Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WDTC1	23038	broad.mit.edu	37	1	27623580	27623580	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27623580G>C	uc009vst.2	+	11	1526	c.991G>C	c.(991-993)GGT>CGT	p.G331R	WDTC1_uc001bno.2_Missense_Mutation_p.G330R|WDTC1_uc001bnp.1_RNA|WDTC1_uc001bnq.2_Missense_Mutation_p.G9R	NM_015023	NP_055838	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	331							protein binding			ovary(1)|central_nervous_system(1)	2		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		tgtgtccaacggtgtgtccaa	0.478											OREG0013279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	65	---	---	---	---	PASS
FAM151A	338094	broad.mit.edu	37	1	55085646	55085646	+	Silent	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55085646G>A	uc001cxn.2	-	2	285	c.153C>T	c.(151-153)GAC>GAT	p.D51D	ACOT11_uc001cxm.1_Intron	NM_176782	NP_788954	Q8WW52	F151A_HUMAN	hypothetical protein LOC338094	51						integral to membrane					0						AGTCCAGCATGTCGGCATCAG	0.607													39	83	---	---	---	---	PASS
ATP5F1	515	broad.mit.edu	37	1	111992095	111992095	+	5'UTR	SNP	C	T	T	rs1264899	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111992095C>T	uc001ebc.2	+	1					WDR77_uc001ebb.2_5'Flank|WDR77_uc010owd.1_5'Flank|WDR77_uc010owe.1_5'Flank|ATP5F1_uc009wgf.1_Missense_Mutation_p.P125S|ATP5F1_uc001ebd.3_RNA	NM_001688	NP_001679	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding				0		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCATCTTGGTCCTGCCCTGAC	0.498													10	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713956	142713956	+	Intron	SNP	G	A	A	rs12161184	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713956G>A	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		AAGTTAAAGAGTAACCTGCAC	0.308													7	39	---	---	---	---	PASS
PPIAL4G	644591	broad.mit.edu	37	1	143767193	143767193	+	3'UTR	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143767193G>C	uc001ejt.2	-	1						NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like						protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0						CTGCAATCCAGCTAGGCATGG	0.284													7	32	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783892	149783892	+	5'UTR	SNP	A	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783892A>C	uc001esr.2	-	1					HIST2H2BF_uc010pbj.1_5'UTR|HIST2H2BF_uc010pbk.1_5'UTR	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a						nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					TGCGCGAAAAAAGAGAAAAGA	0.478													40	126	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156910115	156910115	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156910115C>T	uc001fqo.2	-	35	4537	c.3497G>A	c.(3496-3498)TGC>TAC	p.C1166Y	ARHGEF11_uc010phu.1_Missense_Mutation_p.C582Y|ARHGEF11_uc001fqn.2_Missense_Mutation_p.C1206Y	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1166					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGTGGAAGGGCAAGGCAGGAC	0.612													31	71	---	---	---	---	PASS
NEK7	140609	broad.mit.edu	37	1	198288709	198288709	+	3'UTR	SNP	A	G	G	rs6679100	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198288709A>G	uc001gun.3	+	10						NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						TGTGCAAGTCATACCTCCCCA	0.373													2	10	---	---	---	---	PASS
INTS7	25896	broad.mit.edu	37	1	212118313	212118313	+	Splice_Site	SNP	T	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212118313T>C	uc001hiw.1	-	19	2521	c.2416_splice	c.e19-1	p.L806_splice	INTS7_uc009xdb.1_Splice_Site_p.L786_splice|INTS7_uc001hix.1_Splice_Site_p.L682_splice|INTS7_uc001hiy.1_Splice_Site_p.L792_splice|INTS7_uc010pta.1_Splice_Site_p.L757_splice	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7						snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CAGAGCAAGCTGGAATGCCAA	0.493													28	74	---	---	---	---	PASS
TP53BP2	7159	broad.mit.edu	37	1	223990156	223990156	+	Intron	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223990156C>T	uc010pvb.1	-						TP53BP2_uc001hod.2_Intron|TP53BP2_uc010puz.1_5'Flank|TP53BP2_uc010pva.1_5'UTR	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1						apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		GTTTCAGAATCTAGCCATAGA	0.348													5	9	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71060832	71060832	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71060832C>G	uc002shg.2	-	3	557	c.510G>C	c.(508-510)AAG>AAC	p.K170N		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	170	Potential.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						GTGCCCGGATCTTTGTATTTA	0.428													32	74	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86693955	86693955	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86693955A>C	uc002sri.3	+	10	1795	c.1468A>C	c.(1468-1470)AAA>CAA	p.K490Q	KDM3A_uc010ytj.1_Missense_Mutation_p.K490Q|KDM3A_uc010ytk.1_Missense_Mutation_p.K438Q	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	490					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						ATCTTCAGTAAAAGTAGATAA	0.353													12	98	---	---	---	---	PASS
RGPD4	285190	broad.mit.edu	37	2	108496435	108496435	+	Missense_Mutation	SNP	T	A	A	rs832352		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108496435T>A	uc010ywk.1	+	21	5018	c.4936T>A	c.(4936-4938)TGG>AGG	p.W1646R	RGPD4_uc002tdu.2_Missense_Mutation_p.W833R|RGPD4_uc010ywl.1_RNA	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1646					intracellular transport		binding			skin(2)	2						GCCTCCATTATGGCATGCTGA	0.358													18	219	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215797332	215797332	+	3'UTR	SNP	C	T	T	rs17426207	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215797332C>T	uc002vew.2	-	53					ABCA12_uc002vev.2_3'UTR|ABCA12_uc010zjn.1_3'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTGGTCACACGCTGAGATTG	0.388													10	90	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9470656	9470656	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9470656T>C	uc003brt.2	+	3	469	c.34T>C	c.(34-36)TCA>CCA	p.S12P	SETD5_uc003brs.1_5'UTR|SETD5_uc003bru.2_5'Flank	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	12										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AGTCACCACATCAGATACATC	0.468													16	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	12299945	12299945	+	RNA	SNP	G	C	C	rs13067702	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12299945G>C	uc003bwp.1	-	1		c.8C>G				NR_003112				NR_003112																		ACCCCAGTGTGATGGGCATGG	0.383													7	64	---	---	---	---	PASS
NEK10	152110	broad.mit.edu	37	3	27326451	27326451	+	Silent	SNP	A	G	G	rs10510594	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27326451A>G	uc003cdt.1	-	22	2065	c.1791T>C	c.(1789-1791)AAT>AAC	p.N597N	NEK10_uc003cds.1_5'UTR	NM_199347	NP_955379	Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10 isoform 3	597	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						ACAACCTATCATCTATATAAA	0.383													6	51	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127799983	127799983	+	3'UTR	SNP	A	C	C	rs1057220	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127799983A>C	uc003ekh.2	-	11					RUVBL1_uc003eke.2_Intron|RUVBL1_uc003ekf.2_Intron|RUVBL1_uc010hss.2_3'UTR	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1						cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		AGCGCTGCAGACCACGCCTGA	0.552													2	12	---	---	---	---	PASS
SULT1B1	27284	broad.mit.edu	37	4	70592790	70592790	+	3'UTR	SNP	G	T	T	rs2292092	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70592790G>T	uc003hen.2	-	8						NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member						3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						TTCTTCAGATGTGTGATTTAG	0.348													9	86	---	---	---	---	PASS
IBSP	3381	broad.mit.edu	37	4	88732921	88732921	+	Silent	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88732921C>T	uc003hqx.3	+	7	911	c.813C>T	c.(811-813)TAC>TAT	p.Y271Y		NM_004967	NP_004958	P21815	SIAL_HUMAN	integrin-binding sialoprotein precursor	271					biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		CCAATGAATACGACAATGGAT	0.478													32	63	---	---	---	---	PASS
COL25A1	84570	broad.mit.edu	37	4	110223080	110223080	+	Silent	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110223080G>A	uc003hze.1	-	2	627	c.96C>T	c.(94-96)CCC>CCT	p.P32P	COL25A1_uc003hzg.2_Silent_p.P32P|COL25A1_uc003hzh.1_Silent_p.P32P	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1	32	Cytoplasmic (Potential).					collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CGGCACACGGGGGCATGGTCC	0.667													43	111	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156651423	156651423	+	3'UTR	SNP	C	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156651423C>A	uc003iov.2	+	11					GUCY1A3_uc003iow.2_3'UTR|GUCY1A3_uc010iqd.2_3'UTR|GUCY1A3_uc003iox.2_3'UTR|GUCY1A3_uc003ioz.2_3'UTR|GUCY1A3_uc003ioy.2_3'UTR|GUCY1A3_uc010iqe.2_3'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_3'UTR	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GGGTTTGACTCATTGAAGATG	0.373													22	45	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43609272	43609272	+	5'UTR	SNP	T	C	C	rs12187908	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43609272T>C	uc003joe.2	+	2					NNT_uc003jof.2_5'UTR	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	AACTGGGGAGTCAGAAAATTG	0.368													9	85	---	---	---	---	PASS
NKX2-5	1482	broad.mit.edu	37	5	172659511	172659511	+	3'UTR	SNP	C	A	A	rs703752	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172659511C>A	uc003mcm.1	-	2						NM_004387	NP_004378	P52952	NKX25_HUMAN	NK2 transcription factor related, locus 5						adult heart development|atrial cardiac muscle cell development|atrial septum morphogenesis|heart looping|hemopoiesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell apoptosis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|outflow tract septum morphogenesis|pharyngeal system development|positive regulation of calcium ion transport via voltage-gated calcium channel activity|positive regulation of cardioblast differentiation|positive regulation of cell proliferation|positive regulation of heart contraction|positive regulation of neuron differentiation|positive regulation of sodium ion transport|positive regulation of survival gene product expression|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of cardiac muscle contraction|right ventricular cardiac muscle tissue morphogenesis|septum secundum development|spleen development|thyroid gland development|vasculogenesis|ventricular septum morphogenesis		chromatin binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTTCTCCCCCCGAGAGTCAG	0.607													4	24	---	---	---	---	PASS
HLA-DMB	3109	broad.mit.edu	37	6	32906638	32906638	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32906638A>G	uc003ocl.1	-	2	393	c.160T>C	c.(160-162)TGG>CGG	p.W54R	HLA-DMB_uc003ocj.1_Missense_Mutation_p.W54R|HLA-DMB_uc003ock.1_5'Flank|HLA-DMB_uc010jud.1_5'Flank|HLA-DMB_uc010jue.1_5'Flank|HLA-DMB_uc010juf.1_5'Flank|HLA-DMB_uc011dql.1_Missense_Mutation_p.W54R	NM_002118	NP_002109	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM	54	Beta-1.|Lumenal (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TCTGGATCCCAGCAGGTCAGC	0.507													56	136	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123101647	123101647	+	Intron	SNP	A	G	G	rs2243372	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123101647A>G	uc003pzf.2	+						FABP7_uc003pzd.2_Intron|FABP7_uc003pze.1_Silent_p.R95R	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	GGATGGGGAGAGGGGAATAAA	0.373													6	47	---	---	---	---	PASS
C6orf58	352999	broad.mit.edu	37	6	127912719	127912719	+	Nonsense_Mutation	SNP	T	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127912719T>A	uc003qbh.2	+	6	957	c.945T>A	c.(943-945)TAT>TAA	p.Y315*		NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor	315						extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		CTAATGTATATAGAGATCATT	0.264													27	63	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168265353	168265353	+	Silent	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168265353G>A	uc003qwd.2	+	2	370	c.228G>A	c.(226-228)GCG>GCA	p.A76A	MLLT4_uc003qwb.1_Silent_p.A76A|MLLT4_uc003qwc.1_Silent_p.A76A	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	76	Ras-associating 1.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AAACGCTCGCGGAGAAATTTC	0.433			T	MLL	AL								148	363	---	---	---	---	PASS
ZNF679	168417	broad.mit.edu	37	7	63726597	63726597	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63726597G>C	uc003tsx.2	+	5	855	c.586G>C	c.(586-588)GTT>CTT	p.V196L		NM_153363	NP_699194	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	196	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ATTTTGCATGGTTTCACAACT	0.348													11	26	---	---	---	---	PASS
LRRN3	54674	broad.mit.edu	37	7	110764652	110764652	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110764652T>G	uc003vft.3	+	4	2870	c.1824T>G	c.(1822-1824)AAT>AAG	p.N608K	IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Missense_Mutation_p.N608K|LRRN3_uc003vfs.3_Missense_Mutation_p.N608K	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor	608	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AATGTGTAAATGTCACCACCA	0.358													31	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	7808219	7808219	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7808219A>T	uc010lro.1	+	6	550	c.268A>T	c.(268-270)ATA>TTA	p.I90L		NM_001039615	NP_001034704			zinc finger protein 705D																		AAAACACATGATATCCATGCA	0.328													24	126	---	---	---	---	PASS
FAM86B2	653333	broad.mit.edu	37	8	12285202	12285202	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12285202T>G	uc003wvt.3	-	7	856	c.856A>C	c.(856-858)AAC>CAC	p.N286H	FAM66D_uc011kxp.1_Intron|uc003wvm.1_Intron|uc011kxs.1_5'Flank|uc003wvp.1_5'Flank|FAM86B2_uc003wvq.3_RNA|FAM86B2_uc003wvr.3_Missense_Mutation_p.N109H|FAM86B2_uc003wvs.3_Missense_Mutation_p.N186H|FAM86B2_uc010lsn.2_RNA|FAM86B2_uc003wvu.3_Missense_Mutation_p.N95H|FAM86B2_uc010lso.2_RNA|FAM86B2_uc011kxt.1_Missense_Mutation_p.N58H|FAM86B2_uc011kxu.1_RNA|FAM86B2_uc010lsl.2_RNA	NM_001137610	NP_001131082	P0C5J1	F86B2_HUMAN	hypothetical protein LOC653333	286											0						GTCTCTGGGTTGCGGACGGTA	0.662													7	47	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24771441	24771441	+	Silent	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24771441C>T	uc003xed.3	+	1	168	c.135C>T	c.(133-135)CCC>CCT	p.P45P	NEFM_uc011lac.1_Silent_p.P45P|NEFM_uc010lue.2_5'Flank|uc010luc.1_3'UTR	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	45	Head.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GCGGCTCGCCCAGCACCGTGT	0.697													8	32	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70585379	70585379	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70585379A>T	uc003xyl.2	-	10	2979	c.2272T>A	c.(2272-2274)TAC>AAC	p.Y758N	SLCO5A1_uc010lzb.2_Missense_Mutation_p.Y703N|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_3'UTR	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	758	Helical; Name=12; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TTTATGGAGTACCAGGCCAGA	0.498													46	107	---	---	---	---	PASS
KIAA1432	57589	broad.mit.edu	37	9	5765320	5765320	+	Intron	SNP	C	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5765320C>A	uc003zji.2	+						KIAA1432_uc003zjh.2_Intron|KIAA1432_uc003zjl.3_Intron|KIAA1432_uc003zjj.1_Intron|ERMP1_uc011lme.1_RNA	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a							integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GGTGTGGCTACATTCTTTGAG	0.333													4	21	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17362784	17362784	+	3'UTR	SNP	A	G	G	rs717768	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17362784A>G	uc001ipd.2	-	8					ST8SIA6_uc010qce.1_RNA	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						GCTCATCTCAAAATACTCTTT	0.358													4	40	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38647473	38647473	+	Intron	SNP	T	C	C	rs35215821		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38647473T>C	uc010qex.1	+						HSD17B7P2_uc001izq.2_Intron|HSD17B7P2_uc010qew.1_3'UTR|HSD17B7P2_uc001izo.1_Intron|HSD17B7P2_uc001izp.1_Intron					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						ATTTTTTTTTTCTCGTGTGAT	0.408													4	41	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	49239650	49239650	+	5'UTR	SNP	C	T	T	rs141790562	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49239650C>T	uc001jgd.2	-	1										RecName: Full=Arf-GAP, GTPase, ANK repeat and PH domain-containing protein 11; AltName: Full=Centaurin-gamma-like protein KIAA1975;																		CCACCTGTGCCTCTGCTCACA	0.632													6	48	---	---	---	---	PASS
HBD	3045	broad.mit.edu	37	11	5255732	5255732	+	5'UTR	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5255732C>T	uc001maf.1	-	1						NM_000519	NP_000510	P02042	HBD_HUMAN	delta globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCGACTCTGCCCTGCCTTTT	0.463											OREG0002368	type=REGULATORY REGION|Gene=HBB gene family|Dataset=CRMs in the HBB locus|EvidenceSubtype=Literature derived	14	49	---	---	---	---	PASS
TRIM6	117854	broad.mit.edu	37	11	5617987	5617987	+	Intron	SNP	G	A	A	rs12272467	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5617987G>A	uc001mbc.1	+						HBG2_uc001mak.1_Intron|TRIM6-TRIM34_uc001mbf.2_Translation_Start_Site|TRIM6_uc009yeo.1_Intron|TRIM6_uc010qzj.1_Intron|TRIM6_uc001mbe.2_Translation_Start_Site|TRIM6_uc010qzk.1_Translation_Start_Site|TRIM6_uc010qzl.1_Translation_Start_Site|TRIM6_uc001mbd.2_Translation_Start_Site	NM_058166	NP_477514	Q9C030	TRIM6_HUMAN	tripartite motif-containing 6 isoform 2						protein trimerization	cytoplasm	zinc ion binding				0		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		GAGCAGAGTCGTGCGTGGTTG	0.547													6	37	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55038375	55038375	+	3'UTR	SNP	T	C	C	rs3213870	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55038375T>C	uc010rid.1	+	6						NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TCCTTCTCACTTCCTCTCAGA	0.433													17	109	---	---	---	---	PASS
SERPING1	710	broad.mit.edu	37	11	57367609	57367609	+	Silent	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57367609C>T	uc001nkp.1	+	3	500	c.309C>T	c.(307-309)ACC>ACT	p.T103T	SERPING1_uc001nkq.1_Silent_p.T103T|SERPING1_uc010rju.1_Silent_p.T51T|SERPING1_uc010rjv.1_Silent_p.T108T|SERPING1_uc001nkr.1_Silent_p.T103T|SERPING1_uc009ymi.1_Silent_p.T103T|SERPING1_uc009ymj.1_Silent_p.T103T|SERPING1_uc001nks.1_Intron	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	103	5.|7 X 4 AA tandem repeats of [QE]-P-T-[TQ].		Missing (in HAE; type 2).	T -> S (in Ref. 6; BAF85743).	blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						tccaacccacccaaccaacta	0.144									Hereditary_Angioedema				57	156	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	63997583	63997583	+	Missense_Mutation	SNP	A	C	C	rs11364788		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63997583A>C	uc001nyr.1	-	1	1178	c.746T>G	c.(745-747)GTT>GGT	p.V249G	DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank					Homo sapiens cDNA FLJ34477 fis, clone HLUNG2003833.																		AAAAAAAAAAACCCGCCCAGC	0.532													4	1	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65272451	65272451	+	RNA	SNP	T	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65272451T>A	uc010roh.1	+	1		c.7219T>A			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TAGAAGGAGCTTCCAGTTGAA	0.353													12	47	---	---	---	---	PASS
MOGAT2	80168	broad.mit.edu	37	11	75430950	75430950	+	Intron	SNP	A	G	G	rs650861	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75430950A>G	uc010rru.1	+						MOGAT2_uc001oww.1_Intron|MOGAT2_uc010rrv.1_5'UTR	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2						glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					TGCTAGTGCCAGGCCTATGGG	0.502													8	53	---	---	---	---	PASS
ALG8	79053	broad.mit.edu	37	11	77811990	77811990	+	3'UTR	SNP	T	C	C	rs1263505	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77811990T>C	uc001oza.1	-	13					ALG8_uc001oyz.1_3'UTR|ALG8_uc009yux.1_3'UTR	NM_024079	NP_076984	Q9BVK2	ALG8_HUMAN	dolichyl pyrophosphate Glc1Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity|dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|pancreas(1)	3	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			GCTTGGCACATATCTAAGCAG	0.383													12	145	---	---	---	---	PASS
ANKRD42	338699	broad.mit.edu	37	11	82924358	82924358	+	Intron	SNP	T	C	C	rs617170	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82924358T>C	uc001ozz.1	+						ANKRD42_uc009yvi.1_3'UTR|ANKRD42_uc010rsv.1_Intron|ANKRD42_uc001paa.2_Intron|ANKRD42_uc001pab.1_Intron	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42											skin(1)	1						CTCCAAGAACTGCAAAGCCAT	0.512													9	81	---	---	---	---	PASS
PLEKHG6	55200	broad.mit.edu	37	12	6428116	6428116	+	Intron	SNP	T	G	G	rs4764497	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6428116T>G	uc001qnr.2	+						PLEKHG6_uc001qns.2_Missense_Mutation_p.I494S|PLEKHG6_uc010sew.1_Intron|PLEKHG6_uc010sex.1_Intron	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G						regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						GGGACGGAGATCAAATAAAGG	0.562													5	37	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31632889	31632889	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31632889C>A	uc001rki.1	-	3	724	c.538G>T	c.(538-540)GAT>TAT	p.D180Y	DENND5B_uc001rkh.1_Missense_Mutation_p.D215Y|DENND5B_uc009zjq.1_Missense_Mutation_p.D99Y|DENND5B_uc001rkj.2_Missense_Mutation_p.D202Y|DENND5B_uc001rkk.1_Missense_Mutation_p.D102Y	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	180						integral to membrane				ovary(1)|central_nervous_system(1)	2						CTGCTAATATCATAGGAGTTG	0.408													53	135	---	---	---	---	PASS
CBX5	23468	broad.mit.edu	37	12	54651471	54651471	+	5'UTR	SNP	A	G	G	rs1140681	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54651471A>G	uc001sfh.3	-	2					CBX5_uc001sfk.3_5'UTR|CBX5_uc001sfi.3_5'UTR|CBX5_uc001sfj.3_5'UTR	NM_001127322	NP_001120794	P45973	CBX5_HUMAN	heterochromatin protein 1-alpha						blood coagulation|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|nuclear centromeric heterochromatin|nuclear envelope|nucleolus|transcriptional repressor complex	methylated histone residue binding|protein binding, bridging|repressing transcription factor binding				0						TAAGGCCACCAGGTCCCTGCA	0.458													9	96	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104149153	104149153	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104149153A>C	uc001tjw.2	+	62	6974	c.6788A>C	c.(6787-6789)CAG>CCG	p.Q2263P	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	2263	Extracellular (Potential).|Link.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TTCGCCTCCCAGAACTGTGGC	0.582													70	195	---	---	---	---	PASS
MSI1	4440	broad.mit.edu	37	12	120791177	120791177	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120791177G>A	uc001tye.1	-	10	722	c.658C>T	c.(658-660)CCA>TCA	p.P220S		NM_002442	NP_002433	O43347	MSI1H_HUMAN	musashi 1	220					nervous system development	cytoplasm|nucleus	nucleotide binding			central_nervous_system(2)|breast(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGAAACCTGGGTAACCTGAT	0.592													53	116	---	---	---	---	PASS
SMAD9	4093	broad.mit.edu	37	13	37453744	37453744	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37453744T>C	uc001uvw.2	-	2	426	c.83A>G	c.(82-84)GAT>GGT	p.D28G	SMAD9_uc001uvx.2_Missense_Mutation_p.D28G|SMAD9_uc010tep.1_5'UTR	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	28	MH1.				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		TTCCTCTTCATCTCCTTGCTT	0.557													45	118	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77294906	77294906	+	Intron	SNP	C	G	G	rs75720627	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77294906C>G	uc001xsx.2	+						C14orf166B_uc010asn.1_Intron|C14orf166B_uc001xsw.2_Intron|C14orf166B_uc010aso.1_RNA|C14orf166B_uc010tvg.1_Intron|C14orf166B_uc010tvh.1_5'Flank	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		AAGGCCTGCTCGATTTTGCCT	0.587													3	6	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25584280	25584280	+	3'UTR	SNP	T	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25584280T>C	uc001zaq.2	-	11					uc001zae.2_Intron|UBE3A_uc001zar.2_3'UTR|UBE3A_uc001zas.2_3'UTR|UBE3A_uc001zat.2_3'UTR	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		tgttttgttttgttttACAGC	0.259													4	27	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41796315	41796315	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41796315G>A	uc001zoa.3	-	20	2652	c.2474C>T	c.(2473-2475)CCA>CTA	p.P825L	LTK_uc001zob.3_Missense_Mutation_p.P764L|LTK_uc010ucx.1_Missense_Mutation_p.P695L|LTK_uc010bcg.2_Missense_Mutation_p.P523L	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	825	Cytoplasmic (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CAACTTCTCTGGACTCAGTTC	0.607										TSP Lung(18;0.14)			44	97	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41829366	41829366	+	5'UTR	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41829366G>C	uc001zod.2	-	2						NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1							nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCTCCAGCAGTGTCTCCGTG	0.557													7	13	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42440057	42440057	+	Intron	SNP	C	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42440057C>G	uc001zoz.2	-						PLA2G4F_uc010bcq.2_5'Flank|PLA2G4F_uc001zoy.2_5'UTR|PLA2G4F_uc010bcr.2_Intron|PLA2G4F_uc001zpa.2_Intron|PLA2G4F_uc010bcs.2_Intron	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF						phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		gagtcttacacgtattatctc	0.134													8	14	---	---	---	---	PASS
TTLL13	440307	broad.mit.edu	37	15	90802227	90802227	+	3'UTR	SNP	G	T	T	rs67188155	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90802227G>T	uc002bpd.1	+	10					TTLL13_uc002bpe.1_Intron	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TCCTTTAGATGAAGAATGTGG	0.358													6	38	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98514489	98514489	+	3'UTR	SNP	A	G	G	rs3803385	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98514489A>G	uc010bom.2	+	8					ARRDC4_uc002bui.3_3'UTR	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4						signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTTTTTGGGAAAGAGACAGGA	0.393													7	67	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	66940	66940	+	Silent	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66940G>A	uc002cfg.1	-	5	1355	c.696C>T	c.(694-696)AGC>AGT	p.S232S		NM_182905	NP_878908			WAS protein family homolog 1																		GCTCTCTCTTGCTGATGGACA	0.597													7	15	---	---	---	---	PASS
JMJD8	339123	broad.mit.edu	37	16	731725	731725	+	3'UTR	SNP	T	G	G	rs6597	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:731725T>G	uc002ciw.1	-	9					STUB1_uc002cit.2_Intron|STUB1_uc002ciu.2_Intron|STUB1_uc010bqz.2_Intron|STUB1_uc002civ.2_Intron|JMJD8_uc002cix.1_3'UTR|JMJD8_uc002ciy.1_3'UTR	NM_001005920	NP_001005920	Q96S16	JMJD8_HUMAN	jumonji domain containing 8											breast(1)	1						GGATGTTAGCTCTGAGATTGG	0.557													5	43	---	---	---	---	PASS
PARN	5073	broad.mit.edu	37	16	14540919	14540919	+	Missense_Mutation	SNP	C	T	T	rs35722504	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14540919C>T	uc010uzd.1	-	23	1832	c.1690G>A	c.(1690-1692)GTA>ATA	p.V564I	PARN_uc010uzc.1_Missense_Mutation_p.V503I|PARN_uc010uze.1_Missense_Mutation_p.V518I|PARN_uc010uzf.1_Missense_Mutation_p.V389I	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation	564					female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						CTCTTTCCTACTGTGCTGGGA	0.433													8	80	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20492304	20492304	+	Intron	SNP	A	T	T	rs1700809	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20492304A>T	uc010bwe.2	+						ACSM2A_uc010vax.1_3'UTR|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						gtgtagtatgatggtttaaga	0.254													5	39	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20492307	20492307	+	Intron	SNP	G	A	A	rs1700810	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20492307G>A	uc010bwe.2	+						ACSM2A_uc010vax.1_3'UTR|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						tagtatgatggtttaagaaca	0.244													5	38	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28109837	28109837	+	3'UTR	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28109837G>C	uc002dpa.1	-	24					XPO6_uc002dpb.1_3'UTR|XPO6_uc010vcp.1_3'UTR	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						GCAGAAGTCCGTGTCCCCAGG	0.612													16	79	---	---	---	---	PASS
CIAPIN1	57019	broad.mit.edu	37	16	57464248	57464248	+	Silent	SNP	G	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57464248G>C	uc002ell.1	-	8	921	c.750C>G	c.(748-750)ACC>ACG	p.T250T	CIAPIN1_uc002elk.1_RNA|CIAPIN1_uc002elm.1_Silent_p.T237T|CIAPIN1_uc002eln.1_Missense_Mutation_p.L212V|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Missense_Mutation_p.L185V	NM_020313	NP_064709	Q6FI81	CPIN1_HUMAN	cytokine induced apoptosis inhibitor 1	250					anti-apoptosis|apoptosis	cytoplasm|nucleolus					0						CAAGGCCACAGGTGCTGCGGG	0.448													47	117	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74640954	74640954	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74640954C>A	uc002fcy.3	-	1	89	c.39G>T	c.(37-39)TTG>TTT	p.L13F	GLG1_uc002fcx.2_Missense_Mutation_p.L13F|GLG1_uc002fcw.3_Missense_Mutation_p.L13F|GLG1_uc002fcz.3_5'UTR	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	13						Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						GCGCCGCCGACAAGCGGAACA	0.682													3	6	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1559855	1559855	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1559855T>G	uc002fte.2	-	36	5738	c.5624A>C	c.(5623-5625)CAC>CCC	p.H1875P		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1875	Involved in interaction with pre-mRNA 5' splice site.					catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GTCCAGTAAGTGCACCTAAGA	0.493													28	80	---	---	---	---	PASS
LGALS9C	654346	broad.mit.edu	37	17	18397711	18397711	+	3'UTR	SNP	G	A	A	rs75054442	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18397711G>A	uc002gtw.2	+	11					LGALS9C_uc010vyb.1_3'UTR	NM_001040078	NP_001035167	Q6DKI2	LEG9C_HUMAN	galectin 9 like								sugar binding			ovary(1)	1						GCCGGGGGCTGGGGTGTGGGG	0.632													8	65	---	---	---	---	PASS
ALDH3A2	224	broad.mit.edu	37	17	19568345	19568345	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19568345C>A	uc002gwb.1	+	8	1413	c.1192C>A	c.(1192-1194)CCA>ACA	p.P398T	ALDH3A2_uc002gwa.1_Missense_Mutation_p.P398T|ALDH3A2_uc010cqr.1_Missense_Mutation_p.P205T|ALDH3A2_uc002gwc.1_Missense_Mutation_p.P398T|ALDH3A2_uc002gwd.1_Missense_Mutation_p.P205T	NM_000382	NP_000373	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 2	398	Cytoplasmic.				cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)	CAACTCTTTCCCATTTGGAGG	0.448													36	136	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27000391	27000391	+	5'UTR	SNP	A	G	G	rs9904043	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27000391A>G	uc002hby.2	+	2					SUPT6H_uc010crt.2_5'UTR	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					TTCCCTAGTTATCTTCAGGCA	0.458													8	44	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38792655	38792655	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792655C>T	uc002hux.2	-	6	485	c.361G>A	c.(361-363)GCA>ACA	p.A121T	SMARCE1_uc010wff.1_Missense_Mutation_p.A86T|SMARCE1_uc010wfg.1_Missense_Mutation_p.A51T|SMARCE1_uc002huy.2_Missense_Mutation_p.A86T|SMARCE1_uc010wfh.1_Missense_Mutation_p.A51T|SMARCE1_uc010wfi.1_Missense_Mutation_p.A103T|SMARCE1_uc002huz.1_Missense_Mutation_p.A86T|SMARCE1_uc010wfj.1_Missense_Mutation_p.A103T	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	121	HMG box.				chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				ACCTTTTCTGCTTCGTATTCG	0.378													92	435	---	---	---	---	PASS
CDK5RAP3	80279	broad.mit.edu	37	17	46051911	46051911	+	Intron	SNP	G	A	A	rs886444	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46051911G>A	uc002imr.2	+						CDK5RAP3_uc010wlc.1_Intron|CDK5RAP3_uc002imq.1_5'UTR|CDK5RAP3_uc002imu.2_Intron|CDK5RAP3_uc002ims.2_5'UTR|CDK5RAP3_uc002imv.2_Intron|CDK5RAP3_uc002imw.2_Intron|CDK5RAP3_uc002imx.2_5'UTR	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						TCTGTGAGTGGGAAGAGACTG	0.502													8	61	---	---	---	---	PASS
APPBP2	10513	broad.mit.edu	37	17	58541434	58541434	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58541434G>A	uc002iys.1	-	6	998	c.710C>T	c.(709-711)ACA>ATA	p.T237I	APPBP2_uc010ddl.1_Missense_Mutation_p.T166I	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein	237	TPR 3.				intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TAAGCCTGCTGTAATTTCTTT	0.308													41	111	---	---	---	---	PASS
CDK3	1018	broad.mit.edu	37	17	73997474	73997474	+	Intron	SNP	G	A	A	rs2069528	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73997474G>A	uc010dgt.2	+						CDK3_uc002jqg.3_Missense_Mutation_p.G18S	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3						cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						CAAATTGCCCGGTGCCTTCTG	0.517													7	46	---	---	---	---	PASS
NFATC1	4772	broad.mit.edu	37	18	77246369	77246369	+	Silent	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77246369C>T	uc010xfg.1	+	9	2667	c.2214C>T	c.(2212-2214)CCC>CCT	p.P738P	NFATC1_uc002lnd.2_Silent_p.P738P|NFATC1_uc002lne.2_Silent_p.P266P|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfj.1_Silent_p.P266P|NFATC1_uc002lnf.2_Silent_p.P725P|NFATC1_uc002lng.2_Silent_p.P725P|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	738	Trans-activation domain B (TAD-B).				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		CGATGCCACCCGACCCCAGCT	0.642													92	250	---	---	---	---	PASS
PPAN-P2RY11	692312	broad.mit.edu	37	19	10224885	10224885	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10224885T>A	uc002mna.2	+	13	1856	c.1856T>A	c.(1855-1857)CTG>CAG	p.L619Q	PPAN-P2RY11_uc010xla.1_3'UTR|P2RY11_uc002mnc.2_Missense_Mutation_p.L199Q	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	PPAN-P2RY11 protein	Error:Variant_position_missing_in_Q9NQ55_after_alignment					RNA splicing	nucleolus	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GACCACGGGCTGGCGGCCTAC	0.716													15	33	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10610550	10610550	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610550A>C	uc002moq.1	-	2	316	c.160T>G	c.(160-162)TAC>GAC	p.Y54D	KEAP1_uc002mor.1_Missense_Mutation_p.Y54D	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	54					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	p.Y54C(1)		lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			TCCAGGGTGTAGCTGAAGGTG	0.617													56	186	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21933943	21933943	+	Intron	SNP	C	T	T	rs10423041	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21933943C>T	uc002nqi.2	-						ZNF100_uc002nqh.2_5'Flank|LOC641367_uc010xrg.1_RNA	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AACCGATGTGCGAGACAAGAG	0.448													9	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23433107	23433107	+	5'UTR	SNP	G	C	C	rs10405424	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23433107G>C	uc010xri.1	-	1										SubName: Full=cDNA FLJ56866, moderately similar to Zinc finger protein 43;																		TTGCAGGTCAGAGGGCCACAG	0.612													7	47	---	---	---	---	PASS
ALKBH6	84964	broad.mit.edu	37	19	36504472	36504472	+	5'UTR	SNP	C	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36504472C>G	uc002oct.2	-	1					ALKBH6_uc002ocv.1_Intron|ALKBH6_uc002ocx.1_Intron|ALKBH6_uc002ocw.1_Intron|ALKBH6_uc010eeo.1_5'UTR|ALKBH6_uc010eep.1_Intron|uc002ocy.2_5'Flank	NM_032878	NP_116267	Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 isoform 2							cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CAGCATCTTACAAGCCACACA	0.522													2	1	---	---	---	---	PASS
ZNF180	7733	broad.mit.edu	37	19	45004305	45004305	+	5'UTR	SNP	G	C	C	rs12977470	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45004305G>C	uc002ozf.3	-	1					ZNF180_uc002ozh.3_Intron|ZNF180_uc002ozi.3_Intron|ZNF180_uc002ozg.3_5'UTR|ZNF180_uc010ejm.2_5'UTR	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				GACACCAAGCGCTGCCCCACG	0.687											OREG0025537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	199	---	---	---	---	PASS
ZNF137	7696	broad.mit.edu	37	19	53099965	53099965	+	RNA	SNP	A	G	G	rs2279151	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53099965A>G	uc002pzt.2	+	1		c.29A>G				NR_023311				Homo sapiens zinc finger protein 137, mRNA (cDNA clone IMAGE:40016639).												0				GBM - Glioblastoma multiforme(134;0.0212)|OV - Ovarian serous cystadenocarcinoma(262;0.0221)		TTTCACGAGTATGGAAAGACC	0.383													3	19	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54401765	54401765	+	Silent	SNP	C	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54401765C>T	uc002qcq.1	+	11	1446	c.1164C>T	c.(1162-1164)GTC>GTT	p.V388V	PRKCG_uc010yef.1_3'UTR|PRKCG_uc010yeg.1_Silent_p.V388V|PRKCG_uc010yeh.1_Silent_p.V275V	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	388	Protein kinase.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		ACGTGATCGTCCAGGACGACG	0.627													30	73	---	---	---	---	PASS
KCNE1	3753	broad.mit.edu	37	21	35821419	35821419	+	3'UTR	SNP	T	C	C	rs2070357	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35821419T>C	uc010gmp.2	-	2					KCNE1_uc002ytz.2_3'UTR|KCNE1_uc010gmq.2_3'UTR|KCNE1_uc010gmr.2_3'UTR|KCNE1_uc010gms.2_3'UTR|KCNE1_uc002yua.2_RNA	NM_001127670	NP_001121142	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound	lysosome	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(2)	2					Indapamide(DB00808)	AATCCACCCCTCACCCCTTAC	0.313													7	62	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19882630	19882630	+	Intron	SNP	G	A	A	rs5993856	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19882630G>A	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_3'UTR|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_3'UTR	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					GTTGATCCTCGATGAGGACAC	0.512													5	32	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	28807442	28807442	+	5'UTR	SNP	G	A	A	rs6526806	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28807442G>A	uc004dby.2	+	2						NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTTAGGGAACGGCCTTTAAGA	0.353													6	57	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39916518	39916518	+	Silent	SNP	G	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39916518G>A	uc004den.3	-	11	4777	c.4485C>T	c.(4483-4485)AAC>AAT	p.N1495N	BCOR_uc004dep.3_Silent_p.N1461N|BCOR_uc004deo.3_Silent_p.N1443N|BCOR_uc010nhb.2_Silent_p.N203N|BCOR_uc004dem.3_Silent_p.N1461N	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1495	ANK 1.				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						AGTAACCTGCGTTGTCCCGAT	0.517													19	7	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48675025	48675025	+	Silent	SNP	T	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48675025T>A	uc011mmi.1	+	19	1871	c.1776T>A	c.(1774-1776)GCT>GCA	p.A592A	HDAC6_uc004dks.1_Silent_p.A592A|HDAC6_uc010nig.1_Silent_p.A440A|HDAC6_uc004dkt.1_Silent_p.A592A|HDAC6_uc011mmk.1_Silent_p.A573A|HDAC6_uc004dkv.1_Silent_p.A240A|HDAC6_uc004dkw.1_Silent_p.A240A|HDAC6_uc004dkx.1_5'Flank	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	592	Histone deacetylase 2.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	TGGTGGAGGCTGTGCTCTCAG	0.587													19	18	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3085	3085	+	5'Flank	SNP	A	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3085A>G	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		CAGACCGGAGTAATCCAGGTC	0.463													80	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	48208949	48208950	+	IGR	INS	-	TGG	TGG			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48208949_48208950insTGG								FOXD2 (302587 upstream) : SKINTL (358437 downstream)																							gacggtggtgatggtggcggtg	0.000													4	3	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	76084765	76084765	+	Intron	DEL	G	-	-	rs34647299		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76084765delG	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron	NM_001130058	NP_001123530	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						caaaaaaaaagggggggggga	0.000													6	3	---	---	---	---	
ABCD3	5825	broad.mit.edu	37	1	94883978	94883980	+	5'UTR	DEL	GCC	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94883978_94883980delGCC	uc001dqn.3	+	1					ABCD3_uc001dqm.3_5'UTR|ABCD3_uc010oto.1_5'UTR|ABCD3_uc010otp.1_5'UTR|ABCD3_uc009wdr.2_5'UTR	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		CAGTAAGGTAgccgccgccgccg	0.404													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145292942	145292943	+	5'Flank	INS	-	A	A	rs145781959	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145292942_145292943insA	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NOTCH2NL_uc010oyh.1_Intron|NBPF10_uc001emq.1_5'Flank	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GTGGCATTGTCACAAGGGTACA	0.470													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													4	2	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169792833	169792834	+	Intron	INS	-	AATA	AATA	rs146660874	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169792833_169792834insAATA	uc001ggp.2	+						C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggq.2_Intron|C1orf112_uc009wvt.2_Intron|C1orf112_uc010plu.1_Intron|C1orf112_uc009wvu.1_Intron|C1orf112_uc001ggr.2_Intron|C1orf112_uc010plv.1_Intron	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TATACAGGAGTAATAATTAGTA	0.257													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218852096	218852099	+	IGR	DEL	GTGT	-	-	rs72056109		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218852096_218852099delGTGT								TGFB2 (234137 upstream) : LYPLAL1 (495093 downstream)																							ATGTGCAAGCgtgtgtgtgtgtgt	0.078													3	3	---	---	---	---	
TMEM131	23505	broad.mit.edu	37	2	98451037	98451037	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98451037delA	uc002syh.3	-						TMEM131_uc010yvg.1_Intron	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6						TACAGGGGTTAAAAAAAAAAA	0.313													7	4	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209346020	209346021	+	Intron	INS	-	GCAACCTC	GCAACCTC	rs61511423		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209346020_209346021insGCAACCTC	uc002vdb.2	+						PTH2R_uc010zjb.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		ctcggctcactcgcctcccggg	0.015													3	3	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240111871	240111871	+	Intron	DEL	G	-	-	rs74761897		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240111871delG	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron|HDAC4_uc010fyy.2_5'Flank	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TTCACGGGGCGGGGGGGGGGT	0.627													8	4	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188227	10188228	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188227_10188228delAC	uc003bvc.2	+	2	583_584	c.370_371delAC	c.(370-372)ACAfs	p.T124fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	124	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T124fs*35(3)|p.T124_H125>H(1)|p.H125fs*6(1)|p.T124fs*10(1)|p.R120fs*34(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGATGCAGGGACACACGATGGG	0.401		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				194	114	---	---	---	---	
RPSA	3921	broad.mit.edu	37	3	39452945	39452945	+	Intron	DEL	T	-	-	rs35233395		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39452945delT	uc003cjp.2	+						RPSA_uc003cjq.2_Intron|RPSA_uc003cjr.2_Intron|RPSA_uc003cjt.2_Intron	NM_002295	NP_002286	P08865	RSSA_HUMAN	ribosomal protein SA						cell adhesion|endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|ribosomal small subunit assembly|rRNA export from nucleus|translational elongation|translational termination|viral transcription	90S preribosome|cytosolic small ribosomal subunit|nucleus|plasma membrane	protein binding|receptor activity|ribosome binding|structural constituent of ribosome			lung(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		TGTccaggcatttttttttca	0.249													4	2	---	---	---	---	
CELSR3	1951	broad.mit.edu	37	3	48672694	48672726	+	Intron	DEL	CGAGGCGTCGCAAGCGGAGAATGCCTGCTCCAG	-	-	rs66952042		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48672694_48672726delCGAGGCGTCGCAAGCGGAGAATGCCTGCTCCAG	uc003cuf.1	-						SLC26A6_uc003cug.2_5'Flank|SLC26A6_uc003cuh.2_Intron|SLC26A6_uc010hke.2_Intron|SLC26A6_uc003cuk.2_Intron|SLC26A6_uc003cui.2_Intron|SLC26A6_uc003cuj.2_Intron|SLC26A6_uc011bbp.1_Intron	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3						homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGAGGTAAACCGAGGCGTCGCAAGCGGAGAATGCCTGCTCCAGCGAGGCGTCG	0.691													3	5	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52584496	52584496	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52584496delT	uc003des.2	-	29	4850	c.4838delA	c.(4837-4839)TACfs	p.Y1613fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.Y1506fs|PBRM1_uc003der.2_Frame_Shift_Del_p.Y1526fs|PBRM1_uc003det.2_Frame_Shift_Del_p.Y1521fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.Y1576fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.Y1558fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.Y1533fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.Y1506fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1613					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCCTTCAATGTATTTCAGGTA	0.498			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								68	44	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151011751	151011762	+	Intron	DEL	GCCATTAACCCT	-	-	rs67834444		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151011751_151011762delGCCATTAACCCT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGACTTCCAGCCATTAACCCTGCCATTCACC	0.443													4	2	---	---	---	---	
RFC1	5981	broad.mit.edu	37	4	39304919	39304920	+	Intron	DEL	AA	-	-	rs74757070		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39304919_39304920delAA	uc003gty.1	-						RFC1_uc003gtx.1_Intron	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit						DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GTTGTTAAAGAAAAAAAAAAAA	0.391													4	3	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48567798	48567798	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48567798delA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gyi.1_5'Flank	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GTAATAGTGTAAAAAAGAAAG	0.303													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49644698	49644699	+	IGR	INS	-	GGAAA	GGAAA	rs4066504		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644698_49644699insGGAAA								CWH43 (580605 upstream) : None (None downstream)																							atggaatggaatggaatggaat	0.000													6	3	---	---	---	---	
G3BP2	9908	broad.mit.edu	37	4	76581177	76581178	+	Intron	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76581177_76581178insT	uc003hir.2	-						G3BP2_uc003his.2_Intron|G3BP2_uc003hit.2_Intron	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding						cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			Attttctttccttttttttttt	0.124													5	3	---	---	---	---	
C4orf45	152940	broad.mit.edu	37	4	159956042	159956043	+	Intron	INS	-	A	A	rs79629884		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159956042_159956043insA	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940												0						gactctgtctcaaaaaaaaaaa	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7045028	7045029	+	IGR	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7045028_7045029insT								PAPD7 (287867 upstream) : ADCY2 (351314 downstream)																							ttctttctttcttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7372641	7372649	+	IGR	DEL	CCACCATCA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7372641_7372649delCCACCATCA								PAPD7 (615480 upstream) : ADCY2 (23694 downstream)																							accaccacctccaccatcaccaccaccac	0.000													5	3	---	---	---	---	
WDR70	55100	broad.mit.edu	37	5	37379190	37379190	+	5'Flank	DEL	A	-	-	rs35727443		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37379190delA	uc003jkv.2	+						WDR70_uc010iva.1_5'Flank	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			gctctggcttaaaaaaaaaaa	0.229													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475737	90475737	+	IGR	DEL	G	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475737delG								GPR98 (15705 upstream) : ARRDC3 (188804 downstream)																							aaggaaggaaggaaggaagga	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172716824	172716825	+	IGR	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172716824_172716825insT								NKX2-5 (54562 upstream) : STC2 (24901 downstream)																							tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180708698	180708699	+	IGR	INS	-	G	G	rs1815381		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708698_180708699insG								TRIM52 (20579 upstream) : None (None downstream)																							gggcggtaggcgggggctggag	0.213													4	2	---	---	---	---	
C6orf106	64771	broad.mit.edu	37	6	34654566	34654567	+	Intron	DEL	TA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34654566_34654567delTA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3						accccgtctctactaaaaatac	0.000													4	2	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42790382	42790382	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42790382delA	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron|KIAA0240_uc003oso.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			AAACAAGATTAAAAAAAAAAA	0.234													5	3	---	---	---	---	
SYNCRIP	10492	broad.mit.edu	37	6	86350406	86350406	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86350406delA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TCTATACCTGAAAAAAAAAAA	0.338													5	4	---	---	---	---	
EYA4	2070	broad.mit.edu	37	6	133836761	133836764	+	Intron	DEL	GTGT	-	-	rs145450874		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133836761_133836764delGTGT	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		gtgtgtgtgagtgtgtgtgtgtgt	0.324													4	2	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150094487	150094501	+	Intron	DEL	GTTTTGTTTTGTTTT	-	-	rs71672010		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150094487_150094501delGTTTTGTTTTGTTTT	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		TGTAGAAGGAgttttgttttgttttgttttgtttt	0.130													4	2	---	---	---	---	
FNDC1	84624	broad.mit.edu	37	6	159669939	159669940	+	Intron	DEL	GT	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159669939_159669940delGT	uc010kjv.2	+							NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TTATTTTAGGGTGTGTGTGTGT	0.406													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74149997	74149998	+	Intron	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74149997_74149998insT	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AGTTTTCCCTGttttttttttt	0.149													9	4	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83824113	83824115	+	5'UTR	DEL	AAA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83824113_83824115delAAA	uc003uhz.2	-	1						NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						CTCCaaaaagaaaaaaaaaaaaa	0.379													4	3	---	---	---	---	
CAPZA2	830	broad.mit.edu	37	7	116532874	116532874	+	Intron	DEL	T	-	-	rs139698378		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116532874delT	uc003vil.2	+						CAPZA2_uc003vik.1_Intron|CAPZA2_uc011knk.1_Intron	NM_006136	NP_006127	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line,						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex	actin binding				0	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			AACCAAAACCTTTTTTTTTTT	0.308													4	4	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141374031	141374032	+	Intron	DEL	AC	-	-	rs35125206		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141374031_141374032delAC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					CTGCAGAAAAacacacacacac	0.490													3	3	---	---	---	---	
DLC1	10395	broad.mit.edu	37	8	12958414	12958415	+	Intron	DEL	TT	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12958414_12958415delTT	uc003wwm.2	-						DLC1_uc003wwk.1_Intron|DLC1_uc003wwl.1_Intron|DLC1_uc011kxx.1_Intron	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						AATTTTAAAGtttttttttttt	0.233													5	3	---	---	---	---	
DLC1	10395	broad.mit.edu	37	8	12990391	12990392	+	Intron	INS	-	G	G	rs77853157		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12990391_12990392insG	uc003wwm.2	-						DLC1_uc003wwk.1_Intron|DLC1_uc003wwl.1_Intron	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TTTCTCGCGGCGGGTCCCCTCC	0.589													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55243464	55243464	+	IGR	DEL	A	-	-	rs35886430		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55243464delA								MRPL15 (182390 upstream) : SOX17 (127031 downstream)																							GTTTAGTTTGAAAAAAAAAAA	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68419453	68419454	+	IGR	DEL	AA	-	-	rs62545511		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68419453_68419454delAA								FAM27B (625264 upstream) : MIR1299 (582785 downstream)																							catacacaccaaacacacatac	0.000													6	3	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97221855	97221855	+	3'UTR	DEL	T	-	-	rs34087557		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97221855delT	uc004aur.2	+	12					HIATL1_uc011luh.1_3'UTR	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CCTCCTCCTGTTTTTTTTTTT	0.403													6	3	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													6	4	---	---	---	---	
OBFC1	79991	broad.mit.edu	37	10	105649126	105649126	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105649126delA	uc001kxl.2	-						OBFC1_uc001kxm.2_Intron|OBFC1_uc001kxn.2_Intron	NM_024928	NP_079204	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold						positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding			ovary(1)	1		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		AGGTTAAAACAAAAAAAAAGC	0.393													4	2	---	---	---	---	
CCDC147	159686	broad.mit.edu	37	10	106158934	106158935	+	Intron	DEL	GT	-	-	rs140937747		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106158934_106158935delGT	uc001kyh.2	+							NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147											ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TTCTTTATGAgtgtgtgtgtgt	0.317													4	3	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7476751	7476752	+	Intron	INS	-	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7476751_7476752insA	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						gactctgtctcaaaaaaaaaaa	0.168													4	2	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	22041045	22041056	+	Intron	DEL	GACAGAGGGGTT	-	-	rs145112683		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22041045_22041056delGACAGAGGGGTT	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	aattgctgaggacagaggggtttccaggacat	0.175													3	4	---	---	---	---	
C12orf41	54934	broad.mit.edu	37	12	49073043	49073044	+	Intron	INS	-	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49073043_49073044insA	uc001rrx.2	-						C12orf41_uc001rrw.2_Intron|C12orf41_uc001rrz.2_Intron|C12orf41_uc001rry.2_Intron	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934											ovary(2)	2						AAAAACAAAACAAAAAAAAAAA	0.337													9	4	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51854857	51854858	+	Intron	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51854857_51854858insT	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TTACTGTCTTCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
GALNT4	8693	broad.mit.edu	37	12	89919631	89919632	+	5'Flank	DEL	CC	-	-	rs67346689		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89919631_89919632delCC	uc001tbd.2	-						POC1B_uc001tba.2_5'Flank|POC1B_uc001tbb.2_5'Flank|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Intron|GALNT4_uc010suo.1_Intron	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4						carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0						CAGGGAGGGACCCCCCCCACCT	0.668													3	3	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94620767	94620767	+	Intron	DEL	C	-	-	rs63735761		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94620767delC	uc001tdc.2	+							NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						ccactgcactcccagcctggg	0.104													4	4	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881161	109881166	+	Intron	DEL	ACACAC	-	-	rs10545297		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881161_109881166delACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						gtgtgtatatacacacacacacacac	0.112													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110868215	110868220	+	IGR	DEL	GTGTGT	-	-	rs113592903		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110868215_110868220delGTGTGT								ANAPC7 (26680 upstream) : ARPC3 (4487 downstream)																							CAgtgtgtgcgtgtgtgtgtgtgtgt	0.335													5	4	---	---	---	---	
TMEM120B	144404	broad.mit.edu	37	12	122188508	122188513	+	Intron	DEL	ACACCA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122188508_122188513delACACCA	uc001ubc.3	+						TMEM120B_uc009zxh.2_Intron	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		caccccacccacaccaacaccaacac	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20086381	20086382	+	IGR	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20086381_20086382insT								P704P (66109 upstream) : OR4Q3 (129205 downstream)																							GTCTTACAAGGTAAAAAAAATG	0.312													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56014150	56014151	+	IGR	INS	-	A	A			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56014150_56014151insA								TBPL2 (106887 upstream) : C14orf33 (10539 downstream)																							aacactgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92090986	92090986	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92090986delA	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ctccattgccaaaaaaaaaaa	0.124													4	2	---	---	---	---	
SPPL2A	84888	broad.mit.edu	37	15	51041982	51041983	+	Intron	INS	-	G	G			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51041982_51041983insG	uc001zyv.2	-							NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A							integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TGCAATGTTATGGCTTGCCAAC	0.401													83	37	---	---	---	---	
TEX9	374618	broad.mit.edu	37	15	56704371	56704372	+	Intron	INS	-	GT	GT	rs137938599	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56704371_56704372insGT	uc002adp.2	+						TEX9_uc010ugl.1_Intron	NM_198524	NP_940926	Q8N6V9	TEX9_HUMAN	testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TACCCCCAAGCgtgtgtgtgtg	0.312													9	4	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73558929	73558929	+	Intron	DEL	T	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73558929delT	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						TTTGTTTTGCTTTTTTTTTTG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78675656	78675656	+	IGR	DEL	T	-	-	rs112849950		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78675656delT								CRABP1 (35084 upstream) : IREB2 (54862 downstream)																							ATAAGGAGAAttttttttttt	0.209													3	3	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3818137	3818137	+	Intron	DEL	G	-	-	rs76555127		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3818137delG	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ATTTAAAAGTGtttttttttt	0.189			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				4	3	---	---	---	---	
ZNF821	55565	broad.mit.edu	37	16	71894760	71894761	+	Intron	DEL	TT	-	-	rs72174311		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71894760_71894761delTT	uc010vmj.1	-						ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_Intron|ZNF821_uc002fbf.2_Intron|ZNF821_uc002fbg.3_Intron|ZNF821_uc002fbh.3_Intron|ZNF821_uc002fbi.3_Intron	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GTCTACCAACtttttttttttt	0.277													4	2	---	---	---	---	
CDK10	8558	broad.mit.edu	37	16	89756781	89756782	+	Intron	INS	-	A	A	rs145022233	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89756781_89756782insA	uc010cio.2	+						CDK10_uc002foa.2_Intron|CDK10_uc010cip.2_Intron|CDK10_uc010vpl.1_Intron|CDK10_uc002fob.2_Intron|CDK10_uc002fod.2_Intron|CDK10_uc002foe.2_Intron|CDK10_uc002fof.2_Intron|CDK10_uc002fog.3_Intron|CDK10_uc002foh.3_Intron	NM_052988	NP_443714	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10 isoform a						negative regulation of cell proliferation|traversing start control point of mitotic cell cycle		ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		GGAAACCCTCCGGGGGAACGCG	0.619													6	6	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	58888882	58888882	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58888882delA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTTCAGAGGTAAaaaaaaaaa	0.254													4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						AGGGAGGTGGCGGCGGGGGGT	0.706													4	3	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2405705	2405705	+	Intron	DEL	T	-	-	rs113589749		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2405705delT	uc010xgx.1	+						TMPRSS9_uc002lvv.1_Intron	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGGCAttcttttttttttt	0.214													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3298938	3298942	+	IGR	DEL	AAGGA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3298938_3298942delAAGGA								CELF5 (1867 upstream) : NFIC (60674 downstream)																							gaaggaaaggaaggaaaggaaagga	0.000													6	3	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10557259	10557259	+	Intron	DEL	T	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10557259delT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	GCTCAGTTCcttttttttttt	0.308													4	3	---	---	---	---	
RASAL3	64926	broad.mit.edu	37	19	15564412	15564413	+	Intron	INS	-	T	T			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15564412_15564413insT	uc002nbe.2	-						RASAL3_uc002nbd.2_Intron|RASAL3_uc010eaa.1_Intron	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CTTGTCCtttcttttttttttt	0.302											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ZNF321	399669	broad.mit.edu	37	19	53431606	53431606	+	3'UTR	DEL	A	-	-	rs35140094		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53431606delA	uc010eqj.2	-	4					ZNF321_uc002qaj.1_3'UTR|ZNF321_uc002qak.1_3'UTR	NM_203307	NP_976052			zinc finger protein 321												0				GBM - Glioblastoma multiforme(134;0.0305)		ACTCCGTCTTAAAAAAAAAAA	0.149													5	3	---	---	---	---	
TNNT1	7138	broad.mit.edu	37	19	55652163	55652174	+	Intron	DEL	TAATAATAATAA	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55652163_55652174delTAATAATAATAA	uc002qjb.3	-						TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron|TNNT1_uc002qjf.2_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a						muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		ataataatagtaataataataataataataat	0.241													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	7315761	7315762	+	IGR	DEL	TG	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7315761_7315762delTG								BMP2 (554851 upstream) : HAO1 (547869 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.228													4	2	---	---	---	---	
C20orf70	140683	broad.mit.edu	37	20	31768033	31768033	+	Intron	DEL	A	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31768033delA	uc002wyo.1	+							NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor							extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						tcaaaaaaagaaaaaaaaaaa	0.080													4	2	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62663026	62663026	+	Intron	DEL	A	-	-	rs72442281		TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62663026delA	uc002yho.2	+						PRPF6_uc002yhp.2_Intron|NCRNA00176_uc002yhq.2_5'Flank|NCRNA00176_uc011abq.1_5'Flank	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					actccttctcaaaaaaaaaaa	0.154													3	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44757276	44757278	+	IGR	DEL	CAC	-	-	rs147538597	by1000genomes	TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44757276_44757278delCAC								CRYAA (164363 upstream) : SIK1 (77120 downstream)																							tcaccaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44127853	44127853	+	Intron	DEL	T	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44127853delT	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_5'Flank|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TACTGTCAGATTTTTTTTTTA	0.373													6	3	---	---	---	---	
RS1	6247	broad.mit.edu	37	X	18671763	18671763	+	Intron	DEL	T	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18671763delT	uc004cyo.2	-							NM_000330	NP_000321	O15537	XLRS1_HUMAN	X-linked juvenile retinoschisis protein						cell adhesion|multicellular organismal development|response to stimulus|visual perception	extracellular space				ovary(2)	2	Hepatocellular(33;0.183)					TGAGGTTGAGTTTTCCTTTCT	0.308													4	2	---	---	---	---	
CD99L2	83692	broad.mit.edu	37	X	149984720	149984721	+	Intron	DEL	AT	-	-			TCGA-A3-3324-01A-01D-0966-08	TCGA-A3-3324-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149984720_149984721delAT	uc004fel.2	-						CD99L2_uc004fek.2_5'Flank|CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGACAAAATGATATAGGTTTAA	0.460													11	8	---	---	---	---	
