Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF4	400735	broad.mit.edu	37	1	12943166	12943166	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12943166C>T	uc001aun.2	-	2	121	c.50G>A	c.(49-51)CGG>CAG	p.R17Q		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	17										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGCAGGCTCCGCCCTGCAAG	0.562													151	280	---	---	---	---	PASS
KPNA6	23633	broad.mit.edu	37	1	32628134	32628134	+	Intron	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32628134T>A	uc001bug.2	+						KPNA6_uc001buh.2_Intron|KPNA6_uc010ogx.1_Intron|KPNA6_uc010ogy.1_Intron|KPNA6_uc009vtz.2_Intron	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				ATGTGAGTGGTCTTAGAAGGG	0.318													43	83	---	---	---	---	PASS
CYP4A22	284541	broad.mit.edu	37	1	47607784	47607784	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47607784C>G	uc001cqv.1	+	4	438	c.387C>G	c.(385-387)TAC>TAG	p.Y129*	CYP4A22_uc009vyo.2_Nonsense_Mutation_p.Y129*|CYP4A22_uc009vyp.2_Nonsense_Mutation_p.Y129*	NM_001010969	NP_001010969	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A,	129						endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding			skin(2)|ovary(1)|breast(1)	4						CCTTAGGGTACGGCTTGCTCC	0.537													13	50	---	---	---	---	PASS
ZYG11B	79699	broad.mit.edu	37	1	53262037	53262037	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53262037G>T	uc001cuj.2	+	7	1603	c.1408G>T	c.(1408-1410)GCT>TCT	p.A470S	ZYG11B_uc009vzg.2_RNA|ZYG11B_uc010onj.1_Missense_Mutation_p.A461S|ZYG11B_uc009vzh.2_5'Flank	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	470							protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						GATGGCAGTTGCTATCATTTC	0.428													13	63	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60456334	60456334	+	3'UTR	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60456334T>C	uc001czs.1	-	12					C1orf87_uc001czr.1_3'UTR	NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795								calcium ion binding			ovary(1)|breast(1)	2						TCTCACAATATGGGCTTGTTA	0.498													114	236	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037416	75037416	+	Silent	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037416T>A	uc001dgg.2	-	14	4197	c.3978A>T	c.(3976-3978)ACA>ACT	p.T1326T		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1326	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CATTCTTTTGTGTGTTTCCTT	0.557													119	237	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75115008	75115008	+	Intron	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75115008C>T	uc001dgg.2	-							NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254											ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						ACCTAAAATACAAAAATAAAA	0.363													21	47	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92613244	92613244	+	Missense_Mutation	SNP	G	T	T	rs150938488		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92613244G>T	uc001doo.2	+	9	1290	c.1023G>T	c.(1021-1023)TGG>TGT	p.W341C	BTBD8_uc010otc.1_RNA	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	341						nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TTAACAGGTGGATTGTAAAGC	0.289													12	35	---	---	---	---	PASS
CCDC76	54482	broad.mit.edu	37	1	100614189	100614189	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100614189G>C	uc001dsv.2	+	11	1278	c.1259G>C	c.(1258-1260)AGT>ACT	p.S420T	CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_Missense_Mutation_p.V276L	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76	420					tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		AGGCTTCTTAGTGTTGAAGAA	0.318													39	60	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103480073	103480073	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103480073C>T	uc001dul.2	-	13	1884	c.1566G>A	c.(1564-1566)CAG>CAA	p.Q522Q	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Silent_p.Q534Q|COL11A1_uc001dun.2_Silent_p.Q483Q|COL11A1_uc009weh.2_Silent_p.Q406Q	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	522	Telopeptide.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTACCCGAGCCTGCTGAAGAA	0.423													11	24	---	---	---	---	PASS
PHGDH	26227	broad.mit.edu	37	1	120279815	120279815	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120279815G>A	uc001ehz.2	+	8	1098	c.871G>A	c.(871-873)GCT>ACT	p.A291T	PHGDH_uc009whm.2_Missense_Mutation_p.A189T|PHGDH_uc001eia.2_Missense_Mutation_p.A291T|PHGDH_uc009whn.2_Missense_Mutation_p.A291T|PHGDH_uc001eib.2_Missense_Mutation_p.A257T	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	291					brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	CACCAAGGAGGCTCAGAGCCG	0.597													94	122	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120480469	120480469	+	Intron	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120480469G>T	uc001eik.2	-						NOTCH2_uc001eil.2_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCCAAGGGAGCAAAGCTTAC	0.493			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				47	76	---	---	---	---	PASS
PPIAL4G	644591	broad.mit.edu	37	1	143767794	143767794	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143767794G>A	uc001ejt.2	-	1	88	c.55C>T	c.(55-57)CGC>TGC	p.R19C		NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like	19	PPIase cyclophilin-type.				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0						ATGGAGATGCGGCCCAAGGGC	0.493													11	662	---	---	---	---	PASS
SEC22B	9554	broad.mit.edu	37	1	145109536	145109536	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109536G>A	uc001eml.1	+	5	338	c.198G>A	c.(196-198)GAG>GAA	p.E66E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B	66	Longin.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						ACATTATTGAGCAGGGGGTGT	0.403													23	756	---	---	---	---	PASS
HIST2H3D	653604	broad.mit.edu	37	1	149785213	149785213	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149785213G>A	uc010pbl.1	-	1	24	c.24C>T	c.(22-24)GCC>GCT	p.A8A	HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	NM_001123375	NP_001116847	Q71DI3	H32_HUMAN	histone cluster 2, H3d	8					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding				0						TCGACTTGCGGGCAGTCTGCT	0.602													26	62	---	---	---	---	PASS
FAM63A	55793	broad.mit.edu	37	1	150971905	150971905	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150971905C>T	uc001ewf.2	-	8	2605	c.921G>A	c.(919-921)AAG>AAA	p.K307K	FAM63A_uc001ewc.2_Silent_p.K165K|FAM63A_uc010pcm.1_Silent_p.K212K|FAM63A_uc001ewd.2_Silent_p.K165K|FAM63A_uc001ewe.2_Silent_p.K141K|FAM63A_uc010pcn.1_Silent_p.K355K|FAM63A_uc001ewg.2_Silent_p.K307K	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	307							protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTTCACCCTCCTTAGCAGCTG	0.557													243	393	---	---	---	---	PASS
CRTC2	200186	broad.mit.edu	37	1	153920731	153920731	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153920731C>G	uc010ped.1	-	14	2006	c.1936G>C	c.(1936-1938)GCT>CCT	p.A646P	DENND4B_uc001fdd.1_5'Flank|CRTC2_uc001fde.3_RNA|CRTC2_uc001fdf.3_Missense_Mutation_p.A182P	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	646					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCCAATCCAGCTGCTGACACC	0.597													64	356	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156845314	156845314	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156845314C>A	uc001fqh.1	+	12	1413	c.1357C>A	c.(1357-1359)CCG>ACG	p.P453T	NTRK1_uc001fqf.1_Missense_Mutation_p.P417T|NTRK1_uc009wsi.1_Missense_Mutation_p.P152T|NTRK1_uc001fqi.1_Missense_Mutation_p.P447T|NTRK1_uc009wsk.1_Missense_Mutation_p.P447T	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	453	Cytoplasmic (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CTCTCTAGGCCCGGCTGTGCT	0.637			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			99	146	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156933370	156933370	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156933370G>A	uc001fqo.2	-	11	1900	c.860C>T	c.(859-861)CCA>CTA	p.P287L	ARHGEF11_uc001fqn.2_Missense_Mutation_p.P327L	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	287					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TAAAGGCTTTGGGCTTTGATC	0.423													14	246	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156933393	156933393	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156933393G>A	uc001fqo.2	-						ARHGEF11_uc001fqn.2_Intron	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CACCCTGGGGGAGAGAGTCAA	0.463													15	221	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167095218	167095218	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095218G>C	uc001geb.1	+	5	850	c.850G>C	c.(850-852)GAG>CAG	p.E284Q		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	284					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GGAGAGAGAAGAGGACTATGG	0.617													23	113	---	---	---	---	PASS
TNFSF4	7292	broad.mit.edu	37	1	173155730	173155730	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173155730G>A	uc001giw.2	-	3	633	c.477C>T	c.(475-477)TCC>TCT	p.S159S	TNFSF4_uc001giv.2_Silent_p.S109S	NM_003326	NP_003317	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily,	159	Extracellular (Potential).				acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1						AGTCATCCAGGGAGGTATTGT	0.448													23	216	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196884210	196884210	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196884210G>C	uc001gto.2	+	5	810	c.741G>C	c.(739-741)CAG>CAC	p.Q247H	CFHR4_uc009wyy.2_Missense_Mutation_p.Q493H|CFHR4_uc001gtp.2_Missense_Mutation_p.Q494H	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	247	Sushi 4.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						ATGAACTTCAGGGTTCTAATT	0.403													122	251	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201022412	201022412	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201022412G>A	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CCTGCAGGGCGGGCGGGAGCG	0.657													20	78	---	---	---	---	PASS
ATF3	467	broad.mit.edu	37	1	212788511	212788511	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212788511C>A	uc001hjf.2	+	2	281	c.148C>A	c.(148-150)CAG>AAG	p.Q50K	ATF3_uc001hjj.2_Missense_Mutation_p.Q50K|ATF3_uc009xdg.1_RNA|ATF3_uc001hjh.2_Missense_Mutation_p.Q50K|ATF3_uc001hji.2_Missense_Mutation_p.Q50K|ATF3_uc010ptg.1_RNA	NM_001030287	NP_001025458	P18847	ATF3_HUMAN	activating transcription factor 3 isoform 1	50						nucleolus	identical protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)		GTTTGCCATCCAGAACAAGCA	0.572													5	218	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848479	215848479	+	Silent	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848479T>C	uc001hku.1	-	63	13161	c.12774A>G	c.(12772-12774)ACA>ACG	p.T4258T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4258	Extracellular (Potential).|Fibronectin type-III 27.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGCTTGCAATGTCCTCACCA	0.363										HNSCC(13;0.011)			48	73	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229770687	229770687	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229770687G>A	uc001hts.1	+	4	463	c.327G>A	c.(325-327)GAG>GAA	p.E109E	URB2_uc009xfd.1_Silent_p.E109E	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	109						nucleolus				central_nervous_system(2)|ovary(1)	3						GAGTAGCTGAGTTCTCTCTTT	0.413													9	121	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237936937	237936937	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237936937G>T	uc001hyl.1	+	87	11884	c.11764G>T	c.(11764-11766)GAG>TAG	p.E3922*	RYR2_uc010pya.1_Nonsense_Mutation_p.E337*	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3922					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACTCTTACAGAGTATATTCA	0.353													7	18	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371436	240371436	+	Silent	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371436T>C	uc010pyd.1	+	5	3549	c.3324T>C	c.(3322-3324)CCT>CCC	p.P1108P	FMN2_uc010pye.1_Silent_p.P1112P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1108	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TGGGCATACCTCCTCCGCCCC	0.731													3	23	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247053361	247053361	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247053361T>C	uc001ibu.1	-	16	2058	c.2051A>G	c.(2050-2052)GAT>GGT	p.D684G	AHCTF1_uc001ibv.1_Missense_Mutation_p.D693G|AHCTF1_uc009xgs.1_5'UTR	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	684	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CACAGAATCATCTAGATTTTT	0.338													26	144	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247597398	247597398	+	Intron	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247597398C>A	uc001icr.2	+						NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Intron|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Intron	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTGTTCTTGGCATGAAGGTTG	0.557													64	380	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248031301	248031301	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248031301C>T	uc001ido.2	+	5	855	c.807C>T	c.(805-807)ATC>ATT	p.I269I	OR2W3_uc001idp.1_5'UTR	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	269						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CAGAGAACATCCCCATGGAAC	0.532													19	44	---	---	---	---	PASS
OR2M5	127059	broad.mit.edu	37	1	248308992	248308992	+	Silent	SNP	C	T	T	rs141891339		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248308992C>T	uc010pze.1	+	1	543	c.543C>T	c.(541-543)TTC>TTT	p.F181F		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TCTGTGACTTCCCTTCCCTAC	0.423													95	754	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458744	248458744	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458744A>T	uc010pzj.1	-	1	137	c.137T>A	c.(136-138)CTG>CAG	p.L46Q		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	46	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCAGTGAATCAGGAGAATCAT	0.527													35	238	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	248813221	248813221	+	IGR	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248813221A>G								OR2T35 (10662 upstream) : OR2T27 (12 downstream)																							CTAGCAGCATATGAAATTTCT	0.428													25	178	---	---	---	---	PASS
NT5C1B	93034	broad.mit.edu	37	2	18736983	18736983	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18736983C>T	uc010exr.2	-	9	1531	c.1427G>A	c.(1426-1428)GGA>GAA	p.G476E	NT5C1B_uc002rcy.2_3'UTR|RDH14_uc002rcx.3_Missense_Mutation_p.G162E	NM_033253	NP_150278	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 2	Error:Variant_position_missing_in_Q96P26_after_alignment					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				ATGGTTCACTCCGAACTGCAT	0.458													105	201	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27459695	27459695	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27459695C>T	uc002rji.2	+	27	4555	c.4393C>T	c.(4393-4395)CCG>TCG	p.P1465S	CAD_uc010eyw.2_Missense_Mutation_p.P1402S	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1465	DHOase (dihydroorotase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TGTGCGACTGCCGGGTAAGTC	0.577													5	401	---	---	---	---	PASS
CLEC4F	165530	broad.mit.edu	37	2	71036442	71036442	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71036442G>A	uc002shf.2	-	7	1808	c.1731C>T	c.(1729-1731)TTC>TTT	p.F577F	CLEC4F_uc010yqv.1_Intron	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN	C-type lectin, superfamily member 13	577	Extracellular (Potential).|C-type lectin.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(5)	5						GGGTGTCTATGAAGCTGCAAG	0.527													44	69	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79350070	79350070	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79350070C>T	uc002snz.2	+	5	528	c.425C>T	c.(424-426)TCA>TTA	p.S142L	REG1A_uc010ysd.1_Missense_Mutation_p.S142L	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	142	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						AGCCTGACCTCAAGCACAGGT	0.567													50	182	---	---	---	---	PASS
STARD7	56910	broad.mit.edu	37	2	96873906	96873906	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96873906C>A	uc002svm.3	-	1	668	c.267G>T	c.(265-267)AGG>AGT	p.R89S	LOC285033_uc002svn.2_5'Flank|LOC285033_uc002svo.2_5'Flank	NM_020151	NP_064536	Q9NQZ5	STAR7_HUMAN	START domain containing 7 precursor	89	Potential.					mitochondrion					0						CCTCCTGGATCCTCTCCTCGT	0.687													13	44	---	---	---	---	PASS
C2orf40	84417	broad.mit.edu	37	2	106694236	106694236	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106694236A>T	uc010fjf.2	+	4	409	c.301A>T	c.(301-303)ATC>TTC	p.I101F		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	101						extracellular region|transport vesicle					0						TGAAGATGACATCACCTATTG	0.423													29	207	---	---	---	---	PASS
EPB41L5	57669	broad.mit.edu	37	2	120889225	120889225	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120889225G>T	uc002tmg.2	+	18	1659	c.1533G>T	c.(1531-1533)CAG>CAT	p.Q511H	EPB41L5_uc010fll.2_Missense_Mutation_p.Q511H|EPB41L5_uc010flm.2_Missense_Mutation_p.Q315H	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	511						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						AGCTCAAACAGCTTGAGATGG	0.443													14	137	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132010529	132010529	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132010529C>T	uc002tsn.2	+	13	1687	c.1635C>T	c.(1633-1635)CAC>CAT	p.H545H	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Silent_p.H145H|POTEE_uc002tsl.2_Silent_p.H127H|POTEE_uc010fmy.1_Silent_p.H9H	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	545							ATP binding				0						TGAAGAAGCACGGAAGTACTC	0.393													14	153	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135884226	135884226	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135884226G>T	uc002tuj.2	+	11	998	c.973G>T	c.(973-975)GGT>TGT	p.G325C	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.G325C|RAB3GAP1_uc010fng.2_Missense_Mutation_p.G150C|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	325						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		GTGTTTGCTAGGTAAGGTATA	0.373													85	249	---	---	---	---	PASS
CXCR4	7852	broad.mit.edu	37	2	136873271	136873271	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136873271T>C	uc002tuz.2	-	2	322	c.227A>G	c.(226-228)TAC>TGC	p.Y76C	CXCR4_uc002tuy.2_Missense_Mutation_p.Y80C|CXCR4_uc010fnk.2_Missense_Mutation_p.Y61C	NM_003467	NP_003458	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4 isoform b	76	Cytoplasmic.				activation of MAPK activity|apoptosis|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|inflammatory response|initiation of viral infection|regulation of chemotaxis|response to hypoxia|response to virus	cell leading edge|cell surface|cytoplasmic membrane-bounded vesicle|integral to membrane|plasma membrane	actin binding|C-X-C chemokine receptor activity|coreceptor activity|myosin light chain binding|ubiquitin binding|ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)	GTGCAGCCTGTACTTGTCCGT	0.507													53	255	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170002329	170002329	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170002329C>T	uc002ues.2	-	70	13129	c.12916G>A	c.(12916-12918)GAG>AAG	p.E4306K		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4306	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AGCGTTTTCTCTTTCTTTCCT	0.393													28	100	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170038679	170038679	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038679A>T	uc002ues.2	-	51	10209	c.9996T>A	c.(9994-9996)TAT>TAA	p.Y3332*		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3332	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GACAATACCCATATTGAGGGT	0.507													65	172	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170127502	170127502	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170127502G>A	uc002ues.2	-	16	2445	c.2232C>T	c.(2230-2232)GTC>GTT	p.V744V	LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	744	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AATCAATCCCGACAAAGAAAG	0.418													4	168	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179421741	179421741	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179421741G>A	uc010zfg.1	-	279	80660	c.80436C>T	c.(80434-80436)GGC>GGT	p.G26812G	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.G20507G|TTN_uc010zfi.1_Silent_p.G20440G|TTN_uc010zfj.1_Silent_p.G20315G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27739							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTCCATCTGCCATCTGGAA	0.453													23	61	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202609061	202609061	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202609061T>A	uc002uyo.2	-	10	2446	c.2090A>T	c.(2089-2091)GAG>GTG	p.E697V	ALS2_uc002uyp.3_Missense_Mutation_p.E697V|ALS2_uc002uyq.2_Missense_Mutation_p.E697V|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	697	DH.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						AGTAGCTAACTCGTGGAGACT	0.403													31	107	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215855660	215855660	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215855660G>A	uc002vew.2	-	24	3610	c.3390C>T	c.(3388-3390)ATC>ATT	p.I1130I	ABCA12_uc002vev.2_Silent_p.I812I|ABCA12_uc010zjn.1_Silent_p.I57I	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1130	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGAGTATAATGATGAGGATCA	0.398													37	143	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19551898	19551898	+	Intron	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19551898G>C	uc003cbk.1	+						KCNH8_uc010hex.1_Intron	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						TCACAGGTATGGCTTTTGCTA	0.328													13	34	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25686854	25686854	+	Silent	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25686854T>G	uc011awn.1	-	2	220	c.177A>C	c.(175-177)ACA>ACC	p.T59T	TOP2B_uc003cdj.2_Silent_p.T54T	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	59					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						GTTCAAGTTGTGTCTTCTTCT	0.363													66	166	---	---	---	---	PASS
C3orf39	84892	broad.mit.edu	37	3	43122452	43122452	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43122452G>A	uc003cmq.1	-	2	613	c.472C>T	c.(472-474)CGC>TGC	p.R158C	C3orf39_uc003cmr.1_Missense_Mutation_p.R158C	NM_032806	NP_116195	Q8NAT1	AGO61_HUMAN	glycosyltransferase precursor	158						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)		GGGTTGAAGCGGTTGGCGATG	0.617													7	117	---	---	---	---	PASS
C3orf45	132228	broad.mit.edu	37	3	50324115	50324115	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50324115G>A	uc003cyz.2	+	3	210	c.183G>A	c.(181-183)CTG>CTA	p.L61L		NM_153215	NP_694947	Q8N112	CC045_HUMAN	hypothetical protein LOC132228	61						integral to membrane				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGGCACACTGCGCCCCTATC	0.637													12	60	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78796020	78796020	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78796020G>T	uc003dqe.2	-	5	738	c.530C>A	c.(529-531)TCG>TAG	p.S177*	ROBO1_uc003dqb.2_Nonsense_Mutation_p.S138*|ROBO1_uc003dqc.2_Nonsense_Mutation_p.S138*|ROBO1_uc003dqd.2_Nonsense_Mutation_p.S138*	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	177	Extracellular (Potential).|Ig-like C2-type 2.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CATGACATCCGAAGGGTTTTG	0.458													3	47	---	---	---	---	PASS
ARL6	84100	broad.mit.edu	37	3	97499500	97499500	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97499500A>G	uc003drv.2	+	5	540	c.227A>G	c.(226-228)TAC>TGC	p.Y76C	ARL6_uc003drw.2_RNA|ARL6_uc003dru.2_Missense_Mutation_p.Y76C|ARL6_uc010hoy.2_Missense_Mutation_p.Y76C	NM_177976	NP_816931	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	76					cilium assembly|determination of left/right symmetry|melanosome transport|protein polymerization|protein targeting to membrane|small GTPase mediated signal transduction|visual perception|Wnt receptor signaling pathway	axonemal microtubule|cilium axoneme|cilium membrane|membrane coat|microtubule basal body	GTP binding|metal ion binding|phospholipid binding|protein binding				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		CAAGGAAGATACAGAAATCTC	0.284									Bardet-Biedl_syndrome				83	135	---	---	---	---	PASS
OR5H15	403274	broad.mit.edu	37	3	97887879	97887879	+	Silent	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97887879T>C	uc011bgu.1	+	1	336	c.336T>C	c.(334-336)TGT>TGC	p.C112C		NM_001005515	NP_001005515	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCACAGAATGTTTTCTCTTGG	0.378													4	247	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102171756	102171756	+	Intron	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102171756A>G	uc003dvs.1	+						ZPLD1_uc003dvt.1_Intron|ZPLD1_uc011bhg.1_Intron	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						ATATATTTTTATTTCAGCTGA	0.318													16	82	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108549571	108549571	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108549571C>G	uc003dxi.1	+	2	206	c.62C>G	c.(61-63)GCT>GGT	p.A21G	TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	21	Helical; Signal-anchor for type III membrane protein; (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						TTGGGCTTGGCTTTGGTTATA	0.398													111	251	---	---	---	---	PASS
C3orf30	152405	broad.mit.edu	37	3	118865136	118865136	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118865136G>T	uc003ecb.1	+	1	140	c.100G>T	c.(100-102)GAC>TAC	p.D34Y	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.D34Y	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	34										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		GGAAGAAGACGACCAGAAGAA	0.552													32	68	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120461339	120461339	+	Silent	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120461339G>T	uc003edx.2	-	1	46	c.16C>A	c.(16-18)CGG>AGG	p.R6R	GTF2E1_uc003edy.2_5'Flank|GTF2E1_uc003edz.3_5'Flank	NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	6	Small GTPase-like.				small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		ACCTTCACCCGATCCAGGGAC	0.552													22	155	---	---	---	---	PASS
ABTB1	80325	broad.mit.edu	37	3	127398972	127398972	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127398972C>T	uc003ejt.2	+	11	1262	c.1174C>T	c.(1174-1176)CGC>TGC	p.R392C	ABTB1_uc003ejr.2_Missense_Mutation_p.R250C|ABTB1_uc003ejs.2_Missense_Mutation_p.R367C|ABTB1_uc003eju.2_Missense_Mutation_p.R250C|ABTB1_uc010hsm.2_Missense_Mutation_p.R119C	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1	392						cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						CAAGCTCTTCCGCCTGGCGCG	0.642													97	401	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135721425	135721425	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135721425A>G	uc003eqv.1	+	2	1650	c.1085A>G	c.(1084-1086)AAG>AGG	p.K362R	PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	362					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						AATTCTAGGAAGATGGACACT	0.388													3	146	---	---	---	---	PASS
AGTR1	185	broad.mit.edu	37	3	148459391	148459391	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148459391C>A	uc003ewg.2	+	4	1015	c.569C>A	c.(568-570)ACC>AAC	p.T190N	AGTR1_uc003ewh.2_Missense_Mutation_p.T190N|AGTR1_uc003ewi.2_Missense_Mutation_p.T190N|AGTR1_uc003ewj.2_Missense_Mutation_p.T190N|AGTR1_uc003ewk.2_Missense_Mutation_p.T190N	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	190	Extracellular (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CAAAATTCAACCCTCCCGATA	0.403													14	173	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150659451	150659451	+	Silent	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150659451G>T	uc003eyk.1	-	2	642	c.351C>A	c.(349-351)GCC>GCA	p.A117A	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Silent_p.A41A|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	117	Helical; (Potential).				equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ACATGAAGAAGGCTGTCCCCA	0.428													34	103	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153870648	153870648	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153870648A>T	uc011bog.1	+	6	1625	c.1414A>T	c.(1414-1416)AGT>TGT	p.S472C	SGEF_uc011boh.1_Missense_Mutation_p.S472C	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	472	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TAAAGAACTGAGTGATACAAT	0.383													6	17	---	---	---	---	PASS
NCEH1	57552	broad.mit.edu	37	3	172351674	172351674	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172351674G>A	uc011bpx.1	-	5	1076	c.938C>T	c.(937-939)TCA>TTA	p.S313L	NCEH1_uc003fig.2_Missense_Mutation_p.S305L|NCEH1_uc011bpw.1_Missense_Mutation_p.S140L|NCEH1_uc011bpy.1_Missense_Mutation_p.S140L	NM_001146276	NP_001139748	Q6PIU2	NCEH1_HUMAN	arylacetamide deacetylase-like 1 isoform a	273	Lumenal (Potential).				lipid catabolic process	endoplasmic reticulum|integral to membrane|microsome	carboxylesterase activity				0						CACATCAAGTGAAGTGTGATT	0.493													16	306	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186457173	186457173	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186457173C>T	uc011bsa.1	+	9	1307	c.1095C>T	c.(1093-1095)TAC>TAT	p.Y365Y	KNG1_uc003fqr.2_Silent_p.Y365Y	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	365	Cystatin 3.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	AAAAAATTTACCCTACTGTCA	0.423													105	293	---	---	---	---	PASS
GRK4	2868	broad.mit.edu	37	4	3029676	3029676	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3029676G>A	uc003ggn.1	+	11	1463	c.1008G>A	c.(1006-1008)GAG>GAA	p.E336E	GRK4_uc003ggo.1_Silent_p.E336E|GRK4_uc003ggp.1_Silent_p.E304E|GRK4_uc003ggq.1_Silent_p.E304E	NM_182982	NP_892027	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4 isoform	336	Protein kinase.					cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGGCCACAGAGATCCCAGAAG	0.507													75	155	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5468481	5468481	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5468481G>C	uc003gih.1	+	10	1025	c.961G>C	c.(961-963)GAA>CAA	p.E321Q	STK32B_uc010ida.1_Missense_Mutation_p.E274Q	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	321							ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						GATGATTCTAGAATCCAAGCC	0.493													31	63	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36126522	36126522	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36126522G>C	uc003gsq.1	-	22	4046	c.3708C>G	c.(3706-3708)AAC>AAG	p.N1236K		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1236	Rho-GAP.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						GTGTTGCTCGGTTGACCCCTG	0.373													22	49	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46307591	46307591	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46307591T>A	uc003gxc.3	-	6	1370	c.697A>T	c.(697-699)AGT>TGT	p.S233C	GABRA2_uc010igc.2_Missense_Mutation_p.S233C|GABRA2_uc011bzc.1_Missense_Mutation_p.S178C|GABRA2_uc003gxe.2_Missense_Mutation_p.S233C	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	233	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TAACCTGTACTGGATTTAATT	0.368													25	85	---	---	---	---	PASS
LIN54	132660	broad.mit.edu	37	4	83857171	83857171	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83857171C>A	uc003hnx.3	-	11	2186	c.1808G>T	c.(1807-1809)CGA>CTA	p.R603L	LIN54_uc003hnz.3_Missense_Mutation_p.R382L|LIN54_uc003hny.3_Missense_Mutation_p.R202L|LIN54_uc010ijt.2_Missense_Mutation_p.R514L|LIN54_uc010iju.2_Missense_Mutation_p.R202L|LIN54_uc010ijv.2_Missense_Mutation_p.R382L	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	603	CXC 2.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				ACATCCTGATCGTTTGCAATT	0.403													4	250	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95508210	95508210	+	Intron	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95508210G>T	uc003hti.2	+						PDLIM5_uc003htf.2_Missense_Mutation_p.A208S|PDLIM5_uc003htg.2_Missense_Mutation_p.A228S|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TGAAGTTTCAGCACGTGCTCT	0.373													11	31	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111463936	111463936	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111463936G>T	uc003iab.3	+	12	2179	c.1837G>T	c.(1837-1839)GGA>TGA	p.G613*		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	613	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TAATCCTAGTGGAAATGCTTT	0.383													28	84	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119644736	119644736	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119644736G>A	uc003ici.3	-	23	3305	c.3033C>T	c.(3031-3033)TAC>TAT	p.Y1011Y	SEC24D_uc003ich.3_RNA|SEC24D_uc003icj.3_Silent_p.Y1012Y	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	1011					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						AAGAGCCTCCGTAAAGTCCTT	0.383													5	180	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158254042	158254042	+	Silent	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158254042A>G	uc003ipm.3	+	7	1413	c.954A>G	c.(952-954)AGA>AGG	p.R318R	GRIA2_uc011cit.1_Silent_p.R271R|GRIA2_uc003ipl.3_Silent_p.R318R|GRIA2_uc003ipk.3_Silent_p.R271R|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	318	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	GGAAGCAAAGAATTGAAATCT	0.483													19	73	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13729589	13729589	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13729589C>T	uc003jfd.2	-	69	11884	c.11842G>A	c.(11842-11844)GAA>AAA	p.E3948K	DNAH5_uc003jfc.2_Missense_Mutation_p.E116K	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3948					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTGCTAAGTTCCACCAAATTC	0.378									Kartagener_syndrome				31	121	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24491929	24491929	+	Silent	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24491929A>T	uc003jgr.1	-	11	1964	c.1632T>A	c.(1630-1632)ACT>ACA	p.T544T	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	544	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		AGATTCTGGCAGTATTATCTA	0.294										HNSCC(23;0.051)			9	35	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26915759	26915759	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26915759C>T	uc003jgs.1	-	3	671	c.502G>A	c.(502-504)GTT>ATT	p.V168I	CDH9_uc010iug.2_Missense_Mutation_p.V168I	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	168	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ATTTCAGGAACACTGGCAGTG	0.353													21	63	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	31799606	31799606	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31799606G>T	uc003jhl.2	+	2	639	c.251G>T	c.(250-252)GGC>GTC	p.G84V	PDZD2_uc003jhm.2_Missense_Mutation_p.G84V	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	84					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GAGACTGTGGGCCTGAGTTTT	0.577													17	770	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937484	33937484	+	Silent	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937484G>T	uc003jic.1	+	1	996	c.639G>T	c.(637-639)TCG>TCT	p.S213S		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	213	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						GCTGCTTCTCGGCCAAGGCGC	0.677													13	38	---	---	---	---	PASS
CHSY3	337876	broad.mit.edu	37	5	129521341	129521341	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129521341G>T	uc003kvd.2	+	3	2506	c.2506G>T	c.(2506-2508)GTT>TTT	p.V836F		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	836	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TTTCCATCCAGTTCATTGTGA	0.443													28	105	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137721893	137721893	+	Silent	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137721893A>G	uc003lcy.1	+	7	1163	c.963A>G	c.(961-963)CGA>CGG	p.R321R	KDM3B_uc010jew.1_Intron|KDM3B_uc011cys.1_5'Flank	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	321					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						AGGCAAGCCGAGGGCCCTGGA	0.542													67	168	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140573603	140573603	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140573603C>T	uc003lix.2	+	1	1652	c.1478C>T	c.(1477-1479)CCC>CTC	p.P493L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	493	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGCTGCCGCCCCAAGACCCG	0.682													23	145	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147029969	147029969	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147029969T>G	uc003loq.1	-	4	1151	c.769A>C	c.(769-771)AAC>CAC	p.N257H	JAKMIP2_uc011dbx.1_Missense_Mutation_p.N215H|JAKMIP2_uc003lor.1_Missense_Mutation_p.N257H|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.N257H	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	257						Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTCATGTTGCACTCAGCC	0.483													5	131	---	---	---	---	PASS
SLC36A1	206358	broad.mit.edu	37	5	150856327	150856327	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150856327G>A	uc003luc.2	+						GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Intron|SLC36A1_uc010jhw.1_Intron	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 member 1						cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)	GGTACGTGGAGGGAGGATGGA	0.488													11	76	---	---	---	---	PASS
GALNT10	55568	broad.mit.edu	37	5	153760052	153760052	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153760052G>T	uc003lvh.2	+	6	931	c.799G>T	c.(799-801)GAT>TAT	p.D267Y	GALNT10_uc003lvg.1_Missense_Mutation_p.D267Y|GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Missense_Mutation_p.D108Y	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a	267	Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CCCGATGATTGATGTAATTGA	0.537													97	221	---	---	---	---	PASS
OR2B6	26212	broad.mit.edu	37	6	27925357	27925357	+	Silent	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27925357T>C	uc011dkx.1	+	1	339	c.339T>C	c.(337-339)CTT>CTC	p.L113L		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	113	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTGAATATCTTCTCCTGGCCG	0.458													16	157	---	---	---	---	PASS
OR12D2	26529	broad.mit.edu	37	6	29365344	29365344	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29365344A>T	uc003nmf.3	+	1	929	c.868A>T	c.(868-870)ACT>TCT	p.T290S		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ACTGATCTATACTTTGAGGAA	0.458													68	236	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33641396	33641396	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33641396G>A	uc011drk.1	+	23	3176	c.2957G>A	c.(2956-2958)CGC>CAC	p.R986H		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	986	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CTGGATTACCGCATATCCTAC	0.542													7	806	---	---	---	---	PASS
ZNF451	26036	broad.mit.edu	37	6	56993549	56993549	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56993549C>T	uc003pdm.1	+	5	559	c.335C>T	c.(334-336)GCT>GTT	p.A112V	ZNF451_uc003pdl.2_Missense_Mutation_p.A112V|ZNF451_uc003pdn.1_Missense_Mutation_p.A112V|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.A112V	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	112					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTTCAGCATGCTCATGGGTTA	0.358													10	90	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76022396	76022396	+	Missense_Mutation	SNP	C	A	A	rs144029973		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76022396C>A	uc003pia.2	-	5	3525	c.3152G>T	c.(3151-3153)CGG>CTG	p.R1051L	FILIP1_uc003phy.1_Missense_Mutation_p.R1051L|FILIP1_uc003phz.2_Missense_Mutation_p.R952L|FILIP1_uc010kbe.2_Missense_Mutation_p.R1054L|FILIP1_uc003pib.1_Missense_Mutation_p.R803L	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1051										skin(3)|ovary(1)	4						GTTGTATTTCCGTACTGGAGT	0.463													6	825	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84366466	84366466	+	Intron	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84366466C>A	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TCGGTTGTTCCACCTACCGAG	0.368													7	14	---	---	---	---	PASS
HTR1E	3354	broad.mit.edu	37	6	87725810	87725810	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87725810C>A	uc003pli.2	+	2	1461	c.758C>A	c.(757-759)ACC>AAC	p.T253N		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	253	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	TCAGACCCTACCACAGAGTTT	0.478													66	506	---	---	---	---	PASS
CDK19	23097	broad.mit.edu	37	6	110953250	110953250	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110953250T>C	uc003puh.1	-	6	702	c.629A>G	c.(628-630)CAT>CGT	p.H210R	CDK19_uc003pui.1_Missense_Mutation_p.H150R|CDK19_uc011eax.1_Missense_Mutation_p.H86R	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)	210	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CTTTGTATAATGCCTTGCACC	0.353													24	188	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146276093	146276093	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146276093C>A	uc003qlf.2	-	2	765	c.366G>T	c.(364-366)CAG>CAT	p.Q122H	SHPRH_uc003qld.2_Missense_Mutation_p.Q122H|SHPRH_uc003qle.2_Missense_Mutation_p.Q122H|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Intron|SHPRH_uc003qlk.1_Missense_Mutation_p.Q122H	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	122					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CAGGAAGAAGCTGAAGAGTTA	0.328													16	72	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152786540	152786540	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152786540C>A	uc010kiw.2	-	18	2387	c.1785G>T	c.(1783-1785)AGG>AGT	p.R595S	SYNE1_uc003qot.3_Missense_Mutation_p.R602S|SYNE1_uc003qou.3_Missense_Mutation_p.R595S|SYNE1_uc010kjb.1_Missense_Mutation_p.R578S|SYNE1_uc003qpa.1_Missense_Mutation_p.R595S|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Missense_Mutation_p.R111S|SYNE1_uc003qoz.2_Missense_Mutation_p.R27S|SYNE1_uc003qoy.2_Missense_Mutation_p.R162S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	595	Cytoplasmic (Potential).|HAT 1.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGAGAGATTCCTCCACTGAG	0.428										HNSCC(10;0.0054)			25	61	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160477534	160477534	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160477534C>G	uc003qta.2	+	20	2921	c.2773C>G	c.(2773-2775)CAG>GAG	p.Q925E		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	925	6.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		CTGTCCCATTCAGACAACGAC	0.552													26	155	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	162683555	162683555	+	Splice_Site	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162683555A>T	uc003qtx.3	-	3	546	c.412_splice	c.e3+1	p.A138_splice	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Splice_Site|PARK2_uc003qty.3_Splice_Site_p.A138_splice|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Splice_Site_p.A138_splice	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CATTCCAATTACCTGGACTTC	0.488													35	190	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8272244	8272244	+	Silent	SNP	G	A	A	rs149823604	byFrequency	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8272244G>A	uc003srm.2	-	3	226	c.159C>T	c.(157-159)GAC>GAT	p.D53D	ICA1_uc010ktr.2_Silent_p.D53D|ICA1_uc003srl.2_Silent_p.D41D|ICA1_uc003srn.3_Translation_Start_Site|ICA1_uc003srp.3_Silent_p.D52D|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Silent_p.D53D|ICA1_uc003srr.2_Silent_p.D52D|ICA1_uc003sro.3_Silent_p.D53D|ICA1_uc011jxg.1_Silent_p.D53D|ICA1_uc003srs.1_Silent_p.D53D	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	53	AH.				neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		CCAGGTCCGCGTCAGAGGCAA	0.478													5	62	---	---	---	---	PASS
GPNMB	10457	broad.mit.edu	37	7	23296641	23296641	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23296641C>T	uc003swc.2	+	4	659	c.498C>T	c.(496-498)CCC>CCT	p.P166P	GPNMB_uc003swa.2_Silent_p.P166P|GPNMB_uc003swb.2_Silent_p.P166P|GPNMB_uc011jyy.1_Intron|GPNMB_uc011jyz.1_Silent_p.P67P	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	166	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			CTCACCACCCCGGATGGAGAA	0.468													107	192	---	---	---	---	PASS
AQP1	358	broad.mit.edu	37	7	30951901	30951901	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30951901G>A	uc003tbv.1	+	1	434	c.377G>A	c.(376-378)CGC>CAC	p.R126H	AQP1_uc011kac.1_Missense_Mutation_p.R186H	NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1	126	Extracellular.				ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	TCGCTTGGCCGCAATGACGTG	0.498													5	298	---	---	---	---	PASS
NPSR1	387129	broad.mit.edu	37	7	34851432	34851432	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34851432C>T	uc003teg.1	+	4	563	c.435C>T	c.(433-435)GAC>GAT	p.D145D	AAA1_uc010kwq.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Silent_p.D145D|NPSR1_uc010kwt.1_5'UTR|NPSR1_uc010kwu.1_Intron|NPSR1_uc010kwv.1_Intron|NPSR1_uc003tei.1_Silent_p.D145D|NPSR1_uc010kww.1_Silent_p.D134D|NPSR1_uc011kar.1_Intron|AAA1_uc010kwy.2_Intron|AAA1_uc003tek.3_Intron	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma	145	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	TCAGCATAGACAGATACCATG	0.498													44	277	---	---	---	---	PASS
TBX20	57057	broad.mit.edu	37	7	35242156	35242156	+	Silent	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35242156G>T	uc011kas.1	-	8	1241	c.1230C>A	c.(1228-1230)GGC>GGA	p.G410G		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	410						nucleus	DNA binding			central_nervous_system(1)	1						GGAATGTGGGGCCACTCCCTT	0.557													17	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38369949	38369949	+	3'UTR	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38369949C>G	uc010kxj.1	-	2					uc010kxk.1_RNA					SubName: Full=Putative uncharacterized protein ENSP00000374866;																		CTGTGCCTATCCCAGGTGGCA	0.443													34	67	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43485045	43485045	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43485045G>A	uc003tid.1	+	11	2879	c.2274G>A	c.(2272-2274)CTG>CTA	p.L758L	HECW1_uc011kbi.1_Silent_p.L758L	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	758					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GCCCTGAGCTGGACCCGGAGT	0.657													40	82	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48046905	48046905	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48046905C>T	uc003tof.2	-	6	446	c.349G>A	c.(349-351)GAA>AAA	p.E117K	SUN3_uc010kyq.2_Missense_Mutation_p.E17K|SUN3_uc003tog.2_Missense_Mutation_p.E117K|SUN3_uc011kcf.1_Missense_Mutation_p.E105K	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1	117	Potential.					integral to membrane				central_nervous_system(1)	1						AAATTGTTTTCCAGATTCTGG	0.413													46	120	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50571751	50571751	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50571751C>A	uc003tpf.3	-	7	807	c.721G>T	c.(721-723)GCC>TCC	p.A241S	DDC_uc010kza.2_Missense_Mutation_p.A156S|DDC_uc003tpg.3_Missense_Mutation_p.A241S	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	241					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	CCCAGGGTGGCAACCATCTAG	0.488													40	177	---	---	---	---	PASS
CCT6A	908	broad.mit.edu	37	7	56130730	56130730	+	Silent	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56130730C>G	uc003trl.1	+	14	1712	c.1548C>G	c.(1546-1548)CTC>CTG	p.L516L	PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Silent_p.L471L|CCT6A_uc011kcu.1_Silent_p.L485L|SUMF2_uc003tro.2_5'Flank|SUMF2_uc011kcv.1_5'Flank|SUMF2_uc011kcw.1_5'Flank|SUMF2_uc011kcx.1_5'Flank|SUMF2_uc003trv.2_5'Flank|SUMF2_uc003trt.2_5'Flank|SUMF2_uc011kcy.1_5'Flank|SUMF2_uc011kcz.1_5'Flank|SUMF2_uc003tru.2_5'Flank|SUMF2_uc011kda.1_5'Flank|SUMF2_uc003trx.2_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	516					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CCAACATTCTCTTGGTTGATG	0.443													49	550	---	---	---	---	PASS
RSBN1L	222194	broad.mit.edu	37	7	77325778	77325778	+	5'UTR	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77325778G>C	uc010ldt.1	+	1					RSBN1L_uc003ugm.2_5'Flank|uc003ugj.1_RNA	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like							nucleus				ovary(1)	1						AATACAACAGGAGCGCAAAAT	0.697													13	47	---	---	---	---	PASS
KRIT1	889	broad.mit.edu	37	7	91864747	91864747	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91864747C>G	uc003ulq.1	-	6	870	c.699G>C	c.(697-699)TTG>TTC	p.L233F	KRIT1_uc010lev.1_Missense_Mutation_p.L26F|KRIT1_uc003ulr.1_Missense_Mutation_p.L233F|KRIT1_uc003uls.1_Missense_Mutation_p.L233F|KRIT1_uc003ult.1_Missense_Mutation_p.L233F|KRIT1_uc003ulu.1_Missense_Mutation_p.L233F|KRIT1_uc003ulv.1_Missense_Mutation_p.L233F	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1	233					angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CTGATCCAAACAAAGGGTTGT	0.343									Familial_Cerebral_Cavernous_Angioma				9	144	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92970853	92970853	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92970853G>A	uc003umo.2	+	23	2301	c.2173G>A	c.(2173-2175)GGG>AGG	p.G725R	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.G695R|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.G445R	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	725											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TACGCTGTATGGGTTGGCAGA	0.433													56	132	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94947701	94947701	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94947701G>A	uc003uns.2	-	2	176	c.79C>T	c.(79-81)CGA>TGA	p.R27*	PON1_uc011kih.1_Intron	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	27					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	GCATTAAGTCGTGTTCTGTGG	0.388													6	61	---	---	---	---	PASS
TAF6	6878	broad.mit.edu	37	7	99711348	99711348	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99711348G>A	uc003uti.2	-	4	369	c.288C>T	c.(286-288)TTC>TTT	p.F96F	TAF6_uc003utg.2_Silent_p.F37F|TAF6_uc003uth.2_Silent_p.F153F|TAF6_uc003utk.2_Silent_p.F96F|TAF6_uc011kji.1_Silent_p.F133F|TAF6_uc003utj.2_Silent_p.F86F|TAF6_uc003utl.2_Silent_p.F96F|TAF6_uc003utm.2_Silent_p.F96F|TAF6_uc003utn.1_RNA	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	96					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACCAGAGGCGAAGCGGAAAG	0.597													37	53	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150706363	150706363	+	Intron	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150706363C>A	uc003wif.2	+						NOS3_uc011kuy.1_Intron	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1						anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CACGTGAGGACGACGGCTTTA	0.627													11	42	---	---	---	---	PASS
SLC20A2	6575	broad.mit.edu	37	8	42297058	42297058	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42297058C>T	uc010lxl.2	-	7	1538	c.844G>A	c.(844-846)GAC>AAC	p.D282N	SLC20A2_uc010lxm.2_Missense_Mutation_p.D282N|SLC20A2_uc003xpe.2_Missense_Mutation_p.D282N|SLC20A2_uc011lcu.1_Missense_Mutation_p.D84N	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2	282	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATGGTGCTGTCATCATTAGCC	0.557													19	224	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74516011	74516011	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74516011C>A	uc003xzm.2	-	10	1215	c.979G>T	c.(979-981)GTT>TTT	p.V327F	STAU2_uc011lfg.1_Missense_Mutation_p.V155F|STAU2_uc003xzn.2_Missense_Mutation_p.V295F|STAU2_uc011lfh.1_Missense_Mutation_p.V223F|STAU2_uc003xzo.2_Missense_Mutation_p.V327F|STAU2_uc003xzp.2_Missense_Mutation_p.V295F|STAU2_uc011lfi.1_Missense_Mutation_p.V289F|STAU2_uc003xzq.2_Missense_Mutation_p.V107F|STAU2_uc010lzk.2_Missense_Mutation_p.V295F|STAU2_uc010lzl.1_Missense_Mutation_p.V155F	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	327	DRBM 4.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GAAAGCAAAACATAATCCGGC	0.413													27	95	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103340026	103340026	+	Silent	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103340026A>T	uc003ykr.1	-	12	1458	c.1425T>A	c.(1423-1425)TCT>TCA	p.S475S	UBR5_uc003yks.1_Silent_p.S475S	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	475					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGCAATGTAAAGAAACTATCC	0.433													16	181	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106815442	106815442	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815442G>A	uc003ymd.2	+	8	3155	c.3132G>A	c.(3130-3132)GTG>GTA	p.V1044V	ZFPM2_uc011lhs.1_Silent_p.V775V	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	1044					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGGTAATAGTGAATGGTGGAC	0.473													24	43	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110504122	110504122	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110504122G>A	uc003yne.2	+	62	10239	c.10135G>A	c.(10135-10137)GCC>ACC	p.A3379T		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3379	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATGGGGGAATGCCAACCGAGT	0.378										HNSCC(38;0.096)			6	7	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164580	139164580	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164580A>G	uc003yuy.2	-	13	2309	c.2138T>C	c.(2137-2139)GTC>GCC	p.V713A	FAM135B_uc003yux.2_Missense_Mutation_p.V614A|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.V275A|FAM135B_uc003yvb.2_Missense_Mutation_p.V275A	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	713										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGGGTGCAAGACTTCCCGATC	0.552										HNSCC(54;0.14)			22	114	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79836154	79836154	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79836154G>T	uc004akr.2	+	13	1303	c.1043G>T	c.(1042-1044)TGG>TTG	p.W348L	VPS13A_uc004akp.3_Missense_Mutation_p.W348L|VPS13A_uc004akq.3_Missense_Mutation_p.W348L|VPS13A_uc004aks.2_Missense_Mutation_p.W348L	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	348					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CCCAGGTTATGGATGTGGTCA	0.348													4	155	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101817581	101817581	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101817581G>T	uc004azb.1	+	34	3325	c.3119G>T	c.(3118-3120)GGA>GTA	p.G1040V		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1040	Triple-helical region 7 (COL7).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GGTGAAAAAGGAGAAAAAGGA	0.498													36	128	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113431191	113431191	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113431191G>A	uc004bey.2	+	1	105	c.7G>A	c.(7-9)GAG>AAG	p.E3K	MUSK_uc004bex.2_Missense_Mutation_p.E3K	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	3					transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						AATCATGAGAGAGCTCGTCAA	0.433													7	603	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116812085	116812085	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116812085G>T	uc004bid.2	+	15	2602	c.2503G>T	c.(2503-2505)GAG>TAG	p.E835*	ZNF618_uc004bic.2_Nonsense_Mutation_p.E742*|ZNF618_uc011lxi.1_Nonsense_Mutation_p.E802*|ZNF618_uc011lxj.1_Nonsense_Mutation_p.E803*|ZNF618_uc010mvb.2_Nonsense_Mutation_p.E425*	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	835					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCTCATCAACGAGGTGAAGGA	0.637													47	105	---	---	---	---	PASS
CIZ1	25792	broad.mit.edu	37	9	130948061	130948061	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130948061G>A	uc004btt.2	-						CIZ1_uc004btr.2_Intron|CIZ1_uc004bts.2_Intron|CIZ1_uc011maq.1_Intron|CIZ1_uc004btu.2_Intron|CIZ1_uc011mar.1_Intron|CIZ1_uc011mas.1_Intron|CIZ1_uc004btw.2_Intron|CIZ1_uc004btv.2_Intron|CIZ1_uc004btx.2_Intron	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform							nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						GTTACCTGCAGGCAAGAAGAC	0.567													17	35	---	---	---	---	PASS
FBXW5	54461	broad.mit.edu	37	9	139835842	139835842	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139835842C>T	uc004cjx.2	-	8	1469	c.1318G>A	c.(1318-1320)GCG>ACG	p.A440T	FBXW5_uc010nbx.2_RNA|FBXW5_uc004cjy.2_Missense_Mutation_p.A188T|FBXW5_uc004cjz.2_Missense_Mutation_p.A170T	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	440							catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		ATCTCCTCCGCGATTGGTGGC	0.667													6	33	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17146477	17146477	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17146477G>C	uc001ioo.2	-	12	1410	c.1358C>G	c.(1357-1359)TCT>TGT	p.S453C		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	453	EGF-like 7; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAACTGAAAGAATCAACGCC	0.468													3	123	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55566745	55566745	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55566745G>T	uc010qhq.1	-	36	5038	c.4643C>A	c.(4642-4644)GCA>GAA	p.A1548E	PCDH15_uc010qhr.1_Missense_Mutation_p.A1543E	NM_001142771	NP_001136243	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD3-1 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ACCATTCTGTGCAATATATAT	0.478										HNSCC(58;0.16)			20	92	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582824	55582824	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582824G>A	uc001jju.1	-	33	5057	c.4662C>T	c.(4660-4662)CCC>CCT	p.P1554P	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.P1551P|PCDH15_uc010qhw.1_Silent_p.P1514P|PCDH15_uc010qhx.1_Silent_p.P1485P|PCDH15_uc010qhy.1_Silent_p.P1561P|PCDH15_uc010qhz.1_Silent_p.P1556P|PCDH15_uc010qia.1_Silent_p.P1534P|PCDH15_uc010qib.1_Silent_p.P1531P	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1554	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTGTATTTTGGGTGAAAATG	0.423										HNSCC(58;0.16)			41	199	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687433	68687433	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687433C>A	uc001jmz.1	+	2	1309	c.759C>A	c.(757-759)AGC>AGA	p.S253R	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.S253R	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	253	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GGACCTGGAGCTCCTTACAAA	0.483													85	295	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71678051	71678051	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71678051G>A	uc001jpr.1	+	18	1543	c.1007G>A	c.(1006-1008)GGA>GAA	p.G336E	COL13A1_uc001jqj.1_Missense_Mutation_p.G336E|COL13A1_uc001jps.1_Missense_Mutation_p.G307E|COL13A1_uc001jpt.1_Missense_Mutation_p.G295E|COL13A1_uc001jpu.1_Missense_Mutation_p.G317E|COL13A1_uc001jpv.1_Missense_Mutation_p.G336E|COL13A1_uc001jpx.1_Missense_Mutation_p.G314E|COL13A1_uc001jpw.1_Missense_Mutation_p.G283E|COL13A1_uc001jpy.1_Missense_Mutation_p.G274E|COL13A1_uc001jpz.1_Missense_Mutation_p.G279E|COL13A1_uc001jqa.1_Missense_Mutation_p.G276E|COL13A1_uc001jqc.1_Missense_Mutation_p.G336E|COL13A1_uc001jqb.1_Missense_Mutation_p.G285E|COL13A1_uc001jql.2_Missense_Mutation_p.G336E|COL13A1_uc001jqd.1_Missense_Mutation_p.G324E|COL13A1_uc001jqe.1_Missense_Mutation_p.G319E|COL13A1_uc001jqf.1_Missense_Mutation_p.G317E|COL13A1_uc001jqg.1_Missense_Mutation_p.G314E|COL13A1_uc001jqh.1_Missense_Mutation_p.G336E|COL13A1_uc001jqi.1_Missense_Mutation_p.G336E|COL13A1_uc010qjf.1_Missense_Mutation_p.G126E|COL13A1_uc001jqk.1_Missense_Mutation_p.G174E	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	336	Extracellular (Potential).|Triple-helical region 2 (COL2).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	GGGGCGCCCGGAATTGCCGTG	0.592													17	53	---	---	---	---	PASS
SFTPD	6441	broad.mit.edu	37	10	81701273	81701273	+	Intron	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81701273G>T	uc001kbh.2	-						MBL1P_uc001kbf.2_Intron	NM_003019	NP_003010	P35247	SFTPD_HUMAN	pulmonary surfactant-associated protein D						cell junction assembly|innate immune response|lung alveolus development|macrophage chemotaxis|negative regulation of interleukin-2 biosynthetic process|negative regulation of T cell proliferation|positive regulation of phagocytosis|reactive oxygen species metabolic process|receptor-mediated endocytosis|respiratory gaseous exchange|surfactant homeostasis	collagen|endocytic vesicle|extracellular space|lysosome	bacterial cell surface binding|protein binding|sugar binding			skin(1)	1	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			AGCAGACCCTGGGGTAAAAGA	0.488													5	236	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104171506	104171506	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104171506G>A	uc001kvg.1	-	8	2427	c.1900C>T	c.(1900-1902)CAG>TAG	p.Q634*	PSD_uc001kvf.1_5'Flank|PSD_uc001kvh.1_Nonsense_Mutation_p.Q255*|PSD_uc009xxd.1_Nonsense_Mutation_p.Q634*	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	634	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		AAGTATCGCTGGGAGAAGTGG	0.592													6	55	---	---	---	---	PASS
FAM160B1	57700	broad.mit.edu	37	10	116596002	116596002	+	Silent	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116596002A>G	uc001lcb.2	+	5	854	c.519A>G	c.(517-519)CTA>CTG	p.L173L	FAM160B1_uc001lcc.2_Silent_p.L173L	NM_020940	NP_065991	Q5W0V3	F16B1_HUMAN	hypothetical protein LOC57700 isoform a	173										lung(1)	1						ACTTTTTCCTAGAGGTATGAT	0.343													91	250	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127417921	127417921	+	Intron	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127417921T>A	uc001liq.1	+						C10orf137_uc001lin.2_Intron|C10orf137_uc001lio.1_Intron|C10orf137_uc001lip.1_Intron	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CTATTTTAAATCACAGGGTCT	0.368													3	46	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	133106502	133106502	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133106502C>T	uc001lkp.2	-	3	728	c.642G>A	c.(640-642)ACG>ACA	p.T214T		NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	214										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CTAACACCACCGTGGGGAGCG	0.478													11	33	---	---	---	---	PASS
JAKMIP3	282973	broad.mit.edu	37	10	133930716	133930716	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133930716C>T	uc001lkx.3	+	2	271	c.271C>T	c.(271-273)CGT>TGT	p.R91C		NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACAGGCTGTGCGTGAGACGCT	0.607													8	57	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134013907	134013907	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134013907G>A	uc009ybb.2	+	9	1013	c.859G>A	c.(859-861)GGT>AGT	p.G287S		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	287					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GGGCACCGACGGTTCACACTA	0.667													4	135	---	---	---	---	PASS
NLRP6	171389	broad.mit.edu	37	11	281697	281697	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:281697G>A	uc010qvs.1	+	4	1963	c.1963G>A	c.(1963-1965)GAC>AAC	p.D655N	NLRP6_uc010qvt.1_Missense_Mutation_p.D655N	NM_138329	NP_612202	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	655						cytoplasm	ATP binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGCCGCATGGACGTGGCTGT	0.627													64	211	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6806907	6806907	+	Silent	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806907T>A	uc001mer.1	+	1	639	c.639T>A	c.(637-639)GCT>GCA	p.A213A		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	213	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTCTTGCTGCTATACTGGCCT	0.498													67	215	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8732709	8732709	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8732709G>A	uc001mgt.2	-	10	2428	c.2242C>T	c.(2242-2244)CCT>TCT	p.P748S	ST5_uc009yfr.2_Missense_Mutation_p.P328S|ST5_uc001mgu.2_Missense_Mutation_p.P328S|ST5_uc001mgv.2_Missense_Mutation_p.P748S|ST5_uc010rbq.1_RNA|ST5_uc010rbp.1_Missense_Mutation_p.P261S|ST5_uc009yfs.2_RNA	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1	748	UDENN.				positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		TTGGCATCAGGGAAGCAAAAC	0.567													51	204	---	---	---	---	PASS
TEAD1	7003	broad.mit.edu	37	11	12904622	12904622	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12904622C>T	uc001mkj.3	+	9	1269	c.604C>T	c.(604-606)CGC>TGC	p.R202C	TEAD1_uc001mkk.3_Missense_Mutation_p.R121C|TEAD1_uc009ygl.2_Missense_Mutation_p.R96C	NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1	217	Transcriptional activation (Potential).				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		AACCAAGCTTCGCCTGGTGGA	0.547													8	341	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22249017	22249017	+	Missense_Mutation	SNP	G	T	T	rs146725859		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22249017G>T	uc001mqi.2	+	7	850	c.533G>T	c.(532-534)AGT>ATT	p.S178I	ANO5_uc001mqj.2_Missense_Mutation_p.S177I	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	178	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						CTCCCACTGAGTGTGAAGTAT	0.463													44	187	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371597	55371597	+	Missense_Mutation	SNP	A	T	T	rs143807541	byFrequency	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371597A>T	uc010rii.1	-	1	253	c.253T>A	c.(253-255)TCT>ACT	p.S85T		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTCTTTTCAGAGAGAGCATCC	0.393													28	113	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55432849	55432849	+	Silent	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55432849C>A	uc001nht.3	+	3	472	c.207C>A	c.(205-207)GTC>GTA	p.V69V	OR4C6_uc010rik.1_Silent_p.V69V	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TTTTGGATGTCATGTTCTCAT	0.453													87	284	---	---	---	---	PASS
OR5T3	390154	broad.mit.edu	37	11	56020624	56020624	+	Missense_Mutation	SNP	C	A	A	rs147827901		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56020624C>A	uc010rjd.1	+	1	949	c.949C>A	c.(949-951)CCC>ACC	p.P317T		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	317	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					CAAGTTGAATCCCATCATCTA	0.323													9	49	---	---	---	---	PASS
OR5A1	219982	broad.mit.edu	37	11	59211379	59211379	+	Silent	SNP	G	A	A	rs147466806		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59211379G>A	uc001nnx.1	+	1	738	c.738G>A	c.(736-738)TCG>TCA	p.S246S		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CGTGTGCCTCGCATCTGATGG	0.542													133	431	---	---	---	---	PASS
C11orf66	220004	broad.mit.edu	37	11	61257962	61257962	+	Intron	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61257962C>T	uc001nru.1	+						C11orf66_uc009ynq.1_Intron	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN	IIIG9 protein											ovary(1)	1						TCTCCTCTTGCCTCCCTGCAG	0.602													122	455	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65389837	65389837	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65389837G>T	uc001oey.2	+	11	2357	c.2357G>T	c.(2356-2358)CGG>CTG	p.R786L	PCNXL3_uc009yqn.2_5'Flank	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	786						integral to membrane					0						CTGCTGGACCGGTGAGTGTCC	0.642													3	10	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65396071	65396071	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65396071G>A	uc001oey.2	+	23	3708	c.3708G>A	c.(3706-3708)TGG>TGA	p.W1236*	PCNXL3_uc001oez.2_Nonsense_Mutation_p.W123*	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1236						integral to membrane					0						GCCAGCTGTGGGACTTGCTGT	0.602													19	69	---	---	---	---	PASS
GDPD5	81544	broad.mit.edu	37	11	75160035	75160035	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75160035C>T	uc001owo.3	-	10	1238	c.701G>A	c.(700-702)CGC>CAC	p.R234H	GDPD5_uc001owp.3_Missense_Mutation_p.R234H|GDPD5_uc001own.3_5'UTR|GDPD5_uc009yuc.2_Missense_Mutation_p.R96H|GDPD5_uc009yud.2_Missense_Mutation_p.R115H|GDPD5_uc009yue.1_Missense_Mutation_p.R122H	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain	234	Extracellular (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						GGGGGCCCCGCGGTGGCCAAT	0.607													22	58	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95825560	95825560	+	Silent	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95825560C>A	uc001pfw.1	-	2	2920	c.1635G>T	c.(1633-1635)CCG>CCT	p.P545P		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	545					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TGGCTGGGTGCGGGTTGTTAA	0.527			T	MECT1|CRTC3	salivary gland mucoepidermoid								11	41	---	---	---	---	PASS
MMP1	4312	broad.mit.edu	37	11	102667842	102667842	+	Silent	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102667842A>T	uc001phi.2	-	3	545	c.402T>A	c.(400-402)ATT>ATA	p.I134I	uc001phh.1_Intron|MMP1_uc010ruv.1_Silent_p.I68I	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1	134	Metalloprotease.				blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		AGGCTTTCTCAATGGCATGGT	0.433													100	351	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113688476	113688476	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113688476G>A	uc001poh.2	-	13	1400	c.1367C>T	c.(1366-1368)CCT>CTT	p.P456L	USP28_uc001pog.2_Missense_Mutation_p.P164L|USP28_uc010rwy.1_Missense_Mutation_p.P331L|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Missense_Mutation_p.P456L	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	456					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTCTGAGGCAGGTTTTGTACT	0.463													4	348	---	---	---	---	PASS
OR8D4	338662	broad.mit.edu	37	11	123777604	123777604	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123777604G>A	uc010saa.1	+	1	466	c.466G>A	c.(466-468)GCT>ACT	p.A156T		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TTTCACTGATGCTGTGATCCA	0.468													104	383	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124766107	124766107	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124766107C>T	uc001qbg.2	-	4	806	c.666G>A	c.(664-666)CGG>CGA	p.R222R	ROBO4_uc010sas.1_Silent_p.R77R|ROBO4_uc001qbh.2_Silent_p.R112R|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	222	Ig-like C2-type 2.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGATGGAAACCCGGGCTGCGC	0.602													61	179	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6058318	6058318	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6058318C>T	uc001qnn.1	-	52	8555	c.8305G>A	c.(8305-8307)GAC>AAC	p.D2769N	ANO2_uc001qnm.2_5'Flank|VWF_uc010set.1_3'UTR	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2769	CTCK.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	GAGCACTGGTCCTGCACATCG	0.547													33	91	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6690881	6690881	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690881T>C	uc001qpo.2	-	31	4779	c.4615A>G	c.(4615-4617)AAA>GAA	p.K1539E	CHD4_uc001qpn.2_Missense_Mutation_p.K1532E|CHD4_uc001qpp.2_Missense_Mutation_p.K1564E|uc001qpq.1_Intron|SCARNA11_uc001qpr.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1539					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GTAGGAGTTTTTGGGGAGGGT	0.557													70	202	---	---	---	---	PASS
C12orf59	120939	broad.mit.edu	37	12	10342551	10342551	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10342551C>A	uc001qxr.2	+	5	981	c.364C>A	c.(364-366)CAC>AAC	p.H122N	C12orf59_uc001qxq.2_Missense_Mutation_p.H102N			Q4KMG9	CL059_HUMAN	RecName: Full=Uncharacterized protein C12orf59; Flags: Precursor;	122						integral to membrane				ovary(1)	1						GGCTCACTCCCACAGCTCCCT	0.562													16	144	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12317355	12317355	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317355A>C	uc001rah.3	-	9	2046	c.1904T>G	c.(1903-1905)TTG>TGG	p.L635W	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.L635W	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	635	Extracellular (Potential).|Beta-propeller 3.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				CCGTGAAAACAAAAGGAAAGC	0.453													18	277	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14792812	14792812	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14792812T>C	uc001rcd.2	-	19	2278	c.2141A>G	c.(2140-2142)GAG>GGG	p.E714G		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	714	Cytoplasmic (Potential).|Protein kinase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						CTCTTTTTCCTCTGCTGTTTC	0.254													68	221	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49440038	49440038	+	Intron	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49440038C>T	uc001rta.3	-							NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AAGGGATGTTCTCACCGTTCA	0.557			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			5	40	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50189134	50189134	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50189134T>C	uc009zlk.2	-	8	2711	c.2509A>G	c.(2509-2511)AAG>GAG	p.K837E	NCKAP5L_uc001rvc.3_Missense_Mutation_p.K41E|NCKAP5L_uc001rvb.2_Missense_Mutation_p.K430E	NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	833	Pro-rich.									central_nervous_system(1)	1						GGGGACTCCTTGGTGACTAGC	0.637													23	165	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50196740	50196740	+	Splice_Site	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50196740C>A	uc009zlk.2	-	5	433	c.231_splice	c.e5+1	p.K77_splice		NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like											central_nervous_system(1)	1						GGGTTACTCACCTTCTGGTTC	0.602													15	47	---	---	---	---	PASS
ATP5G2	517	broad.mit.edu	37	12	54059103	54059103	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54059103T>C	uc009znc.2	-	6	1122	c.421A>G	c.(421-423)ATG>GTG	p.M141V	ATP5G2_uc001sec.2_Missense_Mutation_p.M198V|ATP5G2_uc001sed.2_Missense_Mutation_p.M157V	NM_001002031	NP_001002031	Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	141					ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding			ovary(1)	1						CTCCTTCACATGGCAAAGAGG	0.567													19	53	---	---	---	---	PASS
OR6C65	403282	broad.mit.edu	37	12	55794749	55794749	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55794749C>A	uc010spl.1	+	1	437	c.437C>A	c.(436-438)TCC>TAC	p.S146Y		NM_001005518	NP_001005518	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTAATCAGCTCCTGGCTGGCT	0.428													47	204	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56477570	56477570	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56477570G>A	uc001sjh.2	+	2	311	c.118G>A	c.(118-120)GGC>AGC	p.G40S	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_5'UTR|ERBB3_uc001sjg.2_Missense_Mutation_p.G40S	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	40	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GAGTGTGACCGGCGATGCTGA	0.547													9	445	---	---	---	---	PASS
ZBTB39	9880	broad.mit.edu	37	12	57398015	57398015	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57398015G>A	uc001sml.1	-	2	773	c.687C>T	c.(685-687)CTC>CTT	p.L229L	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	229					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						CAGTGCCTAGGAGTGGCTGGG	0.572													8	76	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64238638	64238638	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64238638A>G	uc010ssp.1	+	1	98	c.42A>G	c.(40-42)ATA>ATG	p.I14M	SRGAP1_uc001srt.2_Missense_Mutation_p.I14M	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	14					axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		AAGAGATCATAGCCGAGTATG	0.493													21	195	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72050788	72050788	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72050788C>G	uc001swo.2	-	2	1251	c.892G>C	c.(892-894)GCA>CCA	p.A298P	ZFC3H1_uc010sts.1_Missense_Mutation_p.A298P|ZFC3H1_uc001swp.2_Missense_Mutation_p.A298P	NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	298					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						AATTCAAATGCCTGAAAAGTT	0.368													52	180	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78452816	78452816	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78452816C>A	uc001syp.2	+	12	2730	c.2557C>A	c.(2557-2559)CTG>ATG	p.L853M	NAV3_uc001syo.2_Missense_Mutation_p.L853M|NAV3_uc010sub.1_Missense_Mutation_p.L353M	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	853						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TACTAGAAGTCTGAACCGAAT	0.398										HNSCC(70;0.22)			18	119	---	---	---	---	PASS
SDS	10993	broad.mit.edu	37	12	113835191	113835191	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113835191G>A	uc001tvg.2	-	6	554	c.432C>T	c.(430-432)GGC>GGT	p.G144G	SDS_uc001tvh.1_Silent_p.G144G	NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	144					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TGGAAGCGTGGCCTTCCCTGG	0.657													20	80	---	---	---	---	PASS
FBXO21	23014	broad.mit.edu	37	12	117610395	117610395	+	Silent	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117610395T>A	uc001twk.2	-	7	933	c.894A>T	c.(892-894)ACA>ACT	p.T298T	FBXO21_uc001twj.2_Silent_p.T298T|FBXO21_uc009zwq.2_Silent_p.T298T	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1	298					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TTGGGATTCCTGTTCTGCGAA	0.353													38	101	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130847603	130847603	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130847603C>T	uc001uik.2	+	18	2199	c.2109C>T	c.(2107-2109)GGC>GGT	p.G703G	PIWIL1_uc001uij.1_Silent_p.G703G	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	703	Piwi.				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ACCGCGATGGCGTAGGAGACG	0.478													48	150	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26127982	26127982	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26127982A>T	uc001uqk.2	+	12	1251	c.1109A>T	c.(1108-1110)TAC>TTC	p.Y370F	ATP8A2_uc010tdi.1_Missense_Mutation_p.Y330F|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Missense_Mutation_p.Y330F	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	330	Helical; (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATCATCTTATACAACAATCTT	0.393													85	244	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76432057	76432057	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76432057C>G	uc001vjv.2	+	27	4826	c.4066C>G	c.(4066-4068)CTG>GTG	p.L1356V	LMO7_uc010thv.1_Missense_Mutation_p.S1343C|LMO7_uc010thw.1_Missense_Mutation_p.S1269C|LMO7_uc001vjx.1_RNA	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	Error:Variant_position_missing_in_Q8WWI1_after_alignment						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GCCCGATCAGCTGGACGGCCA	0.448													4	109	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528999	20528999	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528999G>C	uc001vwn.1	+	1	796	c.796G>C	c.(796-798)GCA>CCA	p.A266P		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		CAGTAGTTTGGCAAGCAATAA	0.408													37	80	---	---	---	---	PASS
RNASE13	440163	broad.mit.edu	37	14	21502245	21502245	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21502245C>A	uc001vzj.2	-	2	341	c.203G>T	c.(202-204)TGC>TTC	p.C68F	NDRG2_uc010tll.1_Intron	NM_001012264	NP_001012264	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 precursor	68						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			upper_aerodigestive_tract(1)	1	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		GATCTTTGGGCAATCTGAATT	0.433													61	133	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52507411	52507411	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52507411G>A	uc001wzo.2	-	8	2218	c.1984C>T	c.(1984-1986)CAC>TAC	p.H662Y	NID2_uc010tqs.1_Missense_Mutation_p.H662Y|NID2_uc010tqt.1_Missense_Mutation_p.H662Y|NID2_uc001wzp.2_Missense_Mutation_p.H662Y	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	662	Nidogen G2 beta-barrel.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					GGAGAGATGTGGGCTGTGAAA	0.368													5	377	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52734677	52734677	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52734677T>G	uc001wzq.2	+	1	247	c.145T>G	c.(145-147)TGC>GGC	p.C49G		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	49	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	GCTGGGGTGGTGCTCGCGGCG	0.692													4	22	---	---	---	---	PASS
PPP2R5E	5529	broad.mit.edu	37	14	63851287	63851287	+	Silent	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63851287C>A	uc001xgd.1	-	12	1667	c.1077G>T	c.(1075-1077)GTG>GTT	p.V359V	PPP2R5E_uc010tsf.1_Silent_p.V283V|PPP2R5E_uc010tsg.1_Silent_p.V283V|PPP2R5E_uc001xge.2_Silent_p.V359V|PPP2R5E_uc010tsh.1_Silent_p.V359V|PPP2R5E_uc001xgf.1_RNA	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,	359					signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		CTCTTTCTGCCACCTTTGGGA	0.299													57	104	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	74975375	74975375	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74975375C>T	uc001xqa.2	-	24	3971	c.3584G>A	c.(3583-3585)AGC>AAC	p.S1195N		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1195	Cys-rich.|EGF-like 12; calcium-binding (Potential).				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGACCCGTGGCTGTTGAGGCA	0.632													31	60	---	---	---	---	PASS
AMN	81693	broad.mit.edu	37	14	103390101	103390101	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103390101G>A	uc001ymg.3	+	2	130	c.97G>A	c.(97-99)GCA>ACA	p.A33T	AMN_uc001ymh.3_5'UTR	NM_030943	NP_112205	Q9BXJ7	AMNLS_HUMAN	amnionless protein precursor	33	Extracellular (Potential).				lipid metabolic process|lipoprotein metabolic process|multicellular organismal development	integral to membrane|plasma membrane					0				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTCGACGTCGCAGCCAACTG	0.706													13	81	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104208451	104208451	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104208451G>T	uc001yof.1	-	11	1781	c.1498C>A	c.(1498-1500)CCC>ACC	p.P500T	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Missense_Mutation_p.P367T	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	500	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				AGCAGGGTGGGCCTCTGTCGA	0.642													8	106	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106322307	106322307	+	RNA	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106322307G>T	uc010tyt.1	-	3598		c.55179C>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						GAAAAGGGTTGGGGCGGATGC	0.627													3	2	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107199139	107199139	+	RNA	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107199139G>A	uc010tyt.1	-	21		c.1559C>T								Parts of antibodies, mostly variable regions.												0						CCATGTAGTGGTCACTGAAGG	0.592													29	168	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25936908	25936908	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25936908T>A	uc010ayu.2	-	15	3225	c.3119A>T	c.(3118-3120)CAG>CTG	p.Q1040L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1040	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ATCTGCCACCTGGATCATGCT	0.473													93	411	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346291	29346291	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346291C>T	uc001zck.2	+	3	411	c.204C>T	c.(202-204)CCC>CCT	p.P68P	APBA2_uc010azj.2_Silent_p.P68P|APBA2_uc010uat.1_Silent_p.P68P|APBA2_uc001zcl.2_Silent_p.P68P|APBA2_uc010uas.1_Silent_p.P68P	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	68					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		ACCACAGCCCCGATGGGGACT	0.642													51	349	---	---	---	---	PASS
SLC24A5	283652	broad.mit.edu	37	15	48431199	48431199	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48431199A>G	uc001zwe.2	+	7	978	c.905A>G	c.(904-906)GAC>GGC	p.D302G	SLC24A5_uc010bel.2_Missense_Mutation_p.D242G|uc001zwf.1_5'Flank|SLC24A5_uc001zwk.2_5'Flank	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN	solute carrier family 24, member 5 precursor	302	Cytoplasmic (Potential).				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity				0		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		CCTGAAGCAGACTTAAAAAGA	0.313													18	59	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55929437	55929437	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55929437G>T	uc002adg.2	-	15	2602	c.2554C>A	c.(2554-2556)CGC>AGC	p.R852S		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	852	Fibronectin type-III 5.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ATAGTATAGCGGGTCACAACT	0.473													6	463	---	---	---	---	PASS
ACSBG1	23205	broad.mit.edu	37	15	78475066	78475066	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78475066T>A	uc002bdh.2	-	6	781	c.725A>T	c.(724-726)AAG>ATG	p.K242M	ACSBG1_uc010umw.1_Missense_Mutation_p.K238M|ACSBG1_uc010umx.1_Translation_Start_Site|ACSBG1_uc010umy.1_Missense_Mutation_p.K135M	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN	lipidosin	242					long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1						ATTGGCCATCTTGTTTGGAGG	0.527													28	361	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84611716	84611716	+	Missense_Mutation	SNP	C	T	T	rs144077662		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84611716C>T	uc002bjz.3	+	19	2596	c.2372C>T	c.(2371-2373)ACG>ATG	p.T791M	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.T791M|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.T791M	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	791	TSP type-1 6.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGCTGCTAACGGATGGCAGC	0.547													23	87	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88726675	88726675	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88726675A>C	uc002bme.1	-	4	531	c.369T>G	c.(367-369)TTT>TTG	p.F123L	NTRK3_uc002bmh.2_Missense_Mutation_p.F123L|NTRK3_uc002bmf.1_Missense_Mutation_p.F123L|NTRK3_uc010upl.1_Missense_Mutation_p.F25L|NTRK3_uc010bnh.1_Missense_Mutation_p.F123L|NTRK3_uc002bmg.2_Missense_Mutation_p.F123L	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	123	LRR 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGTTCTTGGCAAAGGCTCTGG	0.463			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			42	378	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4827908	4827908	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4827908G>A	uc002cxq.2	-	10	1108	c.967C>T	c.(967-969)CGC>TGC	p.R323C	SEPT12_uc002cxr.2_Missense_Mutation_p.R277C|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	323					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CCGGGCCCGCGGGGCAGCAGG	0.627													9	18	---	---	---	---	PASS
ERCC4	2072	broad.mit.edu	37	16	14029165	14029165	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14029165C>T	uc002dce.2	+	8	1385	c.1376C>T	c.(1375-1377)TCA>TTA	p.S459L	ERCC4_uc010uyz.1_Missense_Mutation_p.S9L	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	459					double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						GAAGACAGTTCAAAGAGAATT	0.413			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				28	109	---	---	---	---	PASS
NOMO3	408050	broad.mit.edu	37	16	16349574	16349574	+	Intron	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16349574T>C	uc002deq.2	+						NOMO3_uc002dep.2_Intron|NOMO3_uc010bvp.1_Intron	NM_001004067	NP_001004067	P69849	NOMO3_HUMAN	nodal modulator 3 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		CTTTGTTTTCTAGCCCGTGTT	0.567													42	106	---	---	---	---	PASS
UMOD	7369	broad.mit.edu	37	16	20359547	20359547	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20359547G>C	uc002dgz.2	-	4	1100	c.971C>G	c.(970-972)ACT>AGT	p.T324S	UMOD_uc002dha.2_Missense_Mutation_p.T324S|UMOD_uc002dhb.2_Missense_Mutation_p.T357S	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	324					cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						GGCCTCACCAGTGATGTTGAA	0.557													6	261	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20548681	20548681	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20548681C>A	uc002dhj.3	-	15	1843	c.1633G>T	c.(1633-1635)GAG>TAG	p.E545*	ACSM2B_uc002dhk.3_Nonsense_Mutation_p.E545*	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	545					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						AAGACAAACTCTATCTGTTGA	0.483													5	359	---	---	---	---	PASS
ERI2	112479	broad.mit.edu	37	16	20812550	20812550	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20812550T>A	uc010vbb.1	-	5	478	c.435A>T	c.(433-435)AAA>AAT	p.K145N	ERI2_uc002dht.3_Missense_Mutation_p.K52N|ERI2_uc002dhs.2_Missense_Mutation_p.K145N|ERI2_uc010bwh.2_Missense_Mutation_p.K52N|ERI2_uc010vbc.1_5'UTR|ERI2_uc002dhu.1_Missense_Mutation_p.K145N	NM_001142725	NP_001136197	A8K979	ERI2_HUMAN	exoribonuclease 2 isoform 1	145	Exonuclease.					intracellular	exonuclease activity|nucleic acid binding|zinc ion binding			large_intestine(1)	1						ATGCACATAATTTTACTTCAG	0.318													22	90	---	---	---	---	PASS
IL27	246778	broad.mit.edu	37	16	28515293	28515293	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28515293T>A	uc002dqc.2	-	2	133	c.110A>T	c.(109-111)CAG>CTG	p.Q37L	uc010vct.1_Intron	NM_145659	NP_663634	Q8NEV9	IL27A_HUMAN	interleukin 27 precursor	37					inflammatory response|innate immune response|positive regulation of interferon-gamma biosynthetic process|regulation of defense response to virus|regulation of T cell proliferation|regulation of T-helper 1 cell differentiation	extracellular space	cytokine activity|interleukin-27 receptor binding				0						CAGGCTCAGCTGGGGCCTCCC	0.637													38	102	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30518189	30518189	+	Intron	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30518189G>T	uc002dyi.3	+						ITGAL_uc002dyj.3_Intron|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor						blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	TGGGTGAGAGGACAGCGCCTG	0.617													32	128	---	---	---	---	PASS
ZNF688	146542	broad.mit.edu	37	16	30583558	30583558	+	5'UTR	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30583558C>G	uc002dyt.2	-	1					ZNF688_uc002dys.2_Missense_Mutation_p.E13D|uc002dyu.2_5'Flank	NM_145271	NP_660314	P0C7X2	ZN688_HUMAN	zinc finger protein 688 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCCTGAAGCCTCTGTTGACA	0.642													10	44	---	---	---	---	PASS
CMTM1	113540	broad.mit.edu	37	16	66600506	66600506	+	Intron	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66600506C>A	uc002epi.3	+						CMTM1_uc002epb.3_Intron|CMTM1_uc002epc.3_Intron|CMTM1_uc002epd.3_Intron|CMTM1_uc002epe.3_Intron|CMTM1_uc002epf.3_Intron|CMTM1_uc002epg.3_Intron|CMTM1_uc002eph.3_Intron|CMTM1_uc002epl.3_Missense_Mutation_p.S30R|CMTM1_uc002epj.3_Intron|CMTM1_uc002epk.3_Intron|CMTM1_uc002epa.3_Intron|CMTM1_uc002epn.3_Missense_Mutation_p.S30R|CMTM1_uc002epo.3_RNA|CMTM1_uc002epp.3_RNA|CMTM1_uc002epq.3_RNA|CMTM1_uc010cds.2_RNA|CMTM1_uc002epr.3_Missense_Mutation_p.S30R|CMTM1_uc002epm.3_RNA|CMTM1_uc010cdt.1_Missense_Mutation_p.S30R	NM_181269	NP_851786	Q8IZ96	CKLF1_HUMAN	chemokine-like factor superfamily 1 isoform 1						chemotaxis	extracellular space|integral to membrane	cytokine activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		TGGCAAGTAGCGGCAGCGTAG	0.602													4	97	---	---	---	---	PASS
CDYL2	124359	broad.mit.edu	37	16	80638276	80638276	+	3'UTR	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80638276T>C	uc002ffs.2	-	7						NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GCCCGTGAGCTGGGGCCCCTC	0.547													6	239	---	---	---	---	PASS
CDH13	1012	broad.mit.edu	37	16	83712002	83712002	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83712002G>T	uc002fgx.2	+	10	1594	c.1474G>T	c.(1474-1476)GTG>TTG	p.V492L	CDH13_uc010vns.1_Missense_Mutation_p.V539L|CDH13_uc010vnt.1_Missense_Mutation_p.V238L|CDH13_uc010vnu.1_Missense_Mutation_p.V453L	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	492	Cadherin 4.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		GGACCTCTCTGTGGGCAGCGT	0.617													37	123	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89858948	89858948	+	Silent	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89858948A>G	uc002fou.1	-	12	1056	c.1014T>C	c.(1012-1014)GAT>GAC	p.D338D	FANCA_uc010vpn.1_Silent_p.D338D	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	338					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TCTGAACAGCATCAGATGCTG	0.413			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				25	117	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89936619	89936619	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89936619G>A	uc002foz.1	+	15	2136	c.2084G>A	c.(2083-2085)CGA>CAA	p.R695Q	SPIRE2_uc010ciw.1_Missense_Mutation_p.R647Q|SPIRE2_uc002fpa.1_Missense_Mutation_p.R647Q|SPIRE2_uc010cix.1_Missense_Mutation_p.R562Q	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	695					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACTACGCCACGACGCAGTCGC	0.607													4	17	---	---	---	---	PASS
DVL2	1856	broad.mit.edu	37	17	7133693	7133693	+	Silent	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7133693C>G	uc002gez.1	-	3	603	c.321G>C	c.(319-321)CGG>CGC	p.R107R	DVL2_uc010vtr.1_Silent_p.R107R|DVL2_uc010vts.1_Silent_p.R9R|DVL2_uc010clz.1_Silent_p.R107R	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	107					canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						CCAGTTCTGCCCGAGGCTCAT	0.587													27	120	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	A	A	rs11540652		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577538C>A	uc002gim.2	-	7	937	c.743G>T	c.(742-744)CGG>CTG	p.R248L	TP53_uc002gig.1_Missense_Mutation_p.R248L|TP53_uc002gih.2_Missense_Mutation_p.R248L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116L|TP53_uc010cng.1_Missense_Mutation_p.R116L|TP53_uc002gii.1_Missense_Mutation_p.R116L|TP53_uc010cnh.1_Missense_Mutation_p.R248L|TP53_uc010cni.1_Missense_Mutation_p.R248L|TP53_uc002gij.2_Missense_Mutation_p.R248L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155L|TP53_uc002gio.2_Missense_Mutation_p.R116L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			37	88	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15978954	15978954	+	Silent	SNP	C	A	A	rs144012103	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15978954C>A	uc002gpo.2	-	27	3804	c.3564G>T	c.(3562-3564)TCG>TCT	p.S1188S	NCOR1_uc002gpn.2_Silent_p.S1204S|NCOR1_uc002gpp.1_Silent_p.S1095S|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Silent_p.S96S|NCOR1_uc010vwc.1_5'UTR	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1188	Interaction with ETO.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGGGCATTCTCGAAATGGACC	0.493													4	269	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26093620	26093620	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26093620G>A	uc002gzu.2	-							NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GAGGGCTGTGGAGGACACAGA	0.537													99	297	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29670080	29670080	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29670080G>T	uc002hgg.2	+	48	7449	c.7116G>T	c.(7114-7116)AAG>AAT	p.K2372N	NF1_uc002hgh.2_Missense_Mutation_p.K2351N|NF1_uc010cso.2_Missense_Mutation_p.K560N|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2372					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGCACTGCAAGCAAATGGATC	0.363			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	144	---	---	---	---	PASS
TTC25	83538	broad.mit.edu	37	17	40113408	40113408	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40113408C>T	uc002hyj.3	+	10	1541	c.1452C>T	c.(1450-1452)GAC>GAT	p.D484D	TTC25_uc010cxt.2_RNA	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25	484						cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				AGGCCTTGGACGATGCCAACA	0.498													4	13	---	---	---	---	PASS
B4GALNT2	124872	broad.mit.edu	37	17	47237971	47237971	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47237971C>A	uc002ion.2	+	7	973	c.914C>A	c.(913-915)CCT>CAT	p.P305H	B4GALNT2_uc010wlt.1_Missense_Mutation_p.P219H|B4GALNT2_uc010wlu.1_Missense_Mutation_p.P245H	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	305	Lumenal (Potential).				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			ATCCGCCATCCTGTCATACCC	0.532													6	476	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67152038	67152038	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67152038G>T	uc010dfa.1	-	30	4363	c.3484C>A	c.(3484-3486)CCC>ACC	p.P1162T	ABCA10_uc010wqs.1_Missense_Mutation_p.P154T|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1162					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TCCGGATTGGGATGAGTTTCT	0.413													31	143	---	---	---	---	PASS
SSTR2	6752	broad.mit.edu	37	17	71166457	71166457	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71166457C>A	uc002jje.2	+	2	1359	c.999C>A	c.(997-999)AGC>AGA	p.S333R		NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	333	Cytoplasmic (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)			TCAAGGTGAGCGGCACAGATG	0.522													5	211	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6973094	6973094	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6973094T>C	uc002knm.2	-	47	6830	c.6736A>G	c.(6736-6738)ACA>GCA	p.T2246A	LAMA1_uc010wzj.1_Missense_Mutation_p.T1722A	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2246	Laminin G-like 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AACATGAGTGTTGAATTGTTT	0.368													137	477	---	---	---	---	PASS
KIAA0802	23255	broad.mit.edu	37	18	8798272	8798272	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8798272G>T	uc002knr.2	+	10	2561	c.2419G>T	c.(2419-2421)GGA>TGA	p.G807*	KIAA0802_uc002knq.2_Nonsense_Mutation_p.G766*|KIAA0802_uc002kns.2_Nonsense_Mutation_p.G137*	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	1117											0						CGCGGACAGGGGACAGCCCCA	0.632													13	47	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29125982	29125982	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29125982C>T	uc002kwu.3	+	15	2821	c.2633C>T	c.(2632-2634)TCA>TTA	p.S878L	uc002kwv.3_Intron	NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	878	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			ATGGTTAATTCAGAGAATACC	0.388													69	198	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39595531	39595531	+	Splice_Site	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39595531G>T	uc002lap.2	+	12	1474	c.1416_splice	c.e12+1	p.E472_splice	PIK3C3_uc010xcl.1_Splice_Site_p.E409_splice	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3						cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						AAATCTGGAAGTGAGTACAAA	0.373										TSP Lung(28;0.18)			4	154	---	---	---	---	PASS
ZNF414	84330	broad.mit.edu	37	19	8577341	8577341	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8577341C>A	uc002mkf.2	-	4	578	c.460G>T	c.(460-462)GAG>TAG	p.E154*	ZNF414_uc002mke.3_Nonsense_Mutation_p.E154*|ZNF414_uc010dwf.2_Nonsense_Mutation_p.E143*	NM_032370	NP_115746	Q96IQ9	ZN414_HUMAN	zinc finger protein 414 isoform 2	154	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGAAGGTCTCGGTGCAGCTC	0.607													4	192	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602907	10602907	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602907G>T	uc002moq.1	-	3	827	c.671C>A	c.(670-672)TCC>TAC	p.S224Y	KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.S224Y	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	224	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			TTGGCAGTGGGACAGGTTGAA	0.612													25	57	---	---	---	---	PASS
FARSA	2193	broad.mit.edu	37	19	13044510	13044510	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13044510T>G	uc002mvs.2	-	1	49	c.1A>C	c.(1-3)ATG>CTG	p.M1L	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Missense_Mutation_p.M1L|FARSA_uc010dyy.1_Missense_Mutation_p.M1L	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	1					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	CCATCCGCCATGACTCCTTCC	0.677													2	3	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807265	20807265	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807265T>C	uc002npb.1	-	4	1568	c.1418A>G	c.(1417-1419)AAA>AGA	p.K473R	ZNF626_uc002npc.1_Missense_Mutation_p.K397R	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	473	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						AGTATGAATTTTCTTATGTGT	0.388													3	37	---	---	---	---	PASS
DYRK1B	9149	broad.mit.edu	37	19	40318157	40318157	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40318157G>C	uc002omj.2	-	7	1227	c.947C>G	c.(946-948)TCC>TGC	p.S316C	DYRK1B_uc002omi.2_Missense_Mutation_p.S316C|DYRK1B_uc002omk.2_Missense_Mutation_p.S316C	NM_004714	NP_004705	Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	316	Protein kinase.				positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity			ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			CACCTCATTGGAGCCACTGAA	0.642													55	64	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42853772	42853772	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42853772G>T	uc002otl.3	+	13	2854	c.2219G>T	c.(2218-2220)GGC>GTC	p.G740V	MEGF8_uc002otm.3_Missense_Mutation_p.G348V	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	807	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GAGATCCAGGGCCAGCTCAAT	0.647													10	219	---	---	---	---	PASS
ZNF577	84765	broad.mit.edu	37	19	52380565	52380565	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52380565C>T	uc010yde.1	-	6	644	c.253G>A	c.(253-255)GAA>AAA	p.E85K	ZNF577_uc010ydd.1_RNA|ZNF577_uc002pxx.3_Missense_Mutation_p.E85K|ZNF577_uc002pxv.2_Missense_Mutation_p.E78K|ZNF577_uc002pxw.2_Missense_Mutation_p.E78K	NM_032679	NP_116068	Q9BSK1	ZN577_HUMAN	zinc finger protein 577 isoform a	85	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		GCTGCTCCTTCTGCTATCCCT	0.507													78	188	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57327379	57327379	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57327379C>G	uc002qnu.2	-	7	2782	c.2431G>C	c.(2431-2433)GAT>CAT	p.D811H	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.D782H|PEG3_uc002qnv.2_Missense_Mutation_p.D811H|PEG3_uc002qnw.2_Missense_Mutation_p.D687H|PEG3_uc002qnx.2_Missense_Mutation_p.D685H|PEG3_uc010etr.2_Missense_Mutation_p.D811H	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	811					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTGATAGCATCGAAGCTCTGA	0.468													57	537	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328935	57328935	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328935A>T	uc002qnu.2	-	7	1226	c.875T>A	c.(874-876)ATG>AAG	p.M292K	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.M263K|PEG3_uc002qnv.2_Missense_Mutation_p.M292K|PEG3_uc002qnw.2_Missense_Mutation_p.M168K|PEG3_uc002qnx.2_Missense_Mutation_p.M166K|PEG3_uc010etr.2_Missense_Mutation_p.M292K	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	292					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGCTTCAGGCATAGTTTTTAG	0.458													20	189	---	---	---	---	PASS
ZNF671	79891	broad.mit.edu	37	19	58238825	58238825	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58238825T>G	uc002qpz.3	-	1	171	c.72A>C	c.(70-72)AGA>AGC	p.R24S	ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_5'UTR|ZNF671_uc010yhf.1_5'UTR	NM_024833	NP_079109	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	24					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCGGCAGGCGTCTCGATCGGG	0.692													4	24	---	---	---	---	PASS
RBCK1	10616	broad.mit.edu	37	20	398440	398440	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:398440G>A	uc002wdp.3	+	4	1019	c.326G>A	c.(325-327)CGA>CAA	p.R109Q	RBCK1_uc010zpl.1_Missense_Mutation_p.R109Q|RBCK1_uc010zpm.1_RNA|RBCK1_uc002wdq.3_Missense_Mutation_p.R67Q|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_5'UTR	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	109	Interaction with IRF3.|Ubiquitin-like.|Interaction with RNF31.|Interaction with TAB2.				interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				CGGCTGGCACGAGACCAGGAG	0.517													17	71	---	---	---	---	PASS
TBC1D20	128637	broad.mit.edu	37	20	420942	420942	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:420942C>G	uc002wds.2	-	6	856	c.718G>C	c.(718-720)GAC>CAC	p.D240H	TBC1D20_uc002wdv.2_Missense_Mutation_p.D63H|TBC1D20_uc002wdt.2_RNA|TBC1D20_uc002wdu.2_RNA	NM_144628	NP_653229	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	240	Rab-GAP TBC.|Helical; (Potential).				interspecies interaction between organisms	integral to membrane|intracellular	Rab GTPase activator activity			central_nervous_system(1)	1		all_epithelial(17;0.228)|Breast(17;0.231)				AGGAAGAAGTCATATAACCGC	0.562													14	57	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5903669	5903669	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5903669C>T	uc002wmg.2	+	4	1185	c.879C>T	c.(877-879)TCC>TCT	p.S293S	CHGB_uc010zqz.1_5'UTR	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	293						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						CCGACAGGTCCTCTCAAGGAG	0.582													5	39	---	---	---	---	PASS
MCM8	84515	broad.mit.edu	37	20	5963711	5963711	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5963711G>A	uc002wmi.2	+	14	2010	c.1633G>A	c.(1633-1635)GGT>AGT	p.G545S	MCM8_uc002wmj.2_Missense_Mutation_p.G529S|MCM8_uc002wmk.2_Missense_Mutation_p.G585S|MCM8_uc002wml.2_Missense_Mutation_p.G545S|MCM8_uc010gbp.2_Missense_Mutation_p.G498S|MCM8_uc002wmm.2_Missense_Mutation_p.G83S	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	545	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						TGCTAAGGCTGGTGTGGTTTG	0.403													10	169	---	---	---	---	PASS
CST1	1469	broad.mit.edu	37	20	23728456	23728456	+	Silent	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23728456G>T	uc002wtp.2	-	3	494	c.423C>A	c.(421-423)TCC>TCA	p.S141S		NM_001898	NP_001889	P01037	CYTN_HUMAN	cystatin SN precursor	141						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Lung NSC(19;0.0676)|all_lung(19;0.148)					CAGATCCCTAGGATTCTTGAC	0.587													12	57	---	---	---	---	PASS
CST1	1469	broad.mit.edu	37	20	23728457	23728457	+	Missense_Mutation	SNP	G	T	T	rs142792460		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23728457G>T	uc002wtp.2	-	3	493	c.422C>A	c.(421-423)TCC>TAC	p.S141Y		NM_001898	NP_001889	P01037	CYTN_HUMAN	cystatin SN precursor	141						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Lung NSC(19;0.0676)|all_lung(19;0.148)					AGATCCCTAGGATTCTTGACA	0.592													13	56	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34025387	34025387	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34025387G>T	uc002xck.1	-	1	641	c.322C>A	c.(322-324)CCA>ACA	p.P108T	GDF5_uc010gfc.1_Missense_Mutation_p.P108T|GDF5_uc010zvc.1_Missense_Mutation_p.P108T	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein	108					cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GGGTGTCCTGGCTTGGGTTCA	0.637													14	114	---	---	---	---	PASS
SPINT4	391253	broad.mit.edu	37	20	44352615	44352615	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44352615T>A	uc002xpe.1	+	2	231	c.212T>A	c.(211-213)TTC>TAC	p.F71Y		NM_178455	NP_848550	Q6UDR6	SPIT4_HUMAN	serine peptidase inhibitor, Kunitz type 4	71	BPTI/Kunitz inhibitor.					extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2		Myeloproliferative disorder(115;0.028)				ACTTTTGTCTTCTCCGGCTGT	0.388													62	212	---	---	---	---	PASS
SLC2A10	81031	broad.mit.edu	37	20	45355628	45355628	+	Intron	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45355628G>C	uc002xsl.2	+							NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TCTCATTGGTGAGTCCTTCCC	0.308													42	385	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51872316	51872316	+	Silent	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872316G>A	uc002xwo.2	+	2	3275	c.2319G>A	c.(2317-2319)AAG>AAA	p.K773K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	773					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CCAAAAGCAAGAAAGCCGAGT	0.557													89	209	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57484842	57484842	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57484842G>C	uc002xzw.2	+	10	3036	c.2751G>C	c.(2749-2751)AAG>AAC	p.K917N	GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Missense_Mutation_p.K215N|GNAS_uc002xzx.2_Missense_Mutation_p.K215N|GNAS_uc010gjr.2_Missense_Mutation_p.K165N|GNAS_uc002xzy.2_Missense_Mutation_p.K200N|GNAS_uc002yaa.2_Missense_Mutation_p.K260N|GNAS_uc010zzt.1_Missense_Mutation_p.K275N|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Missense_Mutation_p.K165N|GNAS_uc002yae.2_Missense_Mutation_p.K199N	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	274					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			ACCTCTTCAAGAGCATCTGGA	0.582			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			27	178	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58348476	58348476	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58348476C>G	uc002yau.2	+	6	1361	c.894C>G	c.(892-894)CAC>CAG	p.H298Q	PHACTR3_uc002yat.2_Missense_Mutation_p.H295Q|PHACTR3_uc010zzw.1_Missense_Mutation_p.H257Q|PHACTR3_uc002yav.2_Missense_Mutation_p.H257Q|PHACTR3_uc002yaw.2_Missense_Mutation_p.H257Q|PHACTR3_uc002yax.2_Missense_Mutation_p.H187Q	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	298						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AGGAGCTGCACAGGGCGCTGG	0.687													3	7	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60902416	60902416	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60902416A>C	uc002ycq.2	-	38	5052	c.4985T>G	c.(4984-4986)GTG>GGG	p.V1662G		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1662	Laminin IV type A.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTGGGGCACCACCTGCCGGTC	0.662													3	28	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33074583	33074583	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33074583A>T	uc002ypd.2	-	5	857	c.431T>A	c.(430-432)GTA>GAA	p.V144E	SFRS15_uc002ype.2_Missense_Mutation_p.V144E|SFRS15_uc010glu.2_Missense_Mutation_p.V129E|SFRS15_uc002ypf.1_5'Flank|SFRS15_uc002ypg.2_Missense_Mutation_p.V144E	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	144						nucleus	nucleotide binding|RNA binding				0						ATTTTCTGCTACTGGGGCTGC	0.398													50	112	---	---	---	---	PASS
U2AF1	7307	broad.mit.edu	37	21	44520566	44520566	+	Intron	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44520566G>A	uc002zda.1	-						U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.R66C|U2AF1_uc010gpi.1_Missense_Mutation_p.R66C|U2AF1_uc002zdc.1_3'UTR	NM_001025203	NP_001020374	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxillary factor 1 isoform						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding				0						AACTTACAGCGCAAACCGTCA	0.488													6	138	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21096998	21096998	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21096998T>C	uc002zsz.3	-	31	3568	c.3337A>G	c.(3337-3339)AAA>GAA	p.K1113E		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1113					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ACCATCATTTTGTTCAGGTCA	0.463													192	284	---	---	---	---	PASS
HIC2	23119	broad.mit.edu	37	22	21800555	21800555	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21800555C>T	uc002zur.3	+	3	1601	c.1371C>T	c.(1369-1371)CTC>CTT	p.L457L	HIC2_uc002zus.3_Silent_p.L457L	NM_015094	NP_055909	Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	457	C2H2-type 1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding			skin(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				CTGAGCAGCTCAATGCGCACG	0.612													8	356	---	---	---	---	PASS
ZNRF3	84133	broad.mit.edu	37	22	29442802	29442802	+	Silent	SNP	C	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29442802C>T	uc003aeg.2	+	6	708	c.543C>T	c.(541-543)GCC>GCT	p.A181A	ZNRF3_uc003aeh.1_Silent_p.A181A	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	281	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1						GCTGTGGGGCCCTGGACACAC	0.577													306	427	---	---	---	---	PASS
MCM5	4174	broad.mit.edu	37	22	35802676	35802676	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35802676G>A	uc003anu.3	+	5	648	c.554G>A	c.(553-555)CGC>CAC	p.R185H	MCM5_uc010gwr.2_5'UTR|MCM5_uc003anv.3_Missense_Mutation_p.R142H|MCM5_uc010gws.1_5'Flank	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	185					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						ATTGCCATGCGCCCTGGCCTC	0.622													9	102	---	---	---	---	PASS
GTPBP1	9567	broad.mit.edu	37	22	39122021	39122021	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39122021A>T	uc003awg.2	+	7	1238	c.1084A>T	c.(1084-1086)ATA>TTA	p.I362L		NM_004286	NP_004277	O00178	GTPB1_HUMAN	GTP binding protein 1	362					immune response|positive regulation of mRNA catabolic process|signal transduction	cytoplasmic exosome (RNase complex)|cytosol	GTP binding|GTPase activity			ovary(1)	1	Melanoma(58;0.04)					GATGTGCCCGATATTCCAGAT	0.572													67	705	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67942420	67942420	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67942420G>T	uc004dxa.2	+	11	2863	c.2491G>T	c.(2491-2493)GCT>TCT	p.A831S	STARD8_uc004dxb.2_Missense_Mutation_p.A911S|STARD8_uc004dxc.3_Missense_Mutation_p.A831S	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	831	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						GCTGCGTGATGCTGCTGAGCG	0.647													28	43	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299017	125299017	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299017C>A	uc004euk.1	-	1	918	c.891G>T	c.(889-891)AGG>AGT	p.R297S		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	297	WD 3.									lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						TGGACAGGAGCCTGGATAGTG	0.607													69	113	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686398	125686398	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686398G>A	uc004eul.2	-	1	445	c.194C>T	c.(193-195)CCC>CTC	p.P65L		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	65										skin(3)|ovary(1)	4						GAGCCTGGCGGGGCCCCACCC	0.692													29	27	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138878475	138878475	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138878475C>G	uc004faz.2	-	12	1271	c.1172G>C	c.(1171-1173)GGA>GCA	p.G391A	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.G391A	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	391	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					AACCAGGGCTCCTTCATTAAT	0.358													16	10	---	---	---	---	PASS
GPR50	9248	broad.mit.edu	37	X	150348232	150348232	+	Intron	SNP	A	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150348232A>T	uc010ntg.1	+						uc004fes.1_5'Flank|GPR50_uc011myc.1_Intron	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50						cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCCTCGATATGTTTTTCAG	0.483													352	388	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151091925	151091925	+	5'UTR	SNP	G	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151091925G>T	uc004fez.2	+	2					MAGEA4_uc004ffa.2_5'UTR|MAGEA4_uc004ffb.2_5'UTR|MAGEA4_uc004ffc.2_5'UTR|MAGEA4_uc004ffd.2_5'UTR	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4								protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCTTCAGGTTCTGAGCAG	0.547													33	32	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900357	151900357	+	Silent	SNP	A	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900357A>G	uc010ntp.2	-	3	798	c.444T>C	c.(442-444)CCT>CCC	p.P148P	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Silent_p.P148P|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	148	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TGAAGATCACAGGAAAGAAGT	0.512													5	289	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153592742	153592742	+	Splice_Site	SNP	T	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153592742T>G	uc004fkk.2	-	14	2272	c.2023_splice	c.e14-1	p.V675_splice	FLNA_uc010nuu.1_Splice_Site_p.V675_splice	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2						actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGCCTTCACCTAGCGGGAGAC	0.637													66	38	---	---	---	---	PASS
NOC2L	26155	broad.mit.edu	37	1	880640	880640	+	Intron	DEL	C	-	-	rs113796517		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:880640delC	uc001abz.3	-						NOC2L_uc001aby.3_Intron|NOC2L_uc009vjq.2_Intron	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog							nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CCGCTGACTTCCAGCAGGTGG	0.622													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4274176	4274177	+	IGR	INS	-	CTCCCTCCT	CTCCCTCCT	rs11801830	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4274176_4274177insCTCCCTCCT								LOC100133612 (440299 upstream) : LOC284661 (197934 downstream)																							tccttccttccttccctccctc	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20200635	20200636	+	IGR	INS	-	CAT	CAT	rs55934105		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200635_20200636insCAT								RNF186 (58864 upstream) : OTUD3 (8252 downstream)																							accaccaccaccaccaccacca	0.193													5	4	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145325870	145325871	+	Intron	INS	-	A	A			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145325870_145325871insA	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AACTCTTCCTTACGTTAGCCAT	0.431													3	3	---	---	---	---	
PPP1R12B	4660	broad.mit.edu	37	1	202457853	202457854	+	Intron	DEL	AC	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202457853_202457854delAC	uc001gya.1	+						PPP1R12B_uc001gxz.1_Intron|PPP1R12B_uc001gyb.1_Intron|PPP1R12B_uc001gyc.1_Intron	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCTGATTTAAacacacacacac	0.173													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224262236	224262237	+	IGR	INS	-	CCTC	CCTC	rs60087320	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224262236_224262237insCCTC								TP53BP2 (228562 upstream) : FBXO28 (39554 downstream)																							cttcctcccttccttccttcct	0.104													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	245094994	245094995	+	IGR	INS	-	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245094994_245094995insT								HNRNPU (67167 upstream) : EFCAB2 (38176 downstream)																							ctttttttttcttttttttttt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8763017	8763018	+	IGR	INS	-	AC	AC	rs147578997	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8763017_8763018insAC								LOC339788 (646040 upstream) : ID2 (56322 downstream)																							TAGacagacagacacacacaca	0.431													4	2	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25639652	25639653	+	Intron	INS	-	GGAA	GGAA			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25639652_25639653insGGAA	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgp.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCAGAACCTggaaggaagga	0.243													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88514345	88514348	+	IGR	DEL	CCTT	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88514345_88514348delCCTT								THNSL2 (28200 upstream) : FOXI3 (233378 downstream)																							tttctttctcccttccttccttcc	0.015													18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222946100	222946102	+	IGR	DEL	AGG	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222946100_222946102delAGG								EPHA4 (507178 upstream) : PAX3 (118505 downstream)																							ACAgaggaaaaggaggaggagga	0.320													4	2	---	---	---	---	
CHL1	10752	broad.mit.edu	37	3	431277	431277	+	Intron	DEL	G	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:431277delG	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		tactagccgtgggagataaaa	0.214													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	1003193	1003194	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs62230836		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1003193_1003194insTTCCTTCC								CHL1 (552098 upstream) : CNTN6 (131426 downstream)																							tccttccttctttccttccttc	0.054													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126981714	126981715	+	IGR	INS	-	TG	TG	rs142070061	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126981714_126981715insTG								PLXNA1 (225486 upstream) : TPRA1 (310193 downstream)																							AACTGTTTGCAtgtgtgtgtgt	0.277													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	134383510	134383511	+	IGR	DEL	TT	-	-	rs10563578		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134383510_134383511delTT								KY (13032 upstream) : EPHB1 (130749 downstream)																							CTTTAAGCAGTTTtgtgtgtgt	0.267													3	5	---	---	---	---	
CLRN1OS	116933	broad.mit.edu	37	3	150583313	150583316	+	Intron	DEL	GTGC	-	-	rs59433651		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150583313_150583316delGTGC	uc011bny.1	+											Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0						gtgtgtgtgtgtgCGCGCGCGCGC	0.358											OREG0015880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194600441	194600442	+	IGR	DEL	CG	-	-	rs35726588		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194600441_194600442delCG								FAM43A (190677 upstream) : C3orf21 (188573 downstream)																							cacacacacacgcacacgcgcg	0.238													4	3	---	---	---	---	
NAT8L	339983	broad.mit.edu	37	4	2065299	2065300	+	Intron	INS	-	G	G			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2065299_2065300insG	uc003geq.1	+							NM_178557	NP_848652	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related,							integral to membrane|microsome|mitochondrial membrane|rough endoplasmic reticulum membrane	aspartate N-acetyltransferase activity				0			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			GAATAGTGGCTGCCCCCTCCCT	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	79569453	79569454	+	Intron	INS	-	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79569453_79569454insT	uc003hlf.2	+						uc003hlg.2_Intron|uc003hlh.2_Intron|uc003hli.2_Intron					Homo sapiens cDNA FLJ32651 fis, clone SYNOV2001581.																		ttccttccttcctccctccctc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6553935	6553936	+	IGR	INS	-	ACACAC	ACACAC	rs113889128		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6553935_6553936insACACAC								UBE2QL1 (61230 upstream) : LOC255167 (28351 downstream)																							AGATTTTGTGTacacacacaca	0.168													4	2	---	---	---	---	
CXCL14	9547	broad.mit.edu	37	5	134909400	134909401	+	Intron	DEL	GT	-	-	rs140419480		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134909400_134909401delGT	uc003lay.2	-							NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor						cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			gcatgcatgcgtgtgtgtgtgt	0.401													4	3	---	---	---	---	
KCTD16	57528	broad.mit.edu	37	5	143688318	143688322	+	Intron	DEL	GTGGG	-	-	rs72337848		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143688318_143688322delGTGGG	uc003lnm.1	+						KCTD16_uc003lnn.1_Intron	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TCCTCAGATTgtggggtggggtggg	0.346													3	3	---	---	---	---	
PPP2R2B	5521	broad.mit.edu	37	5	145969949	145969949	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145969949delT	uc003loe.2	-						PPP2R2B_uc010jgm.2_Intron|PPP2R2B_uc003log.3_Intron|PPP2R2B_uc003lof.3_Intron|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCtttttgttttttttttg	0.313													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14383214	14383221	+	IGR	DEL	TCCTTCCT	-	-	rs58552935		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14383214_14383221delTCCTTCCT								CD83 (246068 upstream) : JARID2 (862513 downstream)																							ccttccttcctccttccttccttccttc	0.159													6	4	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35582932	35582933	+	Intron	INS	-	AC	AC	rs148530740	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35582932_35582933insAC	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_Intron	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						caacaacaactacacacacaca	0.000													4	2	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136977762	136977762	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136977762delT	uc003qhc.2	-						MAP3K5_uc011edj.1_5'Flank|MAP3K5_uc011edk.1_Intron|MAP3K5_uc010kgw.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTTTTCACACttttttttttt	0.154													6	4	---	---	---	---	
LFNG	3955	broad.mit.edu	37	7	2566954	2566955	+	3'UTR	INS	-	TGTGCG	TGTGCG	rs71995145		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2566954_2566955insTGTGCG	uc003smf.2	+	8					LFNG_uc003smg.2_Intron	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a						organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		AGGGCCGTGCCtgtgcgtgtgc	0.589													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20042913	20042916	+	IGR	DEL	AAAT	-	-	rs148399376		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20042913_20042916delAAAT								TMEM196 (229697 upstream) : MACC1 (131372 downstream)																							GGGCTACAAAaaataaataaataa	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67238662	67238663	+	IGR	INS	-	TCCC	TCCC	rs143624826	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67238662_67238663insTCCC								STAG3L4 (452150 upstream) : None (None downstream)																							ctttccttccttccttttcctt	0.000													4	2	---	---	---	---	
DLC1	10395	broad.mit.edu	37	8	13346921	13346922	+	Intron	INS	-	AC	AC	rs139688988	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13346921_13346922insAC	uc003wwm.2	-						DLC1_uc003wwn.2_Intron|DLC1_uc011kxy.1_Intron	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						acacacaccatacacacacaca	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20791639	20791639	+	IGR	DEL	A	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20791639delA								LZTS1 (678836 upstream) : GFRA2 (757891 downstream)																							agacagtctgaaaaaaaaaaa	0.189													4	3	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25985808	25985809	+	Intron	INS	-	GGAGGGAA	GGAGGGAA	rs149982442	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25985808_25985809insGGAGGGAA	uc003xek.2	+							NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		gaaggagggagggaaggaagga	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	27046972	27046972	+	IGR	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27046972delT								MIR548H-4 (140492 upstream) : STMN4 (46844 downstream)																							ggaaggaaactggaatagaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109140178	109140178	+	IGR	DEL	A	-	-	rs60517627		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109140178delA								RSPO2 (44265 upstream) : EIF3E (73795 downstream)																							ggaaggaaggaagggaagaaa	0.015													3	5	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144511954	144511959	+	In_Frame_Del	DEL	TGGTGG	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144511954_144511959delTGGTGG	uc003yyc.1	-	1	618_623	c.618_623delCCACCA	c.(616-624)CACCACCAT>CAT	p.206_208HHH>H		NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	206_208	His-rich.				insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggtggt	0.587										HNSCC(29;0.082)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70117581	70117581	+	IGR	DEL	G	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70117581delG								LOC100133920 (452632 upstream) : FOXD4L5 (58128 downstream)																							GGTCTTCAGAGGTTTACCCTC	0.308													4	2	---	---	---	---	
C5	727	broad.mit.edu	37	9	123780857	123780860	+	Intron	DEL	AAGG	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123780857_123780860delAAGG	uc004bkv.2	-						C5_uc010mvm.1_Intron|C5_uc010mvn.1_Intron	NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	ACCAAAaagaaaggaaggaaggaa	0.010													4	4	---	---	---	---	
PFKFB3	5209	broad.mit.edu	37	10	6263003	6263006	+	Intron	DEL	TGTA	-	-	rs3083330		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6263003_6263006delTGTA	uc001ije.2	+						PFKFB3_uc001ijd.2_Intron|PFKFB3_uc009xii.2_Intron|PFKFB3_uc010qaw.1_Intron|PFKFB3_uc001ijf.2_Intron	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						tgtgcatctctgtatggctctgtg	0.069													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6446879	6446893	+	IGR	DEL	CTTCCTTCCTCCCTT	-	-	rs12769866		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6446879_6446893delCTTCCTTCCTCCCTT								PFKFB3 (169374 upstream) : PRKCQ (22212 downstream)																							ttcctccctccttccttcctcccttcccttccctt	0.019													3	5	---	---	---	---	
SLC25A16	8034	broad.mit.edu	37	10	70252710	70252711	+	Intron	INS	-	CTT	CTT	rs144604204	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70252710_70252711insCTT	uc001joi.2	-						SLC25A16_uc010qix.1_Intron|SLC25A16_uc010qiy.1_Intron|SLC25A16_uc001joj.2_Intron	NM_152707	NP_689920	P16260	GDC_HUMAN	solute carrier family 25, member 16						coenzyme biosynthetic process|pantothenate metabolic process	integral to membrane|mitochondrial inner membrane	binding|solute:solute antiporter activity				0						GTACTTCTCCAATTATACACGA	0.282													2	4	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	77685430	77685430	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77685430delT	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					tttctttttcttttttttttt	0.109													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78887325	78887328	+	Intron	DEL	AGGA	-	-	rs72447373		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78887325_78887328delAGGA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TAGAGAAAATaggaaggaaggaag	0.230													7	4	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	88053481	88053481	+	Intron	DEL	G	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88053481delG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AGGGAGGGGTGGGGGAGGAGA	0.478										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2441291	2441311	+	Intron	DEL	GGCCCCCACGGCCCAGGTCTC	-	-	rs147399841		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2441291_2441311delGGCCCCCACGGCCCAGGTCTC	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CCACGGCCCAGGCCCCCACGGCCCAGGTCTCGGTGCTCAGG	0.683													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45764950	45764965	+	IGR	DEL	AAGGAAGGAAGGAAGA	-	-	rs56170165	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45764950_45764965delAAGGAAGGAAGGAAGA								CHST1 (77778 upstream) : DKFZp779M0652 (28018 downstream)																							ggaaggaaggaaggaaggaaggaagagagagagaga	0.000													3	4	---	---	---	---	
PPFIA1	8500	broad.mit.edu	37	11	70221287	70221288	+	Intron	INS	-	A	A	rs12289655	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70221287_70221288insA	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron|PPFIA1_uc001opr.2_Intron|PPFIA1_uc001ops.2_Intron|uc001opt.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AAAGAAACTTTaaaaaaaaaaa	0.356													6	3	---	---	---	---	
RPS3	6188	broad.mit.edu	37	11	75112533	75112534	+	Intron	INS	-	A	A	rs111445702		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75112533_75112534insA	uc001owh.2	+						RPS3_uc001owg.2_Intron|RPS3_uc001owi.2_Intron|RPS3_uc001owk.1_Intron|SNORD15B_uc001owl.1_5'Flank	NM_001005	NP_000996	P23396	RS3_HUMAN	ribosomal protein S3						activation of caspase activity|endocrine pancreas development|induction of apoptosis|negative regulation of DNA repair|negative regulation of NF-kappaB transcription factor activity|response to DNA damage stimulus|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleus|ruffle membrane	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|iron-sulfur cluster binding|mRNA binding|NF-kappaB binding|protein kinase binding|structural constituent of ribosome				0						gaccctgtctcaaaaaaaaaaG	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95110003	95110006	+	IGR	DEL	CCTC	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110003_95110006delCCTC								SESN3 (144298 upstream) : FAM76B (392100 downstream)																							tcccttccctcctccctccctccc	0.201													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	782121	782122	+	IGR	DEL	GT	-	-	rs113737610		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:782121_782122delGT								NINJ2 (9366 upstream) : WNK1 (80103 downstream)																							tttactaggggtgtgtgtgtgt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	7765109	7765144	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAG	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7765109_7765144delGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAG								CD163 (108695 upstream) : APOBEC1 (36853 downstream)																							aaaaaagaaagaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaagga	0.000													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48661124	48661127	+	IGR	DEL	TTCC	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48661124_48661127delTTCC								OR10AD1 (64049 upstream) : H1FNT (61636 downstream)																							ccttccttctttccttccttcctt	0.034													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69537521	69537522	+	IGR	INS	-	GAAG	GAAG	rs149342263	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69537521_69537522insGAAG								CPM (180501 upstream) : CPSF6 (95795 downstream)																							aaagaaagaaagaaggaaggaa	0.000													2	4	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81655693	81655693	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81655693delT	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010suf.1_Intron|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						TTTTTTTGTCTTTTTTTTTTT	0.403													7	4	---	---	---	---	
LHFP	10186	broad.mit.edu	37	13	39943736	39943737	+	Intron	INS	-	T	T			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39943736_39943737insT	uc001uxf.2	-							NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		tccttccttcctccctctctcc	0.243			T	HMGA2	lipoma								6	3	---	---	---	---	
HEATR4	399671	broad.mit.edu	37	14	73986075	73986075	+	Intron	DEL	A	-	-	rs68181245		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73986075delA	uc010tub.1	-						HEATR4_uc010tua.1_Intron	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCTGTGGGGGAAAAAAAAAAG	0.428													7	4	---	---	---	---	
AHSA1	10598	broad.mit.edu	37	14	77934393	77934399	+	Intron	DEL	TCTTTTT	-	-	rs138877566	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77934393_77934399delTCTTTTT	uc001xtw.2	+						AHSA1_uc010tvk.1_Intron	NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase						protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ATCTTCTGCCTCttttttttttttttt	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101238002	101238003	+	IGR	INS	-	TGTG	TGTG	rs150906762	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101238002_101238003insTGTG								DLK1 (36528 upstream) : MEG3 (54442 downstream)																							TGATGGATAGAtgtgtgtgtgt	0.267													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24057142	24057147	+	IGR	DEL	GAGGAA	-	-	rs12911245		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24057142_24057147delGAGGAA								NDN (124692 upstream) : PWRN2 (352779 downstream)																							ggaggaggaggaggaagaggaggagg	0.092													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70678976	70678977	+	IGR	INS	-	AC	AC	rs140835916	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70678976_70678977insAC								TLE3 (288720 upstream) : UACA (267918 downstream)																							GATCTGTCATAacacacacaca	0.391													4	2	---	---	---	---	
IDH3A	3419	broad.mit.edu	37	15	78450167	78450167	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78450167delT	uc002bdd.2	+						IDH3A_uc010umt.1_Intron|IDH3A_uc010umu.1_Intron|IDH3A_uc002bde.2_Intron|IDH3A_uc010umv.1_Intron|IDH3A_uc002bdf.2_Intron|IDH3A_uc002bdg.2_5'Flank	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha						carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	TCTTTCTTTCTTTtttttttt	0.179													4	2	---	---	---	---	
UMOD	7369	broad.mit.edu	37	16	20356762	20356764	+	Intron	DEL	TTC	-	-	rs10568780		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20356762_20356764delTTC	uc002dgz.2	-						UMOD_uc002dha.2_Intron|UMOD_uc002dhb.2_Intron	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor						cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						ctttctttctttcttcctttctt	0.000													4	2	---	---	---	---	
NAE1	8883	broad.mit.edu	37	16	66839541	66839541	+	Intron	DEL	A	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66839541delA	uc002eqf.2	-						NAE1_uc002eqe.2_Intron|NAE1_uc002eqg.2_Intron|NAE1_uc010cdv.2_Intron	NM_003905	NP_003896	Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1 isoform a						apoptosis|cell cycle|DNA replication|mitotic cell cycle DNA replication checkpoint|protein neddylation|signal transduction	cytoplasm|insoluble fraction|plasma membrane	catalytic activity|protein heterodimerization activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	actgcgtctcaaaaaaaaaaa	0.124													4	3	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	115995	115996	+	Intron	DEL	GT	-	-	rs7224800		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:115995_115996delGT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GGCCCCAGTGgtgtgtgtgtgt	0.436													4	2	---	---	---	---	
SLC47A2	146802	broad.mit.edu	37	17	19608911	19608911	+	Intron	DEL	T	-	-	rs34629869		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19608911delT	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_Intron|SLC47A2_uc010cqt.1_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					ACTCAGGGGCttttttttttt	0.348													6	3	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62068536	62068537	+	IGR	INS	-	CTTC	CTTC			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62068536_62068537insCTTC								SCN4A (18258 upstream) : C17orf72 (7174 downstream)																							tttctttccttcttccttcctt	0.000													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77271205	77271206	+	Intron	INS	-	CTCTCT	CTCTCT	rs3073180		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77271205_77271206insCTCTCT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			tccatgtctccctctctctctc	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45154974	45154975	+	IGR	DEL	AC	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45154974_45154975delAC								IER3IP1 (452229 upstream) : SMAD2 (204492 downstream)																							acacacacagacacacacacac	0.396													5	3	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10109877	10109877	+	Intron	DEL	T	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10109877delT	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TTGCTTGGCAttttttttttg	0.109													4	2	---	---	---	---	
WIZ	58525	broad.mit.edu	37	19	15536627	15536627	+	Intron	DEL	G	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15536627delG	uc002nbc.2	-						WIZ_uc002nba.3_Intron|WIZ_uc002nbb.3_Intron	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs							nucleus	zinc ion binding				0						aggaggaggagggaggaggag	0.249													4	3	---	---	---	---	
ZNF507	22847	broad.mit.edu	37	19	32852601	32852602	+	Intron	INS	-	CTTT	CTTT	rs146661098	by1000genomes	TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32852601_32852602insCTTT	uc002nte.2	+						ZNF507_uc002ntd.2_Intron	NM_001136156	NP_001129628	Q8TCN5	ZN507_HUMAN	zinc finger protein 507						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(110;0.162)					tccttcctttccttcctttcct	0.089													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48300248	48300253	+	IGR	DEL	GTGTGT	-	-	rs35350054		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48300248_48300253delGTGTGT								SEPW1 (12309 upstream) : TPRX1 (4247 downstream)																							aggagtttgagtgtgtgtgtgtgtgt	0.073													4	2	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48546781	48546782	+	Intron	INS	-	CAC	CAC			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48546781_48546782insCAC	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		atcattatcatcaccaccacca	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49068601	49068602	+	IGR	DEL	AA	-	-	rs71338418		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068601_49068602delAA								CEBPB (259389 upstream) : PTPN1 (58289 downstream)																							agaaagaaagaaaaagaaagaa	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52557956	52557957	+	IGR	INS	-	GTGCGC	GTGCGC	rs67132379		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52557956_52557957insGTGCGC								SUMO1P1 (65708 upstream) : BCAS1 (2122 downstream)																							tgtgtgtgtgtgcgcgtgtgtg	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36577729	36577730	+	IGR	DEL	TG	-	-	rs71771701		TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36577729_36577730delTG								APOL3 (15504 upstream) : APOL4 (7448 downstream)																							TAAAATTGCCtgtgtgtgtgtg	0.342													6	3	---	---	---	---	
PAK3	5063	broad.mit.edu	37	X	110416183	110416184	+	Intron	DEL	TC	-	-			TCGA-66-2777-01A-01D-1267-08	TCGA-66-2777-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110416183_110416184delTC	uc004epa.2	+						PAK3_uc010npt.1_Intron|PAK3_uc010npu.1_Intron|PAK3_uc004eoy.1_Intron|PAK3_uc004eoz.2_Intron|PAK3_uc011mst.1_Intron|PAK3_uc010npv.1_Intron|PAK3_uc010npw.1_Intron	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d						multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						AATTTCTATTtctctctctctc	0.322										TSP Lung(19;0.15)			5	4	---	---	---	---	
