Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CYB5RL	606495	broad.mit.edu	37	1	54661136	54661136	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54661136G>T	uc009vzo.2	-	3	474	c.154C>A	c.(154-156)CAA>AAA	p.Q52K	CYB5RL_uc001cww.2_5'UTR|CYB5RL_uc001cwx.3_RNA|CYB5RL_uc001cwy.3_5'UTR	NM_001031672	NP_001026842	Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	52							cytochrome-b5 reductase activity				0						TTGCTGGCTTGGGCTGCCTCC	0.602													4	32	---	---	---	---	PASS
PRCC	5546	broad.mit.edu	37	1	156767110	156767110	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156767110C>A	uc001fqa.2	+	6	1656	c.1366C>A	c.(1366-1368)CAG>AAG	p.Q456K	PRCC_uc001fqb.2_Missense_Mutation_p.Q424K	NM_005973	NP_005964	Q92733	PRCC_HUMAN	papillary renal cell carcinoma	456					cell cycle|mitotic cell cycle checkpoint	nucleus	protein binding		PRCC/TFE3(25)	kidney(25)|central_nervous_system(2)	27	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCGGAAACACCAGATCACATA	0.463			T	TFE3	papillary renal 						OREG0013886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	178	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68882419	68882419	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68882419C>T	uc010yqj.1	+	2	893	c.893C>T	c.(892-894)GCG>GTG	p.A298V	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	298	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						CTATGCTGGGCGCCCTTCTAC	0.597													39	80	---	---	---	---	PASS
DQX1	165545	broad.mit.edu	37	2	74745642	74745642	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74745642C>T	uc010yrw.1	-	12	2250	c.2085G>A	c.(2083-2085)ATG>ATA	p.M695I	DQX1_uc002smc.2_Missense_Mutation_p.M256I	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	695						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						TAGAATCTGCCATTCCTTCCC	0.532													44	139	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209104723	209104723	+	Nonsense_Mutation	SNP	A	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209104723A>C	uc002vcs.2	-	8	1101	c.855T>G	c.(853-855)TAT>TAG	p.Y285*	IDH1_uc002vct.2_Nonsense_Mutation_p.Y285*|IDH1_uc002vcu.2_Nonsense_Mutation_p.Y285*	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	285					2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity			central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		CGAGAGAGCCATACCCTGTAA	0.517			Mis		gliobastoma 								30	73	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	211018808	211018808	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018808G>T	uc002vds.2	-	2	707	c.499C>A	c.(499-501)CAA>AAA	p.Q167K	C2orf67_uc002vdt.2_Missense_Mutation_p.Q167K|C2orf67_uc002vdw.2_Missense_Mutation_p.Q167K|C2orf67_uc002vdy.1_Missense_Mutation_p.Q167K|C2orf67_uc002vdv.2_Missense_Mutation_p.Q167K|C2orf67_uc002vdx.1_Missense_Mutation_p.Q167K	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	167										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TTTTGTAGTTGTACTTTATCT	0.333													51	147	---	---	---	---	PASS
ZBTB49	166793	broad.mit.edu	37	4	4322531	4322531	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4322531C>A	uc003ghu.2	+	8	1961	c.1786C>A	c.(1786-1788)CTG>ATG	p.L596M	uc003ghw.2_5'Flank|ZBTB49_uc003ghv.2_Missense_Mutation_p.L79M|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Missense_Mutation_p.L174M	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509	596					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						CCCAGATGTGCTGGAGGAGCT	0.557													25	46	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113353249	113353249	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113353249C>A	uc003iap.3	+	11	2825	c.2546C>A	c.(2545-2547)TCC>TAC	p.S849Y	ALPK1_uc003ian.3_Missense_Mutation_p.S849Y|ALPK1_uc011cfx.1_Missense_Mutation_p.S771Y|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.S677Y	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	849							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CCTGATGCCTCCACAGTGGAT	0.562													4	78	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5462929	5462929	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5462929T>G	uc003jdm.3	+	13	3704	c.3482T>G	c.(3481-3483)ATA>AGA	p.I1161R		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1161										ovary(1)|central_nervous_system(1)	2						GATTTTAACATAAGTACTTTT	0.428													14	33	---	---	---	---	PASS
ISOC1	51015	broad.mit.edu	37	5	128430566	128430566	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128430566C>A	uc003kva.2	+	1	125	c.107C>A	c.(106-108)GCG>GAG	p.A36E		NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	36						peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		TCAGTCTTCGCGCGACCCTCG	0.557													3	21	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725628	140725628	+	Silent	SNP	C	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725628C>G	uc003ljm.1	+	1	2028	c.2028C>G	c.(2026-2028)GGC>GGG	p.G676G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.G436G|PCDHGA3_uc011dap.1_Silent_p.G676G	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	676	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGACCTGGGCAGCCTCGAGC	0.687													19	131	---	---	---	---	PASS
TREM1	54210	broad.mit.edu	37	6	41243725	41243725	+	3'UTR	SNP	G	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41243725G>C	uc003oqf.1	-	4					TREM1_uc003oqg.1_3'UTR	NM_018643	NP_061113	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1						blood coagulation|humoral immune response|intracellular signal transduction|leukocyte migration	extracellular region|integral to membrane|intracellular|plasma membrane	receptor activity			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)				Glutathione(DB00143)	GTGAGACGCTGACTTTAGAAA	0.483													4	2	---	---	---	---	PASS
B3GAT2	135152	broad.mit.edu	37	6	71665632	71665632	+	Silent	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71665632C>T	uc003pfv.2	-	1	1157	c.501G>A	c.(499-501)CTG>CTA	p.L167L	B3GAT2_uc011dxz.1_RNA|B3GAT2_uc003pfw.2_Silent_p.L167L	NM_080742	NP_542780	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	167	Lumenal (Potential).				carbohydrate biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GCCTCTGGCGCAGCCAGGCGA	0.701													10	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	2552830	2552830	+	IGR	SNP	G	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2552830G>A								CHST12 (78616 upstream) : LFNG (6649 downstream)																							GCTCAGGAAGGCTGTGGGATG	0.368													60	178	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82583288	82583288	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583288C>A	uc003uhx.2	-	5	7270	c.6981G>T	c.(6979-6981)GAG>GAT	p.E2327D	PCLO_uc003uhv.2_Missense_Mutation_p.E2327D|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2258					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTCGTTCGGCCTCCAACTCCT	0.413													133	301	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11703250	11703250	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11703250C>T	uc003wum.2	-	11	1166	c.842G>A	c.(841-843)CGC>CAC	p.R281H	CTSB_uc003wul.2_Missense_Mutation_p.R218H|CTSB_uc011kxl.1_Missense_Mutation_p.R202H|CTSB_uc003wun.2_Missense_Mutation_p.R281H|CTSB_uc003wuo.2_Missense_Mutation_p.R281H|CTSB_uc003wup.2_Missense_Mutation_p.R281H|CTSB_uc003wuq.2_Missense_Mutation_p.R281H|CTSB_uc010lsc.2_Missense_Mutation_p.R157H|CTSB_uc003wur.2_Missense_Mutation_p.R281H|CTSB_uc003wus.1_Missense_Mutation_p.R281H|CTSB_uc003wut.1_Missense_Mutation_p.R281H|CTSB_uc003wuu.2_3'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein	281					proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		GCCCAGGATGCGGATGGCATG	0.612													23	65	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732843	52732843	+	3'UTR	SNP	C	T	T	rs116069210	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732843C>T	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTTTTAACTCCTAACAAA	0.284													3	18	---	---	---	---	PASS
PLAG1	5324	broad.mit.edu	37	8	57080032	57080032	+	Silent	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57080032G>T	uc003xsq.3	-	3	724	c.273C>A	c.(271-273)ACC>ACA	p.T91T	PLAG1_uc003xsr.3_Silent_p.T91T|PLAG1_uc010lyi.2_Silent_p.T91T|PLAG1_uc010lyj.2_Silent_p.T9T	NM_001114635	NP_001108107	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform b	91	Decreased nuclear import with localization in the nucleus but also in the cytoplasm.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TACACTTGTGGGTTTTCTCAG	0.363			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								13	48	---	---	---	---	PASS
CHMP5	51510	broad.mit.edu	37	9	33264197	33264197	+	5'UTR	SNP	A	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33264197A>T	uc003zsl.3	+	1					SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Intron|BAG1_uc003zsj.2_Intron|BAG1_uc003zsk.2_Intron|CHMP5_uc003zsm.3_5'Flank|CHMP5_uc011lnv.1_5'Flank	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5						cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			ACCTGCATGGAGCCCACCTGG	0.657													5	7	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832015	42832015	+	RNA	SNP	A	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832015A>C	uc010qey.1	-	3		c.1960T>G				NR_024380				Homo sapiens noncoding mRNA sequence.												0						TATGTACATTAAGGTCTAAAG	0.343													3	3	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832122C>T	uc010qey.1	-	3		c.1853G>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTAAAAGGCTTTGCCACAT	0.348													6	13	---	---	---	---	PASS
KCNK18	338567	broad.mit.edu	37	10	118969176	118969176	+	Missense_Mutation	SNP	G	A	A	rs139101102		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118969176G>A	uc010qsr.1	+	3	521	c.521G>A	c.(520-522)CGC>CAC	p.R174H		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	174	Cytoplasmic (Potential).					integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		TTCTTTACCCGCCCCCTCCTC	0.507													32	199	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1275577	1275577	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1275577G>T	uc009ycr.1	+	56	16610	c.16484G>T	c.(16483-16485)GGC>GTC	p.G5495V	MUC5B_uc001ltb.2_Missense_Mutation_p.G5161V	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5158	VWFD 4.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AAGGAGGAGGGCCTGGTGAGT	0.682													7	61	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974717	49974717	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974717C>T	uc010rhz.1	+	1	743	c.743C>T	c.(742-744)TCC>TTC	p.S248F		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	248	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						GTCATCTTATCCTTTATACCC	0.433													108	337	---	---	---	---	PASS
MEN1	4221	broad.mit.edu	37	11	64571721	64571721	+	3'UTR	SNP	G	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64571721G>A	uc001obj.2	-	10					MAP4K2_uc001obh.2_5'Flank|MAP4K2_uc001obi.2_5'Flank|MAP4K2_uc010rnp.1_5'Flank|MEN1_uc001obk.2_3'UTR|MEN1_uc001obl.2_3'UTR|MEN1_uc001obm.2_3'UTR|MEN1_uc001obn.2_3'UTR|MEN1_uc001obo.2_3'UTR|MEN1_uc001obp.2_3'UTR|MEN1_uc001obq.2_3'UTR|MEN1_uc001obr.2_3'UTR	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1						DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding			parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						TGTCCCCTTTGGGCTGGGGGC	0.607			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				35	81	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73850649	73850649	+	Splice_Site	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73850649C>T	uc001ouu.2	-	4	934	c.707_splice	c.e4+1	p.R236_splice	C2CD3_uc001ouv.2_Splice_Site_p.R236_splice	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					ATGGTAATTACCTCGGAGTGG	0.408													215	474	---	---	---	---	PASS
LPCAT3	10162	broad.mit.edu	37	12	7087581	7087581	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7087581A>G	uc001qsi.2	-	9	1076	c.962T>C	c.(961-963)GTG>GCG	p.V321A	EMG1_uc010sfv.1_Intron|LPCAT3_uc010sfw.1_Missense_Mutation_p.V215A|LPCAT3_uc009zfp.2_RNA|LPCAT3_uc010sfx.1_RNA|LPCAT3_uc009zfq.1_Missense_Mutation_p.V179A	NM_005768	NP_005759	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	321					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity			ovary(1)	1						AAAGAGCCACACCTTCATGTT	0.547													83	232	---	---	---	---	PASS
CLSTN3	9746	broad.mit.edu	37	12	7288076	7288076	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7288076G>T	uc001qsr.2	+	4	815	c.537G>T	c.(535-537)CAG>CAT	p.Q179H	CLSTN3_uc001qss.2_Missense_Mutation_p.Q191H	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	179	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						AGTACAGCCAGATCTGCTACT	0.582													74	152	---	---	---	---	PASS
CLSTN3	9746	broad.mit.edu	37	12	7288077	7288077	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7288077A>G	uc001qsr.2	+	4	816	c.538A>G	c.(538-540)ATC>GTC	p.I180V	CLSTN3_uc001qss.2_Missense_Mutation_p.I192V	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	180	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						GTACAGCCAGATCTGCTACTA	0.582													73	154	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13769424	13769424	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13769424C>A	uc001rbt.2	-	5	1472	c.1293G>T	c.(1291-1293)AGG>AGT	p.R431S		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	431	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGACTGTGTTCCTCATGCAGG	0.517													51	90	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49960086	49960086	+	Intron	SNP	A	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49960086A>T	uc001ruk.1	-						MCRS1_uc001rui.1_Intron|MCRS1_uc001ruj.1_5'UTR|MCRS1_uc001rul.1_Intron|MCRS1_uc009zlj.1_Intron|MCRS1_uc001rum.1_Intron|MCRS1_uc001run.1_Intron	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1						DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						TTCCCCTGCCAGCCCTCTTGG	0.587													9	17	---	---	---	---	PASS
KCNRG	283518	broad.mit.edu	37	13	50594550	50594550	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50594550A>G	uc001vdu.2	+	2	1019	c.779A>G	c.(778-780)GAG>GGG	p.E260G	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	260						voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CCAAAACCAGAGACTATCATC	0.353													60	132	---	---	---	---	PASS
OR10G2	26534	broad.mit.edu	37	14	22102295	22102295	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102295G>C	uc010tmc.1	-	1	704	c.704C>G	c.(703-705)ACC>AGC	p.T235S		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		CCCATCAGCGGTGCGTATCTT	0.542													24	50	---	---	---	---	PASS
WDR61	80349	broad.mit.edu	37	15	78588078	78588078	+	Intron	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78588078A>G	uc002bdn.2	-						WDR61_uc002bdo.2_5'UTR|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron|WDR61_uc010blc.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						CTGTGGAAACAACACCAGGAT	0.443													42	82	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	79045468	79045468	+	RNA	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79045468A>G	uc002bei.2	+	2		c.145A>G								Homo sapiens similar to TBC1 domain family, member 2B, mRNA (cDNA clone IMAGE:40132505), partial cds.																		GCTGATCAGTATCTCCTTTGG	0.612													3	3	---	---	---	---	PASS
RNF151	146310	broad.mit.edu	37	16	2018623	2018623	+	Silent	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2018623C>A	uc002cnt.1	+	4	443	c.435C>A	c.(433-435)GGC>GGA	p.G145G		NM_174903	NP_777563	Q2KHN1	RN151_HUMAN	ring finger protein 151	145	TRAF-type.				cell differentiation|spermatogenesis	cytoplasm|nucleus	ubiquitin-protein ligase activity|zinc ion binding				0						GCCCCCTGGGCTGCGGGGCCA	0.741													3	10	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2168149	2168149	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2168149C>G	uc002cos.1	-	5	1053	c.844G>C	c.(844-846)GGA>CGA	p.G282R	PKD1_uc002cot.1_Missense_Mutation_p.G282R	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	282	Extracellular (Potential).|PKD 1.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCCAGAGGTCCGTGGGGCCCC	0.726													3	15	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3641179	3641179	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3641179C>A	uc002cvp.2	-	12	3087	c.2460G>T	c.(2458-2460)AGG>AGT	p.R820S		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	820	Potential.|Interaction with PLK1 and TERF2-TERF2IP.|Glu-rich.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						CCCACATTGACCTCAAGAGTT	0.478								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				83	259	---	---	---	---	PASS
SLC7A5P2	387254	broad.mit.edu	37	16	21531133	21531133	+	Missense_Mutation	SNP	C	G	G	rs518428	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21531133C>G	uc002djd.2	-	1	633	c.554G>C	c.(553-555)CGG>CCG	p.R185P	uc002diq.3_Intron|LOC100271836_uc002dja.2_Intron|LOC100271836_uc002djb.2_Intron	NR_002594				RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;												0						ACCCCCGGCCCGCGCCCCGTA	0.657													4	7	---	---	---	---	PASS
ZNF48	197407	broad.mit.edu	37	16	30409890	30409890	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30409890A>G	uc002dya.1	+	2	1378	c.1319A>G	c.(1318-1320)GAG>GGG	p.E440G	ZNF48_uc002dxz.1_Missense_Mutation_p.E317G	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	440	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGGCTGGGGAGCCACCCCCA	0.672													4	28	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89167563	89167563	+	Silent	SNP	G	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89167563G>A	uc002fmp.2	+	3	814	c.474G>A	c.(472-474)CCG>CCA	p.P158P	ACSF3_uc010cig.1_Silent_p.P158P|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_5'Flank	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	158					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TCCTGAGCCCGGTGGTCAGGA	0.637													11	27	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7752241	7752241	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7752241G>T	uc002giw.1	+	11	3011	c.2635G>T	c.(2635-2637)GCC>TCC	p.A879S	KDM6B_uc002gix.2_Missense_Mutation_p.A181S	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	879	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CGGGCCCTGGGCCCGGGAGCG	0.716													5	59	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40049295	40049295	+	Missense_Mutation	SNP	T	G	G	rs144101604		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40049295T>G	uc002hyg.2	-	15	1755	c.1592A>C	c.(1591-1593)TAC>TCC	p.Y531S	ACLY_uc002hyh.2_Missense_Mutation_p.Y521S|ACLY_uc002hyi.2_Missense_Mutation_p.Y585S|ACLY_uc010wfx.1_Missense_Mutation_p.Y575S|ACLY_uc010wfy.1_Missense_Mutation_p.Y260S	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	531					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				CGTGAAAGGGTAGACCATGGC	0.463													30	79	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49098649	49098649	+	Silent	SNP	T	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49098649T>C	uc002itc.2	-	7	1070	c.861A>G	c.(859-861)ACA>ACG	p.T287T	SPAG9_uc002itb.2_Silent_p.T273T|SPAG9_uc002itd.2_Silent_p.T273T|SPAG9_uc002itf.2_Silent_p.T108T|SPAG9_uc002ita.2_Silent_p.T130T|SPAG9_uc002ite.2_Silent_p.T117T	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	287					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CAGTAGGAATTGTTGCCACAT	0.378													144	282	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72201786	72201786	+	Translation_Start_Site	SNP	G	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72201786G>A	uc002llq.2	+	1	95	c.-116G>A	c.(-118--114)ACGTG>ACATG			NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor						proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GGGGGACAACGTGGGTCAGGG	0.512													7	8	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15537959	15537959	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15537959C>A	uc002nbc.2	-	4	1460	c.1437G>T	c.(1435-1437)AAG>AAT	p.K479N	WIZ_uc002nba.3_Missense_Mutation_p.K346N|WIZ_uc002nbb.3_Missense_Mutation_p.K305N	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1162	Pro-rich.					nucleus	zinc ion binding				0						CTGGGAACATCTTTCGGGCCG	0.622													19	104	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44511202	44511202	+	5'UTR	SNP	A	T	T	rs2356549	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44511202A>T	uc002oyb.1	+	2						NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TACTCAAGACACTGAAGACTC	0.428													4	149	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52658790	52658790	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52658790G>C	uc010ydi.1	-	5	2520	c.2146C>G	c.(2146-2148)CCT>GCT	p.P716A	ZNF836_uc010ydj.1_Missense_Mutation_p.P716A	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	716	C2H2-type 18; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCCCAGTAGGATTTCTGTGA	0.398													55	125	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846025	18846025	+	RNA	SNP	G	C	C	rs5993363		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846025G>C	uc002zoe.2	+	5		c.2387G>C			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		GACGTTGAAGGCTGCCTTCAG	0.647													4	100	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846098	18846098	+	RNA	SNP	G	A	A	rs9306211		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846098G>A	uc002zoe.2	+	5		c.2460G>A			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		ATGCCTCGGCGCTCGATCTCC	0.622													7	41	---	---	---	---	PASS
TOB2	10766	broad.mit.edu	37	22	41832382	41832382	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41832382A>G	uc003azz.1	-	2	1675	c.968T>C	c.(967-969)CTC>CCC	p.L323P		NM_016272	NP_057356	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	323					female gamete generation|negative regulation of cell proliferation	cytoplasm|nucleus				ovary(1)	1						GTTGTAGCTGAGGCCTTCCAC	0.602													51	121	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50893343	50893343	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50893343C>T	uc003blh.2	-	35	4907	c.4712G>A	c.(4711-4713)AGG>AAG	p.R1571K	SBF1_uc003ble.2_Missense_Mutation_p.R47K|SBF1_uc003blf.2_Missense_Mutation_p.R47K|SBF1_uc011arx.1_Missense_Mutation_p.R1209K	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1545	Myotubularin phosphatase.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CACCTGGCCCCTGCGTTCCCC	0.637													36	76	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54491893	54491893	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54491893C>T	uc004dtg.2	-	8	2361	c.1627G>A	c.(1627-1629)GAT>AAT	p.D543N	FGD1_uc011moi.1_Missense_Mutation_p.D301N	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	543	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CTTTGGGCATCCTTGCTGTCC	0.562													4	44	---	---	---	---	PASS
ZXDB	158586	broad.mit.edu	37	X	57619421	57619421	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57619421A>G	uc004dvd.2	+	1	1153	c.940A>G	c.(940-942)ACC>GCC	p.T314A		NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	314	Required for interaction with ZXDC (By similarity).|C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						CTGCGGCTGGACCTTCACCAC	0.627													6	13	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	153008982	153008982	+	Silent	SNP	C	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153008982C>T	uc004fif.2	+	10	2430	c.2031C>T	c.(2029-2031)GGC>GGT	p.G677G	ABCD1_uc004fig.2_Silent_p.G177G|ABCD1_uc004fih.2_RNA	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	677	ABC transporter.				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGGGGAGGGCGGCTGGAAGT	0.647													4	5	---	---	---	---	PASS
TMEM48	55706	broad.mit.edu	37	1	54243933	54243934	+	Intron	INS	-	AC	AC	rs74780750	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54243933_54243934insAC	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						tgtgtgtatatacacacacaca	0.000													4	2	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113666345	113666346	+	Intron	INS	-	TTTTTT	TTTTTT	rs139220276	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666345_113666346insTTTTTT	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCTGGTGGTGGTTTTtgtgtgt	0.287													4	3	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239567589	239567589	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239567589delA	uc001hyo.1	+									P20309	ACM3_HUMAN	Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	actctgtctcaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58479807	58479808	+	IGR	INS	-	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479807_58479808insA								FANCL (11292 upstream) : None (None downstream)																							TTTTGtaaattaaaaaaaaaaa	0.233													4	2	---	---	---	---	
SMYD5	10322	broad.mit.edu	37	2	73448561	73448561	+	Intron	DEL	T	-	-	rs112717194		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73448561delT	uc002siw.2	+						SMYD5_uc010yre.1_Intron|SMYD5_uc002six.1_5'Flank	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5								metal ion binding				0						GCCTGTAGTCTTTTTTTTTTT	0.403													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132653321	132653322	+	IGR	DEL	TG	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132653321_132653322delTG								C2orf27B (94087 upstream) : NCRNA00164 (251842 downstream)																							TCTCTCTCTCtgtgtgtgtgtg	0.252													4	2	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169712115	169712116	+	Intron	INS	-	A	A	rs74552507		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169712115_169712116insA	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						GTTGTGTGAACaaaaaaaaaaa	0.248													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176464345	176464346	+	IGR	DEL	TG	-	-	rs72082315		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176464345_176464346delTG								ATP5G3 (417855 upstream) : KIAA1715 (326064 downstream)																							GAATTCACATtgtgtgtgtgtg	0.257													4	2	---	---	---	---	
CMTM7	112616	broad.mit.edu	37	3	32490824	32490824	+	Intron	DEL	G	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32490824delG	uc003cey.1	+						CMTM7_uc003cez.1_Intron	NM_138410	NP_612419	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0						TTTGCGTGTTGCAAGGGAGAA	0.567													19	15	---	---	---	---	
SACM1L	22908	broad.mit.edu	37	3	45748586	45748587	+	Intron	INS	-	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45748586_45748587insT	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735	Q9NTJ5	SAC1_HUMAN	suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TGTTGCTCTTGTTTTTTTTTTT	0.282													4	3	---	---	---	---	
GPR128	84873	broad.mit.edu	37	3	100330144	100330147	+	Intron	DEL	CTTT	-	-	rs10583593		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330144_100330147delCTTT	uc003duc.2	+							NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						tccttccttcctttcttctttcct	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126981714	126981715	+	IGR	INS	-	TGTG	TGTG	rs142070061	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126981714_126981715insTGTG								PLXNA1 (225486 upstream) : TPRA1 (310193 downstream)																							AACTGTTTGCAtgtgtgtgtgt	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156978684	156978688	+	IGR	DEL	TTTTA	-	-	rs71740874		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156978684_156978688delTTTTA								CCNL1 (100202 upstream) : VEPH1 (10 downstream)																							CTGTAGCTCCTTTTATTTTATTTTA	0.361													3	3	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188773821	188773840	+	Intron	DEL	CCTTCCTTCCTTCCTTCCTT	-	-	rs9878552	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188773821_188773840delCCTTCCTTCCTTCCTTCCTT	uc003frv.1	+							NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		tccctccctcccttccttccttccttccttccttccttcc	0.000													3	3	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196288493	196288494	+	Intron	INS	-	A	A	rs140815446		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196288493_196288494insA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		ctcaattaattaaaaaaaaaaa	0.297													7	4	---	---	---	---	
BANK1	55024	broad.mit.edu	37	4	102681038	102681041	+	Intron	DEL	TGCA	-	-	rs61508076	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102681038_102681041delTGCA	uc003hvx.3	+							NM_001083907	NP_001077376	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		tgtgtgtgtgtgCACACGCACATG	0.397													4	2	---	---	---	---	
ELF2	1998	broad.mit.edu	37	4	139983329	139983329	+	Intron	DEL	T	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139983329delT	uc003ihp.1	-						ELF2_uc003ihm.1_Intron|ELF2_uc003ihn.1_Intron|ELF2_uc003iho.1_Intron|ELF2_uc011chc.1_5'UTR	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					TTGTTTCTACttttttttttt	0.109													6	3	---	---	---	---	
SPOCK3	50859	broad.mit.edu	37	4	167663376	167663379	+	Intron	DEL	TCTA	-	-	rs141328456		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167663376_167663379delTCTA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CATACATGTGtctatctatcatct	0.211													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29785801	29785808	+	IGR	DEL	CACACACA	-	-	rs111352687		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29785801_29785808delCACACACA								None (None upstream) : None (None downstream)																							GTCATTcacgcacacacacacacacaca	0.202													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35087524	35087525	+	Intron	INS	-	TG	TG			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35087524_35087525insTG	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TCTCTTTCCTTtgtgtgtgtgt	0.371													4	2	---	---	---	---	
HOMER1	9456	broad.mit.edu	37	5	78697991	78697992	+	Intron	INS	-	T	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78697991_78697992insT	uc003kfy.2	-						HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		Gttttcttttcttttttttttt	0.158													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	120331009	120331010	+	IGR	DEL	AC	-	-	rs144596254		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120331009_120331010delAC								PRR16 (308047 upstream) : FTMT (856640 downstream)																							ctaataggatacacacacacac	0.109													4	3	---	---	---	---	
ZNF608	57507	broad.mit.edu	37	5	124080873	124080873	+	5'Flank	DEL	G	-	-	rs67159920		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124080873delG	uc003ktq.1	-						ZNF608_uc003ktr.1_5'Flank|ZNF608_uc003kts.1_Intron|ZNF608_uc003ktt.1_Intron	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608							intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTCCTGTGAAGGGGGGGGGAA	0.433													2	4	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140808737	140808738	+	Intron	DEL	AC	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140808737_140808738delAC	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_5'Flank|PCDHGA12_uc003lkt.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTGTTTATacacacacacac	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173791107	173791109	+	IGR	DEL	TGA	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173791107_173791109delTGA								HMP19 (254926 upstream) : MSX2 (360466 downstream)																							gtggtgatggtgatgatgatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174357094	174357097	+	IGR	DEL	CTTT	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174357094_174357097delCTTT								MSX2 (199193 upstream) : DRD1 (510579 downstream)																							tcttttcttcctttctttcttttc	0.098													4	2	---	---	---	---	
MUT	4594	broad.mit.edu	37	6	49399240	49399240	+	3'UTR	DEL	T	-	-	rs71809455		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49399240delT	uc003ozg.3	-	13						NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor						fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTTTAGGGATTTTTTTTTTA	0.279													6	3	---	---	---	---	
LAMA2	3908	broad.mit.edu	37	6	129706456	129706459	+	Intron	DEL	GGAA	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129706456_129706459delGGAA	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		agaagaaaagggaaggaaggaagg	0.088													4	4	---	---	---	---	
DAGLB	221955	broad.mit.edu	37	7	6469934	6469935	+	Intron	DEL	GA	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6469934_6469935delGA	uc003sqa.2	-						DAGLB_uc011jwt.1_Intron|DAGLB_uc011jwu.1_Intron|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GGGAGGGAGGGAGAGAGagaga	0.134													3	4	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14524926	14524929	+	Intron	DEL	GTGT	-	-	rs146657658		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14524926_14524929delGTGT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	TGCTCATGAGgtgtgtgtgtgtgt	0.343													4	2	---	---	---	---	
CCT6A	908	broad.mit.edu	37	7	56127550	56127551	+	Intron	INS	-	T	T	rs35171408		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56127550_56127551insT	uc003trl.1	+						PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Intron|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform						'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			tgactggctaattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67030598	67030599	+	IGR	INS	-	A	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67030598_67030599insA								STAG3L4 (244086 upstream) : None (None downstream)																							TGGAGGCAGTGAAGTTCTGAGT	0.351													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67941856	67941857	+	IGR	INS	-	TG	TG	rs148545949	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67941856_67941857insTG								None (None upstream) : None (None downstream)																							AAGAGAATACAtgtgtgtgtgt	0.129													6	3	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17871605	17871605	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17871605delA	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		CTTTAAAGCTAAAAAAAAAAA	0.284			T	RET|JAK2	papillary thyroid|CML|MPD								8	6	---	---	---	---	
UBE2W	55284	broad.mit.edu	37	8	74737352	74737352	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74737352delA	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			CTAAAAATACAAAAAAAAAAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134727338	134727379	+	IGR	DEL	TCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC	-	-	rs71293266	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727338_134727379delTCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC								ST3GAL1 (143155 upstream) : ZFAT (762654 downstream)																							cttccttccttccttcctccctcccttccttcctcccttccttccttccttctttcttccct	0.033													4	4	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32457558	32457558	+	Intron	DEL	A	-	-	rs7865082	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32457558delA	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		CAATTGGAGGAAAAAAAAAAA	0.413													4	2	---	---	---	---	
UNC13B	10497	broad.mit.edu	37	9	35309220	35309223	+	Intron	DEL	GTGT	-	-	rs71977035		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35309220_35309223delGTGT	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GTCAGGGTCAgtgtgtgtgtgtgt	0.333													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79828414	79828414	+	Intron	DEL	T	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79828414delT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CCCCCATATCttttttttttt	0.174													3	3	---	---	---	---	
GKAP1	80318	broad.mit.edu	37	9	86367994	86367995	+	Intron	INS	-	T	T	rs149480448	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86367994_86367995insT	uc004amy.2	-						GKAP1_uc004amz.2_Intron	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a						signal transduction	Golgi apparatus					0						caacaacaacaacataaataaa	0.104													4	2	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286583	92286584	+	Intron	INS	-	TGG	TGG	rs147664656	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286583_92286584insTGG	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						gatggtggtgatggtggtggtg	0.000													4	2	---	---	---	---	
ZDHHC13	54503	broad.mit.edu	37	11	19197720	19197720	+	3'UTR	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19197720delA	uc001mpi.2	+	17					ZDHHC13_uc001mpj.2_3'UTR	NM_019028	NP_061901	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC domain containing 13 isoform						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|palmitoyltransferase activity|signal transducer activity|zinc ion binding				0						GCAGACATCTAAAAAAAAAAC	0.259													4	2	---	---	---	---	
UBE2L6	9246	broad.mit.edu	37	11	57328097	57328097	+	Intron	DEL	T	-	-	rs67576121		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57328097delT	uc001nkn.1	-						UBE2L6_uc001nko.1_Intron	NM_004223	NP_004214	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6 isoform 1						negative regulation of type I interferon production	cytosol	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ttcttttttcttttttttttt	0.095													2	4	---	---	---	---	
CLEC2A	387836	broad.mit.edu	37	12	10086823	10086824	+	5'Flank	INS	-	GTGT	GTGT	rs148140886	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10086823_10086824insGTGT	uc009zhc.2	-						CLEC2A_uc009zhb.2_5'Flank	NM_001130711	NP_001124183	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A						natural killer cell mediated cytotoxicity	integral to membrane|plasma membrane	protein homodimerization activity|receptor activity|sugar binding				0						CAATTTGATCAgtgtgtgtgtg	0.297													4	2	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32491512	32491512	+	Intron	DEL	A	-	-	rs3830311		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32491512delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TAACTGTAATAAATCTTTTTT	0.274													4	2	---	---	---	---	
NELL2	4753	broad.mit.edu	37	12	45235922	45235923	+	Intron	DEL	AG	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45235922_45235923delAG	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		aaggaaggaaagggaaagaagg	0.020													4	2	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114366222	114366223	+	Intron	INS	-	AC	AC	rs71443065		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114366222_114366223insAC	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TACATGTGcatacacacacaca	0.233													3	3	---	---	---	---	
SLITRK1	114798	broad.mit.edu	37	13	84455887	84455887	+	5'UTR	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84455887delA	uc001vlk.2	-	1						NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor							integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GCAAGCaaagaaaaaaaaaaa	0.343													4	2	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	108028294	108028295	+	Intron	DEL	AC	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108028294_108028295delAC	uc001vql.2	-							NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						acacacacatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	25817327	25817328	+	IGR	DEL	GT	-	-	rs71451411		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25817327_25817328delGT								STXBP6 (298156 upstream) : None (None downstream)																							gtcactttgcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36703489	36703492	+	IGR	DEL	GTGT	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36703489_36703492delGTGT								BRMS1L (362321 upstream) : MBIP (64272 downstream)																							TCTTCGACGAgtgtgtgtgtgtgt	0.260													3	3	---	---	---	---	
BMP4	652	broad.mit.edu	37	14	54416602	54416603	+	3'UTR	DEL	TT	-	-	rs76335800		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54416602_54416603delTT	uc001xal.3	-	3					BMP4_uc010aoh.2_3'UTR|BMP4_uc001xao.3_3'UTR|BMP4_uc001xan.3_3'UTR	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein						activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						GAttttttcctttttttttttt	0.257													6	3	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64427327	64427327	+	Intron	DEL	T	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64427327delT	uc001xgm.2	+						SYNE2_uc001xgk.2_Intron|SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGTGAAGTGTTTTTTTTTTT	0.204													6	3	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64651047	64651048	+	Intron	INS	-	GT	GT	rs146438176		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64651047_64651048insGT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TATGCATAGGGgtgtgtgtgtg	0.421													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79694131	79694138	+	Intron	DEL	TCCTCCCT	-	-	rs61995409		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79694131_79694138delTCCTCCCT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		cttccttccctcctcccttcctcccttc	0.048													5	3	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81952993	81952993	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81952993delA	uc010tvv.1	-							NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACAGGTTTATAAAAAAAAAAA	0.199													4	2	---	---	---	---	
DUOX2	50506	broad.mit.edu	37	15	45390104	45390105	+	Intron	INS	-	G	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45390104_45390105insG	uc010bea.2	-						DUOX2_uc001zun.2_Intron	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCTGAAGGCTAGAAACAGACCC	0.545													36	18	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45447768	45447769	+	Intron	DEL	AA	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45447768_45447769delAA	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		actccatctcaaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ATP8B4	79895	broad.mit.edu	37	15	50366116	50366117	+	Intron	INS	-	A	A	rs144222358	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50366116_50366117insA	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCCATGACAATAAGCATACCAA	0.332													2	5	---	---	---	---	
SCG3	29106	broad.mit.edu	37	15	51980761	51980763	+	Intron	DEL	AGG	-	-	rs138925498		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51980761_51980763delAGG	uc002abh.2	+						SCG3_uc010ufz.1_Intron	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor						platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		ttttttttctaggagtttatcat	0.054													8	4	---	---	---	---	
BBS4	585	broad.mit.edu	37	15	73014944	73014946	+	Intron	DEL	TTT	-	-	rs5813691		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73014944_73014946delTTT	uc002avb.2	+						BBS4_uc010ukv.1_Intron|BBS4_uc002avc.2_Intron|BBS4_uc002avd.2_Intron|BBS4_uc010bja.2_5'Flank	NM_033028	NP_149017	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4						adult behavior|brain morphogenesis|cell cycle cytokinesis|centrosome organization|cerebral cortex development|convergent extension involved in gastrulation|dendrite development|fat cell differentiation|heart looping|hippocampus development|intracellular transport|maintenance of protein location in nucleus|melanosome transport|microtubule anchoring at centrosome|neural tube closure|nonmotile primary cilium assembly|photoreceptor cell maintenance|pigment granule aggregation in cell center|positive regulation of flagellum assembly|regulation of cilium beat frequency involved in ciliary motility|regulation of cytokinesis|regulation of lipid metabolic process|retina homeostasis|retinal rod cell development|sensory perception of smell|sensory processing|spermatid development|striatum development	BBSome|centriolar satellite|centriole|cilium membrane|microtubule basal body|motile cilium|nonmotile primary cilium|nucleus|pericentriolar material	alpha-tubulin binding|beta-tubulin binding|dynactin binding|microtubule motor activity				0						ATAATCTGTATTTTTTTATGTTG	0.350									Bardet-Biedl_syndrome		OREG0023258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	81387422	81387423	+	IGR	INS	-	CACACA	CACACA	rs72048399		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81387422_81387423insCACACA								MESDC1 (91078 upstream) : C15orf26 (4326 downstream)																							GTTTTGTTTTTcacacacacac	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90298248	90298249	+	IGR	INS	-	AC	AC	rs139944710	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90298248_90298249insAC								MESP1 (3708 upstream) : MESP2 (5573 downstream)																							CTCTGTTTTCTacacacacaca	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102293062	102293064	+	Intron	DEL	CTC	-	-	rs62026972		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102293062_102293064delCTC	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_RNA|uc002bxq.2_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank|uc002bys.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		AGTTCATCTTCTCAGAGCTGCTG	0.576													2	4	---	---	---	---	
RPL3L	6123	broad.mit.edu	37	16	1995362	1995362	+	Intron	DEL	T	-	-	rs2531333		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1995362delT	uc002cnh.2	-						SEPX1_uc010uvs.1_5'Flank	NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						tctcaaaaaataaaataaata	0.254													4	2	---	---	---	---	
ATP2A1	487	broad.mit.edu	37	16	28898314	28898314	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28898314delA	uc002dro.1	+						uc010vct.1_Intron|ATP2A1_uc002drn.1_Intron|ATP2A1_uc002drp.1_Intron|ATP2A1_uc010bym.1_5'Flank	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform						apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						actctgtctcaaaaaaaaaaa	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31176570	31176571	+	IGR	DEL	TG	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31176570_31176571delTG								PRSS36 (15155 upstream) : FUS (14882 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.302													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33942128	33942129	+	IGR	INS	-	T	T	rs76660512	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33942128_33942129insT								None (None upstream) : MIR1826 (23379 downstream)																							TGGAAAAAATACCACTTGTTAC	0.267													9	4	---	---	---	---	
KARS	3735	broad.mit.edu	37	16	75664526	75664528	+	Intron	DEL	TTA	-	-	rs71839384		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75664526_75664528delTTA	uc002feq.2	-						KARS_uc002fer.2_Intron|KARS_uc002fes.2_Intron	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2						interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	ttttatttatttattattattat	0.202													6	3	---	---	---	---	
RPA1	6117	broad.mit.edu	37	17	1748462	1748463	+	Intron	INS	-	TC	TC	rs145293126	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1748462_1748463insTC	uc002fto.2	+							NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0						TGCTTtgtgtgtgtgtgtgtgt	0.163								NER					3	3	---	---	---	---	
LASP1	3927	broad.mit.edu	37	17	37070931	37070934	+	Intron	DEL	ACAC	-	-	rs68023823		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37070931_37070934delACAC	uc002hra.2	+						LASP1_uc010cvq.2_Intron|LASP1_uc010wdz.1_Intron	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1							cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						CGAGAGacagacacacacacacac	0.426			T	MLL	AML								4	3	---	---	---	---	
ATP6V0A1	535	broad.mit.edu	37	17	40634914	40634914	+	Intron	DEL	A	-	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40634914delA	uc002hzr.2	+						ATP6V0A1_uc002hzq.2_Intron|ATP6V0A1_uc002hzs.2_Intron|ATP6V0A1_uc010wgj.1_Intron|ATP6V0A1_uc010wgk.1_Intron|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Intron	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		actctgtctcaaaaaaaaaaa	0.144													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													3	4	---	---	---	---	
TUBB6	84617	broad.mit.edu	37	18	12307078	12307079	+	5'Flank	INS	-	A	A	rs145762430		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12307078_12307079insA	uc002kqw.2	+						TUBB6_uc002kqv.2_5'Flank|TUBB6_uc010dld.2_5'Flank|TUBB6_uc002kqx.2_5'Flank|TUBB6_uc002kqy.2_5'Flank	NM_032525	NP_115914	Q9BUF5	TBB6_HUMAN	tubulin, beta 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0				READ - Rectum adenocarcinoma(1;0.0649)		ACCCAAGGGTTAAAAAAAAAAA	0.490													4	2	---	---	---	---	
MUM1	84939	broad.mit.edu	37	19	1376306	1376310	+	Intron	DEL	GTTTG	-	-	rs7508308		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1376306_1376310delGTTTG	uc010xgm.1	+						MUM1_uc002lrz.2_Intron|MUM1_uc002lsb.2_Intron|MUM1_uc002lsd.2_Intron			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;						chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttttttttttgtttgtttttttttt	0.000													5	3	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4668861	4668862	+	Intron	INS	-	T	T	rs11407336		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668861_4668862insT	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		cacccgactaattttttttttt	0.000													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54396035	54396036	+	Intron	DEL	CG	-	-	rs41275812	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54396035_54396036delCG	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		cacacacacacgcacacacacg	0.213													3	3	---	---	---	---	
KIR2DL3	3804	broad.mit.edu	37	19	55271765	55271766	+	Intron	DEL	GA	-	-	rs112795662		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55271765_55271766delGA	uc010erw.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		GGTGGAGGGTgagagagagaga	0.446													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49595936	49595937	+	IGR	INS	-	ACAG	ACAG	rs75386135	by1000genomes	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49595936_49595937insACAG								MOCS3 (18116 upstream) : KCNG1 (24257 downstream)																							cacacacacacacacacacaca	0.000													2	4	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16256780	16256781	+	Intron	INS	-	CC	CC			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16256780_16256781insCC	uc010gqp.2	-						uc002zlf.1_5'Flank|POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						AATGAAAGAATCCCCATAGTGG	0.282													15	7	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31985775	31985776	+	Intron	DEL	TA	-	-	rs59686262		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31985775_31985776delTA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TTTATTTATTTATTTTTTTTGT	0.307													3	3	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122772601	122772602	+	Intron	INS	-	CA	CA	rs35302875		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772601_122772602insCA	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						acacacacacactctctctctc	0.178													6	3	---	---	---	---	
