA	p.Q48E	GUCY1A3_uc003iou.2_Missense_Mutation_p.Q48E|GUCY1A3_uc010iqc.2_Missense_Mutation_p.Q48E|GUCY1A3_uc003iow.2_Missense_Mutation_p.Q48E|GUCY1A3_uc010iqd.2_Missense_Mutation_p.Q48E|GUCY1A3_uc003iox.2_Missense_Mutation_p.Q48E|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Missense_Mutation_p.Q48E|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_Missense_Mutation_p.Q48E	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	48					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GCCCATCTGTCAAGACATTCC	0.478													19	93	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156723541	156723541	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156723541A>G	uc003ipc.2	+	10	1390	c.1223A>G	c.(1222-1224)CAC>CGC	p.H408R	GUCY1B3_uc011cio.1_Missense_Mutation_p.H430R|GUCY1B3_uc011cip.1_Missense_Mutation_p.H388R|GUCY1B3_uc003ipd.2_Missense_Mutation_p.H336R|GUCY1B3_uc010iqf.2_Intron|GUCY1B3_uc010iqg.2_Missense_Mutation_p.H379R|GUCY1B3_uc011ciq.1_Missense_Mutation_p.H336R	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	408					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GAGCTGCGGCACAAGCGTCCA	0.478													14	58	---	---	---	---	PASS
PALLD	23022	broad.mit.edu	37	4	169819874	169819874	+	Intron	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169819874G>T	uc011cjx.1	+						CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron|PALLD_uc003irw.2_Intron|PALLD_uc003irx.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		AGGTGAGCTGGGAGATGGAGG	0.403									Pancreatic_Cancer_Familial_Clustering_of				15	53	---	---	---	---	PASS
UFSP2	55325	broad.mit.edu	37	4	186326926	186326926	+	Intron	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186326926C>T	uc003ixo.2	-						UFSP2_uc003ixn.2_Intron|UFSP2_uc003ixq.2_Intron|UFSP2_uc003ixp.2_Intron	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2							endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GTGTCTGAAACAGCTTACCGA	0.333													19	105	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189065247	189065247	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189065247C>A	uc003izm.1	+	5	931	c.816C>A	c.(814-816)TGC>TGA	p.C272*	TRIML1_uc003izn.1_5'UTR	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	272	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TGAGTCTGTGCCGCATCACGG	0.537													3	39	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3599690	3599690	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599690A>G	uc003jde.2	+	2	680	c.628A>G	c.(628-630)ACC>GCC	p.T210A		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	210						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						CGGCAGCGACACCGAGGGCGA	0.627													30	50	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5186346	5186346	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5186346G>A	uc003jdl.2	+	5	1083	c.945G>A	c.(943-945)GTG>GTA	p.V315V	ADAMTS16_uc003jdk.1_Silent_p.V315V|ADAMTS16_uc003jdj.1_Silent_p.V315V	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	315	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	p.V315V(1)		ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CCACCTACGTGCTCACGATAC	0.398													7	98	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483410	19483410	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483410C>A	uc003jgc.2	-	11	2259	c.1882G>T	c.(1882-1884)GCA>TCA	p.A628S	CDH18_uc003jgd.2_Missense_Mutation_p.A628S|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	628	Helical; (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AATGACTTACCCAGGAGAATG	0.458													15	92	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752313	21752313	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752313G>T	uc010iuc.2	-	12	2376	c.1918C>A	c.(1918-1920)CAG>AAG	p.Q640K	CDH12_uc011cno.1_Missense_Mutation_p.Q600K|CDH12_uc003jgk.2_Missense_Mutation_p.Q640K|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	640	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TTTTTCTTCTGCCTTCGCAGT	0.413										HNSCC(59;0.17)			15	213	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24488107	24488107	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24488107G>A	uc003jgr.1	-	12	2364	c.2032C>T	c.(2032-2034)CCT>TCT	p.P678S	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	678	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ATGGCTGCAGGATTCCTCAGG	0.483										HNSCC(23;0.051)			35	168	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24498605	24498605	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24498605C>T	uc003jgr.1	-	9	1749	c.1417G>A	c.(1417-1419)GTG>ATG	p.V473M	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	473	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		AAAACAGCCACGCGTGTTGTC	0.388										HNSCC(23;0.051)			19	196	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576154	33576154	+	Intron	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576154C>T	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TAGGAAATGTCTTACCTCGCT	0.413										HNSCC(64;0.19)			31	194	---	---	---	---	PASS
RAD1	5810	broad.mit.edu	37	5	34911720	34911720	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34911720C>T	uc003jix.2	-	4	834	c.505G>A	c.(505-507)GAA>AAA	p.E169K	RAD1_uc003jiw.2_Missense_Mutation_p.E60K|RAD1_uc003jiy.2_Missense_Mutation_p.E169K	NM_002853	NP_002844	O60671	RAD1_HUMAN	RAD1 homolog	169					DNA damage checkpoint|DNA repair|DNA replication|meiotic prophase I	nucleoplasm	3'-5' exonuclease activity|damaged DNA binding|exodeoxyribonuclease III activity|protein binding				0	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			ATATCCAATTCAGAAAATGCT	0.418								Other_conserved_DNA_damage_response_genes					49	276	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35876139	35876139	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35876139G>A	uc003jjs.2	+	8	1020	c.931G>A	c.(931-933)GTG>ATG	p.V311M	IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	311	Cytoplasmic (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GATTCATAGGGTGGATGACAT	0.433													99	75	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38427106	38427106	+	Intron	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38427106T>G	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					TGCTTGTTTTTTCAGCTTTCA	0.313													140	122	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41064647	41064647	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41064647C>A	uc003jmj.3	-	5	877	c.387G>T	c.(385-387)ATG>ATT	p.M129I		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	129							binding			ovary(6)|central_nervous_system(2)	8						GCAGGGTCATCATCATGAAAG	0.463													7	62	---	---	---	---	PASS
C5orf34	375444	broad.mit.edu	37	5	43506461	43506461	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43506461G>A	uc003jnz.1	-	5	638	c.321C>T	c.(319-321)CCC>CCT	p.P107P	C5orf34_uc011cpx.1_5'UTR	NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	107										breast(1)	1	Lung NSC(6;2.07e-05)					TATCAAGACTGGGCCATCTCA	0.413													27	177	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43656767	43656767	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43656767C>T	uc003joe.2	+	16	2561	c.2306C>T	c.(2305-2307)TCT>TTT	p.S769F	NNT_uc003jof.2_Missense_Mutation_p.S769F	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	769					tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	CTCCTGAAATCTGCCCCTCTC	0.443													40	199	---	---	---	---	PASS
CCNB1	891	broad.mit.edu	37	5	68473065	68473065	+	Splice_Site	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68473065G>C	uc003jvm.2	+	8	1261	c.1084_splice	c.e8-1	p.T362_splice	CCNB1_uc011crd.1_Splice_Site_p.T362_splice|CCNB1_uc010ixb.2_Intron	NM_031966	NP_114172	P14635	CCNB1_HUMAN	cyclin B1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitotic cell cycle spindle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|mitotic spindle stabilization|positive regulation of attachment of spindle microtubules to kinetochore|positive regulation of mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	condensed nuclear chromosome outer kinetochore|cytosol|microtubule organizing center|nucleoplasm|spindle pole					0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGTTGCCTTAGACACCAACTC	0.348													17	66	---	---	---	---	PASS
FAM174A	345757	broad.mit.edu	37	5	99871237	99871237	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99871237G>A	uc003knj.1	+	1	123	c.3G>A	c.(1-3)ATG>ATA	p.M1I	uc003kni.2_5'Flank	NM_198507	NP_940909	Q8TBP5	F174A_HUMAN	family with sequence similarity 174, member A	1						integral to membrane					0						CGGGAACGATGAAGGCCTCGC	0.657													23	101	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127486925	127486925	+	Intron	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127486925A>T	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TTTATTTGTTATTGTTAGGAT	0.353													65	162	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127686619	127686619	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127686619G>T	uc003kuu.2	-	21	3192	c.2753C>A	c.(2752-2754)TCT>TAT	p.S918Y	FBN2_uc003kuv.2_Missense_Mutation_p.S885Y	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	918	TB 4.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAGCATTCAGATTTCAGAGT	0.547													27	81	---	---	---	---	PASS
SLC22A5	6584	broad.mit.edu	37	5	131726406	131726406	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131726406T>G	uc003kww.3	+	7	1341	c.1077T>G	c.(1075-1077)TTT>TTG	p.F359L	SLC22A5_uc003kwx.3_Missense_Mutation_p.F383L|SLC22A5_uc010jdr.1_Intron	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5	359	Helical; Name=7; (Potential).				positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	TGGGCTATTTTGGGCTTTCGC	0.458													43	165	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140228222	140228222	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140228222A>G	uc003lhu.2	+	1	866	c.142A>G	c.(142-144)ATC>GTC	p.I48V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.I48V	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	48	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGGCCGCATCGCGCAGGA	0.647													48	131	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140594731	140594731	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594731C>A	uc003lja.1	+	1	1223	c.1036C>A	c.(1036-1038)CCA>ACA	p.P346T		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	346	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGACCATGCCCCAGAAGTTAC	0.438													71	358	---	---	---	---	PASS
TAF7	6879	broad.mit.edu	37	5	140698550	140698550	+	3'UTR	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140698550T>C	uc003ljg.2	-	1						NM_005642	NP_005633	Q15545	TAF7_HUMAN	TATA box-binding protein-associated factor 2F						negative regulation of histone acetylation|negative regulation of protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|spermine transport|transcription initiation from RNA polymerase II promoter	Golgi apparatus|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	histone acetyltransferase binding|thyroid hormone receptor binding|transcription coactivator activity|transcription regulatory region DNA binding|vitamin D receptor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAATTAAATATCAGTTCTT	0.393													16	31	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140710502	140710502	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140710502T>G	uc003lji.1	+	1	251	c.251T>G	c.(250-252)TTG>TGG	p.L84W	PCDHGA1_uc011dan.1_Missense_Mutation_p.L84W	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	84	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGGCAGCTTGATCACCGCG	0.547													39	110	---	---	---	---	PASS
PCDHGB6	56100	broad.mit.edu	37	5	140789170	140789170	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140789170A>T	uc003lkj.1	+	1	1401	c.1401A>T	c.(1399-1401)CCA>CCT	p.P467P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Silent_p.P467P	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	467	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAACCCGCCAGGAGCCTCCA	0.587													10	40	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147481341	147481341	+	Intron	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147481341C>G	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAATTTCACAGGAGTTGTG	0.418													26	113	---	---	---	---	PASS
ARSI	340075	broad.mit.edu	37	5	149681648	149681648	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149681648G>A	uc003lrv.2	-	1	878	c.289C>T	c.(289-291)CGG>TGG	p.R97W		NM_001012301	NP_001012301	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I precursor	97						endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCTGGCTCCGCGAAGGCGTG	0.577													3	11	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161281237	161281237	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161281237C>T	uc010jiw.2	+	4	616	c.148C>T	c.(148-150)CTA>TTA	p.L50L	GABRA1_uc010jix.2_Silent_p.L50L|GABRA1_uc010jiy.2_Silent_p.L50L|GABRA1_uc003lyx.3_Silent_p.L50L|GABRA1_uc010jiz.2_Silent_p.L50L|GABRA1_uc010jja.2_Silent_p.L50L|GABRA1_uc010jjb.2_Silent_p.L50L	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	50	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	GGACAGACTCCTAGATGGTTA	0.378													19	73	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173317235	173317235	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317235G>T	uc003mcs.3	+	1	1905	c.499G>T	c.(499-501)GGT>TGT	p.G167C	CPEB4_uc010jju.1_Missense_Mutation_p.G167C|CPEB4_uc010jjv.2_Missense_Mutation_p.G167C|CPEB4_uc011dfg.1_Missense_Mutation_p.G167C|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	167							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GTCTCTTACTGGTTTCAGTAA	0.493													37	133	---	---	---	---	PASS
PDLIM7	9260	broad.mit.edu	37	5	176915221	176915221	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176915221C>A	uc003mhc.1	-	10	983	c.898G>T	c.(898-900)GCG>TCG	p.A300S	PDLIM7_uc003mha.1_Missense_Mutation_p.A194S|PDLIM7_uc003mhb.1_Missense_Mutation_p.A266S|PDLIM7_uc003mhd.1_Missense_Mutation_p.A152S|PDLIM7_uc003mhe.1_RNA|PDLIM7_uc003mhf.2_Missense_Mutation_p.R279L	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1	300	LIM zinc-binding 1.				cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGTGGTACGCGTGGCCCAGC	0.642													3	98	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28228142	28228142	+	Silent	SNP	C	A	A	rs140336392	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28228142C>A	uc003nkt.2	+	1	1045	c.993C>A	c.(991-993)ATC>ATA	p.I331I	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	331										upper_aerodigestive_tract(1)|ovary(1)	2						GTGAAGAGATCGGTTCTTTTG	0.483													80	136	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32036344	32036344	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32036344C>G	uc003nzl.2	-	17	6245	c.6043G>C	c.(6043-6045)GAC>CAC	p.D2015H		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2097	Fibronectin type-III 13.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						AGGAAGTGGTCAAACTGTCCC	0.647													8	96	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32036704	32036704	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32036704C>A	uc003nzl.2	-	16	5999	c.5797G>T	c.(5797-5799)GAC>TAC	p.D1933Y		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2015	Fibronectin type-III 12.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						AGGGTGATGTCATTCCGGTCA	0.532													32	261	---	---	---	---	PASS
BRPF3	27154	broad.mit.edu	37	6	36182091	36182091	+	Missense_Mutation	SNP	C	T	T	rs148223802	byFrequency	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36182091C>T	uc003olv.3	+	8	3141	c.2917C>T	c.(2917-2919)CGG>TGG	p.R973W	BRPF3_uc010jwb.2_Intron|BRPF3_uc011dtj.1_Intron|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Intron	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	973					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						GCGCCACTCCCGGAAGCGGCC	0.617													16	76	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43415558	43415558	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43415558G>A	uc003ouy.1	+	18	4057	c.3842G>A	c.(3841-3843)CGC>CAC	p.R1281H	ABCC10_uc003ouz.1_Missense_Mutation_p.R1253H|ABCC10_uc010jyo.1_Missense_Mutation_p.R387H	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	1281	ABC transporter 2.|ATP 2 (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			ATCGTGGGCCGCACAGGCTCC	0.642													5	265	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50682991	50682991	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50682991C>A	uc003paf.2	+	2	714	c.202C>A	c.(202-204)CCG>ACG	p.P68T	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	68							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					CCAGTACACCCCGCTCCACCA	0.572													26	112	---	---	---	---	PASS
KLHL31	401265	broad.mit.edu	37	6	53519386	53519386	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53519386A>C	uc003pcb.3	-	2	826	c.685T>G	c.(685-687)TCT>GCT	p.S229A		NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1	229	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					ACTATCTCAGAAGGCAACTGT	0.348													42	179	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55922602	55922602	+	Silent	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55922602T>A	uc003pcs.2	-	30	2959	c.2727A>T	c.(2725-2727)CCA>CCT	p.P909P	COL21A1_uc010jzz.2_Silent_p.P294P|COL21A1_uc011dxg.1_Silent_p.P282P|COL21A1_uc011dxh.1_Silent_p.P260P|COL21A1_uc003pcr.2_Silent_p.P266P	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	909					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTGGGTCTCCTGGAGGACCTT	0.498													13	17	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72974742	72974742	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72974742T>C	uc003pga.2	+	20	3258	c.3181T>C	c.(3181-3183)TGG>CGG	p.W1061R	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Missense_Mutation_p.W278R|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1061					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAGTTCTCACTGGAATATTTA	0.383													10	18	---	---	---	---	PASS
HTR1B	3351	broad.mit.edu	37	6	78172433	78172433	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78172433G>A	uc003pil.1	-	1	688	c.688C>T	c.(688-690)CGC>TGC	p.R230C		NM_000863	NP_000854	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B	230	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity				0		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)	ACGTAGATGCGGCCATAGAGG	0.607													22	96	---	---	---	---	PASS
GJA10	84694	broad.mit.edu	37	6	90605323	90605323	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90605323C>T	uc011eaa.1	+	1	1136	c.1136C>T	c.(1135-1137)CCA>CTA	p.P379L		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	379	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		AGAAACTGTCCATCCTTTGCA	0.522													70	93	---	---	---	---	PASS
FRK	2444	broad.mit.edu	37	6	116289811	116289811	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116289811C>T	uc003pwi.1	-	3	1005	c.558G>A	c.(556-558)CTG>CTA	p.L186L		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	186	SH2.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		CAAATTCGTTCAGTGTTGAAA	0.418													125	165	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119301350	119301350	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119301350C>T	uc003pyj.2	-	10	2602	c.2254G>A	c.(2254-2256)GTC>ATC	p.V752I	FAM184A_uc003pyk.3_Missense_Mutation_p.V632I|FAM184A_uc003pyl.3_Missense_Mutation_p.V632I	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	752	Potential.									ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						AATGCAAGGACATGTGCTTCT	0.393													50	101	---	---	---	---	PASS
TAAR8	83551	broad.mit.edu	37	6	132874072	132874072	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132874072G>T	uc011ecj.1	+	1	241	c.241G>T	c.(241-243)GGT>TGT	p.G81C		NM_053278	NP_444508	Q969N4	TAAR8_HUMAN	trace amine associated receptor 8	81	Helical; Name=2; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)		CTTCTTGGTAGGTGTGACTGT	0.448													114	142	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597033	136597033	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597033G>A	uc003qgx.1	-	5	1883	c.1630C>T	c.(1630-1632)CGT>TGT	p.R544C	BCLAF1_uc003qgw.1_Missense_Mutation_p.R371C|BCLAF1_uc003qgy.1_Missense_Mutation_p.R542C|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R542C	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	544					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTTCAGGACGGTGAGAATCA	0.428													50	526	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146480698	146480698	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146480698C>A	uc010khw.1	+	3	1385	c.915C>A	c.(913-915)CGC>CGA	p.R305R	GRM1_uc010khu.1_Silent_p.R305R|GRM1_uc010khv.1_Silent_p.R305R|GRM1_uc003qll.2_Silent_p.R305R|GRM1_uc011edz.1_Silent_p.R305R|GRM1_uc011eea.1_Silent_p.R305R	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	305	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CCATGCGGCGCCTTGGCGTCG	0.413													12	56	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152472788	152472788	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152472788C>T	uc010kiw.2	-	135	24952	c.24350G>A	c.(24349-24351)CGG>CAG	p.R8117Q	SYNE1_uc010kiv.2_Missense_Mutation_p.R2641Q|SYNE1_uc003qos.3_Missense_Mutation_p.R2641Q|SYNE1_uc003qot.3_Missense_Mutation_p.R8046Q|SYNE1_uc003qou.3_Missense_Mutation_p.R8117Q|SYNE1_uc003qop.3_Missense_Mutation_p.R279Q|SYNE1_uc011eez.1_Missense_Mutation_p.R319Q|SYNE1_uc003qoq.3_Missense_Mutation_p.R319Q|SYNE1_uc003qor.3_Missense_Mutation_p.R1017Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8117	Spectrin 30.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATGCTGTCCCGCGCAGTCTC	0.403										HNSCC(10;0.0054)			15	42	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152485394	152485394	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152485394C>A	uc010kiw.2	-	131	24296	c.23694G>T	c.(23692-23694)AGG>AGT	p.R7898S	SYNE1_uc010kiv.2_Missense_Mutation_p.R2422S|SYNE1_uc003qos.3_Missense_Mutation_p.R2422S|SYNE1_uc003qot.3_Missense_Mutation_p.R7827S|SYNE1_uc003qou.3_Missense_Mutation_p.R7898S|SYNE1_uc003qop.3_Missense_Mutation_p.R60S|SYNE1_uc011eez.1_Missense_Mutation_p.R100S|SYNE1_uc003qoq.3_Missense_Mutation_p.R100S|SYNE1_uc003qor.3_Missense_Mutation_p.R798S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7898	Spectrin 28.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CGAGCCAGGTCCTCAGGCTGC	0.522										HNSCC(10;0.0054)			31	89	---	---	---	---	PASS
RSPH3	83861	broad.mit.edu	37	6	159420467	159420467	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159420467G>T	uc003qrx.2	-	1	732	c.542C>A	c.(541-543)CCA>CAA	p.P181Q	RSPH3_uc010kju.2_Missense_Mutation_p.P181Q|RSPH3_uc003qry.1_Missense_Mutation_p.P181Q	NM_031924	NP_114130	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog	181										ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		GGTCACTCACGGCTGCGTCAG	0.662													8	28	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170627121	170627121	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170627121C>G	uc003qxp.2	+	2	751	c.643C>G	c.(643-645)CTG>GTG	p.L215V	FAM120B_uc003qxo.1_Missense_Mutation_p.L215V|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	215					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		CTGTGAGAGTCTGGGCCTCTG	0.502													36	127	---	---	---	---	PASS
LFNG	3955	broad.mit.edu	37	7	2565317	2565317	+	Splice_Site	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2565317A>T	uc003smf.2	+	5	753	c.736_splice	c.e5-2	p.R246_splice	LFNG_uc003smg.2_Splice_Site_p.R246_splice	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a						organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		CCCTTCTCCCAGCGTCCTGTC	0.692													9	22	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21751446	21751446	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21751446G>A	uc003svc.2	+	43	7003	c.6972G>A	c.(6970-6972)CTG>CTA	p.L2324L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2324	AAA 2 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTGGTATTCTGTATGTGAACC	0.358									Kartagener_syndrome				19	31	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31124364	31124364	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31124364C>A	uc003tca.1	+	8	674	c.451C>A	c.(451-453)CTG>ATG	p.L151M	ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.L130M|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.L151M|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.L151M|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.L151M|ADCYAP1R1_uc003tcf.1_5'Flank	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	151	Extracellular (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						TTATTACTACCTGTCAGTGAA	0.582													17	117	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38279757	38279757	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38279757C>A	uc003tfu.3	-	5	487	c.252G>T	c.(250-252)CTG>CTT	p.L84L	uc003tfv.2_Silent_p.L84L					SubName: Full=TARP protein;																		TGAGCTGCAGCAGTAGTGTAT	0.398													9	16	---	---	---	---	PASS
TARP	445347	broad.mit.edu	37	7	38299821	38299821	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38299821C>A	uc003tge.1	-	7	1193	c.816G>T	c.(814-816)CTG>CTT	p.L272L	uc003tfx.1_5'Flank|uc003tfz.1_Intron|TARP_uc003tgb.2_Silent_p.L68L|TARP_uc003tgc.1_Silent_p.L68L|TARP_uc003tgd.1_Silent_p.L68L			A2JGV3	A2JGV3_HUMAN	Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.	Error:Variant_position_missing_in_A2JGV3_after_alignment											0						TGAGCTGCAGCAGTAGTGTAT	0.398													17	70	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38807137	38807137	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38807137C>T	uc003tgy.2	-	15	1273	c.1247G>A	c.(1246-1248)CGC>CAC	p.R416H	VPS41_uc003tgz.2_Missense_Mutation_p.R391H|VPS41_uc010kxn.2_Missense_Mutation_p.R327H	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	416					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						TCATCATTACCGTGCTGCTAT	0.323													16	90	---	---	---	---	PASS
LANCL2	55915	broad.mit.edu	37	7	55459481	55459481	+	Intron	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55459481C>G	uc003tqp.2	+							NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2						negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TCTTTTGGATCTCAGATCATT	0.363													38	74	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57194369	57194369	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57194369G>A	uc010kzo.2	-	3	367	c.96C>T	c.(94-96)TGC>TGT	p.C32C		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	32	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			CACAATCCAGGCATTGCCATT	0.413													61	137	---	---	---	---	PASS
PHTF2	57157	broad.mit.edu	37	7	77567025	77567025	+	Splice_Site	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77567025A>G	uc003ugs.3	+	12	1465	c.1339_splice	c.e12-2	p.S447_splice	PHTF2_uc003ugp.2_Splice_Site_p.S409_splice|PHTF2_uc003ugq.3_Splice_Site_p.S409_splice|PHTF2_uc010ldv.2_Splice_Site_p.S409_splice|PHTF2_uc003ugt.3_Splice_Site_p.S413_splice|PHTF2_uc003ugu.3_Splice_Site_p.S409_splice|PHTF2_uc003ugv.2_Splice_Site_p.S272_splice|PHTF2_uc010ldw.1_Intron	NM_001127357	NP_001120829	Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1						ttttttttataGAGTCATTTG	0.259													7	15	---	---	---	---	PASS
PON3	5446	broad.mit.edu	37	7	94992098	94992098	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94992098C>T	uc003unt.2	-	7	776	c.751G>A	c.(751-753)GAT>AAT	p.D251N	PON1_uc011kih.1_Intron	NM_000940	NP_000931	Q15166	PON3_HUMAN	paraoxonase 3	251					aromatic compound catabolic process|carboxylic acid catabolic process|response to external stimulus	extracellular space	aryldialkylphosphatase activity|arylesterase activity|metal ion binding|protein homodimerization activity			ovary(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)			TCCCAGTTATCATGTTTTTCC	0.408													5	128	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95157272	95157272	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95157272T>C	uc011kij.1	+	3	635	c.635T>C	c.(634-636)CTG>CCG	p.L212P	ASB4_uc003unx.2_Missense_Mutation_p.L212P	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	212	ANK 5.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			GAGACCCCCCTGGCCATCGCC	0.622											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	60	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100451837	100451837	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100451837A>T	uc003uwp.2	+	2	160	c.18A>T	c.(16-18)TCA>TCT	p.S6S	SLC12A9_uc003uwo.1_Silent_p.S6S|SLC12A9_uc003uwq.2_Silent_p.S6S|SLC12A9_uc011kki.1_Intron|SLC12A9_uc003uwr.2_5'Flank|SLC12A9_uc003uws.2_5'Flank|SLC12A9_uc003uwt.2_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	6	Cytoplasmic (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCGAGAGCTCACCTCTGCTGG	0.627													30	52	---	---	---	---	PASS
TFEC	22797	broad.mit.edu	37	7	115590929	115590929	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115590929G>T	uc003vhj.1	-	6	698	c.514C>A	c.(514-516)CCT>ACT	p.P172T	TFEC_uc003vhk.1_Missense_Mutation_p.P143T|TFEC_uc003vhl.3_Missense_Mutation_p.P143T|TFEC_uc011kmw.1_Missense_Mutation_p.P262T	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	172	Helix-loop-helix motif.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			TGAACTCACGGATCATTAGAC	0.328													12	185	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122787311	122787311	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122787311T>A	uc003vkm.2	-	7	739	c.714A>T	c.(712-714)AAA>AAT	p.K238N	SLC13A1_uc010lks.2_Missense_Mutation_p.K114N	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	238						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	AACACGTAAGTTTACGTGTCA	0.408													39	41	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173615	126173615	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173615G>A	uc003vlr.2	-	8	2132	c.1821C>T	c.(1819-1821)CGC>CGT	p.R607R	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.R607R|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	607	Helical; Name=1; (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TGTCATTATAGCGGACAAAGG	0.458										HNSCC(24;0.065)			11	52	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142567636	142567636	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142567636A>T	uc011kst.1	+	17	3311	c.2524A>T	c.(2524-2526)AGT>TGT	p.S842C	EPHB6_uc011ksu.1_Missense_Mutation_p.S842C|EPHB6_uc003wbs.2_Missense_Mutation_p.S550C|EPHB6_uc003wbt.2_Missense_Mutation_p.S316C|EPHB6_uc003wbu.2_Missense_Mutation_p.S550C|EPHB6_uc003wbv.2_Missense_Mutation_p.S226C	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	842	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					TACAACATCCAGTGATGTCTG	0.488													20	65	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146536904	146536904	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146536904T>A	uc003weu.1	+	3	826	c.310T>A	c.(310-312)TAT>AAT	p.Y104N		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	104	F5/8 type C.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCAAGGAAGGTATAGCAGCTC	0.498										HNSCC(39;0.1)			14	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	148979219	148979219	+	Intron	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148979219C>T	uc003wfr.3	+						uc011kuo.1_5'Flank					Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		CAAGGCCTTCCGCCGGCCCTC	0.701													5	13	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151970857	151970857	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151970857G>A	uc003wla.2	-	7	1164	c.945C>T	c.(943-945)GGC>GGT	p.G315G		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	315					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CCTGAAAGGTGCCGGCTCCTG	0.428			N		medulloblastoma								13	444	---	---	---	---	PASS
LZTS1	11178	broad.mit.edu	37	8	20107455	20107455	+	Silent	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20107455C>G	uc003wzr.2	-	3	1680	c.1569G>C	c.(1567-1569)TCG>TCC	p.S523S	LZTS1_uc010ltg.1_Intron	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	523					cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCTGGAAGCCCGAGGACATCT	0.652													16	63	---	---	---	---	PASS
LZTS1	11178	broad.mit.edu	37	8	20107456	20107456	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20107456G>A	uc003wzr.2	-	3	1679	c.1568C>T	c.(1567-1569)TCG>TTG	p.S523L	LZTS1_uc010ltg.1_Intron	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	523					cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CTGGAAGCCCGAGGACATCTG	0.657													16	63	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35425673	35425673	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35425673A>T	uc003xjr.1	+	3	708	c.380A>T	c.(379-381)CAT>CTT	p.H127L	UNC5D_uc003xjs.1_Missense_Mutation_p.H122L	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	127	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAGGACTTCCATGGGCCCGAG	0.532													74	238	---	---	---	---	PASS
LSM1	27257	broad.mit.edu	37	8	38027393	38027393	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38027393C>T	uc003xkw.2	-	3	346	c.158G>A	c.(157-159)GGC>GAC	p.G53D	LSM1_uc003xkx.2_RNA	NM_014462	NP_055277	O15116	LSM1_HUMAN	Lsm1 protein	53					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|mRNA processing|RNA splicing, via transesterification reactions	cytosol|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0	Colorectal(12;0.000442)					GTATTTTTTGCCCACATGAAT	0.393													5	306	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38162108	38162108	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38162108T>A	uc003xli.2	-	14	3126	c.2608A>T	c.(2608-2610)AGA>TGA	p.R870*	WHSC1L1_uc011lbm.1_Nonsense_Mutation_p.R870*|WHSC1L1_uc010lwe.2_Nonsense_Mutation_p.R870*	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	870	PHD-type 3.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CACTCACCTCTGGCACAAACG	0.303			T	NUP98	AML								58	161	---	---	---	---	PASS
PLEKHA2	59339	broad.mit.edu	37	8	38808484	38808484	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38808484G>T	uc003xmi.3	+	6	696	c.462G>T	c.(460-462)GTG>GTT	p.V154V	PLEKHA2_uc011lce.1_Silent_p.V104V	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A	154					positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TTGGAGGGGTGGTGGTCCACA	0.612													6	24	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52320664	52320664	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52320664C>G	uc003xqu.3	-	17	3621	c.3520G>C	c.(3520-3522)GAA>CAA	p.E1174Q	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1174					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCTTTAATTTCATTTTGAAGA	0.358													20	110	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212690	62212690	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212690C>A	uc003xuh.2	+	2	628	c.304C>A	c.(304-306)CAG>AAG	p.Q102K	CLVS1_uc003xug.2_Missense_Mutation_p.Q102K|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Missense_Mutation_p.Q102K	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	102					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						CCAGTACCGCCAGCTAAACCT	0.507													18	128	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62366774	62366774	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62366774C>T	uc003xuh.2	+	4	1029	c.705C>T	c.(703-705)CTC>CTT	p.L235L	CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Silent_p.L235L	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	235	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TCTACACACTCATCAAGCCAT	0.428													48	406	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68397018	68397018	+	Missense_Mutation	SNP	G	C	C	rs34326072		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68397018G>C	uc003xxq.3	-	7	899	c.643C>G	c.(643-645)CTA>GTA	p.L215V	CPA6_uc003xxr.3_Missense_Mutation_p.L67V|CPA6_uc003xxs.2_Missense_Mutation_p.L215V	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	215					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TTATATGTTAGAAGAGCCTAA	0.353													24	158	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70594546	70594546	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70594546G>C	uc003xyl.2	-	7	2362	c.1655C>G	c.(1654-1656)ACA>AGA	p.T552R	SLCO5A1_uc010lzb.2_Missense_Mutation_p.T497R|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.T552R	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	552	Extracellular (Potential).|Kazal-like.					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GCAGCTTCCTGTCAGATTCCT	0.423													29	242	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86027432	86027432	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86027432A>G	uc003ycw.2	+	5	796	c.642A>G	c.(640-642)TCA>TCG	p.S214S	LRRCC1_uc010lzz.1_Intron|LRRCC1_uc010maa.1_Intron|LRRCC1_uc003ycx.2_Silent_p.S121S|LRRCC1_uc003ycy.2_Silent_p.S194S	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	214	LRRCT.				cell division|mitosis	centriole|nucleus					0						AAATAAATTCATCACAGCTGC	0.348													161	141	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95164230	95164230	+	Silent	SNP	C	A	A	rs149027046	byFrequency	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95164230C>A	uc003ygh.2	-	13	1787	c.1662G>T	c.(1660-1662)ACG>ACT	p.T554T	CDH17_uc011lgo.1_Silent_p.T340T|CDH17_uc011lgp.1_Silent_p.T554T	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	554	Extracellular (Potential).|Cadherin 5.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCACAATAAGCGTGAACTTGG	0.423													41	213	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104709460	104709460	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104709460G>T	uc003ylp.2	+	2	462	c.323G>T	c.(322-324)TGT>TTT	p.C108F		NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	139	FYVE-type.|RabBD.				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGCCATAACTGTTCATATTGC	0.428										HNSCC(12;0.0054)			146	121	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110984732	110984732	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110984732C>T	uc003ynr.3	-	2	1088	c.746G>A	c.(745-747)TGC>TAC	p.C249Y	KCNV1_uc010mcw.2_Missense_Mutation_p.C249Y	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	249	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CCAGCTAATGCACACATACTC	0.527													38	66	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113657357	113657357	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113657357A>T	uc003ynu.2	-	20	3450	c.3291T>A	c.(3289-3291)GTT>GTA	p.V1097V	CSMD3_uc003yns.2_Silent_p.V369V|CSMD3_uc003ynt.2_Silent_p.V1057V|CSMD3_uc011lhx.1_Silent_p.V993V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1097	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGGTTACATCAACAGTCCATG	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			37	95	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120628618	120628618	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120628618A>G	uc003yot.1	-	8	750	c.664T>C	c.(664-666)TAT>CAT	p.Y222H	ENPP2_uc003yos.1_Missense_Mutation_p.Y222H|ENPP2_uc010mdd.1_Missense_Mutation_p.Y222H	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	222					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GATTCTGGATATAGCCCCTTT	0.318													89	48	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125570011	125570011	+	Missense_Mutation	SNP	G	A	A	rs150097928	byFrequency	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125570011G>A	uc003yrk.2	-	11	1675	c.1141C>T	c.(1141-1143)CGG>TGG	p.R381W	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_5'Flank|MTSS1_uc011lin.1_Missense_Mutation_p.R155W|MTSS1_uc011lio.1_Missense_Mutation_p.R271W|MTSS1_uc003yri.2_Intron|MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Missense_Mutation_p.R385W	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	381					actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GAGGTGACCCGAGGGAGCAGG	0.552													4	21	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143961099	143961099	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143961099C>T	uc003yxi.2	-	1	138	c.131G>A	c.(130-132)CGT>CAT	p.R44H	CYP11B1_uc003yxj.2_Missense_Mutation_p.R44H|CYP11B1_uc010mey.2_Missense_Mutation_p.R44H	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	44					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GTTGCCTGGACGCCGGGGCAT	0.647									Familial_Hyperaldosteronism_type_I				17	128	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145003943	145003943	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145003943G>A	uc003zaf.1	-	23	3375	c.3205C>T	c.(3205-3207)CAC>TAC	p.H1069Y	PLEC_uc003zab.1_Missense_Mutation_p.H932Y|PLEC_uc003zac.1_Missense_Mutation_p.H936Y|PLEC_uc003zad.2_Missense_Mutation_p.H932Y|PLEC_uc003zae.1_Missense_Mutation_p.H900Y|PLEC_uc003zag.1_Missense_Mutation_p.H910Y|PLEC_uc003zah.2_Missense_Mutation_p.H918Y|PLEC_uc003zaj.2_Missense_Mutation_p.H959Y	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	1069	Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCCTGGTAGTGCAGCTCCAGG	0.706													3	23	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145661285	145661285	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145661285C>T	uc011llg.1	-	17	2546	c.2531G>A	c.(2530-2532)CGC>CAC	p.R844H	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	844					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			ccggcggcTGCGGGTCAGGGG	0.617													11	28	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971186	21971186	+	Nonsense_Mutation	SNP	G	A	A	rs121913387		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971186G>A	uc003zpk.2	-	2	384	c.172C>T	c.(172-174)CGA>TGA	p.R58*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.P113L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	58	ANK 2.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.R58*(68)|p.?(14)|p.M53_R58del(3)|p.R58fs*59(2)|p.M54fs*61(2)|p.R58fs*89(1)|p.R58R(1)|p.V28_V51del(1)|p.A57_R58>V*(1)|p.R58fs*61(1)|p.R58fs*62(1)|p.G55fs*86(1)|p.R58Q(1)|p.P113L(1)|p.A57fs*85(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TCCGCCACTCGGGCGCTGCCC	0.677		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			3	2	---	---	---	---	PASS
CDKN2B	1030	broad.mit.edu	37	9	22006222	22006222	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22006222C>T	uc003zpo.2	-	2	541	c.181G>A	c.(181-183)GTG>ATG	p.V61M	MTAP_uc003zpi.1_Intron|CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron|CDKN2B_uc003zpn.2_3'UTR	NM_004936	NP_004927	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B isoform 1	61	ANK 2.				cell cycle arrest|cellular response to nutrient|G1 phase of mitotic cell cycle|G2/M transition of mitotic cell cycle|megakaryocyte differentiation|mitotic cell cycle G1/S transition checkpoint|negative regulation of epithelial cell proliferation|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		AGCTCCGCCACGCGGGCGCTG	0.692									Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				7	18	---	---	---	---	PASS
C9orf72	203228	broad.mit.edu	37	9	27558492	27558492	+	Silent	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27558492T>G	uc003zqq.2	-	7	949	c.852A>C	c.(850-852)CTA>CTC	p.L284L		NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	284										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		ACTATACCTTTAGCAGGCCTT	0.338													6	81	---	---	---	---	PASS
C9orf72	203228	broad.mit.edu	37	9	27558493	27558493	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27558493A>T	uc003zqq.2	-	7	948	c.851T>A	c.(850-852)CTA>CAA	p.L284Q		NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	284										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		CTATACCTTTAGCAGGCCTTG	0.333													6	81	---	---	---	---	PASS
C9orf72	203228	broad.mit.edu	37	9	27558494	27558494	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27558494G>A	uc003zqq.2	-	7	947	c.850C>T	c.(850-852)CTA>TTA	p.L284L		NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	284										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TATACCTTTAGCAGGCCTTGT	0.333													5	81	---	---	---	---	PASS
CNTNAP3	79937	broad.mit.edu	37	9	39149959	39149959	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39149959C>A	uc004abi.2	-	10	1732	c.1493G>T	c.(1492-1494)AGC>ATC	p.S498I	CNTNAP3_uc004abj.2_Missense_Mutation_p.S498I|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Missense_Mutation_p.S498I|CNTNAP3_uc011lqs.1_Intron|CNTNAP3_uc004abl.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	498	Extracellular (Potential).|Laminin G-like 2.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAGCCAGAGCTGTTGTCCAG	0.463													18	54	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73151520	73151520	+	Silent	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73151520C>G	uc004aid.2	-	25	4717	c.4473G>C	c.(4471-4473)CCG>CCC	p.P1491P	TRPM3_uc004ahu.2_Silent_p.P1333P|TRPM3_uc004ahv.2_Silent_p.P1293P|TRPM3_uc004ahw.2_Silent_p.P1363P|TRPM3_uc004ahx.2_Silent_p.P1350P|TRPM3_uc004ahy.2_Silent_p.P1353P|TRPM3_uc004ahz.2_Silent_p.P1340P|TRPM3_uc004aia.2_Silent_p.P1338P|TRPM3_uc004aib.2_Silent_p.P1328P|TRPM3_uc004aic.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1516	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TGTGGTACATCGGAGGCTCTG	0.483													41	45	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74856098	74856098	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74856098T>C	uc004aiq.2	+	11	1202	c.1019T>C	c.(1018-1020)CTT>CCT	p.L340P	GDA_uc011lse.1_Missense_Mutation_p.L266P|GDA_uc011lsf.1_Missense_Mutation_p.L266P|GDA_uc004air.2_Missense_Mutation_p.L340P|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Missense_Mutation_p.L262P	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	340					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TATTCCATGCTTGATGCAATC	0.358													43	76	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103070787	103070787	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103070787T>A	uc004bas.2	-	13	2675	c.2460A>T	c.(2458-2460)AGA>AGT	p.R820S	TEX10_uc011lvf.1_Missense_Mutation_p.R659S|TEX10_uc011lvg.1_Missense_Mutation_p.R823S	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1	820						integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		ATTACCTCTTTCTTAGATGTT	0.348													41	36	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104432782	104432782	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104432782G>T	uc004bbp.1	-	3	2513	c.1912C>A	c.(1912-1914)CGG>AGG	p.R638R	GRIN3A_uc004bbq.1_Silent_p.R638R	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	638	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	ACCTGGCTCCGTGCAGTATTG	0.532													28	92	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120476318	120476318	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120476318G>C	uc004bjz.2	+	3	2203	c.1912G>C	c.(1912-1914)GTC>CTC	p.V638L	TLR4_uc004bka.2_Missense_Mutation_p.V598L|TLR4_uc004bkb.2_Missense_Mutation_p.V438L	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	638	Helical; (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TGGTGTGTCGGTCCTCAGTGT	0.438													15	54	---	---	---	---	PASS
REXO4	57109	broad.mit.edu	37	9	136272165	136272165	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136272165T>G	uc004cdm.2	-	8	1381	c.1181A>C	c.(1180-1182)TAC>TCC	p.Y394S	REXO4_uc011mde.1_Missense_Mutation_p.Y257S|REXO4_uc011mdf.1_Missense_Mutation_p.Y257S|REXO4_uc004cdn.2_Missense_Mutation_p.Y145S|REXO4_uc004cdo.2_Missense_Mutation_p.Y222S	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog	394	Exonuclease.					nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		CACCATGACGTACAGCCTCAT	0.597											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	48	---	---	---	---	PASS
REXO4	57109	broad.mit.edu	37	9	136272167	136272167	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136272167C>A	uc004cdm.2	-	8	1379	c.1179G>T	c.(1177-1179)CTG>CTT	p.L393L	REXO4_uc011mde.1_Silent_p.L256L|REXO4_uc011mdf.1_Silent_p.L256L|REXO4_uc004cdn.2_Silent_p.L144L|REXO4_uc004cdo.2_Silent_p.L221L	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog	393	Exonuclease.					nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		CCATGACGTACAGCCTCATTG	0.597											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	47	---	---	---	---	PASS
RXRA	6256	broad.mit.edu	37	9	137313659	137313659	+	Intron	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137313659G>T	uc004cfb.2	+						RXRA_uc004cfc.1_Intron|RXRA_uc004cfd.1_Missense_Mutation_p.W77C	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha						cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	CAGGTGAGTGGCGAGGCCTAG	0.642													29	33	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137717708	137717708	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137717708C>T	uc004cfe.2	+	63	5407	c.5025C>T	c.(5023-5025)GCC>GCT	p.A1675A	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1675	Fibrillar collagen NC1.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ACTTCACAGCCGGGGGGTCGA	0.592													31	39	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7618475	7618475	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7618475G>T	uc001ijq.2	-	10	1998	c.1919C>A	c.(1918-1920)TCG>TAG	p.S640*	ITIH5_uc001ijp.2_Nonsense_Mutation_p.S426*|ITIH5_uc001ijr.1_Nonsense_Mutation_p.S640*	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	640					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CATGGCAGCCGACATGCCGTG	0.692													13	29	---	---	---	---	PASS
MCM10	55388	broad.mit.edu	37	10	13240736	13240736	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13240736G>T	uc001ima.2	+	16	2271	c.2170G>T	c.(2170-2172)GCC>TCC	p.A724S	MCM10_uc001imb.2_Missense_Mutation_p.A723S|MCM10_uc001imc.2_Missense_Mutation_p.A723S	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	724					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						AGAACAACTTGCCTATCTGGA	0.433													28	109	---	---	---	---	PASS
OLAH	55301	broad.mit.edu	37	10	15091769	15091769	+	Intron	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15091769G>T	uc001inu.2	+						ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Intron	NM_001039702	NP_001034791	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase isoform 2						fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0						TGGAAGGTATGTTAATTTTTA	0.383													11	92	---	---	---	---	PASS
C10orf67	256815	broad.mit.edu	37	10	23622061	23622061	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23622061G>A	uc010qcx.1	-	2	326	c.260C>T	c.(259-261)GCC>GTC	p.A87V		NM_153714	NP_714925	Q8IYJ2	CJ067_HUMAN	hypothetical protein LOC256815	87											0						AGTTTGAGTGGCATGGTCTGT	0.333													4	89	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28233361	28233361	+	Splice_Site	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28233361C>A	uc009xky.2	-	12	1632	c.1534_splice	c.e12-1	p.I512_splice	ARMC4_uc010qds.1_Splice_Site_p.I37_splice|ARMC4_uc010qdt.1_Splice_Site_p.I204_splice|ARMC4_uc001itz.2_Splice_Site_p.I512_splice|ARMC4_uc010qdu.1_Splice_Site_p.I204_splice	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4								binding			ovary(4)|skin(2)	6						ATGAACCAATCTGTGTGAGAA	0.338													31	98	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33200848	33200848	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33200848G>A	uc001iws.3	-	12	1810	c.1674C>T	c.(1672-1674)TTC>TTT	p.F558F	ITGB1_uc001iwp.3_Silent_p.F558F|ITGB1_uc001iwq.3_Silent_p.F558F|ITGB1_uc001iwr.3_Silent_p.F558F|ITGB1_uc001iwt.3_Silent_p.F558F|ITGB1_uc001iwu.1_Silent_p.F558F	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	558	Extracellular (Potential).|Cysteine-rich tandem repeats.|II.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				TATCACAGTTGAAATTATCAC	0.403													66	310	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37451602	37451602	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37451602C>A	uc001iza.1	+	16	1857	c.1758C>A	c.(1756-1758)TTC>TTA	p.F586L		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	642						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CATCTGCCTTCGAGGTATTTA	0.328													35	207	---	---	---	---	PASS
ZNF25	219749	broad.mit.edu	37	10	38241620	38241620	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38241620T>A	uc001ize.1	-	6	911	c.806A>T	c.(805-807)CAG>CTG	p.Q269L	ZNF25_uc001izf.1_Missense_Mutation_p.Q233L	NM_145011	NP_659448	P17030	ZNF25_HUMAN	zinc finger protein 25	269	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|central_nervous_system(1)	4		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GTGTGACTTCTGGGAAAAGGC	0.443													40	156	---	---	---	---	PASS
CSTF2T	23283	broad.mit.edu	37	10	53458538	53458538	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53458538T>C	uc001jjp.2	-	1	818	c.772A>G	c.(772-774)ATC>GTC	p.I258V	PRKG1_uc001jjm.2_Intron|PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_015235	NP_056050	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit	258					mRNA processing	nucleus	nucleotide binding|RNA binding			ovary(1)	1				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		CCACCCTGGATAGGAGTCTGC	0.547													12	78	---	---	---	---	PASS
DKK1	22943	broad.mit.edu	37	10	54074314	54074314	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54074314C>A	uc001jjr.2	+	1	274	c.120C>A	c.(118-120)AAC>AAA	p.N40K	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor	40					negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						TCAATTCCAACGCTATCAAGA	0.672											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	104	---	---	---	---	PASS
TFAM	7019	broad.mit.edu	37	10	60148479	60148479	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60148479T>G	uc001jkf.2	+	4	473	c.341T>G	c.(340-342)ATA>AGA	p.I114R	TFAM_uc001jkg.2_RNA|TFAM_uc001jkh.2_Missense_Mutation_p.I114R	NM_003201	NP_003192	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial precursor	114	HMG box 1.				DNA-dependent DNA replication|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase I promoter|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	mitochondrial light strand promoter sense binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AAAGAAGAGATAAGCAGATTT	0.318													27	144	---	---	---	---	PASS
DNA2	1763	broad.mit.edu	37	10	70178815	70178815	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70178815A>G	uc001jof.2	-	19	3201	c.3201T>C	c.(3199-3201)TTT>TTC	p.F1067F	DNA2_uc001jog.1_Silent_p.F743F|DNA2_uc001joh.1_RNA	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog	981					base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						TACTTCTAACAAAAGATACTA	0.323													23	138	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70406034	70406034	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70406034A>G	uc001jok.3	+	4	4053	c.3548A>G	c.(3547-3549)TAT>TGT	p.Y1183C		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1183					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TCCTATATGTATGGCACAATA	0.388													41	161	---	---	---	---	PASS
C10orf28	27291	broad.mit.edu	37	10	99995216	99995216	+	Silent	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99995216G>C	uc001kow.3	+	7	2362	c.2067G>C	c.(2065-2067)GTG>GTC	p.V689V	C10orf28_uc001kox.3_Silent_p.V703V|C10orf28_uc001koy.3_Silent_p.V689V|C10orf28_uc009xvx.2_Silent_p.V689V|C10orf28_uc009xvy.2_Silent_p.V95V|C10orf28_uc001koz.3_RNA	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN	growth inhibition and differentiation related	689							nucleotide binding			large_intestine(1)|skin(1)	2		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)		ACACCATGGTGAAGATTCGTC	0.448													17	61	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100249878	100249878	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100249878G>C	uc001kpn.1	-	10	1456	c.1396C>G	c.(1396-1398)CGG>GGG	p.R466G	HPSE2_uc009xwc.1_Missense_Mutation_p.R456G|HPSE2_uc001kpo.1_Missense_Mutation_p.R398G|HPSE2_uc009xwd.1_Missense_Mutation_p.R344G	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	466					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CGTGGCTTCCGCTGGAGCCCA	0.562													17	86	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104129061	104129061	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104129061A>T	uc001kux.1	+	24	3304	c.3064A>T	c.(3064-3066)ATC>TTC	p.I1022F	GBF1_uc001kuy.1_Missense_Mutation_p.I1022F|GBF1_uc001kuz.1_Missense_Mutation_p.I1023F	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1022					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TCATGGTGACATCCTGCGGGA	0.498													34	152	---	---	---	---	PASS
SUFU	51684	broad.mit.edu	37	10	104353466	104353466	+	Missense_Mutation	SNP	G	A	A	rs144005604	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104353466G>A	uc001kvy.1	+	5	817	c.671G>A	c.(670-672)CGG>CAG	p.R224Q	SUFU_uc001kvw.1_Missense_Mutation_p.R224Q|SUFU_uc001kvx.2_Missense_Mutation_p.R224Q|SUFU_uc009xxe.1_5'Flank|SUFU_uc009xxf.1_5'Flank	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	224					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GAGCTGCTGCGGACAGTGCCT	0.627			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				5	62	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115392842	115392842	+	Splice_Site	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115392842C>A	uc001laj.2	-	16	1796	c.1632_splice	c.e16+1	p.E544_splice	NRAP_uc001lak.2_Splice_Site_p.E509_splice|NRAP_uc001lal.3_Splice_Site_p.E544_splice	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGCTCTCTTACCTCACTGAAG	0.473													45	73	---	---	---	---	PASS
VAX1	11023	broad.mit.edu	37	10	118895983	118895983	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118895983C>T	uc009xyx.2	-	2	674	c.429G>A	c.(427-429)CAG>CAA	p.Q143Q	VAX1_uc001ldb.1_Silent_p.Q143Q	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a	143	Homeobox.					nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		CGCCGGGTACCTGGGTCTCGG	0.637													4	35	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123845054	123845054	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123845054G>A	uc001lfv.2	+	4	3399	c.3039G>A	c.(3037-3039)AGG>AGA	p.R1013R	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Silent_p.R1013R|TACC2_uc010qtv.1_Silent_p.R1013R	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1013						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CATGTCAAAGGCATCCAGGAG	0.547													14	46	---	---	---	---	PASS
C10orf88	80007	broad.mit.edu	37	10	124708171	124708171	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124708171C>A	uc001lgw.2	-	4	867	c.642G>T	c.(640-642)CAG>CAT	p.Q214H	C10orf88_uc001lgx.2_Missense_Mutation_p.Q116H	NM_024942	NP_079218	Q9H8K7	CJ088_HUMAN	hypothetical protein LOC80007	214											0		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		TTACCCGCTGCTGACACCTAA	0.378													37	95	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134912152	134912152	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134912152G>T	uc001llx.3	+	4	576	c.140G>T	c.(139-141)CGC>CTC	p.R47L	GPR123_uc001llw.2_Missense_Mutation_p.R767L	NM_001083909	NP_001077378	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	47	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AGCGCCATCCGCATCAGCCGC	0.662													33	50	---	---	---	---	PASS
PNPLA2	57104	broad.mit.edu	37	11	822507	822507	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:822507C>A	uc001lrt.2	+	5	799	c.597C>A	c.(595-597)TCC>TCA	p.S199S	PNPLA2_uc009ycl.2_5'Flank	NM_020376	NP_065109	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	199	Lumenal (Potential).				negative regulation of sequestering of triglyceride|positive regulation of triglyceride catabolic process	integral to membrane|lipid particle|plasma membrane	triglyceride lipase activity				0		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGACAGCTCCACCAACATCC	0.592													27	111	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1263975	1263975	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1263975C>T	uc009ycr.1	+	47	8070	c.7944C>T	c.(7942-7944)CCC>CCT	p.P2648P	MUC5B_uc001ltb.2_Silent_p.P1958P	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1955	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AAGCCACTCCCTCCTCCAGTC	0.642													22	64	---	---	---	---	PASS
OR52K1	390036	broad.mit.edu	37	11	4510214	4510214	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4510214G>T	uc001lza.1	+	1	84	c.84G>T	c.(82-84)TGG>TGT	p.W28C		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGCATGCCTGGATCTCCATCC	0.498													65	205	---	---	---	---	PASS
OR51E2	81285	broad.mit.edu	37	11	4703143	4703143	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4703143G>C	uc001lzk.2	-	2	1043	c.799C>G	c.(799-801)CTT>GTT	p.L267V		NM_030774	NP_110401	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E,	267	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(3)|ovary(2)	5		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATGGGATGAAGGCTGTTTCCA	0.507													20	70	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080646	5080646	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080646G>A	uc010qyw.1	-	1	212	c.212C>T	c.(211-213)ACT>ATT	p.T71I		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACCCACATCAGTGGTGGCCAA	0.488													13	30	---	---	---	---	PASS
OR52A4	390053	broad.mit.edu	37	11	5142411	5142411	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5142411G>T	uc001lzz.1	-	1	398	c.398C>A	c.(397-399)CCT>CAT	p.P133H	OR52A4_uc001maa.2_RNA	NM_001005222	NP_001005222			olfactory receptor, family 52, subfamily A,											ovary(2)	2		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ACGCCTCAGAGGATAACAGAT	0.483													19	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	5253938	5253938	+	IGR	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5253938C>T								HBB (5637 upstream) : HBD (121 downstream)																							ATGCCTTGTACGGTTCCCTTG	0.413													8	20	---	---	---	---	PASS
HPX	3263	broad.mit.edu	37	11	6462155	6462155	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6462155C>A	uc001mdg.2	-	1	100	c.39G>T	c.(37-39)TTG>TTT	p.L13F	HPX_uc009yfc.2_RNA|HPX_uc010rai.1_Missense_Mutation_p.L13F	NM_000613	NP_000604	P02790	HEMO_HUMAN	hemopexin precursor	13					cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		ATAGGCTCCACAACCCCAGTG	0.562													8	18	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9442248	9442248	+	Intron	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9442248A>G	uc001mho.2	+							NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7						interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TCCAGCAAGTAAGTCTGTTTT	0.358													37	100	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033775	30033775	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033775A>T	uc001msk.2	-	2	1603	c.451T>A	c.(451-453)TGT>AGT	p.C151S		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	151						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTGTAGGAACACTCATCACCA	0.398													19	72	---	---	---	---	PASS
PAX6	5080	broad.mit.edu	37	11	31812271	31812271	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31812271G>T	uc001mtd.3	-	11	2060	c.1170C>A	c.(1168-1170)GGC>GGA	p.G390G	PAX6_uc001mte.3_Silent_p.G390G|PAX6_uc001mtg.3_Silent_p.G404G|PAX6_uc001mtf.3_Silent_p.G390G|PAX6_uc001mth.3_Silent_p.G390G|PAX6_uc009yjr.2_Silent_p.G390G	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a	390	Pro/Ser/Thr-rich.				blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)					TTGAAGTGGTGCCCGAGGTGC	0.542									Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				22	88	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46431886	46431886	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46431886T>C	uc010rgu.1	-	16	3509	c.3149A>G	c.(3148-3150)GAC>GGC	p.D1050G	AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Missense_Mutation_p.D1021G|AMBRA1_uc001ncu.1_Missense_Mutation_p.D960G|AMBRA1_uc001ncv.2_Missense_Mutation_p.D1053G|AMBRA1_uc001ncw.2_Missense_Mutation_p.D931G|AMBRA1_uc001ncx.2_Missense_Mutation_p.D990G	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated	1050					autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GTTCAGCTGGTCCCAGTAGTA	0.527													38	221	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515299	51515299	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515299C>T	uc010ric.1	+	1	18	c.18C>T	c.(16-18)AAC>AAT	p.N6N		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATAGGAATAACATGACAGAGT	0.299													37	132	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	56000266	56000266	+	Silent	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56000266T>A	uc010rjc.1	-	1	396	c.396A>T	c.(394-396)TCA>TCT	p.S132S		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	132	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					ATCCAAGGAATGAAATGACTT	0.388													28	159	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56345037	56345037	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56345037T>C	uc001niz.1	-	1	161	c.161A>G	c.(160-162)CAA>CGA	p.Q54R		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	54	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGTTTGCAGTTGGGAATTGGT	0.463													27	127	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60183065	60183065	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60183065C>G	uc001npj.2	+	5	1189	c.624C>G	c.(622-624)TTC>TTG	p.F208L	MS4A14_uc001npi.2_Missense_Mutation_p.F96L|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.F191L|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	208						integral to membrane	receptor activity			breast(1)	1						ATGCTTTCTTCAAGTTAACAC	0.373													35	165	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62394373	62394373	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62394373G>A	uc001nub.2	-	20	2389	c.2356C>T	c.(2356-2358)CAT>TAT	p.H786Y	GANAB_uc001ntz.2_5'UTR|GANAB_uc001nua.2_Missense_Mutation_p.H808Y|GANAB_uc001nuc.2_Missense_Mutation_p.H689Y|GANAB_uc010rma.1_Missense_Mutation_p.H694Y|GANAB_uc010rmb.1_Missense_Mutation_p.H672Y	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	786					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						TGGGGACCATGATGCTTCTGG	0.527													6	42	---	---	---	---	PASS
FGF3	2248	broad.mit.edu	37	11	69625434	69625434	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69625434C>T	uc001oph.2	-	3	850	c.359G>A	c.(358-360)CGG>CAG	p.R120Q		NM_005247	NP_005238	P11487	FGF3_HUMAN	fibroblast growth factor 3 precursor	120					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			CTCGTGGATCCGCTCCACAAA	0.652													40	696	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76901870	76901870	+	Silent	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76901870C>G	uc001oyb.2	+	30	4151	c.3879C>G	c.(3877-3879)CTC>CTG	p.L1293L	MYO7A_uc010rsm.1_Silent_p.L1282L|MYO7A_uc001oyc.2_Silent_p.L1293L|MYO7A_uc009yus.1_RNA|MYO7A_uc009yut.1_Silent_p.L504L	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	1293	FERM 1.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						AGATCTCTCTCAAGGACCGGT	0.627													3	125	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88300889	88300889	+	Silent	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88300889G>C	uc001pcq.2	-	7	2162	c.1962C>G	c.(1960-1962)TCC>TCG	p.S654S	GRM5_uc009yvm.2_Silent_p.S654S	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	654	Helical; Name=3; (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TCATGGCTGGGGAGAGACCAA	0.493													11	36	---	---	---	---	PASS
DDI1	414301	broad.mit.edu	37	11	103907666	103907666	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103907666G>A	uc001phr.2	+	1	359	c.116G>A	c.(115-117)AGA>AAA	p.R39K	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	39	Ubiquitin-like.				proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GCGGAGTCCAGAGTCCCCGTC	0.587													59	167	---	---	---	---	PASS
HTR3B	9177	broad.mit.edu	37	11	113816817	113816817	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113816817C>A	uc001pok.2	+	9	1351	c.1284C>A	c.(1282-1284)ACC>ACA	p.T428T	HTR3B_uc001pol.2_Silent_p.T417T	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	428	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		GGATCTACACCATCACTCTGT	0.552													42	43	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118372451	118372451	+	Silent	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118372451T>A	uc001pta.2	+	26	6398	c.6375T>A	c.(6373-6375)CCT>CCA	p.P2125P	MLL_uc001ptb.2_Silent_p.P2128P	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2125					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CAGACCGACCTCCTCATTCAC	0.433			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								62	218	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059796	119059796	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059796G>A	uc001pwb.2	+	8	2092	c.1568G>A	c.(1567-1569)GGA>GAA	p.G523E	PDZD3_uc001pvy.2_Missense_Mutation_p.G443E|PDZD3_uc001pvz.2_Missense_Mutation_p.G457E|PDZD3_uc010rzd.1_Missense_Mutation_p.G444E|PDZD3_uc001pwa.2_Missense_Mutation_p.G153E			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	523	PDZ 4.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CCTGTTGGGGGACAGAATGAC	0.622													40	45	---	---	---	---	PASS
OR8D4	338662	broad.mit.edu	37	11	123777855	123777855	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123777855C>T	uc010saa.1	+	1	717	c.717C>T	c.(715-717)AGC>AGT	p.S239S		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		AAGCGTTTAGCACCTGTAGCT	0.463													52	210	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	124007350	124007350	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124007350A>T	uc001pzu.2	+	14	1803	c.1594A>T	c.(1594-1596)ACA>TCA	p.T532S	VWA5A_uc001pzt.2_Missense_Mutation_p.T532S	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	532										upper_aerodigestive_tract(1)|ovary(1)	2						GGATAAGGTGACATTTCCTCT	0.318													49	160	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2743545	2743545	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2743545A>G	uc009zdu.1	+	32	4368	c.4055A>G	c.(4054-4056)AAC>AGC	p.N1352S	CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkc.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qke.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkf.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qjz.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkd.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Missense_Mutation_p.N1304S|CACNA1C_uc001qkh.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkl.2_Missense_Mutation_p.N1352S|CACNA1C_uc001qkn.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qko.2_Missense_Mutation_p.N1324S|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Missense_Mutation_p.N1332S|CACNA1C_uc001qku.2_Missense_Mutation_p.N1304S|CACNA1C_uc001qkq.2_Missense_Mutation_p.N1332S|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Missense_Mutation_p.N1040S	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1352	Extracellular (Potential).|IV.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	ACCGAGGTAAACGTAAGTACA	0.403													12	6	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5756937	5756937	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5756937G>A	uc001qnm.2	-	16	1648	c.1576C>T	c.(1576-1578)CGT>TGT	p.R526C		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	531	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						CCTGGGAAACGATCCTTCCAG	0.438													4	40	---	---	---	---	PASS
GAPDH	2597	broad.mit.edu	37	12	6646779	6646779	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6646779G>T	uc001qop.1	+	8	657	c.555G>T	c.(553-555)CAG>CAT	p.Q185H	GAPDH_uc009zep.1_Missense_Mutation_p.Q143H|GAPDH_uc001qoq.1_Missense_Mutation_p.Q110H|GAPDH_uc001qor.1_Missense_Mutation_p.Q144H|GAPDH_uc001qos.1_Missense_Mutation_p.Q185H|GAPDH_uc001qot.1_Missense_Mutation_p.Q185H|GAPDH_uc001qou.1_Missense_Mutation_p.Q144H|GAPDH_uc001qov.1_Missense_Mutation_p.Q143H|GAPDH_uc001qow.1_Missense_Mutation_p.Q138H|GAPDH_uc001qox.1_Missense_Mutation_p.Q11H	NM_002046	NP_002037	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	185					gluconeogenesis|glycolysis|neuron apoptosis|peptidyl-cysteine S-trans-nitrosylation|protein stabilization	cytosol|membrane|nucleus|perinuclear region of cytoplasm	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|peptidyl-cysteine S-nitrosylase activity|protein binding				0					NADH(DB00157)	CTGCCACCCAGAAGACTGTGG	0.622											OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	63	---	---	---	---	PASS
PHB2	11331	broad.mit.edu	37	12	7076742	7076742	+	Intron	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7076742T>A	uc001qsd.2	-						PHB2_uc010sft.1_Intron|PHB2_uc001qse.1_5'Flank|PHB2_uc001qsf.1_5'Flank|PHB2_uc009zfn.1_5'Flank|SCARNA12_uc001qsg.2_RNA	NM_001144831	NP_001138303	Q99623	PHB2_HUMAN	prohibitin 2 isoform 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial inner membrane|nucleus	estrogen receptor binding|receptor activity			ovary(2)|pancreas(1)	3						GAGCACGGAGTCGCATTCGCC	0.547													36	82	---	---	---	---	PASS
CLEC4A	50856	broad.mit.edu	37	12	8278191	8278191	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8278191T>G	uc001qtz.1	+	2	364	c.117T>G	c.(115-117)AAT>AAG	p.N39K	CLEC4A_uc009zga.1_Intron|CLEC4A_uc001qub.1_Missense_Mutation_p.N39K|CLEC4A_uc001quc.1_Intron|CLEC4A_uc009zgb.1_Missense_Mutation_p.N39K	NM_016184	NP_057268	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A isoform	39	Cytoplasmic (Potential).				cell adhesion|cell surface receptor linked signaling pathway|innate immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0				Kidney(36;0.0915)		ACAAAAGTAATACCGGATTCC	0.403													31	141	---	---	---	---	PASS
TAS2R31	259290	broad.mit.edu	37	12	11183143	11183143	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11183143G>A	uc001qzo.1	-	1	864	c.792C>T	c.(790-792)TGC>TGT	p.C264C	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176885	NP_795366	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	264	Helical; Name=7; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity				0						TAATAGCTTTGCAGAACATGA	0.393													82	437	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49435239	49435239	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49435239C>T	uc001rta.3	-	31	6314	c.6314G>A	c.(6313-6315)CGC>CAC	p.R2105H		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2105					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CGGGGGAATGCGGAGATGTAG	0.652			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	82	---	---	---	---	PASS
ANKRD33	341405	broad.mit.edu	37	12	52284862	52284862	+	Intron	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52284862G>A	uc001rzf.3	+						ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_Missense_Mutation_p.G378S|ANKRD33_uc001rze.2_Missense_Mutation_p.G274S|ANKRD33_uc001rzg.3_Intron|ANKRD33_uc001rzi.3_Intron	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		GAGCCCTCAGGGCATATTGAG	0.642													9	64	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56082084	56082084	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56082084C>T	uc001shh.2	-	23	3191	c.2971G>A	c.(2971-2973)GAG>AAG	p.E991K	ITGA7_uc001shg.2_Missense_Mutation_p.E987K|ITGA7_uc010sps.1_Missense_Mutation_p.E894K|ITGA7_uc001shf.2_5'Flank|ITGA7_uc009znw.2_Missense_Mutation_p.E234K|ITGA7_uc009znx.2_Missense_Mutation_p.E868K	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	1031	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						GCTGAGTACTCCTAAGGGAAC	0.502													18	74	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78513143	78513143	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78513143T>G	uc001syp.2	+	15	3340	c.3167T>G	c.(3166-3168)ATT>AGT	p.I1056S	NAV3_uc001syo.2_Missense_Mutation_p.I1056S|NAV3_uc010sub.1_Missense_Mutation_p.I556S|NAV3_uc009zsf.2_Missense_Mutation_p.I64S	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1056	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CCCTCAGGCATTGGAAGATCG	0.488										HNSCC(70;0.22)			27	172	---	---	---	---	PASS
MYF5	4617	broad.mit.edu	37	12	81112734	81112734	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81112734C>A	uc001szg.2	+	3	807	c.672C>A	c.(670-672)CTC>CTA	p.L224L		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	224					muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						GGTTGCCTCTCCAGGATCTGG	0.493													39	137	---	---	---	---	PASS
C12orf26	84190	broad.mit.edu	37	12	82793073	82793073	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82793073G>A	uc001szq.2	+	4	1052	c.1031G>A	c.(1030-1032)AGA>AAA	p.R344K		NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190	344											0						AAAGAGAGAAGAAAAATGACA	0.338													35	63	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100796511	100796511	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100796511T>G	uc010svi.1	+	8	1354	c.1041T>G	c.(1039-1041)TTT>TTG	p.F347L	SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	347	Vesicular (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TCTTTGGATTTGCAATAAGTA	0.328													21	88	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107245223	107245223	+	Intron	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107245223A>T	uc001tlx.2	+						RIC8B_uc001tlw.2_Intron|RIC8B_uc001tly.2_Intron|RIC8B_uc001tlz.2_Intron|RIC8B_uc009zur.2_Intron	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8						regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CATTTGTGCCATCAGGTTTTA	0.458													33	153	---	---	---	---	PASS
SRRM4	84530	broad.mit.edu	37	12	119583429	119583429	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119583429C>A	uc001txa.1	+	9	1307	c.1015C>A	c.(1015-1017)CCC>ACC	p.P339T		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	339	Ser-rich.				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						CACCTCCTCACCCCAGAACAA	0.627													6	25	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32705840	32705840	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32705840G>T	uc001utx.2	+	8	1244	c.748G>T	c.(748-750)GAG>TAG	p.E250*	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	250					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ATTTATGGCGGAGCTAAAAGA	0.388													50	52	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36521584	36521584	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36521584A>G	uc001uvf.2	-	4	967	c.734T>C	c.(733-735)CTT>CCT	p.L245P		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	245	Doublecortin 2.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		AAAGTCCTGAAGGCACATCAC	0.443													13	59	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49084844	49084844	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49084844C>T	uc001vch.2	-	10	1218	c.847G>A	c.(847-849)GCC>ACC	p.A283T	RCBTB2_uc010tgg.1_Missense_Mutation_p.A288T|RCBTB2_uc001vci.2_Missense_Mutation_p.A259T|RCBTB2_uc010tgh.1_Intron|RCBTB2_uc001vcj.2_Intron|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_Intron	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	283	RCC1 5.						Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TAAGAATTGGCGCCCCAAGCA	0.473													4	141	---	---	---	---	PASS
TUBGCP3	10426	broad.mit.edu	37	13	113158371	113158371	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113158371C>A	uc001vse.1	-	19	2469	c.2282G>T	c.(2281-2283)CGC>CTC	p.R761L	TUBGCP3_uc010tjq.1_Missense_Mutation_p.R751L|TUBGCP3_uc001vsf.2_Missense_Mutation_p.R761L	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	761					G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CAGCAGGCAGCGGGAGATGAT	0.488													37	85	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19553558	19553558	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19553558G>A	uc001vuz.1	+	1	194	c.142G>A	c.(142-144)GAC>AAC	p.D48N	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	48										ovary(1)	1						CACTTCTGGAGACCACGACGA	0.602													18	503	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22321012	22321012	+	Intron	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22321012A>G	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wby.2_Intron|uc001wcb.2_Missense_Mutation_p.Q57R|uc001wcc.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TGGTATGTCCAGTCCCCCGGC	0.498													9	61	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63174229	63174229	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63174229A>T	uc001xfx.2	-	11	3015	c.2964T>A	c.(2962-2964)TTT>TTA	p.F988L	KCNH5_uc001xfy.2_3'UTR	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	988	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		atatatatTAAAAGTGGATTT	0.254													18	56	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68275998	68275998	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68275998G>T	uc001xka.2	-	4	421	c.282C>A	c.(280-282)CTC>CTA	p.L94L	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Silent_p.L94L|ZFYVE26_uc010tta.1_Silent_p.L94L	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	94					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AAACAACTGGGAGTAACTTCT	0.358													32	110	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73442325	73442325	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73442325C>T	uc001xnm.2	-	9	2380	c.1740G>A	c.(1738-1740)AAG>AAA	p.K580K	ZFYVE1_uc001xnl.2_Silent_p.K165K|ZFYVE1_uc010arj.2_Silent_p.K566K	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	580						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		AAGTCACAGCCTTGGTGGGTC	0.587													21	69	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73442367	73442367	+	Silent	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73442367G>A	uc001xnm.2	-	9	2338	c.1698C>T	c.(1696-1698)TTC>TTT	p.F566F	ZFYVE1_uc001xnl.2_Silent_p.F151F|ZFYVE1_uc010arj.2_Silent_p.F552F	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	566						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		ACTGAGCCATGAAGTTCATCC	0.557													17	71	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89181371	89181371	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89181371A>G	uc001xxg.2	-	10	1542	c.1356T>C	c.(1354-1356)AGT>AGC	p.S452S	EML5_uc001xxh.1_5'UTR	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	452	WD 9.					cytoplasm|microtubule				ovary(3)	3						GAGTGATGAAACTAAGGGATC	0.393													23	65	---	---	---	---	PASS
CCDC88C	440193	broad.mit.edu	37	14	91766287	91766287	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91766287G>A	uc010aty.2	-	21	3862	c.3763C>T	c.(3763-3765)CGG>TGG	p.R1255W		NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE	1255	Potential.				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				AGCTCGCCCCGCAGCCTCTGG	0.637													3	4	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92792310	92792310	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92792310T>A	uc001yak.2	+	2	202	c.178T>A	c.(178-180)TGC>AGC	p.C60S	SLC24A4_uc001yai.2_Missense_Mutation_p.C13S|SLC24A4_uc010twm.1_Missense_Mutation_p.C77S|SLC24A4_uc001yaj.2_Missense_Mutation_p.C60S	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	77	Extracellular (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGCCAAGAACTGCACAGATCC	0.502													13	33	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94067100	94067100	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94067100A>G	uc001ybv.1	+	22	3110	c.3027A>G	c.(3025-3027)GAA>GAG	p.E1009E	KIAA1409_uc001ybs.1_Silent_p.E1009E	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1186						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GTAACAAGGAATTTCCTTTTC	0.408													23	79	---	---	---	---	PASS
TCL6	27004	broad.mit.edu	37	14	96135927	96135927	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96135927A>T	uc001yeq.2	+	5	1700	c.231A>T	c.(229-231)AGA>AGT	p.R77S	TCL6_uc001yep.1_RNA|TCL6_uc001yes.2_3'UTR|TCL6_uc001yet.1_Missense_Mutation_p.R19S|TCL6_uc001yeu.2_3'UTR|TCL6_uc001yev.2_3'UTR|TCL1B_uc001yew.2_RNA|TCL1B_uc001yex.2_RNA|TCL1B_uc010avj.2_Intron|TCL6_uc010avk.1_5'Flank	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		attcaaggagaggggaccatg	0.005			T	TRA@	T-ALL								19	65	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96794853	96794853	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96794853C>A	uc001yfi.2	-	14	2359	c.1994G>T	c.(1993-1995)AGT>ATT	p.S665I		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	665										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGGAACTGAACTAAGTCTTGC	0.313													24	85	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106805485	106805485	+	RNA	SNP	C	T	T	rs113376532	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106805485C>T	uc010tyt.1	-	360		c.13723G>A			uc001ysw.1_5'Flank					Parts of antibodies, mostly variable regions.												0						GTCCTGGGCCCGACTCCTGCA	0.607													11	253	---	---	---	---	PASS
TMEM62	80021	broad.mit.edu	37	15	43427721	43427721	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43427721G>C	uc001zqr.2	+	3	583	c.304G>C	c.(304-306)GAT>CAT	p.D102H	TMEM62_uc010bda.2_5'UTR	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	102						integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		AGACCTGACAGATGCCAAAAC	0.408													22	26	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48058391	48058391	+	Intron	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058391T>A	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TAAGTATACTTTGTCACATGA	0.413													17	25	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63929830	63929830	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63929830G>A	uc002amp.2	-	64	12254	c.12106C>T	c.(12106-12108)CAG>TAG	p.Q4036*		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	4036	RCC1 8.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GTACAATTCTGACCACAAATG	0.358													4	4	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88679203	88679203	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88679203A>G	uc002bme.1	-	8	996	c.834T>C	c.(832-834)AAT>AAC	p.N278N	NTRK3_uc002bmh.2_Silent_p.N278N|NTRK3_uc002bmf.1_Silent_p.N278N|NTRK3_uc010upl.1_Silent_p.N180N|NTRK3_uc010bnh.1_Silent_p.N278N|NTRK3_uc002bmg.2_Silent_p.N278N	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	278	Ig-like C2-type 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGGTGAAGCCATTGTCCTCAC	0.478			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			29	136	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93470511	93470511	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93470511G>T	uc002bsp.2	+	4	907	c.332G>T	c.(331-333)CGG>CTG	p.R111L	CHD2_uc002bsm.1_Missense_Mutation_p.R111L|CHD2_uc002bsn.2_Missense_Mutation_p.R111L|CHD2_uc002bso.1_Missense_Mutation_p.R111L|CHD2_uc010urb.1_Missense_Mutation_p.R124L	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	111					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GGGGTCAGGCGGTCAAACCGA	0.373													12	78	---	---	---	---	PASS
RAB26	25837	broad.mit.edu	37	16	2203412	2203412	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2203412G>T	uc002cou.2	+	9	895	c.761G>T	c.(760-762)TGC>TTC	p.C254F	RAB26_uc010bsf.2_Missense_Mutation_p.C188F|TRAF7_uc002cow.2_5'Flank	NM_014353	NP_055168	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	254					exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding				0						GCCTCCTGCTGCCGCCCTTGA	0.627													3	53	---	---	---	---	PASS
UMOD	7369	broad.mit.edu	37	16	20348016	20348016	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20348016C>A	uc002dgz.2	-	9	1903	c.1774G>T	c.(1774-1776)GTC>TTC	p.V592F	UMOD_uc002dha.2_Missense_Mutation_p.V592F|UMOD_uc002dhb.2_Missense_Mutation_p.V625F	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	592					cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						TGATCTATGACACTCCCACTT	0.527													44	53	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20384235	20384235	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20384235A>C	uc002dhc.1	-	7	1030	c.807T>G	c.(805-807)ATT>ATG	p.I269M		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	269					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						GCAACTCGGAAATCAGATCCT	0.458													60	70	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20570768	20570768	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20570768G>T	uc002dhj.3	-	4	389	c.179C>A	c.(178-180)GCT>GAT	p.A60D	ACSM2B_uc002dhk.3_Missense_Mutation_p.A60D|ACSM2B_uc010bwf.1_Missense_Mutation_p.A60D	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	60					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						TCGCTTGCCAGCCTGAGGAAA	0.502													16	23	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30525157	30525157	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30525157A>T	uc002dyi.3	+	25	3028	c.2852A>T	c.(2851-2853)CAC>CTC	p.H951L	ITGAL_uc002dyj.3_Missense_Mutation_p.H867L|ITGAL_uc010vev.1_Missense_Mutation_p.H185L	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	951	Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	CAAGTCAAGCACATGTACCAG	0.502													17	75	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30525158	30525158	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30525158C>T	uc002dyi.3	+	25	3029	c.2853C>T	c.(2851-2853)CAC>CAT	p.H951H	ITGAL_uc002dyj.3_Silent_p.H867H|ITGAL_uc010vev.1_Silent_p.H185H	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	951	Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	AAGTCAAGCACATGTACCAGG	0.507													18	73	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61687975	61687975	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61687975C>A	uc002eog.1	-	12	2189	c.1937G>T	c.(1936-1938)CGG>CTG	p.R646L		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	646	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.R646Q(1)		ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATTTTTATGCCGCCGTAGAGT	0.393													40	197	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	62055227	62055227	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62055227A>T	uc002eog.1	-	2	333	c.81T>A	c.(79-81)ATT>ATA	p.I27I		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	27					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GAGCCATGTAAATGCAAGGGG	0.438													30	174	---	---	---	---	PASS
DYNLRB2	83657	broad.mit.edu	37	16	80577174	80577174	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80577174C>A	uc002ffo.2	+	4	125	c.5C>A	c.(4-6)GCA>GAA	p.A2E	DYNLRB2_uc002ffp.2_RNA|DYNLRB2_uc002ffq.2_RNA	NM_130897	NP_570967	Q8TF09	DLRB2_HUMAN	dynein, light chain, roadblock-type 2	2					microtubule-based movement|transport	cytoplasmic dynein complex|microtubule	microtubule motor activity				0						CTCTTTCAGGCAGAGGTGGAG	0.413													65	245	---	---	---	---	PASS
IRF8	3394	broad.mit.edu	37	16	85945236	85945236	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85945236G>T	uc002fjh.2	+	4	476	c.419G>T	c.(418-420)CGC>CTC	p.R140L	IRF8_uc010chp.2_RNA	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	140					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				GAGTGCGGTCGCTCTGAAATC	0.552													34	31	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10438456	10438456	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10438456A>G	uc010coi.2	-	19	2242	c.2114T>C	c.(2113-2115)CTG>CCG	p.L705P	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.L705P|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	705	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GATGCCTTCCAGCACACCGTT	0.453													81	65	---	---	---	---	PASS
UBB	7314	broad.mit.edu	37	17	16285604	16285604	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285604A>G	uc002gpx.2	+	2	521	c.383A>G	c.(382-384)GAT>GGT	p.D128G	UBB_uc010vwe.1_Intron	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	128	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		CAGCTGGAAGATGGCCGCACT	0.547													21	96	---	---	---	---	PASS
TNFRSF13B	23495	broad.mit.edu	37	17	16843026	16843026	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16843026C>T	uc002gqs.1	-	5	730	c.717G>A	c.(715-717)GCG>GCA	p.A239A	TNFRSF13B_uc010vwt.1_RNA|TNFRSF13B_uc002gqt.1_Silent_p.A193A	NM_012452	NP_036584	O14836	TR13B_HUMAN	tumor necrosis factor receptor 13B	239	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity			kidney(2)	2						CCTGCGTGGGCGCCCTGCACT	0.672									IgA_Deficiency_Selective				8	31	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33477133	33477133	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33477133G>A	uc002hja.2	+	4	369	c.272G>A	c.(271-273)GGG>GAG	p.G91E	UNC45B_uc002hjb.2_Missense_Mutation_p.G91E|UNC45B_uc002hjc.2_Missense_Mutation_p.G91E|UNC45B_uc010cto.2_Missense_Mutation_p.G91E	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	91	TPR 3.				cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GAGCACCTGGGGAAGCTGGAC	0.587													15	77	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42932010	42932010	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42932010C>T	uc002ihn.2	-	22	2434	c.2173G>A	c.(2173-2175)GAT>AAT	p.D725N	EFTUD2_uc010wje.1_Missense_Mutation_p.D690N|EFTUD2_uc010wjf.1_Missense_Mutation_p.D715N	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	725						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				GCCAGCAGATCCCAATCGTAC	0.567													65	105	---	---	---	---	PASS
CRHR1	1394	broad.mit.edu	37	17	43906642	43906642	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43906642C>T	uc010dap.2	+	5	654	c.389C>T	c.(388-390)TCC>TTC	p.S130F	CRHR1_uc010wjx.1_5'UTR|CRHR1_uc002ijp.2_Missense_Mutation_p.S29F|CRHR1_uc002ijm.2_Missense_Mutation_p.S130F|CRHR1_uc002ijn.2_Missense_Mutation_p.S90F|CRHR1_uc010dar.2_Missense_Mutation_p.S130F|CRHR1_uc010dao.2_Missense_Mutation_p.S29F|CRHR1_uc010daq.2_5'UTR|CRHR1_uc010das.1_RNA|CRHR1_uc002ijo.1_RNA	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	130	Helical; Name=1; (Potential).				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CACTGTATCTCCCTGGTGGCC	0.582													26	42	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44116482	44116482	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44116482G>A	uc002ikb.2	-	8	2388	c.2303C>T	c.(2302-2304)GCA>GTA	p.A768V	KIAA1267_uc002ikc.2_Missense_Mutation_p.A768V|KIAA1267_uc002ikd.2_Missense_Mutation_p.A768V|KIAA1267_uc010dav.2_Missense_Mutation_p.A768V|KIAA1267_uc010wkb.1_Missense_Mutation_p.A99V|KIAA1267_uc010wkc.1_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	768						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				CAAGCGCTCTGCTTTTGGCGC	0.587													38	168	---	---	---	---	PASS
HOXB5	3215	broad.mit.edu	37	17	46670559	46670559	+	Missense_Mutation	SNP	C	T	T	rs139139266	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46670559C>T	uc002inr.2	-	1	545	c.486G>A	c.(484-486)ATG>ATA	p.M162I	HOXB3_uc010wlm.1_5'Flank|HOXB3_uc010dbf.2_5'Flank|HOXB3_uc010dbg.2_5'Flank	NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5	162						nucleus	sequence-specific DNA binding				0						TGGAGGTGGCCATGGGCTCTG	0.597													21	81	---	---	---	---	PASS
IGF2BP1	10642	broad.mit.edu	37	17	47126782	47126782	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47126782C>A	uc002iom.2	+	15	2044	c.1710C>A	c.(1708-1710)AAC>AAA	p.N570K	IGF2BP1_uc010dbj.2_Missense_Mutation_p.N431K	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding	570	Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						GACAGAGTAACCAGGCCCAGG	0.597													4	43	---	---	---	---	PASS
CACNG4	27092	broad.mit.edu	37	17	65026669	65026669	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65026669A>G	uc002jft.1	+	4	548	c.533A>G	c.(532-534)CAT>CGT	p.H178R		NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4	178	Extracellular (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			AAAAAGAACCATTACAACTAC	0.458													53	123	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67081324	67081324	+	Splice_Site	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081324C>G	uc002jhw.1	-	32	4205	c.4030_splice	c.e32-1	p.V1344_splice		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TCAGTTCCACCTAAAAAAATA	0.448													6	24	---	---	---	---	PASS
TTYH2	94015	broad.mit.edu	37	17	72239531	72239531	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72239531G>T	uc002jkc.2	+	5	685	c.654G>T	c.(652-654)CTG>CTT	p.L218L	TTYH2_uc010wqw.1_Silent_p.L197L	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1	218	Helical; Name=3; (Potential).					chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						CCTACCTCCTGCTCTTTATCC	0.627													20	136	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78866598	78866598	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78866598G>A	uc002jyt.1	+	19	2976	c.2171G>A	c.(2170-2172)GGA>GAA	p.G724E	RPTOR_uc010wug.1_Missense_Mutation_p.G566E	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	724					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						AGCTCCTATGGAAACATCCGT	0.502													32	158	---	---	---	---	PASS
NPLOC4	55666	broad.mit.edu	37	17	79534552	79534552	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79534552T>C	uc002kat.3	-	15	1639	c.1457A>G	c.(1456-1458)CAT>CGT	p.H486R	NPLOC4_uc002kau.3_Missense_Mutation_p.H486R|NPLOC4_uc010wur.1_Missense_Mutation_p.H325R|NPLOC4_uc010dic.2_5'Flank|NPLOC4_uc002kas.2_Missense_Mutation_p.I10V	NM_017921	NP_060391	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4	486					cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GGCCAAGCTATGGAAGTCCTA	0.448													8	17	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2921625	2921625	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2921625G>A	uc002klo.2	-	18	2587	c.2348C>T	c.(2347-2349)CCA>CTA	p.P783L		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	783	C-LIP.				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GAACTTCTCTGGTTTCTTTTC	0.383													45	96	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28979337	28979337	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28979337A>G	uc002kwq.2	+	9	1243	c.1108A>G	c.(1108-1110)ACC>GCC	p.T370A	DSG4_uc002kwr.2_Missense_Mutation_p.T370A	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	370	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AATGCACCCAACCCCTGTGAG	0.418													46	314	---	---	---	---	PASS
NOL4	8715	broad.mit.edu	37	18	31599452	31599452	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31599452C>A	uc010dmi.2	-	6	1115	c.886G>T	c.(886-888)GGG>TGG	p.G296W	NOL4_uc010xbs.1_Missense_Mutation_p.G11W|NOL4_uc002kxr.3_Missense_Mutation_p.G132W|NOL4_uc010xbt.1_Missense_Mutation_p.G222W|NOL4_uc010dmh.2_Missense_Mutation_p.G222W|NOL4_uc010xbu.1_Missense_Mutation_p.G296W|NOL4_uc002kxt.3_Missense_Mutation_p.G296W|NOL4_uc010xbv.1_Missense_Mutation_p.G45W|NOL4_uc010xbw.1_Missense_Mutation_p.G182W	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	296						nucleolus	RNA binding			ovary(3)	3						TGCTCCAGCCCAGTTTTGCCA	0.498													19	50	---	---	---	---	PASS
TCEB3C	162699	broad.mit.edu	37	18	44554669	44554669	+	Silent	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44554669C>G	uc010xdb.1	-	1	1781	c.1545G>C	c.(1543-1545)GCG>GCC	p.A515A	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	515					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						TGTccgcgggcgccgcgtgcc	0.373													5	186	---	---	---	---	PASS
SKA1	220134	broad.mit.edu	37	18	47917482	47917482	+	Intron	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47917482A>G	uc002let.2	+						SKA1_uc002leu.2_Intron|SKA1_uc010xdl.1_Intron	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						TTAGCCATATACTTTTTTACA	0.269													10	28	---	---	---	---	PASS
NARS	4677	broad.mit.edu	37	18	55270146	55270146	+	Missense_Mutation	SNP	C	T	T	rs145472082		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55270146C>T	uc002lgs.2	-	12	1509	c.1281G>A	c.(1279-1281)ATG>ATA	p.M427I	NARS_uc002lgt.2_Missense_Mutation_p.M426I|NARS_uc010xea.1_Missense_Mutation_p.M178I	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	427					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)	TGGTGTCTGTCATCAGTCTCT	0.453													30	81	---	---	---	---	PASS
C19orf6	91304	broad.mit.edu	37	19	1014274	1014274	+	Missense_Mutation	SNP	C	A	A	rs145798599		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1014274C>A	uc002lqr.1	-	2	570	c.424G>T	c.(424-426)GTG>TTG	p.V142L	C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Missense_Mutation_p.V142L	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1	142						cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGTTCCACGGCCAGGCCC	0.642													23	35	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6984718	6984718	+	5'UTR	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6984718G>A	uc010xjk.1	-	4					EMR4P_uc010dve.1_RNA	NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						GTAACAATCCGGATGATCATA	0.383													4	33	---	---	---	---	PASS
PKN1	5585	broad.mit.edu	37	19	14574647	14574647	+	Silent	SNP	G	A	A	rs149310057	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14574647G>A	uc002myp.2	+	11	1671	c.1503G>A	c.(1501-1503)GCG>GCA	p.A501A	PKN1_uc002myq.2_Silent_p.A507A	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2	501					activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						CAGGGAAGGCGTTCCAGCGTG	0.667													19	50	---	---	---	---	PASS
CYP4F8	11283	broad.mit.edu	37	19	15734154	15734154	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15734154T>C	uc002nbi.2	+	9	951	c.887T>C	c.(886-888)TTG>TCG	p.L296S	CYP4F8_uc010xoj.1_Missense_Mutation_p.L108S	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	296					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						TCCAAGACTTTGGACTTTATT	0.532													47	44	---	---	---	---	PASS
CYP4F8	11283	broad.mit.edu	37	19	15734155	15734155	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15734155G>T	uc002nbi.2	+	9	952	c.888G>T	c.(886-888)TTG>TTT	p.L296F	CYP4F8_uc010xoj.1_Missense_Mutation_p.L108F	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	296					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						CCAAGACTTTGGACTTTATTG	0.532													48	43	---	---	---	---	PASS
C19orf44	84167	broad.mit.edu	37	19	16611923	16611923	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16611923G>A	uc002neh.1	+	2	393	c.320G>A	c.(319-321)CGG>CAG	p.R107Q	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.R107Q|C19orf44_uc002neg.2_Missense_Mutation_p.R107Q|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	107											0						ATCATGAATCGGAAGCTGCAG	0.572													4	171	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17298786	17298786	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17298786C>T	uc010eak.2	+	19	2772	c.2620C>T	c.(2620-2622)CGC>TGC	p.R874C	MYO9B_uc002nfi.2_Missense_Mutation_p.R874C|MYO9B_uc002nfj.1_Missense_Mutation_p.R874C	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	874	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						GCAGCAGCTGCGCTACACCGG	0.582													12	6	---	---	---	---	PASS
FAM125A	93343	broad.mit.edu	37	19	17534529	17534529	+	Silent	SNP	G	A	A	rs144389449	byFrequency	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17534529G>A	uc002ngo.1	+	6	594	c.561G>A	c.(559-561)GCG>GCA	p.A187A	FAM125A_uc002ngp.1_Silent_p.A95A|FAM125A_uc002ngq.1_Silent_p.A83A	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A	187					protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						AGCGGACAGCGTCAAGGCTGG	0.622													43	42	---	---	---	---	PASS
SLC27A1	376497	broad.mit.edu	37	19	17597360	17597360	+	Intron	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17597360C>T	uc002ngu.1	+						SLC27A1_uc002ngt.1_Intron|SLC27A1_uc010xpp.1_Intron	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						TCCCCTCCGTCCTCCCTCCCA	0.711													9	8	---	---	---	---	PASS
LRFN3	79414	broad.mit.edu	37	19	36431636	36431636	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36431636G>T	uc002oco.2	+	2	1761	c.1309G>T	c.(1309-1311)GGG>TGG	p.G437W		NM_024509	NP_078785	Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III	437	Extracellular (Potential).|Fibronectin type-III.				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GACTGAGCACGGGGCCACAGC	0.642													16	21	---	---	---	---	PASS
ZNF114	163071	broad.mit.edu	37	19	48783073	48783073	+	Intron	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48783073G>T	uc002pil.1	+						ZNF114_uc010elv.1_Intron|ZNF114_uc002pim.1_Intron|ZNF114_uc002pin.2_5'Flank	NM_153608	NP_705836	Q8NC26	ZN114_HUMAN	zinc finger protein 114						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		CAGGTAAGTTGGCAGCTCACC	0.577													6	43	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50764812	50764812	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50764812G>T	uc002prr.1	+	19	2429	c.2382G>T	c.(2380-2382)CAG>CAT	p.Q794H	MYH14_uc010enu.1_Missense_Mutation_p.Q835H|MYH14_uc002prq.1_Missense_Mutation_p.Q802H	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	794	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TCCTGGCCCAGCTGGAAGAGG	0.647													7	41	---	---	---	---	PASS
DPRX	503834	broad.mit.edu	37	19	54137819	54137819	+	Silent	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54137819C>A	uc002qcf.1	+	2	114	c.63C>A	c.(61-63)ACC>ACA	p.T21T		NM_001012728	NP_001012746	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	21	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		GGAAACGAACCATGTTCACTA	0.433													45	157	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54313978	54313978	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54313978A>G	uc002qch.3	-	3	1155	c.935T>C	c.(934-936)CTC>CCC	p.L312P	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.L312P|NLRP12_uc002qcj.3_Missense_Mutation_p.L312P|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.L312P	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	312	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTCCCAGCAGAGGCACCAGGG	0.572													38	49	---	---	---	---	PASS
ZIM3	114026	broad.mit.edu	37	19	57646678	57646678	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57646678C>A	uc002qnz.1	-	5	1413	c.1027G>T	c.(1027-1029)GCC>TCC	p.A343S		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	343	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGGGAAAAGGCCTTCTCACAT	0.403													51	283	---	---	---	---	PASS
ZNF329	79673	broad.mit.edu	37	19	58639467	58639467	+	Silent	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58639467G>T	uc002qrn.2	-	4	1641	c.1404C>A	c.(1402-1404)TCC>TCA	p.S468S	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	468	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TGGTCAGACAGGAGCTGTCCC	0.498													4	159	---	---	---	---	PASS
A1BG	1	broad.mit.edu	37	19	58858380	58858380	+	3'UTR	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58858380C>A	uc002qsd.3	-	8					NCRNA00181_uc002qse.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor							extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CCTGGGCCCGCGGCTGCATCA	0.617													20	33	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16254017	16254017	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16254017C>G	uc002wpg.1	-	26	3993	c.3835G>C	c.(3835-3837)GCA>CCA	p.A1279P	KIF16B_uc002wpe.1_Missense_Mutation_p.A631P|KIF16B_uc002wpf.1_Missense_Mutation_p.A620P|KIF16B_uc010gch.1_Missense_Mutation_p.A1228P	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1279	PX.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						GGAGATGTTGCGGACTGGAGC	0.383													39	88	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37356472	37356472	+	Silent	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37356472C>T	uc002xjc.2	+	2	1031	c.768C>T	c.(766-768)TTC>TTT	p.F256F		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	256	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTTGCGCCTTCCTTAAGAACC	0.582													12	55	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37356623	37356623	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37356623C>A	uc002xjc.2	+	2	1182	c.919C>A	c.(919-921)CCC>ACC	p.P307T		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	307	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CAAGAAGTTCCCCATCTCCAT	0.542													20	92	---	---	---	---	PASS
WFDC8	90199	broad.mit.edu	37	20	44181840	44181840	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44181840T>A	uc002xow.2	-	5	600	c.521A>T	c.(520-522)GAT>GTT	p.D174V	WFDC8_uc002xox.2_Missense_Mutation_p.D174V	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	174	WAP 2.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				CTGGGGACAATCGATGTCACT	0.468													56	142	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44684805	44684805	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44684805A>T	uc010zxl.1	+	22	2949	c.2873A>T	c.(2872-2874)GAT>GTT	p.D958V	SLC12A5_uc002xrb.2_Missense_Mutation_p.D935V	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	958	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGTATCACAGATGAGTCACGA	0.522													31	78	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55033756	55033756	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55033756G>A	uc002xxp.2	+	7	2539	c.2314G>A	c.(2314-2316)GAG>AAG	p.E772K	CASS4_uc002xxr.2_Missense_Mutation_p.E772K|CASS4_uc010zze.1_Missense_Mutation_p.E718K|CASS4_uc010gio.2_Missense_Mutation_p.E335K	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	772					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						GGCGGAGGCTGAGAAGCTGGA	0.622													9	37	---	---	---	---	PASS
SYCP2	10388	broad.mit.edu	37	20	58460972	58460972	+	Intron	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58460972A>T	uc002yaz.2	-							NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AGTTAAGTAAATAACACCTAC	0.284													24	59	---	---	---	---	PASS
PCMTD2	55251	broad.mit.edu	37	20	62899256	62899256	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62899256G>A	uc002yil.3	+	5	799	c.599G>A	c.(598-600)CGC>CAC	p.R200H	PCMTD2_uc002yim.3_Intron	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate)	200						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AAGATAACACGCACAGGTCCT	0.373													18	130	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10908867	10908867	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10908867G>T	uc002yip.1	-	23	1846	c.1478C>A	c.(1477-1479)TCA>TAA	p.S493*	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Nonsense_Mutation_p.S475*|TPTE_uc002yir.1_Nonsense_Mutation_p.S455*|TPTE_uc010gkv.1_Nonsense_Mutation_p.S355*	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	493	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GAAGTAAAATGAGCAATTGTC	0.289													9	104	---	---	---	---	PASS
CYYR1	116159	broad.mit.edu	37	21	27852619	27852619	+	Silent	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27852619A>T	uc002ymd.2	-	3	628	c.306T>A	c.(304-306)ACT>ACA	p.T102T	CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Silent_p.T102T	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor	102	Cytoplasmic (Potential).					integral to membrane					0						TGTTGATGTGAGTCGTCCTGA	0.502													35	126	---	---	---	---	PASS
IGSF5	150084	broad.mit.edu	37	21	41151188	41151188	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41151188G>T	uc002yyo.2	+	5	993	c.890G>T	c.(889-891)TGC>TTC	p.C297F		NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily 5 like	297	Cytoplasmic (Potential).|Cys-rich.					integral to membrane|tight junction					0		Prostate(19;5.35e-06)				tgttgtggctgcaactgctgc	0.274													3	6	---	---	---	---	PASS
SMTN	6525	broad.mit.edu	37	22	31487126	31487126	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31487126A>C	uc003ajl.1	+	10	1335	c.1117A>C	c.(1117-1119)ACC>CCC	p.T373P	SMTN_uc003ajk.1_Missense_Mutation_p.T373P|SMTN_uc003ajm.1_Missense_Mutation_p.T373P|SMTN_uc011ale.1_Missense_Mutation_p.T427P|SMTN_uc011alf.1_Missense_Mutation_p.T429P|SMTN_uc003ajn.1_Missense_Mutation_p.T365P|SMTN_uc011alg.1_5'UTR|SMTN_uc003ajo.1_5'Flank|SMTN_uc011alh.1_5'Flank|SMTN_uc010gwe.1_5'Flank	NM_006932	NP_008863	P53814	SMTN_HUMAN	smoothelin isoform c	373					muscle organ development|smooth muscle contraction	actin cytoskeleton|cytoplasm	actin binding|structural constituent of muscle			large_intestine(2)|pancreas(1)	3						CACCAGCACCACCCCTGCCTC	0.672													7	76	---	---	---	---	PASS
SREBF2	6721	broad.mit.edu	37	22	42290907	42290907	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42290907A>T	uc003bbi.2	+	13	2630	c.2461A>T	c.(2461-2463)AAG>TAG	p.K821*	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_RNA	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	821	Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						ACCTCAGGCCAAGAAGAAGGC	0.582													31	125	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21519702	21519702	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21519702C>T	uc004czx.1	+	8	842	c.806C>T	c.(805-807)ACT>ATT	p.T269I	CNKSR2_uc004czw.2_Missense_Mutation_p.T269I|CNKSR2_uc011mjn.1_Missense_Mutation_p.T269I|CNKSR2_uc011mjo.1_Missense_Mutation_p.T269I	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	269	PDZ.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AATCATCAGACTGTGGTATGT	0.328													11	27	---	---	---	---	PASS
MAGEB4	4115	broad.mit.edu	37	X	30261248	30261248	+	Silent	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30261248T>C	uc004dcb.2	+	1	1080	c.996T>C	c.(994-996)AGT>AGC	p.S332S	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	332										ovary(1)	1						CCATGACTAGTGCGTATTCCA	0.512													24	17	---	---	---	---	PASS
XK	7504	broad.mit.edu	37	X	37587107	37587107	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37587107A>T	uc004ddq.2	+	3	809	c.727A>T	c.(727-729)ATC>TTC	p.I243F		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	243	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				TATAATACTCATCAACTTCTT	0.502													45	23	---	---	---	---	PASS
UBQLN2	29978	broad.mit.edu	37	X	56591637	56591637	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56591637C>T	uc004dus.2	+	1	1566	c.1331C>T	c.(1330-1332)TCA>TTA	p.S444L	UBQLN2_uc011moq.1_Missense_Mutation_p.S444L	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	444						cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2						GACACACTATCAGCCATGTCA	0.537													11	36	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65486440	65486440	+	Missense_Mutation	SNP	C	G	G	rs73217443	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65486440C>G	uc011moz.1	+	21	3472	c.3412C>G	c.(3412-3414)CGA>GGA	p.R1138G	HEPH_uc004dwn.2_Missense_Mutation_p.R1137G|HEPH_uc004dwo.2_Missense_Mutation_p.R868G|HEPH_uc010nkr.2_Missense_Mutation_p.R946G|HEPH_uc011mpa.1_Missense_Mutation_p.R1138G	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	1135	Cytoplasmic (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						GTACCAACATCGACAGAGAAA	0.478													21	32	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	86069820	86069820	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86069820G>T	uc004eew.2	+	10	1837	c.1667G>T	c.(1666-1668)GGC>GTC	p.G556V	DACH2_uc004eex.2_Missense_Mutation_p.G543V|DACH2_uc010nmq.2_Missense_Mutation_p.G422V|DACH2_uc011mra.1_Missense_Mutation_p.G389V|DACH2_uc010nmr.2_Missense_Mutation_p.G337V|DACH2_uc004eey.2_Missense_Mutation_p.G249V|DACH2_uc004eez.2_Missense_Mutation_p.G239V	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	556					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						AGTGACAGTGGCCTGAGGATG	0.363													4	28	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101096717	101096717	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101096717C>A	uc011mrk.1	-	5	529	c.169G>T	c.(169-171)GTC>TTC	p.V57F	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	57	RRM.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						GCAACCTGGACAAAGAAGCAT	0.498													4	134	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110491210	110491210	+	Missense_Mutation	SNP	G	T	T	rs12851568		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110491210G>T	uc004epc.1	-	11	1663	c.1495C>A	c.(1495-1497)CTG>ATG	p.L499M	CAPN6_uc011msu.1_Missense_Mutation_p.L244M	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	499					microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						GGCATGTCCAGAGTCAGTTCC	0.428													68	111	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122757941	122757941	+	Silent	SNP	A	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122757941A>C	uc004etu.2	-	27	3320	c.3288T>G	c.(3286-3288)GTT>GTG	p.V1096V	THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_5'Flank	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1096					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						ATTTATGTACAACATGTCGAA	0.318													24	45	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128722987	128722987	+	Silent	SNP	A	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128722987A>G	uc004euq.2	+	22	2631	c.2466A>G	c.(2464-2466)CGA>CGG	p.R822R	OCRL_uc004eur.2_Silent_p.R814R|OCRL_uc010nrb.2_RNA	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	822	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						GGATCTGCCGACAGGTGGGTT	0.522													31	40	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140953296	140953296	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140953296C>T	uc011mwp.1	+	2	163	c.163C>T	c.(163-165)CAT>TAT	p.H55Y		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	55										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TTCTGCCTTTCATCTTGGGCA	0.512													31	37	---	---	---	---	PASS
TSPY2	64591	broad.mit.edu	37	Y	6115633	6115633	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6115633T>C	uc004fqr.1	+	3	641	c.595T>C	c.(595-597)TGC>CGC	p.C199R	TSPY2_uc004fqs.1_Missense_Mutation_p.C199R	NM_022573	NP_072095	A6NKD2	TSPY2_HUMAN	testis specific protein, Y-linked 2	199					cell differentiation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus					0						TGTTCATCTCTGCAAGATCAT	0.468													77	382	---	---	---	---	PASS
SRRM1	10250	broad.mit.edu	37	1	24973014	24973014	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24973014delA	uc001bjm.2	+						SRRM1_uc010oel.1_Intron|SRRM1_uc009vrh.1_Intron|SRRM1_uc009vri.1_5'Flank|SRRM1_uc010oem.1_5'Flank	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		actctgtctcaaaaaaaaaaa	0.129													13	8	---	---	---	---	
KIF2C	11004	broad.mit.edu	37	1	45222217	45222218	+	Intron	DEL	TT	-	-	rs67641740		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45222217_45222218delTT	uc001cmg.3	+						KIF2C_uc010olb.1_Intron|KIF2C_uc010olc.1_Intron|KIF2C_uc001cmh.3_Intron	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C						blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CTCTATCTGCtttttttttttt	0.287													4	2	---	---	---	---	
PRPF3	9129	broad.mit.edu	37	1	150315714	150315714	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150315714delA	uc001eum.3	+						PRPF3_uc009wlp.2_Intron|PRPF3_uc010pca.1_Intron|PRPF3_uc010pcb.1_Intron|PRPF3_uc009wlq.1_Intron	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog						nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		tgagagagagaaaaaaaaaaa	0.149													4	3	---	---	---	---	
SEMA6C	10500	broad.mit.edu	37	1	151110918	151110918	+	Intron	DEL	G	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151110918delG	uc001ewu.2	-						SEMA6C_uc001ewv.2_Intron|SEMA6C_uc001eww.2_Intron|SEMA6C_uc010pcq.1_Intron|SEMA6C_uc009wml.1_Intron	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor							integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGAACCTTTAGGGTCTTGGAG	0.597													14	14	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10795333	10795333	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10795333delA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		gattctgcccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
UXS1	80146	broad.mit.edu	37	2	106739753	106739753	+	Intron	DEL	G	-	-	rs11325302		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106739753delG	uc002tdm.2	-						UXS1_uc002tdl.2_Intron|UXS1_uc002tdn.2_Intron|UXS1_uc002tdo.2_Intron|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						TTTACTTACAGGGGAAAAAAA	0.348													5	3	---	---	---	---	
GALNT5	11227	broad.mit.edu	37	2	158165415	158165416	+	Intron	INS	-	T	T	rs140945706	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158165415_158165416insT	uc002tzg.2	+						GALNT5_uc010zci.1_Intron	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5						glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TTGACAAGTCCtttttttttta	0.307													4	2	---	---	---	---	
C2orf60	129450	broad.mit.edu	37	2	200800443	200800454	+	Intron	DEL	ACACACACACAC	-	-	rs10603476		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200800443_200800454delACACACACACAC	uc002uvi.3	-						C2orf60_uc002uvj.3_Intron|C2orf60_uc002uvk.3_Intron|C2orf60_uc010fss.2_Intron	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450						wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0						CCTGCTTTAAacacacacacacacacacacac	0.250													4	4	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4729949	4729950	+	Intron	INS	-	C	C	rs150466778	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4729949_4729950insC	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		CTATTAGCCTTACTCTGCAGTG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109648950	109648953	+	IGR	DEL	TCCC	-	-	rs113948167		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109648950_109648953delTCCC								FLJ25363 (434936 upstream) : None (None downstream)																							cttccctccttccctccttccttc	0.000													4	3	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	110137396	110137396	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110137396delA	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		cattttatgtaatggatggat	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7207130	7207131	+	IGR	INS	-	CCTT	CCTT	rs151227804	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7207130_7207131insCCTT								PAPD7 (449969 upstream) : ADCY2 (189212 downstream)																							CTTTttccttcccttccttcct	0.109													4	3	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45396488	45396489	+	Intron	INS	-	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45396488_45396489insT	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CATTTTATCTCTTTTTTTTTTT	0.287													1	10	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	50138026	50138027	+	3'UTR	INS	-	T	T			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50138026_50138027insT	uc003jon.3	+	27					PARP8_uc011cpz.1_3'UTR|PARP8_uc003joo.2_3'UTR|PARP8_uc003jop.2_3'UTR	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				TTGAATACTGATTTTTTTTCTT	0.252													3	5	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58287877	58287878	+	Intron	DEL	TG	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58287877_58287878delTG	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TAATTCTATCTGTTTTATATCA	0.267													4	6	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32521843	32521844	+	Intron	DEL	CT	-	-	rs67101368		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521843_32521844delCT	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AGAAGGCTACCTCCTGTAAGAA	0.356													6	3	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71142502	71142502	+	Intron	DEL	T	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71142502delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGCATGCAGAttttttttttt	0.169													7	4	---	---	---	---	
ATG9B	285973	broad.mit.edu	37	7	150719924	150719924	+	Intron	DEL	A	-	-	rs5888425		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150719924delA	uc011kvc.1	-						ATG9B_uc003wig.3_Intron	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		actctgtcttaaaaaaaaaaa	0.104													2	4	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25154317	25154318	+	Intron	DEL	TA	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25154317_25154318delTA	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xef.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		atgaggcaggtatatatatata	0.129													5	3	---	---	---	---	
GRHL2	79977	broad.mit.edu	37	8	102541660	102541661	+	Intron	INS	-	A	A	rs35705751		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102541660_102541661insA	uc010mbu.2	+						GRHL2_uc010mbt.1_Intron|GRHL2_uc011lhi.1_Intron	NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			gactccctctcaaaaaaaaaaa	0.188													5	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													7	7	---	---	---	---	
CNNM2	54805	broad.mit.edu	37	10	104704338	104704339	+	Intron	INS	-	GT	GT	rs148795286	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104704338_104704339insGT	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		tgtatcttttcgtgtgtgtgtg	0.000													3	3	---	---	---	---	
TDRD1	56165	broad.mit.edu	37	10	115962222	115962225	+	Intron	DEL	TTAC	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115962222_115962225delTTAC	uc001lbg.1	+						TDRD1_uc001lbf.2_Intron|TDRD1_uc001lbh.1_Intron|TDRD1_uc001lbi.1_Intron|TDRD1_uc010qsc.1_5'Flank|TDRD1_uc001lbj.2_5'Flank	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1						DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTTTTGAGAATTACTTCATCTTTT	0.314													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131905960	131905960	+	Intron	DEL	G	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131905960delG	uc010qus.1	-											Homo sapiens cDNA FLJ36799 fis, clone ADRGL2007357.																		TTTGCCTCCAGGGGGGGAAGG	0.532													116	61	---	---	---	---	
RIC8A	60626	broad.mit.edu	37	11	212501	212501	+	Frame_Shift_Del	DEL	T	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:212501delT	uc001log.2	+	6	1380	c.1055delT	c.(1054-1056)CTGfs	p.L352fs	RIC8A_uc001lof.2_Frame_Shift_Del_p.L352fs|RIC8A_uc001loh.2_Frame_Shift_Del_p.L345fs	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8	352						cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGGAAGTTCCTGAAGGCCCAG	0.587													26	12	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47768072	47768072	+	Intron	DEL	T	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47768072delT	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						TAAAAACGACttttttttttt	0.164													5	3	---	---	---	---	
KCNJ5	3762	broad.mit.edu	37	11	128786171	128786172	+	Intron	INS	-	GATGGATG	GATGGATG			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128786171_128786172insGATGGATG	uc001qet.2	+						KCNJ5_uc009zck.2_Intron|KCNJ5_uc001qew.2_Intron	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	atggatggatggatgaacagat	0.025													6	7	---	---	---	---	
ARNTL2	56938	broad.mit.edu	37	12	27572952	27572953	+	Intron	INS	-	CA	CA	rs142781412	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27572952_27572953insCA	uc001rht.1	+						ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Intron|ARNTL2_uc001rhv.1_Intron|uc001rhx.2_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear						circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					GTTTGCGCGTGcacacacacac	0.322													5	3	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66856976	66856979	+	Intron	DEL	AAAT	-	-	rs3830371		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66856976_66856979delAAAT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CATTTACTTAAAATAAAAGAAAAG	0.333													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19532388	19532389	+	IGR	INS	-	T	T	rs145833243	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532388_19532389insT								LOC284232 (86279 upstream) : LOC348021 (50010 downstream)																							TTTTGGGAGCCTTTTTTTTTTG	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22300133	22300135	+	IGR	DEL	CAC	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300133_22300135delCAC								FGF9 (21493 upstream) : None (None downstream)																							tcaccaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
FLT3	2322	broad.mit.edu	37	13	28635909	28635910	+	Intron	INS	-	A	A	rs79634806		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28635909_28635910insA	uc001urw.2	-						FLT3_uc010aao.2_Intron|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	ccctgactcacaaaaaaaaaaG	0.144			Mis|O		AML|ALL								20	10	---	---	---	---	
SLC25A21	89874	broad.mit.edu	37	14	37203617	37203618	+	Intron	INS	-	TA	TA	rs149858951	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37203617_37203618insTA	uc001wtz.1	-							NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		TTTTAGTGCTTTATATATAATT	0.297													5	3	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47669738	47669738	+	Intron	DEL	T	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47669738delT	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						ttttcttttcttttttttttt	0.274													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28950878	28950878	+	5'Flank	DEL	G	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28950878delG	uc001zce.1	+											DQ588687																		CCGGGGGCAAGGGTTCAGCTG	0.572													69	30	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53906143	53906144	+	Intron	INS	-	TTAT	TTAT	rs138717914	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53906143_53906144insTTAT	uc002acj.2	-							NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		CACCTAAAATCTTATTTATTTA	0.307													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84036	84053	+	IGR	DEL	GGGAGCCTGGAAGCACAC	-	-	rs3743872	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84036_84053delGGGAGCCTGGAAGCACAC								None (None upstream) : POLR3K (12947 downstream)																							CTTGTCTCTGGGGAGCCTGGAAGCACACGGGCTGGCTA	0.633													5	3	---	---	---	---	
VPS35	55737	broad.mit.edu	37	16	46714944	46714945	+	Intron	INS	-	AC	AC	rs148688318	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46714944_46714945insAC	uc002eef.3	-						VPS35_uc002eed.2_5'Flank|VPS35_uc002eee.2_Intron	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAAAAAACTATacacacacaca	0.223													6	3	---	---	---	---	
TERF2	7014	broad.mit.edu	37	16	69395141	69395142	+	Intron	INS	-	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69395141_69395142insA	uc002exd.2	-							NM_005652	NP_005643	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2						age-dependent telomere shortening|cell cycle|cellular senescence|negative regulation of telomere maintenance via semi-conservative replication|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of transcription, DNA-dependent|telomeric loop formation	Golgi apparatus|nuclear telomere cap complex|nucleoplasm	double-stranded telomeric DNA binding|protein C-terminus binding|protein homodimerization activity			lung(1)	1		Ovarian(137;0.101)				tctgaaaaaggaaaaaaaaaaa	0.153													5	3	---	---	---	---	
MLKL	197259	broad.mit.edu	37	16	74719238	74719239	+	Intron	INS	-	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74719238_74719239insA	uc002fdb.2	-						MLKL_uc002fdc.2_Intron	NM_152649	NP_689862	Q8NB16	MLKL_HUMAN	mixed lineage kinase domain-like isoform 1								ATP binding|protein binding|protein kinase activity			stomach(2)	2						ATCTTGGGATGAAAAAAAAAAA	0.406													6	3	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84034564	84034565	+	Intron	INS	-	GGTGGAG	GGTGGAG	rs144191894	by1000genomes	TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84034564_84034565insGGTGGAG	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						CAGTAAACCCTGGTGGAGGCAG	0.609													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255789	87255791	+	Intron	DEL	CAC	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255789_87255791delCAC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ccatcaccatcaccaccaccacc	0.000													9	4	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13612545	13612545	+	Intron	DEL	C	-	-	rs11311417		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13612545delC	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_5'UTR|C18orf1_uc002ksf.2_5'UTR|C18orf1_uc002ksg.1_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CAGAAACACACCCCCCCCCCC	0.597													6	3	---	---	---	---	
SAFB2	9667	broad.mit.edu	37	19	5622489	5622490	+	Intron	INS	-	G	G			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5622489_5622490insG	uc002mcd.2	-						SAFB_uc010xiq.1_5'Flank|SAFB_uc002mcf.2_5'Flank|SAFB_uc002mcg.2_5'Flank|SAFB_uc002mce.3_5'Flank|SAFB_uc010xir.1_5'Flank|SAFB_uc010xis.1_5'Flank|SAFB_uc010xit.1_5'Flank|SAFB_uc010xiu.1_5'Flank|SAFB2_uc010xio.1_Intron|SAFB2_uc010xip.1_Intron	NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CAGGTGCAGGCGGGGGCGTGCC	0.767													3	4	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17294680	17294680	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17294680delA	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						TTCCAAAGGTAAAAAAAAAAA	0.413													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37784719	37784720	+	IGR	DEL	AC	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37784719_37784720delAC								ZNF383 (50145 upstream) : HKR1 (19019 downstream)																							acacacacagacacacacacag	0.054													3	3	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49964835	49964836	+	Intron	INS	-	A	A			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964835_49964836insA	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		ggaggggctgggcctggactcc	0.312													4	2	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243447	20243449	+	Intron	DEL	TGT	-	-	rs142947975		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243447_20243449delTGT	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CCTGTTTTTGTGTTTTTTTTTTT	0.232													6	4	---	---	---	---	
HMGB3L1	128872	broad.mit.edu	37	20	33421797	33421797	+	RNA	DEL	T	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33421797delT	uc002xax.2	-	1		c.469delA				NR_002165				Homo sapiens high-mobility group (nonhistone chromosomal) protein 4-like, mRNA (cDNA clone IMAGE:40002762).												0						TCTCTCTCTCttttttttttt	0.214													3	3	---	---	---	---	
LAMA5	3911	broad.mit.edu	37	20	60904422	60904426	+	Intron	DEL	CAGCC	-	-	rs3065756		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60904422_60904426delCAGCC	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGGCAGCAGcagcccagcccagcc	0.600													7	4	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666582	45666582	+	Intron	DEL	C	-	-	rs72021582		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666582delC	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GTGCCTAAGACCCCCCCCCCG	0.672													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839640	45839641	+	Intron	INS	-	GTG	GTG	rs140387137		TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839640_45839641insGTG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						tgatgatggcagtggtggtggt	0.000													4	2	---	---	---	---	
BCR	613	broad.mit.edu	37	22	23603806	23603806	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23603806delA	uc002zww.2	+						BCR_uc002zwx.2_Intron|BCR_uc011aiy.1_Intron|BCR_uc010gtx.1_Intron|uc010gty.2_5'Flank	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						tttagtagagacagggttttg	0.134			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								10	19	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													5	4	---	---	---	---	
CXorf56	63932	broad.mit.edu	37	X	118694020	118694020	+	Intron	DEL	A	-	-			TCGA-60-2726-01A-01D-1522-08	TCGA-60-2726-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118694020delA	uc004erk.1	-						CXorf56_uc004erj.1_Intron|CXorf56_uc011mtu.1_Intron	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN	hypothetical protein LOC63932								protein binding				0						catctcaattaaaaaaaaaaa	0.154													5	3	---	---	---	---	
