Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CLCN6	1185	broad.mit.edu	37	1	11882784	11882784	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11882784G>T	uc001ate.3	+	6	492	c.379G>T	c.(379-381)GCT>TCT	p.A127S	CLCN6_uc009vnf.1_Missense_Mutation_p.A127S|CLCN6_uc009vng.1_Missense_Mutation_p.A127S|CLCN6_uc009vnh.1_Missense_Mutation_p.A127S|CLCN6_uc010oat.1_5'UTR|CLCN6_uc010oau.1_Missense_Mutation_p.A105S	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	127					cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCTGCCTCGCTCTGTCTCT	0.542													41	100	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12402955	12402955	+	Splice_Site	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12402955G>A	uc001atv.2	+	42	8874	c.8733_splice	c.e42-1	p.R2911_splice	VPS13D_uc001atw.2_Splice_Site_p.R2886_splice|VPS13D_uc001atx.2_Splice_Site_p.R2098_splice	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTTGGTTCCAGAGCTGCACTC	0.507													18	38	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14142933	14142933	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14142933G>A	uc001avi.2	+	9	5904	c.5048G>A	c.(5047-5049)CGC>CAC	p.R1683H	PRDM2_uc001avg.2_Missense_Mutation_p.A175T|PRDM2_uc009voe.2_RNA|PRDM2_uc009vof.2_RNA	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	1683						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TACAGCCTCCGCTTGGCGTCC	0.597													23	97	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27875979	27875979	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27875979C>T	uc009vsy.2	-	6	3617	c.2648G>A	c.(2647-2649)CGG>CAG	p.R883Q	AHDC1_uc009vsz.1_Missense_Mutation_p.R883Q	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	883							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGCCAGGCCCCGCTGGGCAGG	0.692													13	31	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36205130	36205130	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36205130C>G	uc001bzi.2	-	19	3224	c.3144G>C	c.(3142-3144)ATG>ATC	p.M1048I	CLSPN_uc009vux.2_Missense_Mutation_p.M984I	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	1048					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCCTCAACCTCCTAGAAAGCA	0.383													60	185	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43889965	43889965	+	5'UTR	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43889965C>G	uc001cjk.1	+	2					KIAA0467_uc009vws.1_Nonsense_Mutation_p.S778*	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCCTTGGTGTCAGGCCGCTCA	0.612													23	53	---	---	---	---	PASS
GPBP1L1	60313	broad.mit.edu	37	1	46093979	46093979	+	Silent	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46093979T>A	uc001coq.2	-	13	2735	c.1374A>T	c.(1372-1374)TCA>TCT	p.S458S	GPBP1L1_uc001coo.2_Silent_p.S202S	NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	458					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TTTCGGTGTCTGAGTCCTCAA	0.458													113	289	---	---	---	---	PASS
TAL1	6886	broad.mit.edu	37	1	47691494	47691494	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47691494C>A	uc001cqx.2	-	2	644	c.67G>T	c.(67-69)GAG>TAG	p.E23*	TAL1_uc009vyq.2_5'Flank|TAL1_uc001cqy.2_Nonsense_Mutation_p.E23*|TAL1_uc001cra.1_Intron|TAL1_uc001cqz.1_Intron	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	23					basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						ATGCTGGCCTCGGCCGCGTCC	0.701			T	TRD@|SIL	lymphoblastic leukemia/biphasic								7	32	---	---	---	---	PASS
DIO1	1733	broad.mit.edu	37	1	54371967	54371967	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54371967G>A	uc010onx.1	+	4	704	c.681G>A	c.(679-681)AAG>AAA	p.K227K	DIO1_uc010onw.1_Silent_p.K163K|DIO1_uc009vzl.2_Intron|DIO1_uc001cwb.2_Silent_p.K179K|DIO1_uc010ony.1_Intron|DIO1_uc001cwd.2_RNA|DIO1_uc001cwe.2_RNA|DIO1_uc001cwf.2_RNA|DIO1_uc001cwg.2_Intron	NM_000792	NP_000783	P49895	IOD1_HUMAN	deiodinase, iodothyronine, type I isoform a	227					hormone biosynthetic process|thyroid hormone generation	endoplasmic reticulum membrane|integral to membrane|plasma membrane	selenium binding|thyroxine 5'-deiodinase activity				0						TCCTCTACAAGGTGGTGACCT	0.418													5	23	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	57476433	57476433	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57476433C>T	uc001cys.1	-	16	2277	c.1603G>A	c.(1603-1605)GAT>AAT	p.D535N	DAB1_uc001cyt.1_Missense_Mutation_p.D533N|DAB1_uc001cyq.1_Missense_Mutation_p.D533N|DAB1_uc001cyr.1_Missense_Mutation_p.D449N|DAB1_uc009vzw.1_Missense_Mutation_p.D517N|DAB1_uc009vzx.1_Missense_Mutation_p.D535N	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	568					cell differentiation|nervous system development					skin(2)|ovary(1)	3						CCAAATGGATCACTGTTGGAT	0.438													70	122	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62288639	62288639	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62288639G>T	uc001dab.2	+	15	1820	c.1706G>T	c.(1705-1707)AGG>ATG	p.R569M	INADL_uc009waf.1_Missense_Mutation_p.R569M|INADL_uc001daa.2_Missense_Mutation_p.R569M|INADL_uc001dad.3_Missense_Mutation_p.R266M|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	569	PDZ 4.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						CACACTCTGAGGCTTGGTGTG	0.438													82	233	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66067114	66067114	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66067114G>T	uc001dci.2	+	9	1236	c.1034G>T	c.(1033-1035)GGG>GTG	p.G345V	LEPR_uc001dcg.2_Missense_Mutation_p.G345V|LEPR_uc001dch.2_Missense_Mutation_p.G345V|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Missense_Mutation_p.G345V|LEPR_uc001dck.2_Missense_Mutation_p.G345V	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	345	Extracellular (Potential).|Ig-like.				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ACAAGTGTTGGGTCTAATGTT	0.343													38	128	---	---	---	---	PASS
FPGT	8790	broad.mit.edu	37	1	74670301	74670301	+	Silent	SNP	T	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74670301T>G	uc001dgb.1	+	4	607	c.570T>G	c.(568-570)GCT>GCG	p.A190A	TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Intron|FPGT_uc010oqu.1_Intron|FPGT_uc010oqv.1_Intron	NM_003838	NP_003829	O14772	FPGT_HUMAN	fucose-1-phosphate guanyltransferase	190					fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding			skin(1)	1						GCTTTACTGCTTTAGCTCATC	0.353													54	192	---	---	---	---	PASS
IFI44	10561	broad.mit.edu	37	1	79116279	79116279	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79116279T>C	uc001dip.3	+	2	523	c.399T>C	c.(397-399)CTT>CTC	p.L133L	IFI44_uc010orr.1_Silent_p.L133L|IFI44_uc010ors.1_Intron	NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN	interferon-induced, hepatitis C-associated	133					response to virus	cytoplasm				ovary(1)|central_nervous_system(1)	2						TGGAAAATCTTGGACTTGCTC	0.333													49	135	---	---	---	---	PASS
CDC7	8317	broad.mit.edu	37	1	91985764	91985764	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91985764G>A	uc001doe.2	+	11	1423	c.1258G>A	c.(1258-1260)GAT>AAT	p.D420N	CDC7_uc001dof.2_Missense_Mutation_p.D420N|CDC7_uc010osw.1_Missense_Mutation_p.D392N|CDC7_uc009wdc.2_Missense_Mutation_p.D420N|CDC7_uc009wdd.2_Intron	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7	420	Protein kinase.				cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		AGCAAGTGATGATTTAACTGC	0.353													46	107	---	---	---	---	PASS
PHTF1	10745	broad.mit.edu	37	1	114246795	114246795	+	Intron	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114246795G>T	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc001edm.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGTCTCTGTGGAGTGAGACAC	0.423													13	44	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117576660	117576660	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117576660G>C	uc010oxb.1	+	9	3061	c.3003G>C	c.(3001-3003)TTG>TTC	p.L1001F	CD101_uc009whd.2_Missense_Mutation_p.L1001F|CD101_uc010oxc.1_Missense_Mutation_p.L1001F|CD101_uc010oxd.1_Missense_Mutation_p.L939F	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	1001	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GGGTGGACTTGAAAGAGGCTG	0.493													40	117	---	---	---	---	PASS
REG4	83998	broad.mit.edu	37	1	120351402	120351402	+	5'UTR	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120351402A>T	uc001eig.2	-	3					REG4_uc001eif.2_5'UTR|REG4_uc001eih.1_5'UTR	NM_001159352	NP_001152824	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4							extracellular region	sugar binding			ovary(1)	1	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		TCTTCCTCCTACCCTGAGGAT	0.512											OREG0013729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	36	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151107754	151107754	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151107754G>A	uc001ewu.2	-	15	1765	c.1465C>T	c.(1465-1467)CGA>TGA	p.R489*	SEMA6C_uc001ewv.2_Nonsense_Mutation_p.R489*|SEMA6C_uc001eww.2_Nonsense_Mutation_p.R449*|SEMA6C_uc010pcq.1_Nonsense_Mutation_p.R489*	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	489	Extracellular (Potential).|Sema.					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATGATCCGTCGTGCTGTTTGG	0.562													52	100	---	---	---	---	PASS
RAB13	5872	broad.mit.edu	37	1	153955688	153955688	+	Intron	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153955688T>C	uc001fdt.1	-						RAB13_uc001fdu.1_3'UTR	NM_002870	NP_002861	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cell adhesion|protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	cytoplasmic vesicle membrane|tight junction	GTP binding|GTPase activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTTTGGAGGGTCCTCACCTCC	0.393													130	337	---	---	---	---	PASS
FLAD1	80308	broad.mit.edu	37	1	154961012	154961012	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154961012G>A	uc001fgf.1	+	2	1158	c.804G>A	c.(802-804)ATG>ATA	p.M268I	FLAD1_uc001fgc.2_Missense_Mutation_p.M169I|FLAD1_uc001fgd.1_Missense_Mutation_p.M268I|FLAD1_uc001fge.1_Missense_Mutation_p.M171I|FLAD1_uc001fgg.1_Missense_Mutation_p.M171I|FLAD1_uc001fgh.1_Missense_Mutation_p.M1I	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform	268					FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TGGAGGGGATGAAGGGACTAT	0.567													29	44	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157803066	157803066	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157803066C>A	uc001frk.3	-	5	1098	c.955G>T	c.(955-957)GAG>TAG	p.E319*		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	319	SRCR 3.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AGGGACTGCTCCTCCCCTGAG	0.582													46	116	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158390312	158390312	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158390312C>T	uc010pii.1	-	1	345	c.345G>A	c.(343-345)CTG>CTA	p.L115L		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					CCATGACTGCCAGCAGAAAGG	0.512													50	168	---	---	---	---	PASS
IGSF8	93185	broad.mit.edu	37	1	160063105	160063105	+	Silent	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160063105C>G	uc001fva.2	-	4	966	c.921G>C	c.(919-921)GTG>GTC	p.V307V	IGSF8_uc001fuz.2_Silent_p.V307V|IGSF8_uc009wtf.2_Silent_p.V307V	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	307	Ig-like C2-type 3.|Extracellular (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GCCCCACTGTCACTGCCAGCT	0.612													17	44	---	---	---	---	PASS
ITLN1	55600	broad.mit.edu	37	1	160849215	160849215	+	Intron	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160849215G>A	uc001fxc.2	-							NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor						positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTGAAAACAAGAGGCAGAAAA	0.498													35	68	---	---	---	---	PASS
RC3H1	149041	broad.mit.edu	37	1	173931144	173931144	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173931144G>A	uc001gju.3	-	11	2008	c.1921C>T	c.(1921-1923)CAT>TAT	p.H641Y	RC3H1_uc010pms.1_Missense_Mutation_p.H641Y|RC3H1_uc001gjv.2_Missense_Mutation_p.H641Y|RC3H1_uc010pmt.1_Missense_Mutation_p.H641Y	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin	641	Pro-rich.				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GGTGGATAATGATCCAAGTAG	0.502													37	108	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177226393	177226393	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177226393G>T	uc001glf.2	+	4	854	c.542G>T	c.(541-543)GGG>GTG	p.G181V	FAM5B_uc010pna.1_5'UTR|FAM5B_uc001glg.2_Missense_Mutation_p.G76V	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	181						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						TCTATAATCGGGGGCAGTGGG	0.557													14	55	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178252763	178252763	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178252763G>C	uc001glq.2	+	2	1031	c.267G>C	c.(265-267)ACG>ACC	p.T89T	RASAL2_uc009wxb.2_Silent_p.T89T	NM_170692	NP_733793	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 2	Error:Variant_position_missing_in_Q9UJF2_after_alignment					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						AGACAACAACGTGGGAGCGGA	0.463													83	198	---	---	---	---	PASS
SLC26A9	115019	broad.mit.edu	37	1	205904814	205904814	+	Intron	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205904814G>A	uc001hdq.2	-						SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			CTGGGCTCTGGACCAGTTACC	0.537													49	162	---	---	---	---	PASS
LPGAT1	9926	broad.mit.edu	37	1	211952357	211952357	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211952357T>A	uc001hiu.2	-	6	1570	c.757A>T	c.(757-759)ATA>TTA	p.I253L	LPGAT1_uc001hiv.2_Missense_Mutation_p.I253L	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	253					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		GTTGTATCTATTATCCACTGG	0.338													93	253	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212583816	212583816	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212583816G>A	uc001hjc.3	-	2	252	c.84C>T	c.(82-84)GAC>GAT	p.D28D	TMEM206_uc010pte.1_Silent_p.D89D	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206	28	Cytoplasmic (Potential).					integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TGTCCTGCTCGTCTGCCAGCT	0.542													149	400	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215793754	215793754	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215793754G>T	uc001hks.2	+	18	2536	c.2242G>T	c.(2242-2244)GAA>TAA	p.E748*	KCTD3_uc001hkt.2_Nonsense_Mutation_p.E746*|KCTD3_uc010pub.1_Nonsense_Mutation_p.E646*|KCTD3_uc009xdn.2_Nonsense_Mutation_p.E472*	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	748						voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AGATGAAAATGAAAATAAAAT	0.368													43	115	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215847890	215847890	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215847890T>C	uc001hku.1	-	63	13750	c.13363A>G	c.(13363-13365)ACA>GCA	p.T4455A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4455	Fibronectin type-III 30.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCTGAGCCTGTGACTTGCAAT	0.468										HNSCC(13;0.011)			54	167	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222800953	222800953	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222800953G>A	uc001hnl.2	+	4	400	c.391G>A	c.(391-393)GAT>AAT	p.D131N	MIA3_uc009xea.1_5'UTR	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	131	Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		AGGAAGAGATGATTTTCATAA	0.348													94	320	---	---	---	---	PASS
ITPKB	3707	broad.mit.edu	37	1	226923839	226923839	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226923839C>T	uc010pvo.1	-	2	1661	c.1321G>A	c.(1321-1323)GAC>AAC	p.D441N	ITPKB_uc001hqh.2_Missense_Mutation_p.D441N	NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B	441							ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				TCCACTCTGTCGGAGAGCTGC	0.711													9	30	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370892	240370892	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370892C>A	uc010pyd.1	+	5	3005	c.2780C>A	c.(2779-2781)CCC>CAC	p.P927H	FMN2_uc010pye.1_Missense_Mutation_p.P931H	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	927	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCGCCTCTACCCGGAGCAGGC	0.677													23	78	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11751043	11751043	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11751043C>T	uc002rbk.1	+	18	3196	c.2896C>T	c.(2896-2898)CGG>TGG	p.R966W	GREB1_uc002rbo.1_Missense_Mutation_p.R600W|GREB1_uc002rbp.1_5'Flank	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	966						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGCCTATGAGCGGCTGGCCCA	0.677													16	33	---	---	---	---	PASS
VSNL1	7447	broad.mit.edu	37	2	17830666	17830666	+	Intron	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17830666C>G	uc002rcm.2	+							NM_003385	NP_003376	P62760	VISL1_HUMAN	visinin-like 1								calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGCGCGTGTTCTCCTTTGCAG	0.577													30	117	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24524030	24524030	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24524030T>A	uc002rfe.2	-	11	1332	c.1074A>T	c.(1072-1074)AAA>AAT	p.K358N	ITSN2_uc002rff.2_Missense_Mutation_p.K358N|ITSN2_uc002rfg.2_Missense_Mutation_p.K358N|ITSN2_uc010eyd.2_Missense_Mutation_p.K383N	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	358					endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACCTGGTAATTTCTTCTGAG	0.289													44	141	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27803210	27803210	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27803210T>C	uc002rkz.3	+	1	3822	c.3771T>C	c.(3769-3771)ACT>ACC	p.T1257T	ZNF512_uc010ylv.1_5'Flank|ZNF512_uc010ylw.1_5'Flank|ZNF512_uc002rlb.2_5'Flank|ZNF512_uc010ylx.1_5'Flank|ZNF512_uc002rlc.2_5'Flank|ZNF512_uc002rla.2_5'Flank|ZNF512_uc010yly.1_5'Flank|ZNF512_uc010ylz.1_5'Flank	NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1257										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					ATGAATTCACTCAAGTTCACA	0.448													71	184	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31588976	31588976	+	Splice_Site	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31588976C>G	uc002rnv.1	-	22	2402	c.2323_splice	c.e22-1	p.S775_splice		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CAACAAAGCTCTGTGAGTGAA	0.493													47	142	---	---	---	---	PASS
EFEMP1	2202	broad.mit.edu	37	2	56102098	56102098	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56102098C>G	uc002rzh.2	-	8	1313	c.983G>C	c.(982-984)AGA>ACA	p.R328T	EFEMP1_uc002rzi.2_Missense_Mutation_p.R328T|EFEMP1_uc002rzj.2_Missense_Mutation_p.R328T|EFEMP1_uc010ypc.1_Missense_Mutation_p.R190T	NM_004105	NP_004096	Q12805	FBLN3_HUMAN	EGF-containing fibulin-like extracellular matrix	328	EGF-like 5; calcium-binding (Potential).|Mediates interaction with TIMP3.				negative regulation of chondrocyte differentiation|peptidyl-tyrosine phosphorylation|regulation of transcription, DNA-dependent|visual perception	extracellular space|proteinaceous extracellular matrix	calcium ion binding|epidermal growth factor receptor activity|epidermal growth factor receptor binding|growth factor activity			ovary(4)|pancreas(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGTTCTACTTCTCACCACTTG	0.378													40	104	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60688727	60688727	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60688727G>A	uc002sae.1	-	4	1548	c.1320C>T	c.(1318-1320)GAC>GAT	p.D440D	BCL11A_uc002sab.2_Silent_p.D440D|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Silent_p.D109D|BCL11A_uc010ypj.1_Silent_p.D406D|BCL11A_uc002sad.1_Silent_p.D288D|BCL11A_uc002saf.1_Silent_p.D406D	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	440					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGGAGAGACCGTCGTCGGACT	0.647			T	IGH@	B-CLL								31	62	---	---	---	---	PASS
TMEM17	200728	broad.mit.edu	37	2	62728573	62728573	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62728573G>T	uc002sbt.2	-	4	708	c.368C>A	c.(367-369)CCT>CAT	p.P123H	TMEM17_uc002sbu.2_3'UTR|TMEM17_uc002sbv.1_3'UTR	NM_198276	NP_938017	Q86X19	TMM17_HUMAN	transmembrane protein 17	123	Helical; (Potential).					integral to membrane					0	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			AAGAATTAAAGGTAACTGCAA	0.373													42	105	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86357867	86357867	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86357867A>G	uc002sqw.2	+						PTCD3_uc002sqx.1_Intron	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1						GATGGCATGTATAGAAATCAC	0.393													70	115	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88478390	88478390	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88478390G>A	uc002ssz.3	+	5	813	c.660G>A	c.(658-660)CTG>CTA	p.L220L	THNSL2_uc002ssv.2_RNA|THNSL2_uc002ssw.3_Silent_p.L220L|THNSL2_uc002ssx.3_Silent_p.L188L|THNSL2_uc002sta.3_Silent_p.L62L|THNSL2_uc002ssy.3_Silent_p.L220L|THNSL2_uc010fhe.2_Silent_p.L62L	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	220					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						TGATGAGCCTGAATTCGATCA	0.547													123	277	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90249305	90249305	+	RNA	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90249305T>A	uc010fhm.2	+	28		c.3848T>A								Parts of antibodies, mostly variable regions.																		TCAGCGGCAGTGGATCTGGGA	0.468													97	234	---	---	---	---	PASS
LOC285033	285033	broad.mit.edu	37	2	96906104	96906104	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96906104G>A	uc002svp.1	+	1	128	c.43G>A	c.(43-45)GTG>ATG	p.V15M	LOC285033_uc002svn.2_RNA|LOC285033_uc002svo.2_Intron	NM_001037228	NP_001032305	Q3KRF4	Q3KRF4_HUMAN	hypothetical protein LOC285033	15											0						TCCTCAGTATGTGAGACTGTT	0.393													27	74	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520132	131520132	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520132C>T	uc002trw.2	+	2	677	c.487C>T	c.(487-489)CTA>TTA	p.L163L	FAM123C_uc010fmv.2_Silent_p.L163L|FAM123C_uc010fms.1_Silent_p.L163L|FAM123C_uc010fmt.1_Silent_p.L163L|FAM123C_uc010fmu.1_Silent_p.L163L	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	163										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CTTTCGGAACCTATTCCACAT	0.617													25	94	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132290430	132290430	+	Intron	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132290430C>A	uc002tta.2	+						CCDC74A_uc002ttb.2_Intron	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A											skin(1)	1						CTGCCCCTGCCTTTCAGCTGC	0.687													18	60	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152483674	152483674	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152483674C>A	uc010fnx.2	-	66	9651	c.9460G>T	c.(9460-9462)GTC>TTC	p.V3154F		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3154	Nebulin 86.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCAATGGGGACCCAGCCAATG	0.443													18	59	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165952021	165952021	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165952021C>G	uc002ucx.2	-	25	4923	c.4431G>C	c.(4429-4431)AAG>AAC	p.K1477N	SCN3A_uc010zcy.1_5'Flank|SCN3A_uc002ucy.2_Missense_Mutation_p.K1428N|SCN3A_uc002ucz.2_Missense_Mutation_p.K1428N	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1477						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	GAATACTTATCTTCTTTTTCT	0.338													40	89	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167266365	167266365	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167266365T>C	uc002udu.1	-	24	3919	c.3792A>G	c.(3790-3792)CAA>CAG	p.Q1264Q		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1264	Helical; Name=S1 of repeat IV; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TGGCTATTGCTTGGAAACATA	0.358													4	21	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168097228	168097228	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168097228C>G	uc002udx.2	+	6	1042	c.1024C>G	c.(1024-1026)CAA>GAA	p.Q342E	XIRP2_uc010fpn.2_Missense_Mutation_p.Q375E|XIRP2_uc010fpo.2_Missense_Mutation_p.Q342E|XIRP2_uc010fpp.2_Missense_Mutation_p.Q342E|XIRP2_uc002udy.2_Missense_Mutation_p.Q167E|XIRP2_uc010fpq.2_Missense_Mutation_p.Q120E|XIRP2_uc010fpr.2_Missense_Mutation_p.Q120E	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	167					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TCAGTTTCATCAATATGTTCA	0.338													37	142	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168103057	168103057	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168103057A>T	uc002udx.2	+	8	5173	c.5155A>T	c.(5155-5157)AAT>TAT	p.N1719Y	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.N1544Y|XIRP2_uc010fpq.2_Missense_Mutation_p.N1497Y|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1544					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TACCATTCATAATTTATTGTC	0.348													39	101	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179515497	179515497	+	Silent	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179515497C>G	uc010zfg.1	-	163	32612	c.32388G>C	c.(32386-32388)GCG>GCC	p.A10796A	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_RNA|TTN_uc002umx.1_5'UTR	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11723							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGAGACTCCGCTCTTTCTG	0.418													10	24	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179616708	179616708	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179616708T>C	uc002unb.2	-	46	10643	c.10419A>G	c.(10417-10419)TCA>TCG	p.S3473S	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCAGAATCTGAAAAGGCGT	0.358													165	416	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183595823	183595823	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183595823C>G	uc002uow.1	+	9	1209	c.794C>G	c.(793-795)TCA>TGA	p.S265*	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Nonsense_Mutation_p.S265*|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	265					apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ACTTTTTGTTCAAAAGGAGGA	0.299													21	86	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196834815	196834815	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196834815G>A	uc002utj.3	-	17	2163	c.2062C>T	c.(2062-2064)CGG>TGG	p.R688W		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	688	Stem (By similarity).|Potential.				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CGTTCACACCGTAACTAATAA	0.303													41	124	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207176266	207176266	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207176266G>C	uc002vbp.2	+	5	7264	c.7014G>C	c.(7012-7014)GAG>GAC	p.E2338D		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2338							nucleic acid binding|zinc ion binding			ovary(3)	3						AACAACGTGAGAGAATGATGA	0.423													11	32	---	---	---	---	PASS
IGFBP2	3485	broad.mit.edu	37	2	217498633	217498633	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217498633C>T	uc010zjt.1	+	3	516	c.366C>T	c.(364-366)GGC>GGT	p.G122G	IGFBP2_uc010zju.1_Silent_p.G57G	NM_000597	NP_000588	P18065	IBP2_HUMAN	insulin-like growth factor binding protein 2,	129	IGFBP N-terminal.				positive regulation of activated T cell proliferation|regulation of cell growth|regulation of insulin-like growth factor receptor signaling pathway	extracellular space	insulin-like growth factor I binding|insulin-like growth factor II binding				0		Renal(323;0.0458)		Epithelial(149;2.9e-06)|all cancers(144;0.000223)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00968)		TGGGCGAGGGCACTTGTGAGA	0.687													9	19	---	---	---	---	PASS
PSMD1	5707	broad.mit.edu	37	2	231934768	231934768	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231934768C>A	uc002vrn.1	+	6	671	c.540C>A	c.(538-540)AGC>AGA	p.S180R	PSMD1_uc002vrm.1_Missense_Mutation_p.S180R|PSMD1_uc010fxu.1_Missense_Mutation_p.S44R	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1	180					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TAGCTTATAGCCTTAAGCTCT	0.308													23	133	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242045998	242045998	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242045998G>A	uc002wao.1	-	18	4047	c.3955C>T	c.(3955-3957)CGT>TGT	p.R1319C	PASK_uc010zol.1_Missense_Mutation_p.R1133C|PASK_uc010zom.1_Missense_Mutation_p.R1284C|PASK_uc010fzl.1_Missense_Mutation_p.R1326C|PASK_uc010zon.1_Missense_Mutation_p.R1100C	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1319					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GTCAGCAGACGGGGATCCCCG	0.532													65	208	---	---	---	---	PASS
BOK	666	broad.mit.edu	37	2	242511735	242511735	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242511735C>T	uc002wbq.2	+	5	783	c.537C>T	c.(535-537)GTC>GTT	p.V179V	BOK_uc002wbr.2_5'Flank	NM_032515	NP_115904	Q9UMX3	BOK_HUMAN	BCL2-related ovarian killer	179					activation of caspase activity|cell proliferation|signal transduction by p53 class mediator resulting in induction of apoptosis	mitochondrial membrane|nucleus				ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.04e-33)|all cancers(36;7.87e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.52e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.64e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0835)		AGTGTGTGGTCAGCACAGACC	0.647													4	22	---	---	---	---	PASS
DCLK3	85443	broad.mit.edu	37	3	36756941	36756941	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36756941G>A	uc003cgi.2	-	5	2316	c.1825C>T	c.(1825-1827)CAG>TAG	p.Q609*		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	609	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						CAGGGGTGCTGAAGAACCTGA	0.542													23	53	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39230687	39230687	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39230687C>T	uc003cjk.1	-	2	471	c.250G>A	c.(250-252)GAG>AAG	p.E84K	XIRP1_uc003cji.2_Missense_Mutation_p.E84K|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	84							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GTGGGTTCCTCAGAGCCCAGG	0.607													26	41	---	---	---	---	PASS
LTF	4057	broad.mit.edu	37	3	46487958	46487958	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46487958G>T	uc003cpq.2	-	11	1368	c.1330C>A	c.(1330-1332)CCT>ACT	p.P444T	LTF_uc003fzr.2_Missense_Mutation_p.P400T|LTF_uc010hjh.2_Missense_Mutation_p.P442T|LTF_uc003cpr.2_Missense_Mutation_p.P431T	NM_002343	NP_002334	P02788	TRFL_HUMAN	lactotransferrin precursor	444	Transferrin-like 2.				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity			central_nervous_system(2)|ovary(1)|lung(1)	4				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	Pefloxacin(DB00487)	ACACAGTTAGGATCAGGGTCA	0.438													31	57	---	---	---	---	PASS
SLC25A20	788	broad.mit.edu	37	3	48900089	48900089	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48900089G>C	uc003cva.3	-	5	596	c.421C>G	c.(421-423)CAG>GAG	p.Q141E	SLC25A20_uc011bbw.1_Missense_Mutation_p.Q91E|SLC25A20_uc010hkj.2_Missense_Mutation_p.Q68E	NM_000387	NP_000378	O43772	MCAT_HUMAN	carnitine/acylcarnitine translocase	141	Solcar 2.|Mitochondrial matrix (Potential).				carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)	GAAGAAGCCTGAATCTGGGAG	0.473													21	27	---	---	---	---	PASS
SLC38A3	10991	broad.mit.edu	37	3	50256291	50256291	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50256291G>C	uc003cyn.3	+	14	1358	c.1217G>C	c.(1216-1218)CGG>CCG	p.R406P		NM_006841	NP_006832	Q99624	S38A3_HUMAN	solute carrier family 38, member 3	406					cellular nitrogen compound metabolic process|sodium ion transport	integral to plasma membrane	antiporter activity|L-alanine transmembrane transporter activity|L-asparagine transmembrane transporter activity|L-glutamine transmembrane transporter activity|L-histidine transmembrane transporter activity|symporter activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)	L-Asparagine(DB00174)|L-Glutamine(DB00130)|L-Histidine(DB00117)	AGCTGGCTGCGGCATGTGCTT	0.582													24	36	---	---	---	---	PASS
C3orf18	51161	broad.mit.edu	37	3	50602963	50602963	+	Silent	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50602963C>A	uc003das.2	-	2	619	c.168G>T	c.(166-168)ACG>ACT	p.T56T	C3orf18_uc003dar.2_Silent_p.T56T|C3orf18_uc011bdr.1_Intron|C3orf18_uc010hlo.2_Silent_p.T56T|C3orf18_uc010hlp.2_Intron|C3orf18_uc003dat.2_Silent_p.T56T	NM_016210	NP_057294	Q9UK00	CC018_HUMAN	hypothetical protein LOC51161	56						integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.0175)|Kidney(197;0.0207)		CCACGCCGGCCGTGCCACCAG	0.602													19	35	---	---	---	---	PASS
SHQ1	55164	broad.mit.edu	37	3	72891563	72891563	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72891563A>G	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CCTTAAAGATAAATTTGTTTT	0.244													28	42	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73433565	73433565	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433565A>T	uc003dpl.1	-	10	2248	c.2152T>A	c.(2152-2154)TCC>ACC	p.S718T	PDZRN3_uc011bgh.1_Missense_Mutation_p.S375T|PDZRN3_uc010hoe.1_Missense_Mutation_p.S416T|PDZRN3_uc011bgf.1_Missense_Mutation_p.S435T|PDZRN3_uc011bgg.1_Missense_Mutation_p.S438T	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	718							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AGCATCCAGGACTCGCGGTAC	0.602													13	25	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89448476	89448476	+	Silent	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89448476A>G	uc003dqy.2	+	7	1665	c.1440A>G	c.(1438-1440)CAA>CAG	p.Q480Q	EPHA3_uc003dqx.1_Silent_p.Q480Q|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	480	Extracellular (Potential).|Fibronectin type-III 2.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AGCAGGAACAAGAAACAAGTT	0.368										TSP Lung(6;0.00050)			31	128	---	---	---	---	PASS
TOMM70A	9868	broad.mit.edu	37	3	100105171	100105171	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100105171C>T	uc003dtw.2	-	3	948	c.516G>A	c.(514-516)GTG>GTA	p.V172V		NM_014820	NP_055635	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70	172	Cytoplasmic (Potential).|TPR 2.				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			ovary(1)	1						AGTCTTGTGCCACTTCTTTCC	0.333													41	102	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108813790	108813790	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108813790C>T	uc003dxl.2	-	7	636	c.549G>A	c.(547-549)TTG>TTA	p.L183L	MORC1_uc011bhn.1_Silent_p.L183L	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	183					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						ACTGCTGCATCAATTCTGCTT	0.328													33	69	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111999533	111999533	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111999533T>C	uc003dyu.2	-	3	408	c.186A>G	c.(184-186)TCA>TCG	p.S62S	SLC9A10_uc011bhu.1_5'UTR|SLC9A10_uc010hqc.2_Silent_p.S62S	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	62					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						TACACACCTGTGAAGATGTAA	0.328													37	71	---	---	---	---	PASS
C3orf17	25871	broad.mit.edu	37	3	112729979	112729979	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112729979T>A	uc003dzr.2	-	6	887	c.826A>T	c.(826-828)ATT>TTT	p.I276F	GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_5'Flank|C3orf17_uc011bhz.1_Intron|C3orf17_uc010hqh.2_Intron|C3orf17_uc003dzt.2_Missense_Mutation_p.I179F|C3orf17_uc003dzs.2_Missense_Mutation_p.I140F|C3orf17_uc010hqg.2_Missense_Mutation_p.I101F|C3orf17_uc011bia.1_Missense_Mutation_p.I73F|C3orf17_uc003dzu.2_Missense_Mutation_p.I205F|C3orf17_uc011bib.1_Missense_Mutation_p.I165F|C3orf17_uc011bic.1_Missense_Mutation_p.I109F|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	276						integral to membrane					0						TTTTTTGAAATTCCAAGCAAG	0.333													27	145	---	---	---	---	PASS
C3orf17	25871	broad.mit.edu	37	3	112729980	112729980	+	Silent	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112729980T>A	uc003dzr.2	-	6	886	c.825A>T	c.(823-825)GGA>GGT	p.G275G	GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_5'Flank|C3orf17_uc011bhz.1_Intron|C3orf17_uc010hqh.2_Intron|C3orf17_uc003dzt.2_Silent_p.G178G|C3orf17_uc003dzs.2_Silent_p.G139G|C3orf17_uc010hqg.2_Silent_p.G100G|C3orf17_uc011bia.1_Silent_p.G72G|C3orf17_uc003dzu.2_Silent_p.G204G|C3orf17_uc011bib.1_Silent_p.G164G|C3orf17_uc011bic.1_Silent_p.G108G|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	275						integral to membrane					0						TTTTTGAAATTCCAAGCAAGG	0.328													26	146	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126708343	126708343	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126708343G>T	uc003ejg.2	+	1	842	c.838G>T	c.(838-840)GAG>TAG	p.E280*		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	303	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CATTGGCTGCGAGCAGGCGGG	0.657													36	183	---	---	---	---	PASS
RPN1	6184	broad.mit.edu	37	3	128350847	128350847	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128350847G>A	uc003ekr.1	-	4	863	c.787C>T	c.(787-789)CGC>TGC	p.R263C	RPN1_uc011bkq.1_Missense_Mutation_p.R91C	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor	263	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	p.R263fs*3(1)		ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		TAATCATAGCGTGAGAAAGGC	0.438			T	EVI1	AML								64	151	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129290379	129290379	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129290379G>A	uc003emx.2	-	17	3409	c.3309C>T	c.(3307-3309)GCC>GCT	p.A1103A		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1103	Extracellular (Potential).|IPT/TIG 3.				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGTGGTGGACGGCCATGGACA	0.647													35	68	---	---	---	---	PASS
PCCB	5096	broad.mit.edu	37	3	136016889	136016889	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136016889C>G	uc003eqy.1	+	8	910	c.859C>G	c.(859-861)CCC>GCC	p.P287A	PCCB_uc003eqz.1_Missense_Mutation_p.P287A|PCCB_uc011bmc.1_Missense_Mutation_p.P307A|PCCB_uc011bmd.1_Missense_Mutation_p.P204A	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta	287	Carboxyltransferase.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	GGACCCGGCTCCCGTCCGTGA	0.557													72	327	---	---	---	---	PASS
SOX14	8403	broad.mit.edu	37	3	137484266	137484266	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137484266C>G	uc003erm.1	+	1	688	c.640C>G	c.(640-642)CCC>GCC	p.P214A		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	214					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						CACCCTGCAGCCCCCCGTCGC	0.662													11	39	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148552344	148552344	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148552344C>T	uc003ewl.2	+	3	230	c.207C>T	c.(205-207)TTC>TTT	p.F69F		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	69					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CAGTTGACTTCCGTGTTAAAG	0.328													53	213	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154860077	154860077	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154860077C>A	uc010hvr.1	+	12	1357	c.1146C>A	c.(1144-1146)AGC>AGA	p.S382R	MME_uc003fab.1_Missense_Mutation_p.S382R|MME_uc003fac.1_Missense_Mutation_p.S382R|MME_uc003fad.1_Missense_Mutation_p.S382R|MME_uc003fae.1_Missense_Mutation_p.S382R	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	382	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	TTGTAAGCAGCCTCAGCCGAA	0.388													41	234	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154860078	154860078	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154860078C>A	uc010hvr.1	+	12	1358	c.1147C>A	c.(1147-1149)CTC>ATC	p.L383I	MME_uc003fab.1_Missense_Mutation_p.L383I|MME_uc003fac.1_Missense_Mutation_p.L383I|MME_uc003fad.1_Missense_Mutation_p.L383I|MME_uc003fae.1_Missense_Mutation_p.L383I	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	383	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	TGTAAGCAGCCTCAGCCGAAC	0.388													40	234	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155199743	155199743	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199743A>C	uc011bok.1	-	23	4373	c.4096T>G	c.(4096-4098)TCA>GCA	p.S1366A	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.S1328A	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1366					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGATTTTCTGATTCTCCATCA	0.448													17	198	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155203198	155203198	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203198G>T	uc011bok.1	-	22	3222	c.2945C>A	c.(2944-2946)TCG>TAG	p.S982*	PLCH1_uc011boj.1_Nonsense_Mutation_p.S982*|PLCH1_uc011bol.1_Nonsense_Mutation_p.S944*	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	982					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TACAGGCAGCGACAAAGCTCC	0.468													84	196	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155571554	155571554	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155571554A>T	uc003fan.3	-	1	614	c.233T>A	c.(232-234)CTA>CAA	p.L78Q	SLC33A1_uc003fao.1_Missense_Mutation_p.L78Q	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	78	Helical; (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AAGAAAGAGTAGTAGCAAAAT	0.512													114	168	---	---	---	---	PASS
IFT80	57560	broad.mit.edu	37	3	160003629	160003629	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160003629C>A	uc011boy.1	-	13	1776	c.1343G>T	c.(1342-1344)GGA>GTA	p.G448V	IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Missense_Mutation_p.G311V|IFT80_uc003fdd.1_Missense_Mutation_p.G131V|IFT80_uc003fde.1_Missense_Mutation_p.G311V	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56	448						cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TAACGGCTTTCCGGTTGATGC	0.284													21	139	---	---	---	---	PASS
GPR160	26996	broad.mit.edu	37	3	169802048	169802048	+	Silent	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169802048A>T	uc003fgi.2	+	4	878	c.288A>T	c.(286-288)CTA>CTT	p.L96L	GPR160_uc010hwq.2_Silent_p.L96L	NM_014373	NP_055188	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	96	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ACATCTGCCTATTTACTCAAA	0.313													52	226	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173996720	173996720	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173996720C>T	uc003fio.1	+	6	1352	c.929C>T	c.(928-930)GCA>GTA	p.A310V	NLGN1_uc010hww.1_Missense_Mutation_p.A350V|NLGN1_uc003fip.1_Missense_Mutation_p.A310V	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	327	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTTCAACCTGCAAAATATGCT	0.393													116	196	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184100882	184100882	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184100882G>T	uc003fov.2	+	10	1390	c.1144G>T	c.(1144-1146)GCC>TCC	p.A382S	CHRD_uc003fow.2_Missense_Mutation_p.A12S|CHRD_uc003fox.2_Missense_Mutation_p.A382S|CHRD_uc003foy.2_Missense_Mutation_p.A12S|CHRD_uc010hyc.2_Missense_Mutation_p.A12S|CHRD_uc011brr.1_Missense_Mutation_p.A12S	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	382	CHRD 2.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCTGCAGATGGCCCTGGAGTG	0.677													4	18	---	---	---	---	PASS
LIPH	200879	broad.mit.edu	37	3	185232237	185232237	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185232237C>G	uc003fpm.2	-	8	1165	c.1055G>C	c.(1054-1056)AGA>ACA	p.R352T	LIPH_uc010hyh.2_Missense_Mutation_p.R318T	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor	352					lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			AGCTTTGTCTCTCAATTTGAT	0.363													83	379	---	---	---	---	PASS
PIGZ	80235	broad.mit.edu	37	3	196678730	196678730	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196678730T>C	uc003fxh.2	-	2	320	c.173A>G	c.(172-174)CAC>CGC	p.H58R		NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	58					GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CTCATCTGGGTGCACATAGCC	0.572													24	83	---	---	---	---	PASS
PIGG	54872	broad.mit.edu	37	4	517344	517344	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:517344G>A	uc003gak.3	+	9	1847	c.1711G>A	c.(1711-1713)GTG>ATG	p.V571M	PIGG_uc003gaj.3_Missense_Mutation_p.V563M|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Missense_Mutation_p.V438M|PIGG_uc003gal.3_Missense_Mutation_p.V482M	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	571	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CAGCAGCTTCGTGGAGGAGGA	0.557													82	207	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	860951	860951	+	Missense_Mutation	SNP	C	T	T	rs150706546		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:860951C>T	uc003gbm.3	-	21	2864	c.2665G>A	c.(2665-2667)GAG>AAG	p.E889K	GAK_uc003gbn.3_Missense_Mutation_p.E810K|GAK_uc010ibk.1_Missense_Mutation_p.E783K|GAK_uc010ibi.2_Missense_Mutation_p.E70K|GAK_uc010ibj.2_RNA|GAK_uc003gbl.3_Missense_Mutation_p.E753K	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	889					cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		GCGCCCACCTCGGAGTGCAGG	0.687													19	32	---	---	---	---	PASS
ABLIM2	84448	broad.mit.edu	37	4	8089962	8089962	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8089962T>A	uc003gko.2	-	4	531	c.388A>T	c.(388-390)ATG>TTG	p.M130L	ABLIM2_uc003gkj.3_Missense_Mutation_p.M130L|ABLIM2_uc003gkm.3_Missense_Mutation_p.M130L|ABLIM2_uc003gkp.2_Missense_Mutation_p.M130L|ABLIM2_uc003gkq.2_Missense_Mutation_p.M130L|ABLIM2_uc003gkr.2_Missense_Mutation_p.M130L|ABLIM2_uc003gks.3_Missense_Mutation_p.M130L|ABLIM2_uc011bwl.1_Missense_Mutation_p.M135L	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	130	LIM zinc-binding 2.				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						TTCTGGCACATGCATTCCTTC	0.632													12	34	---	---	---	---	PASS
RAB28	9364	broad.mit.edu	37	4	13370215	13370215	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13370215G>A	uc003gmu.2	-	7	848	c.633C>T	c.(631-633)AAC>AAT	p.N211N	RAB28_uc003gmt.2_3'UTR|RAB28_uc011bwz.1_3'UTR|RAB28_uc003gmv.2_RNA	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1	211					small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2						TTCTAGGAGGGTTAACAGTCC	0.443													39	98	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13602889	13602889	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13602889C>T	uc003gmz.1	-	10	5752	c.5635G>A	c.(5635-5637)GAA>AAA	p.E1879K	BOD1L_uc010idr.1_Missense_Mutation_p.E1216K	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1879							DNA binding			ovary(5)|breast(1)	6						TGCCCAATTTCATTTCCTCTT	0.473													55	159	---	---	---	---	PASS
NCAPG	64151	broad.mit.edu	37	4	17824747	17824747	+	Splice_Site	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17824747G>C	uc003gpp.2	+	8	1435	c.1259_splice	c.e8+1	p.R420_splice	NCAPG_uc011bxj.1_Splice_Site	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		AAGGAGGAAGGTATGTCTAAA	0.289													40	89	---	---	---	---	PASS
KLHL5	51088	broad.mit.edu	37	4	39083642	39083642	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39083642C>T	uc003gts.2	+	4	976	c.901C>T	c.(901-903)CAG>TAG	p.Q301*	KLHL5_uc003gtp.2_Nonsense_Mutation_p.Q255*|KLHL5_uc003gtq.2_Nonsense_Mutation_p.Q114*|KLHL5_uc003gtr.1_Nonsense_Mutation_p.Q301*|KLHL5_uc003gtt.2_Nonsense_Mutation_p.Q240*	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1	301						cytoplasm|cytoskeleton	actin binding			ovary(1)	1						TTGCCTTCTTCAGCTTTCACA	0.383													87	190	---	---	---	---	PASS
USO1	8615	broad.mit.edu	37	4	76678729	76678729	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76678729A>G	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGAAGTAGGTAAGTTTCCAGT	0.254													9	19	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85594031	85594031	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85594031C>T	uc003hpd.2	-	68	10979	c.10571G>A	c.(10570-10572)CGA>CAA	p.R3524Q	WDFY3_uc003hpc.2_Missense_Mutation_p.R279Q	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3524						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCAACAATTTCGAGGCCCATC	0.458													76	236	---	---	---	---	PASS
DSPP	1834	broad.mit.edu	37	4	88535180	88535180	+	Missense_Mutation	SNP	G	C	C	rs79488787		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88535180G>C	uc003hqu.2	+	5	1486	c.1366G>C	c.(1366-1368)GAT>CAT	p.D456H		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	456	Asp/Ser-rich.				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		TTATGATTTTGATGATAAGTC	0.403													26	104	---	---	---	---	PASS
DSPP	1834	broad.mit.edu	37	4	88535201	88535201	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88535201G>A	uc003hqu.2	+	5	1507	c.1387G>A	c.(1387-1389)GAT>AAT	p.D463N		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	463	Asp/Ser-rich.				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		CATGCAAGGAGATGATCCCAA	0.388													26	111	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89400515	89400515	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89400515G>A	uc003hrt.2	+	13	1747	c.1594G>A	c.(1594-1596)GCA>ACA	p.A532T	HERC5_uc011cdm.1_Missense_Mutation_p.A170T	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	532					innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		AGAGTATTGGGCAACTCTGCA	0.323													41	121	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104640740	104640740	+	Silent	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104640740C>A	uc003hxe.1	-	1	236	c.93G>T	c.(91-93)GGG>GGT	p.G31G		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	31	Extracellular (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CCGTGGCCGCCCCGGCAGCTA	0.682													6	57	---	---	---	---	PASS
USP53	54532	broad.mit.edu	37	4	120192475	120192475	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120192475A>T	uc003ics.3	+	15	2526	c.1460A>T	c.(1459-1461)CAT>CTT	p.H487L	USP53_uc003icr.3_Missense_Mutation_p.H487L|USP53_uc003icu.3_Missense_Mutation_p.H110L|USP53_uc003ict.2_Missense_Mutation_p.H110L	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	487					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						GACCTTTCACATTTCCAATCT	0.363													49	120	---	---	---	---	PASS
MMAA	166785	broad.mit.edu	37	4	146576485	146576485	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146576485C>T	uc003ikh.3	+	7	1241	c.1156C>T	c.(1156-1158)CGG>TGG	p.R386W	MMAA_uc010iow.2_RNA	NM_172250	NP_758454	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria type A precursor	386						mitochondrion	GTP binding|nucleoside-triphosphatase activity			ovary(1)	1	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCCACAGTCCGGGAACAGAT	0.483													57	152	---	---	---	---	PASS
NPY1R	4886	broad.mit.edu	37	4	164247497	164247497	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164247497C>T	uc003iqm.1	-	2	476	c.210G>A	c.(208-210)GAG>GAA	p.E70E	NPY1R_uc011cjj.1_Intron	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	70	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CATTTCTCATCTCCTTTTGTT	0.408													43	123	---	---	---	---	PASS
NEK1	4750	broad.mit.edu	37	4	170322914	170322914	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170322914C>T	uc003isb.1	-	31	3880	c.3388G>A	c.(3388-3390)GAG>AAG	p.E1130K	NEK1_uc003isc.1_Missense_Mutation_p.E1086K|NEK1_uc003isd.1_Missense_Mutation_p.E1158K|NEK1_uc003ise.1_Missense_Mutation_p.E1114K|NEK1_uc003isf.1_Missense_Mutation_p.E1061K	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1130					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		AAGACTGACTCTTCTTCTTCA	0.458													115	329	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177190073	177190073	+	Missense_Mutation	SNP	G	C	C	rs143631688		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177190073G>C	uc003iuq.1	-	1	203	c.187C>G	c.(187-189)CAA>GAA	p.Q63E		NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	63					intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		CCTTGTCCTTGGGTTACTCCA	0.393													31	90	---	---	---	---	PASS
TLR3	7098	broad.mit.edu	37	4	187004694	187004694	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187004694G>A	uc003iyq.2	+	4	1955	c.1854G>A	c.(1852-1854)CAG>CAA	p.Q618Q	TLR3_uc011ckz.1_Silent_p.Q341Q|TLR3_uc003iyr.2_Silent_p.Q341Q	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	618	LRR 22.|Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TGAACCTTCAGAAGAATCTCA	0.378													68	186	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34823168	34823168	+	Silent	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34823168A>G	uc003jir.2	+	15	1417	c.1221A>G	c.(1219-1221)CCA>CCG	p.P407P	RAI14_uc010iur.2_Silent_p.P378P|RAI14_uc011coj.1_Silent_p.P407P|RAI14_uc003jis.2_Silent_p.P410P|RAI14_uc003jit.2_Silent_p.P407P|RAI14_uc011cok.1_Silent_p.P399P	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	407						cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					CCTCTCCCCCAGACTCCAAAT	0.463													56	170	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43704376	43704376	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43704376C>G	uc003joe.2	+	22	3386	c.3131C>G	c.(3130-3132)TCT>TGT	p.S1044C	NNT_uc003jof.2_Missense_Mutation_p.S1044C	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1044	Mitochondrial matrix.|NADP.				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	ATGAAGAGGTCTTTGGGTGTT	0.443													98	347	---	---	---	---	PASS
WDR41	55255	broad.mit.edu	37	5	76728962	76728962	+	Nonstop_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76728962A>G	uc003kff.1	-	13	1665	c.1378T>C	c.(1378-1380)TAG>CAG	p.*460Q	WDR41_uc011csy.1_Nonstop_Mutation_p.*402Q|WDR41_uc011csz.1_Nonstop_Mutation_p.*405Q	NM_018268	NP_060738	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	460											0		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		TCCTTAAACTAGACAGCAAGG	0.318													72	98	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82816285	82816285	+	Silent	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82816285C>A	uc003kii.3	+	7	2516	c.2160C>A	c.(2158-2160)GTC>GTA	p.V720V	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Silent_p.V720V|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	720	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		AAGAAGAAGTCTTCTCTGGGA	0.363													47	76	---	---	---	---	PASS
TMEM161B	153396	broad.mit.edu	37	5	87494810	87494810	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87494810C>T	uc003kjc.2	-	10	1197	c.1072G>A	c.(1072-1074)GTT>ATT	p.V358I	TMEM161B_uc011cty.1_Missense_Mutation_p.V347I|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctx.1_Missense_Mutation_p.V149I	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	358						integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TGTAGCTCAACCGTGCTTATT	0.368													30	70	---	---	---	---	PASS
LNPEP	4012	broad.mit.edu	37	5	96332123	96332123	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96332123G>A	uc003kmv.1	+	7	1951	c.1437G>A	c.(1435-1437)TGG>TGA	p.W479*	LNPEP_uc003kmw.1_Nonsense_Mutation_p.W465*	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	479	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CAATGAAGTGGTGGAATGACC	0.378													30	64	---	---	---	---	PASS
VDAC1	7416	broad.mit.edu	37	5	133316532	133316532	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133316532C>T	uc003kyp.1	-	6	538	c.439G>A	c.(439-441)GAG>AAG	p.E147K	VDAC1_uc003kyq.1_Missense_Mutation_p.E147K|VDAC1_uc003kyr.1_Missense_Mutation_p.E147K	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	147					apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	AGCCAGCCCTCGTAACCTAGC	0.532													37	87	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140481893	140481893	+	Missense_Mutation	SNP	G	A	A	rs138158842		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140481893G>A	uc003lio.2	+	1	1660	c.1660G>A	c.(1660-1662)GCC>ACC	p.A554T	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	554	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCTGGACGCCAACGACAA	0.711													33	26	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140811628	140811628	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140811628G>A	uc003lkt.1	+	1	1471	c.1302G>A	c.(1300-1302)ACG>ACA	p.T434T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Silent_p.T434T	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	434	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTATCCACGGAAACTCATA	0.532													39	31	---	---	---	---	PASS
RELL2	285613	broad.mit.edu	37	5	141019182	141019182	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141019182C>T	uc003lli.2	+	5	1317	c.469C>T	c.(469-471)CGG>TGG	p.R157W	HDAC3_uc003llf.2_5'Flank|HDAC3_uc010jgd.1_5'Flank|HDAC3_uc010jge.1_5'Flank|RELL2_uc003llh.2_Missense_Mutation_p.R157W|RELL2_uc003llg.2_Missense_Mutation_p.R91W|RELL2_uc010jgf.2_Missense_Mutation_p.R91W|FCHSD1_uc010jgg.2_3'UTR|FCHSD1_uc003llj.2_RNA|FCHSD1_uc003llk.2_3'UTR	NM_001130029	NP_001123501	Q8NC24	RELL2_HUMAN	RELT-like 2	157						integral to membrane|plasma membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCCGCCCCCGGACAGGGGA	0.652													33	37	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150945543	150945543	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150945543C>A	uc003lue.3	-	1	2963	c.2950G>T	c.(2950-2952)GAG>TAG	p.E984*	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Nonsense_Mutation_p.E984*	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	984	Extracellular (Potential).|Cadherin 8.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCTCTCTCTCCAGAATGAGC	0.612													37	27	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171488194	171488194	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171488194T>A	uc003mbo.1	-	14	2461	c.2161A>T	c.(2161-2163)ATC>TTC	p.I721F		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	721	Potential.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGTCACAGATCTCCCGCCTG	0.612													154	130	---	---	---	---	PASS
EXOC2	55770	broad.mit.edu	37	6	562784	562784	+	Silent	SNP	T	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:562784T>G	uc003mtd.2	-	17	1985	c.1851A>C	c.(1849-1851)CTA>CTC	p.L617L	EXOC2_uc003mte.2_Silent_p.L617L|EXOC2_uc011dho.1_Silent_p.L212L	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	617					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TTAAACTTACTAGAGAAGTCA	0.294													21	42	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17648069	17648069	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17648069G>T	uc003ncd.1	-	13	1801	c.1601C>A	c.(1600-1602)TCT>TAT	p.S534Y	NUP153_uc011dje.1_Missense_Mutation_p.S565Y|NUP153_uc010jpl.1_Missense_Mutation_p.S534Y	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	534					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGCCTCAGTAGATTTTACGAT	0.323													62	155	---	---	---	---	PASS
OR2W1	26692	broad.mit.edu	37	6	29012825	29012825	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29012825G>C	uc003nlw.2	-	1	128	c.128C>G	c.(127-129)ACA>AGA	p.T43R		NM_030903	NP_112165	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AATGATGGCTGTGTTACCCAC	0.408													52	168	---	---	---	---	PASS
OR11A1	26531	broad.mit.edu	37	6	29408737	29408737	+	Intron	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29408737G>T	uc010jrh.1	-									Q9GZK7	O11A1_HUMAN	Homo sapiens mRNA for olfactory receptor (6M1-18 gene), 5'UTR variant 1.						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTTGAAAAGGGGGCGATAGTG	0.502													15	68	---	---	---	---	PASS
FTSJD2	23070	broad.mit.edu	37	6	37442397	37442397	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37442397A>G	uc003ons.2	+	18	2172	c.1919A>G	c.(1918-1920)GAA>GGA	p.E640G		NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2	640					mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CTATCTGTGGAAATTGTGCAT	0.567													43	94	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43188302	43188302	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43188302C>A	uc003ouk.2	+	32	6463	c.6388C>A	c.(6388-6390)CGT>AGT	p.R2130S	CUL9_uc003oul.2_Missense_Mutation_p.R2102S|CUL9_uc010jyk.2_Missense_Mutation_p.R1282S|CUL9_uc003oun.2_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	2130					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						AGCCTTCATTCGTGCCATCGT	0.597													67	196	---	---	---	---	PASS
ENPP4	22875	broad.mit.edu	37	6	46108002	46108002	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46108002G>T	uc003oxy.2	+	2	941	c.682G>T	c.(682-684)GAA>TAA	p.E228*		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	228	Extracellular (Potential).					integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						AGGGCTATGGGAAAATCTTAA	0.393													48	152	---	---	---	---	PASS
HTR1B	3351	broad.mit.edu	37	6	78172034	78172034	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78172034G>C	uc003pil.1	-	1	1087	c.1087C>G	c.(1087-1089)CTC>GTC	p.L363V		NM_000863	NP_000854	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B	363	Helical; Name=7; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity				0		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)	GGGTTGATGAGGGAGTTGAGA	0.443													46	136	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121638707	121638707	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121638707G>C	uc003pyo.1	-	3	497	c.429C>G	c.(427-429)ATC>ATG	p.I143M	C6orf170_uc003pyq.1_RNA	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	143					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		TCTCCTTTTGGATTTTTTTCT	0.363													67	178	---	---	---	---	PASS
TAAR5	9038	broad.mit.edu	37	6	132909846	132909846	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132909846G>T	uc003qdk.2	-	1	1032	c.980C>A	c.(979-981)CCG>CAG	p.P327Q		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	327	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		GCGTGTCTGCGGTGAGAAGAC	0.483													15	72	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599455	136599455	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599455T>C	uc003qgx.1	-	4	817	c.564A>G	c.(562-564)AAA>AAG	p.K188K	BCLAF1_uc003qgw.1_Silent_p.K188K|BCLAF1_uc003qgy.1_Silent_p.K186K|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.K186K	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	188					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CAAATGTATCTTTCGGTTCCT	0.408													63	501	---	---	---	---	PASS
PEX7	5191	broad.mit.edu	37	6	137147450	137147450	+	Intron	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137147450A>T	uc003qhd.2	+						PEX7_uc010kgx.2_Intron	NM_000288	NP_000279	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7						ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		GTTTTTTCCTAGTGTAGCTTT	0.343													75	266	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152476141	152476141	+	Silent	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152476141C>G	uc010kiw.2	-	133	24617	c.24015G>C	c.(24013-24015)CTG>CTC	p.L8005L	SYNE1_uc010kiv.2_Silent_p.L2529L|SYNE1_uc003qos.3_Silent_p.L2529L|SYNE1_uc003qot.3_Silent_p.L7934L|SYNE1_uc003qou.3_Silent_p.L8005L|SYNE1_uc003qop.3_Silent_p.L167L|SYNE1_uc011eez.1_Silent_p.L207L|SYNE1_uc003qoq.3_Silent_p.L207L|SYNE1_uc003qor.3_Silent_p.L905L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8005	Spectrin 29.|Cytoplasmic (Potential).|HAT 12.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATAGTCATCCAGAAATTTCT	0.458										HNSCC(10;0.0054)			60	187	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160557644	160557644	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160557644G>A	uc003qtc.2	+	6	1128	c.1023G>A	c.(1021-1023)CCG>CCA	p.P341P	SLC22A1_uc003qtd.2_Silent_p.P341P	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	341	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TCCGCACGCCGCGCCTGAGGA	0.592													28	111	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	168947759	168947759	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168947759A>G	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		TACTCTCATAATTGTAGTCTC	0.502													33	233	---	---	---	---	PASS
GHRHR	2692	broad.mit.edu	37	7	31018817	31018817	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31018817G>A	uc003tbx.2	+	13	1278	c.1230G>A	c.(1228-1230)ACG>ACA	p.T410T	GHRHR_uc003tby.2_Silent_p.T346T|GHRHR_uc003tbz.2_3'UTR	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	410	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	AGTGGACCACGCCTTCCCGCT	0.597													22	74	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38431468	38431468	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38431468C>G	uc003tgu.2	-	19	1828	c.1759G>C	c.(1759-1761)GAG>CAG	p.E587Q	AMPH_uc003tgv.2_Missense_Mutation_p.E545Q|AMPH_uc003tgt.2_Missense_Mutation_p.E472Q|AMPH_uc003tgw.1_Missense_Mutation_p.E610Q|AMPH_uc010kxl.1_RNA	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	587					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GGCTTCTGCTCCGTAGCCAGC	0.622													23	48	---	---	---	---	PASS
ZNF273	10793	broad.mit.edu	37	7	64388241	64388241	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64388241C>G	uc003tto.2	+	4	611	c.535C>G	c.(535-537)CAA>GAA	p.Q179E	ZNF273_uc003ttl.2_Missense_Mutation_p.Q114E|ZNF273_uc003ttn.2_Missense_Mutation_p.Q114E	NM_021148	NP_066971	Q14593	ZN273_HUMAN	zinc finger protein 273	179					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CAAAATATTTCAATGTGATAA	0.313													44	117	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71743750	71743750	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71743750C>A	uc003twa.3	-	2	566	c.39G>T	c.(37-39)AAG>AAT	p.K13N	CALN1_uc003twb.3_Missense_Mutation_p.K55N|CALN1_uc003twc.3_Missense_Mutation_p.K13N	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	13	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GGTAATTCCCCTTGTACAACA	0.527													23	56	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72857134	72857134	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72857134G>A	uc003tyc.2	-	18	4360	c.4015C>T	c.(4015-4017)CGG>TGG	p.R1339W		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1339					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTTTGCCTCCGGGAGCTCCGC	0.502													22	73	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87150183	87150183	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87150183C>T	uc003uiz.1	-	23	3113	c.2695G>A	c.(2695-2697)GAA>AAA	p.E899K	ABCB1_uc011khc.1_Missense_Mutation_p.E835K	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	899	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TCTATTGCTTCAGTAGCGATC	0.373													40	103	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94173717	94173717	+	Intron	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94173717C>G	uc003uni.3	+						CASD1_uc003unj.3_Intron	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTATCTTTGTCAACAGTTTTT	0.333													68	220	---	---	---	---	PASS
AZGP1	563	broad.mit.edu	37	7	99569369	99569369	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99569369C>T	uc003ush.2	-	2	381	c.337G>A	c.(337-339)GGG>AGG	p.G113R		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	113					antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					ATTCACTGACCGTTACTGTCG	0.517													40	126	---	---	---	---	PASS
CPA2	1358	broad.mit.edu	37	7	129914999	129914999	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129914999G>T	uc003vpq.2	+	6	516	c.497G>T	c.(496-498)GGA>GTA	p.G166V	CPA2_uc011kpc.1_Missense_Mutation_p.G166V	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor	166					proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					TTCAGCACCGGAGGAGACAAG	0.537													27	61	---	---	---	---	PASS
SLC4A2	6522	broad.mit.edu	37	7	150769147	150769147	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150769147C>T	uc003wit.3	+	16	2715	c.2459C>T	c.(2458-2460)TCC>TTC	p.S820F	SLC4A2_uc011kve.1_Missense_Mutation_p.S811F|SLC4A2_uc003wiu.3_Missense_Mutation_p.S806F|SLC4A2_uc003wiv.3_Missense_Mutation_p.S14F	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	820	Membrane (anion exchange).				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCTTCGTCTCCCGCTTCACC	0.602													89	226	---	---	---	---	PASS
WDR60	55112	broad.mit.edu	37	7	158718960	158718960	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158718960C>T	uc003woe.3	+	18	2498	c.2340C>T	c.(2338-2340)AGC>AGT	p.S780S	WDR60_uc010lqv.2_RNA|WDR60_uc010lqw.2_Silent_p.S412S	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	780	WD 2.									ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		AAAAGCAGAGCTTTGTGCTTT	0.413													5	28	---	---	---	---	PASS
ERI1	90459	broad.mit.edu	37	8	8887521	8887521	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8887521C>A	uc011kwu.1	+	7	1287	c.1027C>A	c.(1027-1029)CAA>AAA	p.Q343K	ERI1_uc003wsk.2_Missense_Mutation_p.Q343K	NM_153332	NP_699163	Q8IV48	ERI1_HUMAN	three prime histone mRNA exonuclease 1	343					gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)	TCCACCACCACAAATGCCACA	0.428													41	70	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12947965	12947965	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12947965C>A	uc003wwm.2	-	15	4314	c.3870G>T	c.(3868-3870)ATG>ATT	p.M1290I	DLC1_uc003wwk.1_Missense_Mutation_p.M853I|DLC1_uc003wwl.1_Missense_Mutation_p.M887I|DLC1_uc011kxx.1_Missense_Mutation_p.M779I	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1290					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						GACATCGGCTCATTTCCTCGG	0.512													35	52	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18457934	18457934	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18457934T>C	uc003wza.2	-	12	2524	c.2421A>G	c.(2419-2421)GGA>GGG	p.G807G	PSD3_uc003wyx.3_Silent_p.G136G|PSD3_uc003wyy.2_Silent_p.G273G|PSD3_uc003wyz.2_Silent_p.G108G	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	808	PH.				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		ATCCTCGTTTTCCTCTTGGAG	0.338													65	86	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38205569	38205569	+	Missense_Mutation	SNP	C	T	T	rs149593190	byFrequency	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38205569C>T	uc003xli.2	-	2	639	c.121G>A	c.(121-123)GCT>ACT	p.A41T	WHSC1L1_uc011lbm.1_Missense_Mutation_p.A41T|WHSC1L1_uc010lwe.2_Missense_Mutation_p.A41T|WHSC1L1_uc003xlj.2_Missense_Mutation_p.A41T	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	41					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CCATCTTCAGCAATGTCACTG	0.478			T	NUP98	AML								30	262	---	---	---	---	PASS
ABRA	137735	broad.mit.edu	37	8	107773549	107773549	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107773549G>A	uc003ymm.3	-	2	916	c.862C>T	c.(862-864)CGC>TGC	p.R288C		NM_139166	NP_631905	Q8N0Z2	ABRA_HUMAN	actin-binding Rho activating protein	288					positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TCTTTGGGGCGGCCATAGCCC	0.498													34	79	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113243773	113243773	+	Splice_Site	SNP	C	A	A	rs148762244		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113243773C>A	uc003ynu.2	-	69	10987	c.10828_splice	c.e69+1	p.G3610_splice	CSMD3_uc003yns.2_Splice_Site_p.G2812_splice|CSMD3_uc003ynt.2_Splice_Site_p.G3570_splice|CSMD3_uc011lhx.1_Splice_Site_p.G3441_splice	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GAATACATTACCCAGTCTTTG	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			42	202	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125711824	125711824	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125711824C>A	uc003yrk.2	-	3	685	c.151G>T	c.(151-153)GCA>TCA	p.A51S	MTSS1_uc003yrj.2_Missense_Mutation_p.A51S|MTSS1_uc003yrl.2_Missense_Mutation_p.A51S	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	51	IMD.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AAGGCAGCTGCTGCTACTACT	0.468													23	69	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630994	140630994	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630994T>G	uc003yvf.1	-	2	696	c.632A>C	c.(631-633)AAG>ACG	p.K211T	KCNK9_uc003yvg.1_Missense_Mutation_p.K211T|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	211	Extracellular (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			CAGGGCACCCTTGGTCTGCAG	0.567													18	78	---	---	---	---	PASS
ZNF250	58500	broad.mit.edu	37	8	146107675	146107675	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146107675C>A	uc003zeq.3	-	6	1025	c.908G>T	c.(907-909)CGG>CTG	p.R303L	COMMD5_uc010mgf.2_Intron|ZNF250_uc003zer.3_Missense_Mutation_p.R298L|ZNF250_uc010mgg.2_Missense_Mutation_p.R298L	NM_021061	NP_066405	P15622	ZN250_HUMAN	zinc finger protein 250 isoform a	303	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		CGTGTGGATCCGCTGGTGCTG	0.522													9	26	---	---	---	---	PASS
CHMP5	51510	broad.mit.edu	37	9	33270692	33270692	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33270692C>G	uc003zsl.3	+	5	648	c.293C>G	c.(292-294)TCT>TGT	p.S98C	SUGT1P1_uc010mjq.1_Intron|CHMP5_uc003zsm.3_Missense_Mutation_p.S98C|CHMP5_uc011lnv.1_Missense_Mutation_p.S98C|CHMP5_uc003zsn.2_5'Flank	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5	98	Potential.				cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			ACCATCCAGTCTTTGAAGGAC	0.393													56	69	---	---	---	---	PASS
NPR2	4882	broad.mit.edu	37	9	35793036	35793036	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35793036G>T	uc003zyd.2	+	1	631	c.631G>T	c.(631-633)GAG>TAG	p.E211*	NPR2_uc010mlb.2_Nonsense_Mutation_p.E211*	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	211	Extracellular (Potential).				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	AGGGGGCCCCGAGCAGGCCAC	0.642													15	24	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90296478	90296478	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90296478C>T	uc004apc.2	+	20	2299	c.2161C>T	c.(2161-2163)CCC>TCC	p.P721S	DAPK1_uc004apd.2_Missense_Mutation_p.P721S|DAPK1_uc011ltg.1_Missense_Mutation_p.P721S|DAPK1_uc011lth.1_Missense_Mutation_p.P458S|DAPK1_uc004apf.1_Missense_Mutation_p.P275S	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	721					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						AAGGCGTCGGCCCAGACTGTC	0.567									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				23	78	---	---	---	---	PASS
LOC286238	286238	broad.mit.edu	37	9	91262338	91262338	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91262338G>T	uc010mql.1	-	2	438	c.305C>A	c.(304-306)TCC>TAC	p.S102Y		NM_001100111	NP_001093581			hypothetical protein LOC286238												0						CTTTTCTCTGGACACATGGAG	0.443													20	70	---	---	---	---	PASS
CENPP	401541	broad.mit.edu	37	9	95094543	95094543	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95094543C>G	uc004arz.2	+	2	739	c.199C>G	c.(199-201)CTT>GTT	p.L67V	CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Missense_Mutation_p.L67V	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P	67	Potential.				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						AGAATCAGAACTTTCATTTCT	0.358													34	76	---	---	---	---	PASS
GABBR2	9568	broad.mit.edu	37	9	101216305	101216305	+	Silent	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101216305G>T	uc004ays.2	-	7	1350	c.1194C>A	c.(1192-1194)ATC>ATA	p.I398I		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	398	Extracellular (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CATTGAGGATGATCCTGCCCA	0.557													21	94	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117836043	117836043	+	Missense_Mutation	SNP	T	C	C	rs61729548		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117836043T>C	uc004bjj.3	-	10	3415	c.3053A>G	c.(3052-3054)AAT>AGT	p.N1018S	TNC_uc010mvf.2_Missense_Mutation_p.N1018S	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1018	Fibronectin type-III 5.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GAGACTGTAATTGAGGCGGTA	0.552													36	85	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121971119	121971119	+	Silent	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121971119G>T	uc004bkc.2	-	7	1479	c.1023C>A	c.(1021-1023)CGC>CGA	p.R341R		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	341					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GGAGCTTGTAGCGGTTCTGCA	0.547													33	75	---	---	---	---	PASS
PDCL	5082	broad.mit.edu	37	9	125585479	125585479	+	Intron	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125585479G>A	uc004bmz.1	-						PDCL_uc004bna.2_Intron	NM_005388	NP_005379	Q13371	PHLP_HUMAN	phosducin-like						signal transduction|visual perception						0						TTTTGGGCCTGAGTAGGGTGA	0.537													63	142	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136255349	136255349	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136255349G>C	uc004cdk.2	+	6	497	c.436G>C	c.(436-438)GAA>CAA	p.E146Q	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	146	Protein kinase.						ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGACGCGCTGGAATACCTGCA	0.627													6	37	---	---	---	---	PASS
MAMDC4	158056	broad.mit.edu	37	9	139748260	139748260	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139748260T>C	uc004cjs.2	+	5	536	c.486T>C	c.(484-486)CAT>CAC	p.H162H	MAMDC4_uc011mej.1_5'UTR	NM_206920	NP_996803	Q6UXC1	AEGP_HUMAN	apical early endosomal glycoprotein precursor	162	Extracellular (Potential).|MAM 1.				protein transport	integral to membrane				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		AGCTGACCCATGGCGCAGAGA	0.687													14	30	---	---	---	---	PASS
GTPBP4	23560	broad.mit.edu	37	10	1061808	1061808	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061808G>C	uc001ift.2	+	16	1795	c.1724G>C	c.(1723-1725)CGT>CCT	p.R575P	GTPBP4_uc001ifu.2_RNA|GTPBP4_uc010qad.1_Missense_Mutation_p.R459P|GTPBP4_uc010qae.1_Missense_Mutation_p.R528P	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG	575					negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		CGAACTCCACGTGACGTTTCT	0.507													95	272	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12071426	12071426	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12071426G>A	uc001ila.2	-	2	937	c.463C>T	c.(463-465)CGA>TGA	p.R155*	UPF2_uc001ilb.2_Nonsense_Mutation_p.R155*|UPF2_uc001ilc.2_Nonsense_Mutation_p.R155*|UPF2_uc009xiz.1_Nonsense_Mutation_p.R155*	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	155					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				TCCTCTGGTCGGCTGTCCGGA	0.403													123	262	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17024556	17024556	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17024556C>A	uc001ioo.2	-	31	4674	c.4622G>T	c.(4621-4623)CGG>CTG	p.R1541L		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1541	CUB 10.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTGTCAACCCGAATGACCCA	0.428													19	93	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17024567	17024567	+	Silent	SNP	A	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17024567A>C	uc001ioo.2	-	31	4663	c.4611T>G	c.(4609-4611)TCT>TCG	p.S1537S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1537	CUB 10.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAATGACCCAAGAACAGTCTG	0.438													22	82	---	---	---	---	PASS
ZNF33B	7582	broad.mit.edu	37	10	43089465	43089465	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43089465C>A	uc001jaf.1	-	5	1048	c.933G>T	c.(931-933)AGG>AGT	p.R311S	ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Missense_Mutation_p.R199S|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B	311						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACAATTTCCTCCTGAAATTAT	0.403													105	227	---	---	---	---	PASS
C10orf107	219621	broad.mit.edu	37	10	63519928	63519928	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63519928A>G	uc010qik.1	+	5	705	c.400A>G	c.(400-402)ACG>GCG	p.T134A		NM_173554	NP_775825	Q8IVU9	CJ107_HUMAN	hypothetical protein LOC219621	134											0	Prostate(12;0.016)					AATATTGGATACGGAAATGAA	0.388													36	117	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69881341	69881341	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69881341G>T	uc001jnm.3	+	3	331	c.146G>T	c.(145-147)GGG>GTG	p.G49V	MYPN_uc001jnl.1_Missense_Mutation_p.G49V|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.G49V|MYPN_uc001jnp.1_Missense_Mutation_p.G49V|MYPN_uc009xps.2_Missense_Mutation_p.G49V|MYPN_uc009xpt.2_Missense_Mutation_p.G49V|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	49	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AGTCCTTCTGGGGCCGCTGAA	0.527													34	121	---	---	---	---	PASS
PBLD	64081	broad.mit.edu	37	10	70043999	70043999	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70043999G>T	uc001jns.1	-	10	1005	c.802C>A	c.(802-804)CCA>ACA	p.P268T	PBLD_uc001jnr.1_Missense_Mutation_p.P235T|PBLD_uc001jnt.1_Missense_Mutation_p.P268T	NM_022129	NP_071412	P30039	PBLD_HUMAN	MAWD binding protein isoform a	268					biosynthetic process		isomerase activity			skin(2)|ovary(1)	3						CTTCCGTCTGGACGAAGGGAA	0.458													43	188	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84498359	84498359	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84498359G>C	uc001kco.2	+	3	1007	c.980G>C	c.(979-981)CGT>CCT	p.R327P	NRG3_uc010qlz.1_Missense_Mutation_p.R327P|NRG3_uc001kcp.2_Missense_Mutation_p.R106P|NRG3_uc001kcq.2_5'UTR	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	327	EGF-like.|Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CAAGGAGTCCGTTGTGATCAA	0.388													37	148	---	---	---	---	PASS
IFIT2	3433	broad.mit.edu	37	10	91066005	91066005	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91066005G>A	uc009xts.2	+	2	467	c.292G>A	c.(292-294)GGA>AGA	p.G98R	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron	NM_001547	NP_001538	P09913	IFIT2_HUMAN	interferon-induced protein with	98					negative regulation of protein binding|response to virus|type I interferon-mediated signaling pathway		protein binding			ovary(1)|skin(1)	2		Colorectal(252;0.0161)				GGTCACCTGGGGAAACTATGC	0.483													27	76	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92508608	92508608	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92508608G>C	uc001kha.2	-	2	1526	c.1283C>G	c.(1282-1284)CCT>CGT	p.P428R	HTR7_uc001kgz.2_Missense_Mutation_p.P428R|HTR7_uc001khb.2_Missense_Mutation_p.P428R	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	428	Cytoplasmic (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	CACAAACTCAGGTCTCTCTGG	0.488													66	198	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97192217	97192217	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97192217C>T	uc001kkp.2	-	4	334	c.289G>A	c.(289-291)GAA>AAA	p.E97K	SORBS1_uc001kkn.2_Missense_Mutation_p.E53K|SORBS1_uc001kkm.2_Missense_Mutation_p.E85K|SORBS1_uc001kko.2_Missense_Mutation_p.E97K|SORBS1_uc001kkq.2_Missense_Mutation_p.E97K|SORBS1_uc001kkr.2_Missense_Mutation_p.E65K|SORBS1_uc001kks.2_Missense_Mutation_p.E65K|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Missense_Mutation_p.E97K|SORBS1_uc001kkv.2_Missense_Mutation_p.E65K|SORBS1_uc001kkw.2_Missense_Mutation_p.E97K|SORBS1_uc010qoe.1_Missense_Mutation_p.E65K|SORBS1_uc010qof.1_Missense_Mutation_p.E65K|SORBS1_uc001kkx.1_Missense_Mutation_p.E65K	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	97					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GGTTTGCTTTCGTGTTGCCGG	0.597													50	140	---	---	---	---	PASS
TCF7L2	6934	broad.mit.edu	37	10	114724335	114724335	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114724335C>T	uc001lae.3	+	4	909	c.402C>T	c.(400-402)AGC>AGT	p.S134S	TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Silent_p.S134S|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1	134					anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		AGTCCGGCAGCACACATTACT	0.393													24	75	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134015632	134015632	+	Intron	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134015632C>T	uc009ybb.2	+							NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4						axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		TAAGAGAAGGCGGCTGTAAGT	0.632													57	92	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1256637	1256637	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1256637C>T	uc009ycr.1	+	39	4977	c.4851C>T	c.(4849-4851)TTC>TTT	p.F1617F	MUC5B_uc009yct.1_Silent_p.F958F|MUC5B_uc001ltb.2_Silent_p.F961F|MUC5B_uc001lta.2_Silent_p.F626F	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	958	VWFD 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TCAAGCTCTTCGTGGAGGTGA	0.647													7	4	---	---	---	---	PASS
MRGPRE	116534	broad.mit.edu	37	11	3249629	3249629	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3249629C>T	uc001lxq.3	-	2	708	c.398G>A	c.(397-399)CGC>CAC	p.R133H		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	133	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCGTGGGCGGCGGCACGAGTA	0.692													3	7	---	---	---	---	PASS
OR51D1	390038	broad.mit.edu	37	11	4661505	4661505	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4661505T>C	uc010qyk.1	+	1	485	c.485T>C	c.(484-486)CTG>CCG	p.L162P		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	162	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTATCTGCCCTGACCAGGGGG	0.527													70	137	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5968872	5968872	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5968872C>T	uc010qzt.1	+	1	296	c.296C>T	c.(295-297)CCT>CTT	p.P99L		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCAGCTTCCCTGCCTGCTTC	0.532													99	163	---	---	---	---	PASS
OR56B4	196335	broad.mit.edu	37	11	6129459	6129459	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6129459A>G	uc010qzx.1	+	1	451	c.451A>G	c.(451-453)ACA>GCA	p.T151A		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTCAAAGCCACAGGGTTCAT	0.502													67	108	---	---	---	---	PASS
ACP2	53	broad.mit.edu	37	11	47267352	47267352	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47267352G>C	uc001nei.2	-	4	448	c.331C>G	c.(331-333)CTC>GTC	p.L111V	ACP2_uc010rhe.1_Missense_Mutation_p.L83V|ACP2_uc009ylj.2_Missense_Mutation_p.L39V|ACP2_uc010rhf.1_Missense_Mutation_p.L79V|ACP2_uc010rhg.1_Missense_Mutation_p.L111V|ACP2_uc010rhh.1_5'UTR|ACP2_uc010rhi.1_5'UTR|ACP2_uc009ylk.2_Missense_Mutation_p.L111V|ACP2_uc010rhj.1_Missense_Mutation_p.L111V|NR1H3_uc009yll.1_5'Flank|NR1H3_uc010rhk.1_5'Flank	NM_001610	NP_001601	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal isoform 1	111	Lumenal (Potential).					integral to membrane|lysosomal lumen|lysosomal membrane	acid phosphatase activity			ovary(1)	1						GCACTCATGAGAGTCCGGTCA	0.473													38	75	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49179593	49179593	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49179593C>T	uc001ngy.2	-	14	1704	c.1443G>A	c.(1441-1443)CTG>CTA	p.L481L	FOLH1_uc001ngz.2_Silent_p.L481L|FOLH1_uc009yly.2_Silent_p.L466L|FOLH1_uc009ylz.2_Silent_p.L466L|FOLH1_uc009yma.2_Silent_p.L173L	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	481	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	CAGGGCTTTTCAGCTACACAA	0.353													33	102	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406751	55406751	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406751G>A	uc010rij.1	+	1	918	c.918G>A	c.(916-918)CTG>CTA	p.L306L		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AAATACTCCTGAAAAGAAATC	0.398													27	79	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861472	55861472	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861472C>A	uc010rix.1	+	1	689	c.689C>A	c.(688-690)GCA>GAA	p.A230E		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					ATCCAGTCAGCAGCAGGCAGG	0.468													46	148	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043676	56043676	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043676C>G	uc001nio.1	+	1	562	c.562C>G	c.(562-564)CAT>GAT	p.H188D		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					TGAAATTAGGCATGTCTTTTG	0.408													106	317	---	---	---	---	PASS
OR8J1	219477	broad.mit.edu	37	11	56128311	56128311	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56128311A>G	uc010rjh.1	+	1	589	c.589A>G	c.(589-591)ACA>GCA	p.T197A		NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J,	197	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CTTACCAGAAACAGTTGTCTT	0.294													40	143	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59283310	59283310	+	Missense_Mutation	SNP	G	C	C	rs12794170		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59283310G>C	uc010rkv.1	+	1	925	c.925G>C	c.(925-927)GAA>CAA	p.E309Q		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGGACAATCAGAAAGGATTTT	0.383													22	65	---	---	---	---	PASS
TMEM132A	54972	broad.mit.edu	37	11	60699238	60699238	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60699238G>T	uc001nqj.2	+	6	1287	c.1094G>T	c.(1093-1095)CGC>CTC	p.R365L	TMEM132A_uc001nqi.2_Missense_Mutation_p.R366L|TMEM132A_uc001nqk.2_Missense_Mutation_p.R378L|TMEM132A_uc001nql.1_Missense_Mutation_p.R378L|TMEM132A_uc001nqm.2_5'Flank	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	365	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1						GCGGTCACTCGCCCCGTCACG	0.587													62	111	---	---	---	---	PASS
ATG16L2	89849	broad.mit.edu	37	11	72536436	72536436	+	Silent	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72536436C>G	uc001otd.2	+	10	1126	c.1086C>G	c.(1084-1086)CTC>CTG	p.L362L	ATG16L2_uc001ote.2_Silent_p.L256L|ATG16L2_uc009ytj.1_Intron|ATG16L2_uc001otf.2_Silent_p.L117L|ATG16L2_uc001otg.2_Silent_p.L96L|ATG16L2_uc009ytk.2_Silent_p.L117L	NM_033388	NP_203746	Q8NAA4	A16L2_HUMAN	ATG16 autophagy related 16-like 2	362	WD 1.				autophagy|protein transport	cytoplasm	protein binding				0			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			TGATCCACCTCTGGAATGTTG	0.602													40	194	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76371022	76371022	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76371022C>G	uc001oxq.3	-	3	1858	c.1615G>C	c.(1615-1617)GAG>CAG	p.E539Q	LRRC32_uc001oxr.3_Missense_Mutation_p.E539Q|LRRC32_uc010rsf.1_Missense_Mutation_p.E525Q	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	539	LRR 20.|Extracellular (Potential).					integral to plasma membrane					0						TCCAGCACCTCCAGTGACACA	0.642													13	136	---	---	---	---	PASS
TYR	7299	broad.mit.edu	37	11	88911877	88911877	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88911877G>A	uc001pcs.2	+	1	838	c.756G>A	c.(754-756)ATG>ATA	p.M252I		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	252	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	ATGAGTACATGGGAGGTCAGC	0.453									Oculocutaneous_Albinism				37	89	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117267306	117267306	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117267306A>G	uc001prc.2	+	26	3404	c.3257A>G	c.(3256-3258)AAG>AGG	p.K1086R	CEP164_uc001prb.2_Missense_Mutation_p.K1089R|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_RNA|CEP164_uc001prg.1_Missense_Mutation_p.K519R	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1086					cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TCCCAGAGCAAGGAGGACTTA	0.493													65	89	---	---	---	---	PASS
SLC37A2	219855	broad.mit.edu	37	11	124954150	124954150	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124954150G>A	uc001qbn.2	+	12	1311	c.1060G>A	c.(1060-1062)GTC>ATC	p.V354I	SLC37A2_uc010sau.1_Missense_Mutation_p.V354I|SLC37A2_uc010sav.1_Intron|SLC37A2_uc001qbp.2_Intron	NM_001145290	NP_001138762	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glycerol-3-phosphate	354	Helical; (Potential).				carbohydrate transport|transmembrane transport	integral to membrane				ovary(2)	2	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		GGCAGGGCTCGTCTCTGACTA	0.622													12	14	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132307159	132307159	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132307159A>C	uc001qgs.2	-	4	671	c.621T>G	c.(619-621)GAT>GAG	p.D207E	OPCML_uc001qgu.2_Missense_Mutation_p.D200E|OPCML_uc010sck.1_Missense_Mutation_p.D207E|OPCML_uc001qgt.2_Missense_Mutation_p.D206E|OPCML_uc010scl.1_Missense_Mutation_p.D166E	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	207	Ig-like C2-type 2.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GCGCAGCGACATCGTTCAACG	0.557													38	83	---	---	---	---	PASS
HSN2	378465	broad.mit.edu	37	12	977342	977342	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:977342A>T	uc001qiq.2	+	1	473	c.347A>T	c.(346-348)CAG>CTG	p.Q116L	WNK1_uc001qio.3_Intron|WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_213655	NP_998820			hereditary sensory neuropathy, type II												0	all_cancers(10;0.0107)|all_epithelial(11;0.0151)|Ovarian(42;0.0512)|all_lung(10;0.0521)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.000967)|BRCA - Breast invasive adenocarcinoma(9;0.0178)			TGTGAGATACAGGTCCATCCT	0.463													14	42	---	---	---	---	PASS
PRMT8	56341	broad.mit.edu	37	12	3662847	3662847	+	Missense_Mutation	SNP	G	C	C	rs17852025		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3662847G>C	uc001qmf.2	+	4	815	c.448G>C	c.(448-450)GAG>CAG	p.E150Q	PRMT8_uc009zed.2_Missense_Mutation_p.E141Q|PRMT8_uc009zee.1_RNA	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4	150				E -> Q (in Ref. 3; AAH22458).	regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TGACTACTCAGAGAAGATCAT	0.443													47	135	---	---	---	---	PASS
ING4	51147	broad.mit.edu	37	12	6760378	6760378	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6760378C>G	uc001qpw.3	-	8	774	c.733G>C	c.(733-735)GAA>CAA	p.E245Q	ING4_uc001qpv.3_Missense_Mutation_p.E244Q|ING4_uc001qpy.3_Missense_Mutation_p.E241Q|ING4_uc001qpx.3_Missense_Mutation_p.E242Q|ING4_uc009zes.2_3'UTR|ING4_uc009zet.2_Missense_Mutation_p.E221Q|ING4_uc009zeu.2_RNA|ING4_uc009zev.2_RNA	NM_001127582	NP_001121054	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4 isoform 9	245	PHD-type.				apoptosis|cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell proliferation|negative regulation of growth|negative regulation of transcription, DNA-dependent|positive regulation of apoptosis	histone acetyltransferase complex	protein binding|transcription coactivator activity|zinc ion binding			central_nervous_system(3)|ovary(1)	4						TTCTTCCGTTCTTGGGAGCAG	0.522													22	49	---	---	---	---	PASS
MIR1244	100302285	broad.mit.edu	37	12	9392068	9392068	+	RNA	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9392068A>G	hsa-mir-1244-3|MI0015975	-			c.80A>G			uc001qvm.1_5'Flank																	0						TGGCCTTTTTAACCATCTCAT	0.303													37	105	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20787990	20787990	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20787990G>C	uc001reh.1	+	8	2023	c.2001G>C	c.(1999-2001)CTG>CTC	p.L667L		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	667					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TGATGTTTCTGGTAGTCCCAT	0.393													28	57	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31249833	31249833	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31249833G>A	uc001rjt.1	+	17	1922	c.1671G>A	c.(1669-1671)CTG>CTA	p.L557L	DDX11_uc001rjr.1_Silent_p.L557L|DDX11_uc001rjs.1_Silent_p.L557L|DDX11_uc001rju.1_Silent_p.L235L|DDX11_uc001rjv.1_Silent_p.L557L|DDX11_uc001rjw.1_Silent_p.L531L|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	557					G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCAGCACCCTGCGACCAGCTT	0.617										Multiple Myeloma(12;0.14)			16	37	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31255916	31255916	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255916G>C	uc001rjt.1	+	24	2670	c.2419G>C	c.(2419-2421)GAG>CAG	p.E807Q	DDX11_uc001rjr.1_Missense_Mutation_p.E807Q|DDX11_uc001rjs.1_Missense_Mutation_p.E757Q|DDX11_uc001rju.1_Missense_Mutation_p.E479Q|DDX11_uc001rjv.1_Missense_Mutation_p.E807Q|DDX11_uc001rjw.1_Missense_Mutation_p.E781Q|DDX11_uc009zjn.1_RNA|DDX11_uc009zjo.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	807					G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGGTCTGCAGAGCTGCAGGA	0.607										Multiple Myeloma(12;0.14)			18	84	---	---	---	---	PASS
OR8S1	341568	broad.mit.edu	37	12	48919954	48919954	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48919954G>C	uc010slu.1	+	1	540	c.540G>C	c.(538-540)GAG>GAC	p.E180D		NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ACAGCTATGAGATGCCATCCC	0.512													43	107	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49425868	49425868	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49425868T>C	uc001rta.3	-	39	12620	c.12620A>G	c.(12619-12621)AAA>AGA	p.K4207R		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4207	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CTGTGGGTTTTTGGCCAGGAC	0.607			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			15	57	---	---	---	---	PASS
SOAT2	8435	broad.mit.edu	37	12	53499708	53499708	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53499708A>C	uc001sbv.2	+	5	441	c.353A>C	c.(352-354)CAG>CCG	p.Q118P	SOAT2_uc009zms.2_RNA	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	118					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						ATGGAGGTGCAGCATTTCCGC	0.557													42	128	---	---	---	---	PASS
HOXC5	3222	broad.mit.edu	37	12	54427045	54427045	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54427045A>G	uc001sew.2	+	1	214	c.139A>G	c.(139-141)ATC>GTC	p.I47V	HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron|MIR615_hsa-mir-615|MI0003628_5'Flank	NM_018953	NP_061826	Q00444	HXC5_HUMAN	homeobox C5	47					regulation of transcription from RNA polymerase II promoter	cell junction|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGACTTAAGCATCACTTTCCC	0.622													23	58	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72335393	72335393	+	Silent	SNP	C	T	T	rs74510566		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72335393C>T	uc009zrw.1	+	2	276	c.135C>T	c.(133-135)GAC>GAT	p.D45D	TPH2_uc001swy.2_Translation_Start_Site	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	45					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	p.D45D(1)		ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GCAAAAATGACGACAAAGGCA	0.393													25	91	---	---	---	---	PASS
OSBPL8	114882	broad.mit.edu	37	12	76791689	76791689	+	Intron	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76791689T>A	uc001sye.1	-						OSBPL8_uc001syf.1_Intron|OSBPL8_uc001syg.1_Intron|OSBPL8_uc001syh.1_Intron	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform						lipid transport		lipid binding			ovary(1)	1						TACAGAAAGATAAATTTATTT	0.338													37	76	---	---	---	---	PASS
EIF2B1	1967	broad.mit.edu	37	12	124115076	124115076	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124115076C>G	uc001ufm.2	-	3	263	c.120G>C	c.(118-120)GAG>GAC	p.E40D	EIF2B1_uc001ufn.2_Missense_Mutation_p.E40D|EIF2B1_uc010tat.1_Missense_Mutation_p.E40D	NM_001414	NP_001405	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B,	40					cellular response to stimulus|oligodendrocyte development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex|membrane fraction|plasma membrane	protein binding|translation initiation factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		CCTGGATTGTCTCCCCTGGAA	0.473													19	57	---	---	---	---	PASS
GALNT9	50614	broad.mit.edu	37	12	132688080	132688080	+	Silent	SNP	G	A	A	rs139441969	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132688080G>A	uc001ukc.3	-	7	1349	c.1233C>T	c.(1231-1233)CAC>CAT	p.H411H	GALNT9_uc009zyr.2_Silent_p.H185H|GALNT9_uc001ukb.2_Silent_p.H268H|GALNT9_uc001uka.2_Silent_p.H45H	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	411	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CCATGTACACGTGGGACTTGA	0.647													17	51	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133349708	133349708	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133349708C>G	uc001ukz.1	-	24	5039	c.4480G>C	c.(4480-4482)GAA>CAA	p.E1494Q		NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1494					intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CCCGGCCCTTCTTTGGAAGCC	0.622													4	8	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32937318	32937318	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32937318A>G	uc001uub.1	+	18	8206	c.7979A>G	c.(7978-7980)TAT>TGT	p.Y2660C		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2660					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ACTTTTAGATATGATACGGAA	0.323			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			34	48	---	---	---	---	PASS
FAM48A	55578	broad.mit.edu	37	13	37595737	37595737	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37595737C>T	uc001uwg.2	-	21	1912	c.1664G>A	c.(1663-1665)GGG>GAG	p.G555E	FAM48A_uc010abt.2_Missense_Mutation_p.G556E|FAM48A_uc001uwh.2_Missense_Mutation_p.G556E|FAM48A_uc001uwi.2_Missense_Mutation_p.G555E|FAM48A_uc001uwj.2_Missense_Mutation_p.G556E|FAM48A_uc001uwk.2_Missense_Mutation_p.G634E|FAM48A_uc001uwd.2_Missense_Mutation_p.G42E|FAM48A_uc001uwe.2_Missense_Mutation_p.G39E|FAM48A_uc001uwf.2_Missense_Mutation_p.G133E	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A	555					autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		AGCCTGGGCCCCACTGCAGGA	0.448													18	23	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38158192	38158192	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38158192T>C	uc001uwo.3	-	9	1275	c.1157A>G	c.(1156-1158)GAT>GGT	p.D386G	POSTN_uc001uwp.3_Missense_Mutation_p.D386G|POSTN_uc001uwr.2_Missense_Mutation_p.D386G|POSTN_uc001uwq.2_Missense_Mutation_p.D386G|POSTN_uc010teu.1_Missense_Mutation_p.D386G|POSTN_uc010tev.1_Missense_Mutation_p.D386G|POSTN_uc010tew.1_Missense_Mutation_p.D386G|POSTN_uc010tex.1_Missense_Mutation_p.D301G	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1	386	FAS1 3.				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GGCCACAAGATCCGTGAAGGT	0.443													27	42	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329873	88329873	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329873C>T	uc001vln.2	+	2	2449	c.2230C>T	c.(2230-2232)CCC>TCC	p.P744S	SLITRK5_uc010tic.1_Missense_Mutation_p.P503S	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	744	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGTGAAGACGCCCGCGGGCCA	0.652													17	26	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96599352	96599352	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96599352C>T	uc001vmt.2	-	15	1786	c.1616G>A	c.(1615-1617)CGA>CAA	p.R539Q		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	539					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						GTTGAAAGCTCGCCAGAGAGC	0.343													64	101	---	---	---	---	PASS
ADPRHL1	113622	broad.mit.edu	37	13	114107615	114107615	+	Silent	SNP	G	A	A	rs148683938		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114107615G>A	uc001vtq.1	-	1	225	c.138C>T	c.(136-138)CTC>CTT	p.L46L		NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	46					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			GCGAGAGTACGAGGTGGTCCA	0.612													34	83	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20482708	20482708	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20482708G>C	uc010tky.1	-	1	645	c.645C>G	c.(643-645)CTC>CTG	p.L215L		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AGGAGATCAGGAGGAGCAGAA	0.498													11	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22574116	22574116	+	Intron	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22574116T>C	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdb.2_Silent_p.C112C					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CATACCTCTGTGCCTTTACAC	0.478													11	27	---	---	---	---	PASS
JPH4	84502	broad.mit.edu	37	14	24041127	24041127	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24041127G>T	uc001wkq.2	-	5	2072	c.1154C>A	c.(1153-1155)GCA>GAA	p.A385E	JPH4_uc010tnr.1_Missense_Mutation_p.A50E|JPH4_uc001wkr.2_Missense_Mutation_p.A385E	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	385	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		GGCGTCTGCTGCCCTGTCGGG	0.607													12	65	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	34204431	34204431	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34204431A>T	uc001wru.2	+	7	809	c.745A>T	c.(745-747)AGC>TGC	p.S249C	NPAS3_uc001wrs.2_Missense_Mutation_p.S236C|NPAS3_uc001wrt.2_Missense_Mutation_p.S217C|NPAS3_uc001wrv.2_Missense_Mutation_p.S219C	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GGAGTCAACCAGCCCCAGTCT	0.468													55	137	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360493	42360493	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360493C>G	uc001wvm.2	+	4	2624	c.1426C>G	c.(1426-1428)CTG>GTG	p.L476V	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	476	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GGTCAATAATCTGGCTGCTGG	0.403										HNSCC(30;0.082)			43	198	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120930	47120930	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120930G>T	uc001wwg.2	-	1	99	c.10C>A	c.(10-12)CGT>AGT	p.R4S		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	4					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CGAGCTGGACGGCGCCCCATG	0.557													24	114	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47315077	47315077	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47315077A>G	uc001wwj.3	-						MDGA2_uc001wwh.3_Intron|MDGA2_uc001wwi.3_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						AAAATGAGCTACAAATATGAA	0.373													22	62	---	---	---	---	PASS
BMP4	652	broad.mit.edu	37	14	54417392	54417392	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54417392G>A	uc001xal.3	-	3	772	c.585C>T	c.(583-585)CTC>CTT	p.L195L	BMP4_uc010aoh.2_Silent_p.L195L|BMP4_uc001xao.3_Silent_p.L195L|BMP4_uc001xan.3_Silent_p.L195L	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	195					activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						GTCGTGTGATGAGGTGCCCAG	0.572													35	126	---	---	---	---	PASS
SLC10A1	6554	broad.mit.edu	37	14	70245164	70245164	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70245164C>T	uc001xlr.2	-	4	963	c.829G>A	c.(829-831)GAA>AAA	p.E277K		NM_003049	NP_003040	Q14973	NTCP_HUMAN	solute carrier family 10, member 1	277					bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(1)	1				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)		CCAATGACTTCAGGTGGAAAG	0.473													52	150	---	---	---	---	PASS
SIPA1L1	26037	broad.mit.edu	37	14	72090948	72090948	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72090948C>G	uc001xms.2	+	4	2161	c.1813C>G	c.(1813-1815)CAA>GAA	p.Q605E	SIPA1L1_uc001xmt.2_Missense_Mutation_p.Q605E|SIPA1L1_uc001xmu.2_Missense_Mutation_p.Q605E|SIPA1L1_uc001xmv.2_Missense_Mutation_p.Q605E|SIPA1L1_uc010ttm.1_Missense_Mutation_p.Q80E	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	605					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTGGATGAACAAGGGGTGAG	0.483													34	105	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77318767	77318767	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77318767G>A	uc001xsx.2	+	8	901	c.787G>A	c.(787-789)GCT>ACT	p.A263T	C14orf166B_uc010asn.1_Missense_Mutation_p.A23T|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	263	LRR 5.										0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CACAAGGGGAGCTGTGGCCTT	0.582													9	26	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86089506	86089506	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86089506G>A	uc001xvr.2	+	2	2415	c.1648G>A	c.(1648-1650)GCG>ACG	p.A550T	FLRT2_uc010atd.2_Missense_Mutation_p.A550T	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	550	Helical; (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GATCGGGGGCGCGGTGATATT	0.587													46	111	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811738	23811738	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811738G>T	uc001ywh.3	+	1	1285	c.809G>T	c.(808-810)GGG>GTG	p.G270V	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.G270V	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	270	Makorin-type Cys-His.					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GACATGTGTGGGCTGCAGACC	0.527													22	65	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28211956	28211956	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28211956C>A	uc001zbh.3	-	15	1626	c.1516G>T	c.(1516-1518)GCC>TCC	p.A506S	OCA2_uc010ayv.2_Missense_Mutation_p.A482S	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	506	Extracellular (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GTGAATCCGGCAAAGTCCAGG	0.338									Oculocutaneous_Albinism				11	43	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28456138	28456138	+	Intron	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28456138A>G	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGAACTTTTTAAAAAGACACC	0.423													35	72	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31329904	31329904	+	Intron	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31329904G>A	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TGTTCAGGAGGAGGCCTCACT	0.363													33	117	---	---	---	---	PASS
CHRNA7	1139	broad.mit.edu	37	15	32455507	32455507	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32455507G>T	uc001zft.2	+	9	1033	c.961G>T	c.(961-963)GAC>TAC	p.D321Y	uc001zfv.1_Intron|CHRNA7_uc010baf.2_Missense_Mutation_p.D140Y|CHRNA7_uc010baj.1_Missense_Mutation_p.D181Y|CHRNA7_uc010bak.2_Missense_Mutation_p.D236Y	NM_000746	NP_000737	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7	321	Cytoplasmic (Potential).				activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	CCACCACCACGACCCCGACGG	0.592													11	31	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34140564	34140564	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34140564G>A	uc001zhi.2	+	94	13640	c.13570G>A	c.(13570-13572)GAA>AAA	p.E4524K	RYR3_uc010bar.2_Missense_Mutation_p.E4519K	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4524					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATATATCACCGAACAGCCATC	0.498													54	108	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42156199	42156199	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42156199G>C	uc001zos.2	-	40	7170	c.6837C>G	c.(6835-6837)ATC>ATG	p.I2279M		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2314	Spectrin 20.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TGATGCTCCTGATGCAGGCAT	0.592													39	103	---	---	---	---	PASS
SLC28A2	9153	broad.mit.edu	37	15	45564978	45564978	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45564978C>G	uc001zva.2	+	17	1920	c.1855C>G	c.(1855-1857)CAG>GAG	p.Q619E		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	619					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		AGGGCTCTTTCAGAGGTGAGC	0.522													22	89	---	---	---	---	PASS
GCNT3	9245	broad.mit.edu	37	15	59910530	59910530	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59910530C>T	uc002age.2	+	3	542	c.93C>T	c.(91-93)TTC>TTT	p.F31F	GCNT3_uc002agd.2_Silent_p.F31F	NM_004751	NP_004742	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin	31	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|membrane fraction	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)	2						AACTTTCTTTCAGGTTGAAGT	0.478													65	177	---	---	---	---	PASS
SLC24A1	9187	broad.mit.edu	37	15	65917025	65917025	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65917025T>C	uc010ujf.1	+	2	894	c.607T>C	c.(607-609)TCC>CCC	p.S203P	SLC24A1_uc010ujd.1_Missense_Mutation_p.S203P|SLC24A1_uc010uje.1_Missense_Mutation_p.S203P|SLC24A1_uc010ujg.1_Missense_Mutation_p.S203P|SLC24A1_uc010ujh.1_Missense_Mutation_p.S203P	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24	203	Extracellular (Potential).				response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						TTACGTGCCGTCCACATTCAT	0.478													9	25	---	---	---	---	PASS
MAP2K1	5604	broad.mit.edu	37	15	66729115	66729115	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66729115G>A	uc010bhq.2	+	3	798	c.323G>A	c.(322-324)CGG>CAG	p.R108Q	MAP2K1_uc010ujp.1_Missense_Mutation_p.R86Q	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	108	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						CCCGCAATCCGGAACCAGATC	0.473									Cardiofaciocutaneous_syndrome				45	108	---	---	---	---	PASS
TBC1D2B	23102	broad.mit.edu	37	15	78305451	78305451	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78305451C>T	uc002bcy.3	-	9	1984	c.1984G>A	c.(1984-1986)GGC>AGC	p.G662S	TBC1D2B_uc010bla.2_Missense_Mutation_p.G662S|TBC1D2B_uc002bda.2_Missense_Mutation_p.G114S	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a	662	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						TGGGGAATGCCCGCACGGATG	0.527													36	91	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3293241	3293241	+	Missense_Mutation	SNP	G	C	C	rs104895171		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3293241G>C	uc002cun.1	-	10	2286	c.2246C>G	c.(2245-2247)TCT>TGT	p.S749C		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	749	B30.2/SPRY.				inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	AAGGGGCCCAGAGAAAGAGCA	0.532													46	108	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4835825	4835825	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4835825C>G	uc002cxq.2	-	4	498	c.357G>C	c.(355-357)CAG>CAC	p.Q119H	SEPT12_uc002cxr.2_Missense_Mutation_p.Q119H|SEPT12_uc010bty.2_RNA|uc002cxt.2_5'Flank	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	119					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CATTGTTGATCTGGTCCCCGA	0.358													24	88	---	---	---	---	PASS
UMOD	7369	broad.mit.edu	37	16	20347982	20347982	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20347982G>A	uc002dgz.2	-	9	1937	c.1808C>T	c.(1807-1809)CCC>CTC	p.P603L	UMOD_uc002dha.2_Missense_Mutation_p.P603L|UMOD_uc002dhb.2_Missense_Mutation_p.P636L	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	603					cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						CCGTGTGATGGGACCCAAGTT	0.532													26	83	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20975047	20975047	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20975047C>A	uc010vbe.1	-	53	10159	c.10159G>T	c.(10159-10161)GAA>TAA	p.E3387*	DNAH3_uc010vbd.1_Nonsense_Mutation_p.E822*	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3387					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCCGTAATTTCCTTCTTCTGT	0.517													43	95	---	---	---	---	PASS
COG7	91949	broad.mit.edu	37	16	23446017	23446017	+	Silent	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23446017C>T	uc002dlo.2	-	5	815	c.627G>A	c.(625-627)AAG>AAA	p.K209K		NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	209					intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)		CAGTAAACACCTTCACAAACA	0.438											OREG0023684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	69	---	---	---	---	PASS
HIRIP3	8479	broad.mit.edu	37	16	30004662	30004662	+	Missense_Mutation	SNP	G	T	T	rs143991731	byFrequency	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30004662G>T	uc002dve.2	-	7	1998	c.1537C>A	c.(1537-1539)CCT>ACT	p.P513T	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|INO80E_uc002dvg.1_5'Flank|INO80E_uc002dvh.1_5'Flank|INO80E_uc002dvi.1_5'Flank|INO80E_uc002dvj.1_5'Flank|INO80E_uc002dvk.1_5'Flank|HIRIP3_uc002dvf.2_3'UTR	NM_003609	NP_003600	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	513					chromatin assembly or disassembly	nucleus	protein binding			central_nervous_system(1)	1						TCTCCTAAAGGGTTCCAGGCT	0.617													33	85	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56924178	56924178	+	Intron	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56924178C>G	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CACCTCCTCTCTTTCCAGTGA	0.413													31	162	---	---	---	---	PASS
NFATC3	4775	broad.mit.edu	37	16	68155895	68155895	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68155895G>C	uc002evo.1	+	2	319	c.109G>C	c.(109-111)GAG>CAG	p.E37Q	NFATC3_uc010vkl.1_5'UTR|NFATC3_uc010vkm.1_5'UTR|NFATC3_uc010vkn.1_5'UTR|NFATC3_uc010vko.1_5'UTR|NFATC3_uc010vkp.1_5'UTR|NFATC3_uc010vkq.1_5'UTR|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Missense_Mutation_p.E37Q|NFATC3_uc002evm.1_Missense_Mutation_p.E37Q|NFATC3_uc002evn.1_Missense_Mutation_p.E37Q|NFATC3_uc010vkr.1_5'UTR|NFATC3_uc010vks.1_5'UTR|NFATC3_uc010vkt.1_5'UTR|NFATC3_uc010vku.1_5'UTR|NFATC3_uc010vkv.1_5'UTR|NFATC3_uc010vkw.1_5'UTR|NFATC3_uc010vkx.1_5'UTR|NFATC3_uc010vky.1_5'UTR|NFATC3_uc010vkz.1_5'UTR|NFATC3_uc010vla.1_5'UTR|NFATC3_uc010vlb.1_5'UTR|NFATC3_uc010vlc.1_5'UTR	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,	37					inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CGTAGATCTTGAGCCAGATGA	0.353													93	723	---	---	---	---	PASS
VAC14	55697	broad.mit.edu	37	16	70818069	70818069	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70818069G>A	uc002ezm.2	-	5	799	c.541C>T	c.(541-543)CGA>TGA	p.R181*	VAC14_uc010cfw.2_5'UTR|VAC14_uc002ezn.2_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog	181	HEAT 3.				interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				ATCCTCTCTCGCAACAAGGGG	0.542													32	52	---	---	---	---	PASS
OSGIN1	29948	broad.mit.edu	37	16	83998920	83998920	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83998920A>G	uc002fha.2	+	7	1374	c.991A>G	c.(991-993)ACG>GCG	p.T331A	OSGIN1_uc002fhb.2_Missense_Mutation_p.T248A|OSGIN1_uc002fhc.2_Missense_Mutation_p.T248A	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	331					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						CGCCACAGGCACGTTCGACAG	0.701													16	23	---	---	---	---	PASS
GAS8	2622	broad.mit.edu	37	16	90109622	90109622	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90109622C>A	uc002fqi.1	+	11	1428	c.1306C>A	c.(1306-1308)CGC>AGC	p.R436S	GAS8_uc010vps.1_Missense_Mutation_p.R411S|GAS8_uc002fqh.2_Missense_Mutation_p.R353S|GAS8_uc010cjc.1_Missense_Mutation_p.R353S|GAS8_uc010vpw.1_Missense_Mutation_p.R353S|GAS8_uc002fqj.1_Missense_Mutation_p.R244S|LOC100130015_uc002fql.2_Intron|LOC100130015_uc010cjd.2_3'UTR	NM_001481	NP_001472	O95995	GAS8_HUMAN	growth arrest-specific 8	436					negative regulation of cell proliferation|sperm motility	cilium|Golgi apparatus|microtubule|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CGACCTGCTGCGCACGTATGA	0.627													26	39	---	---	---	---	PASS
SPNS3	201305	broad.mit.edu	37	17	4352621	4352621	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4352621G>T	uc002fxt.2	+	7	906	c.862G>T	c.(862-864)GCA>TCA	p.A288S	SPNS3_uc002fxu.2_Missense_Mutation_p.A161S	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3	288					lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						TCTGCTCGAGGCACGCGTGGT	0.677													32	51	---	---	---	---	PASS
ZMYND15	84225	broad.mit.edu	37	17	4647727	4647727	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4647727C>T	uc002fyt.2	+	9	1570	c.1531C>T	c.(1531-1533)CCC>TCC	p.P511S	ZMYND15_uc002fyv.2_Missense_Mutation_p.P550S|ZMYND15_uc002fyu.2_Missense_Mutation_p.P550S	NM_032265	NP_115641	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15 isoform 2	511							zinc ion binding				0						TGGCCTGCCCCCCGAAAGCGA	0.597													39	51	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578442	7578442	+	Missense_Mutation	SNP	T	C	C	rs148924904		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578442T>C	uc002gim.2	-	5	682	c.488A>G	c.(487-489)TAC>TGC	p.Y163C	TP53_uc002gig.1_Missense_Mutation_p.Y163C|TP53_uc002gih.2_Missense_Mutation_p.Y163C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y31C|TP53_uc010cng.1_Missense_Mutation_p.Y31C|TP53_uc002gii.1_Missense_Mutation_p.Y31C|TP53_uc010cnh.1_Missense_Mutation_p.Y163C|TP53_uc010cni.1_Missense_Mutation_p.Y163C|TP53_uc002gij.2_Missense_Mutation_p.Y163C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y70C|TP53_uc002gio.2_Missense_Mutation_p.Y31C|TP53_uc010vug.1_Missense_Mutation_p.Y124C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	163	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y163C(95)|p.Y163N(17)|p.Y163H(17)|p.Y163*(7)|p.0?(7)|p.Y163S(4)|p.Y163Y(3)|p.Y163fs*1(2)|p.Y163D(2)|p.Y163fs*7(2)|p.V157_C176del20(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Y163fs*18(1)|p.I162_Y163delIY(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGACTGCTTGTAGATGGCCAT	0.622		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	49	---	---	---	---	PASS
GUCY2D	3000	broad.mit.edu	37	17	7907007	7907007	+	Silent	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7907007C>A	uc002gjt.2	+	2	716	c.642C>A	c.(640-642)TCC>TCA	p.S214S		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	214	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)				CTGTCGCCTCCGTGACTTCCA	0.721													5	16	---	---	---	---	PASS
USP43	124739	broad.mit.edu	37	17	9586219	9586219	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9586219G>C	uc010cod.2	+	7	1185	c.1185G>C	c.(1183-1185)GAG>GAC	p.E395D	USP43_uc002gma.3_Missense_Mutation_p.E84D|USP43_uc010vva.1_Missense_Mutation_p.E395D|USP43_uc010coe.2_Missense_Mutation_p.E192D	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN	ubiquitin specific protease 43	395					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						TCCACAGTGAGAGCAAGGTGC	0.537													47	73	---	---	---	---	PASS
ZNF286A	57335	broad.mit.edu	37	17	15619583	15619583	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15619583C>G	uc010cot.2	+	6	941	c.545C>G	c.(544-546)TCA>TGA	p.S182*	ZNF286A_uc002goz.3_Nonsense_Mutation_p.S70*|ZNF286A_uc010vwa.1_Nonsense_Mutation_p.S182*|ZNF286A_uc002gpa.2_Nonsense_Mutation_p.S182*	NM_001130842	NP_001124314	Q9HBT8	Z286A_HUMAN	zinc finger protein 286	182					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		CACATGAATTCACTCTCTGAG	0.393													46	96	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520409	33520409	+	Silent	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520409T>A	uc002hjd.2	-	1	1004	c.918A>T	c.(916-918)GCA>GCT	p.A306A		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	306	DUF6 2.|Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		TGTCAGAAGGTGCCACAGTCT	0.582													52	154	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38447371	38447371	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38447371G>T	uc002huj.1	+	3	450	c.240G>T	c.(238-240)AAG>AAT	p.K80N		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	80					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						AGCAAGGCAAGAAAGAGAATG	0.418													71	203	---	---	---	---	PASS
EZH1	2145	broad.mit.edu	37	17	40858079	40858079	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40858079C>T	uc002iaz.2	-	16	1930	c.1785G>A	c.(1783-1785)TGG>TGA	p.W595*	EZH1_uc002iba.2_Nonsense_Mutation_p.W586*|EZH1_uc010wgt.1_Nonsense_Mutation_p.W525*|EZH1_uc010wgu.1_Nonsense_Mutation_p.W601*|EZH1_uc010wgv.1_Nonsense_Mutation_p.W555*|EZH1_uc010wgw.1_Nonsense_Mutation_p.W456*|EZH1_uc010cyp.2_Nonsense_Mutation_p.W496*|EZH1_uc010cyq.2_Nonsense_Mutation_p.W512*|EZH1_uc010cyo.1_Nonsense_Mutation_p.W258*	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	595	Cys-rich.			ASEHWDCKVVSC -> PQSTGTARWFPV (in Ref. 2; BAA25019).	anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		CCTTGCAGTCCCAGTGCTCTG	0.537													23	44	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43012642	43012642	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43012642G>C	uc010wji.1	-	3	557	c.456C>G	c.(454-456)CTC>CTG	p.L152L	KIF18B_uc002iht.2_Silent_p.L152L|KIF18B_uc010wjh.1_Silent_p.L152L	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				GGTAGCTGATGAGCACCTCGA	0.652													11	12	---	---	---	---	PASS
MYST2	11143	broad.mit.edu	37	17	47875906	47875906	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47875906G>A	uc002ipm.2	+	4	692	c.566G>A	c.(565-567)GGC>GAC	p.G189D	MYST2_uc002ipl.1_Missense_Mutation_p.G189D|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Missense_Mutation_p.G33D|MYST2_uc010wme.1_Missense_Mutation_p.G33D	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2	189					DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CCTACACCAGGCTGTAACTCT	0.493													60	182	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48269169	48269169	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48269169G>T	uc002iqm.2	-	31	2233	c.2107C>A	c.(2107-2109)CCC>ACC	p.P703T		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	703	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	TCGTTGCCGGGAGCACCGTTG	0.677			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						6	11	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61958203	61958203	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61958203A>G	uc002jco.1	-	4	447	c.385T>C	c.(385-387)TAT>CAT	p.Y129H	GH2_uc002jcj.2_Missense_Mutation_p.Y129H|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Missense_Mutation_p.Y129H|GH2_uc002jcm.1_Missense_Mutation_p.Y129H|GH2_uc002jcn.1_Missense_Mutation_p.Y114H	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	129						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						GAGGCGCCATACACCAGGCTG	0.612													38	96	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62856606	62856606	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62856606G>A	uc002jey.2	-	11	4189	c.3658C>T	c.(3658-3660)CAG>TAG	p.Q1220*	LRRC37A3_uc010wqg.1_Nonsense_Mutation_p.Q338*|LRRC37A3_uc002jex.1_Nonsense_Mutation_p.Q197*|LRRC37A3_uc010wqf.1_Nonsense_Mutation_p.Q258*|LRRC37A3_uc010dek.1_Nonsense_Mutation_p.Q226*	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1220	Extracellular (Potential).					integral to membrane					0						GGCCCCTGCTGTGTGTGAGGC	0.562													81	150	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	5969427	5969427	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5969427G>A	uc002kmz.3	-	18	1766	c.1606C>T	c.(1606-1608)CGG>TGG	p.R536W	L3MBTL4_uc010dkt.2_Missense_Mutation_p.R536W|L3MBTL4_uc002kmy.3_Missense_Mutation_p.R365W	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	536					chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				TGGCTGGCCCGGATGTCAGCC	0.632													22	29	---	---	---	---	PASS
ZNF519	162655	broad.mit.edu	37	18	14105546	14105546	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14105546T>A	uc002kst.1	-	3	1146	c.993A>T	c.(991-993)AGA>AGT	p.R331S	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	331	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGTATGAGCCTCTGTTAAAAG	0.423													75	212	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19997754	19997754	+	Silent	SNP	A	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19997754A>C	uc002ktv.1	-	1	125	c.21T>G	c.(19-21)CCT>CCG	p.P7P		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	7						integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GAAAACCATAAGGATGAGAAT	0.498													12	41	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63511180	63511180	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63511180G>T	uc002ljz.2	+	7	1439	c.1114G>T	c.(1114-1116)GAT>TAT	p.D372Y	CDH7_uc002lka.2_Missense_Mutation_p.D372Y|CDH7_uc002lkb.2_Missense_Mutation_p.D372Y	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	372	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GGAAGATGTAGATGAGCCCCC	0.502													48	77	---	---	---	---	PASS
SIRT6	51548	broad.mit.edu	37	19	4179213	4179213	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4179213C>A	uc002lzo.2	-	3	325	c.265G>T	c.(265-267)GCG>TCG	p.A89S	SIRT6_uc002lzn.2_Missense_Mutation_p.A17S|SIRT6_uc002lzp.2_Intron|SIRT6_uc010xid.1_Missense_Mutation_p.A17S|SIRT6_uc002lzq.2_Missense_Mutation_p.A89S|SIRT6_uc002lzr.2_Missense_Mutation_p.A17S	NM_016539	NP_057623	Q8N6T7	SIRT6_HUMAN	sirtuin 6	89	Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation	nuclear telomeric heterochromatin|nucleoplasm	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|protein binding|zinc ion binding			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGGCCGCGCGCTCTCAAAG	0.682													3	17	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9057422	9057422	+	Silent	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057422T>C	uc002mkp.2	-	3	30228	c.30024A>G	c.(30022-30024)TCA>TCG	p.S10008S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10010	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCTCTTCCATGATGGATTTT	0.453													52	279	---	---	---	---	PASS
ANGPTL6	83854	broad.mit.edu	37	19	10203304	10203304	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10203304G>C	uc002mmx.1	-	6	1492	c.1374C>G	c.(1372-1374)CTC>CTG	p.L458L	C19orf66_uc002mmu.3_3'UTR|C19orf66_uc002mmv.3_3'UTR|C19orf66_uc002mmw.3_3'UTR|ANGPTL6_uc002mmy.1_Silent_p.L458L	NM_031917	NP_114123	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6 precursor	458	Fibrinogen C-terminal.				angiogenesis|cell differentiation|signal transduction	extracellular space	receptor binding				0			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			CGGCCTTCCTGAGAGAATATG	0.587													29	247	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15365027	15365027	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15365027G>C	uc002nar.2	-	11	2316	c.2094C>G	c.(2092-2094)TTC>TTG	p.F698L	BRD4_uc002nas.2_Missense_Mutation_p.F698L|BRD4_uc002nat.3_Missense_Mutation_p.F698L	NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	698	Ser-rich.				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CTGAGGACGAGAAGCCCTTCA	0.552			T	NUT|C15orf55	lethal midline carcinoma of young people								18	59	---	---	---	---	PASS
CYP4F22	126410	broad.mit.edu	37	19	15640674	15640674	+	Intron	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15640674C>T	uc002nbh.3	+							NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						GGTACGTGGGCTGGGCCTCCG	0.428													43	119	---	---	---	---	PASS
PGLS	25796	broad.mit.edu	37	19	17631857	17631857	+	Silent	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17631857G>C	uc002ngw.2	+	5	794	c.744G>C	c.(742-744)CTG>CTC	p.L248L	FAM129C_uc010xpq.1_5'Flank|FAM129C_uc010xpr.1_5'Flank	NM_012088	NP_036220	O95336	6PGL_HUMAN	6-phosphogluconolactonase	248						cytosol	6-phosphogluconolactonase activity				0						CCCGCCTCCTGACCGTGCCCT	0.692													4	15	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33663274	33663274	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33663274G>C	uc002nui.2	+	10	1248	c.1170G>C	c.(1168-1170)TGG>TGC	p.W390C		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	390	WD 7.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					TGAGACTGTGGAATATTGAAG	0.289													39	140	---	---	---	---	PASS
SLC7A10	56301	broad.mit.edu	37	19	33703916	33703916	+	Intron	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33703916G>A	uc002num.2	-						SLC7A10_uc002nul.2_5'Flank|SLC7A10_uc010xrq.1_Intron	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN	solute carrier family 7, member 10						blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(110;0.137)					AAGCTGGAAGGAGCAGGGGCG	0.662													8	18	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37129562	37129562	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37129562G>C	uc002oem.2	-	6	1913	c.1685C>G	c.(1684-1686)GCA>GGA	p.A562G	ZNF461_uc002oen.2_Missense_Mutation_p.A531G|ZNF461_uc010xtj.1_Missense_Mutation_p.A539G	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	562					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATTTCATGATGCTAGACTAGG	0.343													15	28	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41063074	41063074	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41063074T>A	uc002ony.2	+	26	5521	c.5435T>A	c.(5434-5436)CTG>CAG	p.L1812Q	SPTBN4_uc002onx.2_Missense_Mutation_p.L1812Q|SPTBN4_uc002onz.2_Missense_Mutation_p.L1812Q|SPTBN4_uc010egx.2_Missense_Mutation_p.L555Q|SPTBN4_uc002ooa.2_Missense_Mutation_p.L488Q	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1812	Spectrin 15.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAGGACGGACTGAACGAGGCC	0.642													7	27	---	---	---	---	PASS
EMP3	2014	broad.mit.edu	37	19	48830165	48830165	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48830165G>A	uc002piv.2	+	2	318	c.64G>A	c.(64-66)GCC>ACC	p.A22T		NM_001425	NP_001416	P54852	EMP3_HUMAN	epithelial membrane protein 3	22	Helical; (Potential).				cell growth|negative regulation of cell proliferation	integral to membrane					0		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GCTTTTCGTGGCCACTTTGGA	0.577													83	219	---	---	---	---	PASS
KCNA7	3743	broad.mit.edu	37	19	49575579	49575579	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49575579G>A	uc002pmg.2	-	1	620	c.264C>T	c.(262-264)GTC>GTT	p.V88V		NM_031886	NP_114092	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related	88						voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(1)	1		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)		CTTCCAGGAAGACGTCGAGCG	0.736													9	10	---	---	---	---	PASS
ZNF808	388558	broad.mit.edu	37	19	53056834	53056834	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53056834A>T	uc010epq.1	+	5	842	c.665A>T	c.(664-666)CAG>CTG	p.Q222L	ZNF808_uc002pzq.2_RNA|ZNF808_uc010epr.1_5'Flank	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	222					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CCACAAAAACAGGAAGTACAC	0.383													124	286	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640894	57640894	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640894A>T	uc002qny.2	+	4	1207	c.851A>T	c.(850-852)CAG>CTG	p.Q284L		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	284					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAGCAACTGCAGCAGGGGTTC	0.458													37	121	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58102492	58102492	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58102492G>T	uc002qpg.2	+	4	1410	c.1313G>T	c.(1312-1314)GGC>GTC	p.G438V	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.G383V|ZIK1_uc002qpi.2_Missense_Mutation_p.G425V|ZIK1_uc002qpj.2_Missense_Mutation_p.G335V	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	438	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TATGAGTGTGGCCAGTGTGGA	0.458													24	69	---	---	---	---	PASS
ZNF135	7694	broad.mit.edu	37	19	58579207	58579207	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58579207C>T	uc010yhq.1	+	5	1487	c.1391C>T	c.(1390-1392)TCA>TTA	p.S464L	ZNF135_uc002qre.2_Missense_Mutation_p.S452L|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Missense_Mutation_p.S410L|ZNF135_uc002qrg.2_Missense_Mutation_p.S422L|ZNF135_uc010yhr.1_Missense_Mutation_p.S273L	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	464					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CACAGCTCCTCACTCAGCCAG	0.567													18	48	---	---	---	---	PASS
AHCY	191	broad.mit.edu	37	20	32873392	32873392	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32873392C>T	uc002xai.2	-	9	1160	c.1021G>A	c.(1021-1023)GAG>AAG	p.E341K	AHCY_uc002xaj.2_Missense_Mutation_p.E313K	NM_000687	NP_000678	P23526	SAHH_HUMAN	adenosylhomocysteinase isoform 1	341					methylation|xenobiotic metabolic process	cytosol|melanosome	adenosylhomocysteinase activity|protein binding				0						AGCCGACCCTCGGCCAGCAGG	0.632													26	89	---	---	---	---	PASS
CTSA	5476	broad.mit.edu	37	20	44526355	44526355	+	Splice_Site	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44526355G>C	uc002xqj.3	+	13	1639	c.1165_splice	c.e13-1	p.K389_splice	CTSA_uc002xqh.2_Splice_Site_p.K407_splice|CTSA_uc002xqi.2_Splice_Site|CTSA_uc010zxi.1_Splice_Site_p.K390_splice|CTSA_uc002xqk.3_Splice_Site_p.K389_splice	NM_001127695	NP_001121167	P10619	PPGB_HUMAN	cathepsin A isoform b precursor						intracellular protein transport|proteolysis	endoplasmic reticulum|lysosome|nucleus	enzyme activator activity|protein binding|serine-type carboxypeptidase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TCCTGCTTTAGAAATACCAGA	0.488													33	87	---	---	---	---	PASS
ZBP1	81030	broad.mit.edu	37	20	56185231	56185231	+	Missense_Mutation	SNP	C	A	A	rs77921447		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56185231C>A	uc002xyo.2	-	7	1348	c.1067G>T	c.(1066-1068)GGA>GTA	p.G356V	ZBP1_uc010gjm.2_Missense_Mutation_p.G355V|ZBP1_uc002xyp.2_Missense_Mutation_p.G281V	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1 isoform a	356						cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			CTCCCCCTCTCCAGACCCTGC	0.587													67	167	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58348415	58348415	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58348415C>A	uc002yau.2	+	6	1300	c.833C>A	c.(832-834)TCT>TAT	p.S278Y	PHACTR3_uc002yat.2_Missense_Mutation_p.S275Y|PHACTR3_uc010zzw.1_Missense_Mutation_p.S237Y|PHACTR3_uc002yav.2_Missense_Mutation_p.S237Y|PHACTR3_uc002yaw.2_Missense_Mutation_p.S237Y|PHACTR3_uc002yax.2_Missense_Mutation_p.S167Y	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	278						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCCACGGGGTCTCCGCATCTC	0.672													23	79	---	---	---	---	PASS
OSBPL2	9885	broad.mit.edu	37	20	60835156	60835156	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60835156C>G	uc002yck.1	+	3	359	c.157C>G	c.(157-159)CAA>GAA	p.Q53E	OSBPL2_uc002ycl.1_Missense_Mutation_p.Q41E|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform	53					lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			GAGGCCCTCTCAAGAGAACGG	0.438													54	142	---	---	---	---	PASS
TNFRSF6B	8771	broad.mit.edu	37	20	62329796	62329796	+	Silent	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62329796C>G	uc002yfy.2	+	7	1217	c.783C>G	c.(781-783)CTC>CTG	p.L261L	RTEL1_uc002yfw.2_RNA|TNFRSF6B_uc002yfz.2_Silent_p.L261L	NM_032945	NP_116563	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily,	261					anti-apoptosis|apoptosis	extracellular region|soluble fraction	protein binding|receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			GTCGGCGGCTCACGGAGCTCC	0.771													5	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10863025	10863025	+	IGR	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10863025T>C								None (None upstream) : TPTE (43718 downstream)																							GTCTGAGATCTGAGGACACGG	0.507													53	656	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16339226	16339226	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16339226C>A	uc002yjx.2	-	4	1886	c.1288G>T	c.(1288-1290)GGT>TGT	p.G430C		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	430	Repression domain 2.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CTTTCATCACCACTGCTGTCA	0.388													89	276	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30402967	30402967	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30402967A>G	uc002ymy.2	+	3	315	c.113A>G	c.(112-114)AAG>AGG	p.K38R	USP16_uc002ymx.2_Missense_Mutation_p.K38R|USP16_uc002ymw.2_Missense_Mutation_p.K38R|USP16_uc011acm.1_Missense_Mutation_p.K24R|USP16_uc011acn.1_Intron	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	38					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						AATTTGAAAAAGGCTTTAGTG	0.328													36	106	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	30925892	30925892	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30925892G>A	uc002yno.1	-	17	3205	c.2741C>T	c.(2740-2742)TCA>TTA	p.S914L	GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	914	Cytoplasmic (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	AGTATGAACTGAGGACTGTTT	0.348													51	124	---	---	---	---	PASS
AIFM3	150209	broad.mit.edu	37	22	21331176	21331176	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21331176G>A	uc002ztj.2	+	13	1385	c.1167G>A	c.(1165-1167)GTG>GTA	p.V389V	AIFM3_uc002ztk.2_Silent_p.V389V|AIFM3_uc002ztl.2_Silent_p.V395V|AIFM3_uc011ahx.1_Silent_p.V377V|AIFM3_uc002ztm.1_Silent_p.V201V|LZTR1_uc002ztn.2_5'Flank	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	389					activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ACAACCGGGTGAAGTTCTACA	0.637													45	117	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26270356	26270356	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26270356C>G	uc003abz.1	+	23	4305	c.4055C>G	c.(4054-4056)TCT>TGT	p.S1352C	MYO18B_uc003aca.1_Missense_Mutation_p.S1233C|MYO18B_uc010guy.1_Missense_Mutation_p.S1234C|MYO18B_uc010guz.1_Missense_Mutation_p.S1233C|MYO18B_uc011aka.1_Missense_Mutation_p.S506C|MYO18B_uc011akb.1_Missense_Mutation_p.S865C	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1352	IQ.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						GGCTTTCTGTCTCGCCAGGAA	0.547													17	66	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26291236	26291236	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26291236C>G	uc003abz.1	+	28	4907	c.4657C>G	c.(4657-4659)CTG>GTG	p.L1553V	MYO18B_uc003aca.1_Missense_Mutation_p.L1434V|MYO18B_uc010guy.1_Missense_Mutation_p.L1435V|MYO18B_uc010guz.1_Missense_Mutation_p.L1433V|MYO18B_uc011aka.1_Missense_Mutation_p.L707V|MYO18B_uc011akb.1_Missense_Mutation_p.L1066V	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1553	Potential.|Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CAGGAAAGAGCTGGAGCAAAA	0.552													4	14	---	---	---	---	PASS
NF2	4771	broad.mit.edu	37	22	30067803	30067803	+	Intron	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30067803C>T	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron|NF2_uc011akq.1_5'Flank	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						TGTTTTTCTTCACCCCTCGCA	0.572			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				21	36	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30890207	30890207	+	Intron	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30890207C>T	uc003aid.2	-						SEC14L4_uc011akz.1_Intron|SEC14L4_uc003aie.2_Intron|SEC14L4_uc003aif.2_Intron	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a							integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	ACTGTGGAGTCAAGATGAGTC	0.522													19	76	---	---	---	---	PASS
SFI1	9814	broad.mit.edu	37	22	31946267	31946267	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31946267G>A	uc003ale.2	+	6	870	c.477G>A	c.(475-477)CAG>CAA	p.Q159Q	SFI1_uc003ald.1_Silent_p.Q135Q|SFI1_uc003alf.2_Silent_p.Q159Q|SFI1_uc003alg.2_Silent_p.Q77Q|SFI1_uc011alp.1_Silent_p.Q77Q|SFI1_uc011alq.1_Silent_p.Q135Q|SFI1_uc003alh.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	159	HAT 1.				G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TGATGTTCCAGACGTGGAAGA	0.363													16	40	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22292129	22292129	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22292129C>T	uc004dai.1	+	1	1070	c.1021C>T	c.(1021-1023)CGT>TGT	p.R341C		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	341	Pro-rich.					intracellular	zinc ion binding			lung(1)|pancreas(1)	2						TCCTCCACTACGTGCTCCCCA	0.428													41	44	---	---	---	---	PASS
EFHC2	80258	broad.mit.edu	37	X	44101369	44101369	+	Silent	SNP	G	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44101369G>A	uc004dgb.3	-	9	1368	c.1278C>T	c.(1276-1278)GAC>GAT	p.D426D		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	426							calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						TCAAGCACCTGTCTTTTTCCA	0.433													9	14	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49076220	49076220	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49076220C>G	uc004dnb.2	-	20	2511	c.2449G>C	c.(2449-2451)GAG>CAG	p.E817Q	CACNA1F_uc010nip.2_Missense_Mutation_p.E806Q	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	817	Poly-Glu.|Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	tcttcttcctcttcttcctcc	0.279													5	3	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65412100	65412100	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65412100C>A	uc011moz.1	+	7	1261	c.1201C>A	c.(1201-1203)CAT>AAT	p.H401N	HEPH_uc004dwn.2_Missense_Mutation_p.H401N|HEPH_uc004dwo.2_Missense_Mutation_p.H131N|HEPH_uc010nkr.2_Missense_Mutation_p.H401N|HEPH_uc011mpa.1_Missense_Mutation_p.H401N	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	398	Extracellular (Potential).|Plastocyanin-like 3.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CCCGATGGGGCATGATGGGAG	0.502													33	31	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67652753	67652753	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67652753T>C	uc004dww.3	-	2	404	c.110A>G	c.(109-111)AAA>AGA	p.K37R	OPHN1_uc011mpg.1_Missense_Mutation_p.K37R|OPHN1_uc004dwx.2_Missense_Mutation_p.K37R|OPHN1_uc010nku.1_RNA	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	37					axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						GATTACGTCTTTGATGAATTT	0.522													20	15	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83129187	83129187	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83129187G>C	uc004eei.1	+	4	1492	c.1471G>C	c.(1471-1473)GAG>CAG	p.E491Q	CYLC1_uc004eeh.1_Missense_Mutation_p.E490Q	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	491	6.				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						ATCTGATTTGGAGTTAAAGAA	0.343													12	11	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91134171	91134171	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91134171A>G	uc004efk.1	+	2	3777	c.2932A>G	c.(2932-2934)ATC>GTC	p.I978V	PCDH11X_uc004efl.1_Missense_Mutation_p.I978V|PCDH11X_uc004efo.1_Missense_Mutation_p.I978V|PCDH11X_uc010nmv.1_Missense_Mutation_p.I978V|PCDH11X_uc004efm.1_Missense_Mutation_p.I978V|PCDH11X_uc004efn.1_Missense_Mutation_p.I978V|PCDH11X_uc004efh.1_Missense_Mutation_p.I978V|PCDH11X_uc004efj.1_Missense_Mutation_p.I978V	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	978	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CTGTGACTCTATCTCCAAGTG	0.512													96	107	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91873392	91873392	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91873392C>G	uc004efk.1	+	7	4342	c.3497C>G	c.(3496-3498)GCA>GGA	p.A1166G	PCDH11X_uc004efl.1_Missense_Mutation_p.A1156G|PCDH11X_uc004efo.1_Missense_Mutation_p.A1129G|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.A1158G|PCDH11X_uc004efn.1_Missense_Mutation_p.A1148G	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1166	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TCTTCGCAAGCACAGGCCTCT	0.562													28	24	---	---	---	---	PASS
NLGN4Y	22829	broad.mit.edu	37	Y	16952514	16952514	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:16952514C>T	uc004ftg.2	+	6	2075	c.1823C>T	c.(1822-1824)TCA>TTA	p.S608L	NLGN4Y_uc004fte.2_Missense_Mutation_p.S440L|NLGN4Y_uc011nas.1_Missense_Mutation_p.S628L|NLGN4Y_uc004ftf.2_Missense_Mutation_p.S301L|NLGN4Y_uc004fth.2_Missense_Mutation_p.S608L	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked isoform 1	608	Extracellular (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity				0						CAGTATGTTTCAACAACCACA	0.493													60	210	---	---	---	---	PASS
SLC2A7	155184	broad.mit.edu	37	1	9082740	9082744	+	Intron	DEL	CACCT	-	-	rs140724943		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9082740_9082744delCACCT	uc009vmo.1	-							NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7							integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		aaggctgcaccacctctgtggcagg	0.015													7	5	---	---	---	---	
SEPN1	57190	broad.mit.edu	37	1	26139056	26139057	+	Intron	DEL	AC	-	-	rs66781270		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26139056_26139057delAC	uc010oer.1	+						SEPN1_uc010oes.1_Intron	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor							endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		ctacacacaaacacacacacac	0.173													4	2	---	---	---	---	
RAB3B	5865	broad.mit.edu	37	1	52446101	52446102	+	Intron	INS	-	A	A	rs80211476		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52446101_52446102insA	uc001cth.2	-							NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						ctgtctctaccaaaaaaaaaaa	0.218													5	5	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCCGCCTCAGCCGCCGCCCGAA	0.695			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	3	---	---	---	---	
VPS45	11311	broad.mit.edu	37	1	150054597	150054597	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150054597delA	uc001etp.2	+						VPS45_uc010pbp.1_Intron|VPS45_uc010pbq.1_Intron|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_Intron|VPS45_uc009wlm.1_Intron	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A						blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			actctgtctcaaaaaaaaaaa	0.154													7	4	---	---	---	---	
ANXA9	8416	broad.mit.edu	37	1	150960204	150960204	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150960204delA	uc001ewa.2	+							NM_003568	NP_003559	O76027	ANXA9_HUMAN	annexin A9						cell-cell adhesion	cell surface|cytosol	acetylcholine receptor activity|calcium ion binding|calcium-dependent phospholipid binding|phosphatidylserine binding|protein homodimerization activity				0	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			agtccttctcaaaaaaaaaaa	0.204													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6953876	6953879	+	IGR	DEL	GAGG	-	-	rs112872966		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6953876_6953879delGAGG								LOC400940 (825512 upstream) : CMPK2 (26624 downstream)																							gggagggagagagggagggaggaa	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128824754	128824754	+	IGR	DEL	A	-	-	rs113610724		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128824754delA								SAP130 (39121 upstream) : UGGT1 (24000 downstream)																							gactccatctaaaaaaaaaaa	0.174													4	3	---	---	---	---	
TUBA3D	113457	broad.mit.edu	37	2	132238482	132238483	+	Intron	DEL	TC	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132238482_132238483delTC	uc002tsu.3	+							NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		TTCAGTGAtttctttttttttt	0.228													6	3	---	---	---	---	
VENTXP7	391518	broad.mit.edu	37	3	21447901	21447902	+	RNA	INS	-	CC	CC	rs143568999	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21447901_21447902insCC	uc003ccd.2	+	1		c.684_685insCC				NR_002311				Homo sapiens VENT homeobox (Xenopus laevis) pseudogene 7 (VENTXP7), non-coding RNA.												0						CTGGCATACCACCCCCCACGCC	0.663													2	6	---	---	---	---	
STAB1	23166	broad.mit.edu	37	3	52555005	52555005	+	Frame_Shift_Del	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52555005delT	uc003dej.2	+	55	5966	c.5892delT	c.(5890-5892)TATfs	p.Y1964fs	STAB1_uc003dek.1_5'UTR|STAB1_uc003del.2_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1964	Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTGGTCACTATGGCAGTGAGT	0.602													30	15	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53139428	53139431	+	Intron	DEL	CCCG	-	-	rs60969367		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53139428_53139431delCCCG	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		agactctatcCCCGCCCCCCCCCC	0.270													4	3	---	---	---	---	
EIF4E3	317649	broad.mit.edu	37	3	71745871	71745871	+	Intron	DEL	T	-	-	rs72111632		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71745871delT	uc003dov.3	-						EIF4E3_uc011bgc.1_Intron|EIF4E3_uc003dox.2_Intron|EIF4E3_uc011bgd.1_Intron|EIF4E3_uc010hoc.2_Intron	NM_001134651	NP_001128123	Q8N5X7	IF4E3_HUMAN	eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)		tatatctgaattttttttttt	0.055													4	2	---	---	---	---	
CD47	961	broad.mit.edu	37	3	107789994	107789995	+	Frame_Shift_Ins	INS	-	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107789994_107789995insA	uc003dwt.1	-	3	615_616	c.435_436insT	c.(433-438)ATTGTTfs	p.I145fs	CD47_uc003dwu.1_Frame_Shift_Ins_p.I145fs|CD47_uc003dwv.1_Frame_Shift_Ins_p.I145fs|CD47_uc003dww.1_Frame_Shift_Ins_p.I145fs	NM_001777	NP_001768	Q08722	CD47_HUMAN	CD47 antigen isoform 1 precursor	145_146	Helical; (Potential).				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			GGGAAAATAACAATAAGAATAT	0.282													21	10	---	---	---	---	
ZNF80	7634	broad.mit.edu	37	3	113956106	113956106	+	5'UTR	DEL	C	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113956106delC	uc010hqo.2	-	1					ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				ttctgatgttcggatgtgttc	0.000													4	2	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169846305	169846305	+	Intron	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169846305delT	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AACAATGGCATTTTTTTTTTT	0.303													6	3	---	---	---	---	
RAB28	9364	broad.mit.edu	37	4	13485836	13485836	+	5'UTR	DEL	G	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13485836delG	uc003gmu.2	-	1					RAB28_uc003gmt.2_5'UTR|RAB28_uc011bwz.1_5'UTR|RAB28_uc003gmv.2_RNA	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1						small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2						TGAAGGCTCCGGGGGCGGGGG	0.692													4	2	---	---	---	---	
RBM47	54502	broad.mit.edu	37	4	40493811	40493811	+	Intron	DEL	C	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40493811delC	uc003gvc.2	-						RBM47_uc003gvd.2_Intron|RBM47_uc003gve.2_Intron|RBM47_uc011bys.1_Intron|RBM47_uc003gvg.1_Intron	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a							nucleus	nucleotide binding|RNA binding			breast(3)	3						CGATGTGCCACCGCTGTGGCT	0.468													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70422729	70422730	+	Intron	INS	-	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70422729_70422730insG	uc010iyn.2	-											Homo sapiens cDNA FLJ78390 complete cds.																		CGGGGCGGGGCGGGGGGGAAGA	0.406													4	2	---	---	---	---	
ERAP1	51752	broad.mit.edu	37	5	96117713	96117713	+	Intron	DEL	T	-	-	rs142478570		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96117713delT	uc003kmm.2	-						ERAP1_uc003kml.2_Intron|ERAP1_uc010jbm.1_Intron|ERAP1_uc003kmn.2_Intron	NM_001040458	NP_001035548	Q9NZ08	ERAP1_HUMAN	type 1 tumor necrosis factor receptor shedding						angiogenesis|antigen processing and presentation of endogenous peptide antigen via MHC class I|fat cell differentiation|membrane protein ectodomain proteolysis|regulation of blood pressure|regulation of innate immune response|response to bacterium	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|integral to membrane	aminopeptidase activity|interleukin-1, Type II receptor binding|interleukin-6 receptor binding|metalloexopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TCAGTTACAAttttttttttt	0.189													5	3	---	---	---	---	
CHD1	1105	broad.mit.edu	37	5	98204036	98204036	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98204036delA	uc003knf.2	-						CHD1_uc010jbn.2_Intron	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	ctcaaaaaagaaaaaaaaaaa	0.100													9	5	---	---	---	---	
TXNDC15	79770	broad.mit.edu	37	5	134232341	134232342	+	Intron	INS	-	T	T	rs11438328		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134232341_134232342insT	uc003lac.1	+						TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_Intron	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor						cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ttttttttcccttttttttttt	0.114													4	3	---	---	---	---	
FAM193B	54540	broad.mit.edu	37	5	176966139	176966140	+	5'UTR	INS	-	G	G			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176966139_176966140insG	uc003mhs.3	-	3					FAM193B_uc003mht.2_5'Flank|FAM193B_uc003mhu.2_5'Flank|FAM193B_uc003mhv.2_5'UTR|FAM193B_uc003mhw.2_RNA	NM_019057	NP_061930	E9PET5	E9PET5_HUMAN	hypothetical protein LOC54540												0						TGGCTGGAGGCGGGGGGGACCT	0.475													10	15	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179528352	179528353	+	3'UTR	DEL	GG	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179528352_179528353delGG	uc003mlq.2	-	13					RASGEF1C_uc003mlr.2_3'UTR|RASGEF1C_uc003mlp.3_3'UTR	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCACTGTGGGGGGGGGGGG	0.668													4	2	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74115749	74115749	+	Intron	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74115749delT	uc003pgw.2	+						DDX43_uc011dyn.1_Intron	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						AAATATGTACttttttttttt	0.199													4	2	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124676680	124676711	+	Intron	DEL	CTTTTTCTTAAGCAAAACTAAGTGAACTGTTG	-	-	rs150242620	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124676680_124676711delCTTTTTCTTAAGCAAAACTAAGTGAACTGTTG	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		CAAAAATGTACTTTTTCTTAAGCAAAACTAAGTGAACTGTTGCTTATTATAG	0.302													8	5	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159147883	159147884	+	Intron	DEL	TT	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159147883_159147884delTT	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TTGAACtttctttttttttttt	0.193													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74160435	74160436	+	Intron	INS	-	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74160435_74160436insT	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_5'Flank	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AACTATTTTTCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99578706	99578706	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99578706delA	uc003usi.2	+											RecName: Full=Putative zinc-alpha-2-glycoprotein-like 2; Flags: Precursor;																		cttagtttacagtgaaaacaa	0.164													4	3	---	---	---	---	
XKR5	389610	broad.mit.edu	37	8	6679301	6679302	+	Intron	DEL	CA	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6679301_6679302delCA	uc003wqp.2	-						XKR5_uc003wqq.2_Intron|XKR5_uc003wqr.1_Intron	NM_207411	NP_997294	Q6UX68	XKR5_HUMAN	XK-related protein 5a							integral to membrane					0			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TGCATTGGTGcacacacacaca	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103753690	103753691	+	IGR	DEL	AC	-	-	rs13260659		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103753690_103753691delAC								KLF10 (85707 upstream) : AZIN1 (84846 downstream)																							cttaaaacatacacacacacac	0.163													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110509659	110509659	+	Intron	DEL	C	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110509659delC	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAAAACCGttctttttttttt	0.224										HNSCC(38;0.096)			4	3	---	---	---	---	
SYBU	55638	broad.mit.edu	37	8	110631460	110631460	+	Intron	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110631460delT	uc003ynj.3	-						SYBU_uc003yni.3_Intron|SYBU_uc003ynk.3_Intron|SYBU_uc010mco.2_Intron|SYBU_uc003ynl.3_Intron|SYBU_uc010mcp.2_Intron|SYBU_uc010mcq.2_Intron|SYBU_uc003yno.3_Intron|SYBU_uc010mcr.2_Intron|SYBU_uc003ynm.3_Intron|SYBU_uc003ynn.3_Intron|SYBU_uc010mcs.2_Intron|SYBU_uc010mct.2_Intron|SYBU_uc010mcu.2_Intron|SYBU_uc003ynp.3_Intron|SYBU_uc010mcv.2_Intron	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						ATGCAAAACCttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129660047	129660048	+	IGR	INS	-	TTTC	TTTC	rs141640170	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129660047_129660048insTTTC								MIR1208 (497613 upstream) : None (None downstream)																							ttctctttctttttctttcttt	0.045													3	3	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77417178	77417178	+	Intron	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77417178delT	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_5'UTR	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTCCTAGAGATTTTTTTTAAT	0.299													24	11	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618916	137618917	+	Intron	INS	-	GGAC	GGAC	rs139171326	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618916_137618917insGGAC	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		gatggatggatggatggatggG	0.238													4	3	---	---	---	---	
ZMYND19	116225	broad.mit.edu	37	9	140482898	140482907	+	Intron	DEL	GTGGGCCACA	-	-	rs3831164		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140482898_140482907delGTGGGCCACA	uc004cno.1	-							NM_138462	NP_612471	Q96E35	ZMY19_HUMAN	zinc finger, MYND domain containing 19							Golgi apparatus|plasma membrane	zinc ion binding			skin(1)	1	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		GCCAGGCCATGTGGGCCACAGTGGGCTCCA	0.586													3	3	---	---	---	---	
SUPV3L1	6832	broad.mit.edu	37	10	70960397	70960397	+	Intron	DEL	A	-	-	rs35423280		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70960397delA	uc001jpe.1	+						SUPV3L1_uc010qjd.1_Intron	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor						DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						AAACTGCATTAAAAAAAGCCC	0.408													4	3	---	---	---	---	
PCGF6	84108	broad.mit.edu	37	10	105086146	105086146	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105086146delA	uc001kwt.2	-						PCGF6_uc001kwu.2_Intron|PCGF6_uc009xxk.2_Intron|PCGF6_uc009xxl.2_Intron|PCGF6_uc009xxm.2_Intron	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a						negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		actccatctcaaaaaaaaaaa	0.124													6	3	---	---	---	---	
OR51V1	283111	broad.mit.edu	37	11	5222105	5222105	+	5'Flank	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5222105delA	uc010qyz.1	-							NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATGTCATTTAAAAGTCATTA	0.313													13	8	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67829386	67829387	+	Intron	INS	-	A	A			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829386_67829387insA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	GGAGTAGGAAGAAAAAAAAAAA	0.406													9	4	---	---	---	---	
INPPL1	3636	broad.mit.edu	37	11	71946722	71946722	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71946722delG	uc001osf.2	+	24	2810	c.2663delG	c.(2662-2664)TGGfs	p.W888fs	INPPL1_uc001osg.2_Frame_Shift_Del_p.W646fs	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	888					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						CCCTCAGAGTGGATCAGCATT	0.607													70	117	---	---	---	---	
USP28	57646	broad.mit.edu	37	11	113725073	113725073	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113725073delA	uc001poh.2	-						USP28_uc010rwy.1_Intron|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Intron|USP28_uc010rwz.1_Intron	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28						cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTTGCAAAACAAAAAAACCAC	0.368													112	60	---	---	---	---	
E2F7	144455	broad.mit.edu	37	12	77428004	77428005	+	Intron	INS	-	T	T	rs144053051	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77428004_77428005insT	uc001sym.3	-							NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						TTTCAATGTACTTTTTTTTTTA	0.292													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20529304	20529305	+	IGR	INS	-	TAAT	TAAT	rs150190820	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20529304_20529305insTAAT								OR4L1 (162 upstream) : OR4K17 (56261 downstream)																							aaacataaggatagagatctgc	0.129													5	4	---	---	---	---	
RHOJ	57381	broad.mit.edu	37	14	63757404	63757404	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63757404delA	uc001xgb.1	+							NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor						actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		acaaaaatacaaaaaaaaaaa	0.229													4	2	---	---	---	---	
CLPX	10845	broad.mit.edu	37	15	65477364	65477365	+	Intron	INS	-	C	C			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65477364_65477365insC	uc002aom.2	-						CLPX_uc010uiu.1_Intron|CLPX_uc010bhg.1_Intron	NM_006660	NP_006651	O76031	CLPX_HUMAN	ClpX caseinolytic protease X homolog precursor						protein folding|proteolysis involved in cellular protein catabolic process	mitochondrial endopeptidase Clp complex|mitochondrial inner membrane|mitochondrial nucleoid	ATP binding|ATPase activity|metal ion binding|peptidase activator activity|unfolded protein binding				0						TGGCCAGTCCACCCCCCCCCCG	0.708													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78202278	78202278	+	IGR	DEL	C	-	-	rs71145877		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78202278delC								LINGO1 (213803 upstream) : LOC645752 (4281 downstream)																							TTGACAGTGGCTCCCCCAGCC	0.577													11	6	---	---	---	---	
TELO2	9894	broad.mit.edu	37	16	1557813	1557814	+	Intron	DEL	GT	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1557813_1557814delGT	uc002cly.2	+							NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog							chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				tcggcccggggtgtgtgtgtgt	0.178													4	2	---	---	---	---	
GCSH	2653	broad.mit.edu	37	16	81118317	81118317	+	Intron	DEL	T	-	-	rs111388132		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81118317delT	uc002fgd.2	-						GCSH_uc002fge.2_Intron	NM_004483	NP_004474	P23434	GCSH_HUMAN	glycine cleavage system protein H (aminomethyl							glycine cleavage complex|mitochondrion	aminomethyltransferase activity				0					Glycine(DB00145)	TCCAAAtttcttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3895191	3895191	+	IGR	DEL	C	-	-	rs145456066		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895191delC								ATP2A3 (27455 upstream) : ZZEF1 (12549 downstream)																							ttccttccttcccttcccttc	0.075													2	4	---	---	---	---	
SPAG7	9552	broad.mit.edu	37	17	4862630	4862631	+	3'UTR	INS	-	CA	CA	rs141343111	by1000genomes	TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4862630_4862631insCA	uc002gae.2	-	7					SPAG7_uc002gad.2_3'UTR|SPAG7_uc002gaf.2_3'UTR	NM_004890	NP_004881	O75391	SPAG7_HUMAN	sperm associated antigen 7							nucleus	nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2						ATTCACACTCTCACACACACAC	0.470													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25754047	25754047	+	Intron	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25754047delT	uc002gzg.2	+											Homo sapiens similar to ubiquitin specific protease 6, mRNA (cDNA clone IMAGE:5168266), with apparent retained intron.																		GACGCTGTTCTTttttttttt	0.274													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36370035	36370036	+	Intron	DEL	GT	-	-	rs3987840		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36370035_36370036delGT	uc010wdn.1	-						uc002hpx.2_Intron			Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		agattaTGTCgtgtgtgtgtgt	0.114													4	2	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36908873	36908873	+	5'Flank	DEL	T	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36908873delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						TCACTTCCGCTTTTCCCGCCT	0.577													6	3	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377700	45377701	+	Intron	INS	-	GC	GC	rs113076632		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377700_45377701insGC	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	TTGTCTTACAGGCGCGCGCGCG	0.525													4	3	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67218479	67218479	+	Intron	DEL	A	-	-	rs34320016		TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67218479delA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					actccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
WDR83	84292	broad.mit.edu	37	19	12784224	12784224	+	Intron	DEL	C	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12784224delC	uc002mue.3	+						WDR83_uc002muc.2_Intron|WDR83_uc010dyw.2_Intron	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						aggctaggatctttttttttt	0.249													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26113543	26113543	+	IGR	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26113543delA								C20orf191 (18866 upstream) : MIR663 (75279 downstream)																							TCTTTGCCTTAACAACATTAT	0.363													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9769306	9769307	+	IGR	INS	-	AAGAT	AAGAT			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9769306_9769307insAAGAT								None (None upstream) : None (None downstream)																							TTCCGAAGTAGAAGAATGAGTT	0.317													6	3	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47410424	47410424	+	Intron	DEL	C	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410424delC	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	gtgaaggtgacccggggaggg	0.104													8	4	---	---	---	---	
APOL1	8542	broad.mit.edu	37	22	36651357	36651358	+	Intron	DEL	CT	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36651357_36651358delCT	uc003apf.2	+						APOL1_uc011amn.1_Intron|APOL1_uc003apc.2_Intron|APOL1_uc003ape.2_Intron|APOL1_uc011amo.1_Intron|APOL1_uc011amp.1_Intron|APOL1_uc011amq.1_Intron|APOL1_uc010gwx.2_Intron	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor						cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						GAGGCACCAGCTCTCTCTACCC	0.604													5	4	---	---	---	---	
SAT1	6303	broad.mit.edu	37	X	23802147	23802147	+	Intron	DEL	A	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23802147delA	uc004dau.2	+						SAT1_uc010nfv.2_Frame_Shift_Del_p.K117fs|SAT1_uc004dav.2_Intron	NM_002970	NP_002961	P21673	SAT1_HUMAN	diamine N-acetyltransferase 1						angiogenesis|polyamine biosynthetic process	cytosol	diamine N-acetyltransferase activity|protein binding				0					Spermine(DB00127)	ACTACTGAGGAAAAAAAAAAA	0.398													4	2	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41075634	41075635	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41075634_41075635insT	uc004dfb.2	+	35	6447_6448	c.5814_5815insT	c.(5812-5817)TCATACfs	p.S1938fs	USP9X_uc004dfc.2_Frame_Shift_Ins_p.S1938fs	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1938_1939					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						AGCGTATGTCATACAGGCGCCA	0.371													78	94	---	---	---	---	
RBM10	8241	broad.mit.edu	37	X	47039681	47039683	+	In_Frame_Del	DEL	ATG	-	-			TCGA-66-2768-01A-01D-1522-08	TCGA-66-2768-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47039681_47039683delATG	uc004dhf.2	+	11	1512_1514	c.1133_1135delATG	c.(1132-1137)AATGTT>ATT	p.378_379NV>I	RBM10_uc004dhg.2_In_Frame_Del_p.300_301NV>I|RBM10_uc004dhh.2_In_Frame_Del_p.377_378NV>I|RBM10_uc010nhq.2_In_Frame_Del_p.301_302NV>I|RBM10_uc004dhi.2_In_Frame_Del_p.443_444NV>I	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	378_379	RRM 2.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						AAGACCATCAATGTTGAGTTTGC	0.498													9	9	---	---	---	---	
