Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TPRG1L	127262	broad.mit.edu	37	1	3545080	3545080	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3545080C>T	uc001akm.2	+	5	813	c.732C>T	c.(730-732)CTC>CTT	p.L244L	TPRG1L_uc009vlj.2_Silent_p.L185L	NM_182752	NP_877429	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	244						cell junction|synaptic vesicle					0	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		GCCCCCTGCTCATCGAGACCT	0.532													52	110	---	---	---	---	PASS
RNF207	388591	broad.mit.edu	37	1	6272877	6272877	+	Intron	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6272877C>T	uc001amg.2	+						RNF207_uc010nzp.1_RNA	NM_207396	NP_997279	Q6ZRF8	RN207_HUMAN	ring finger protein 207							intracellular	zinc ion binding				0	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GAGTCGGCCACTAACCAGATG	0.532													5	294	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35580687	35580687	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35580687T>A	uc001bym.2	+	11	3404	c.3256T>A	c.(3256-3258)TCA>ACA	p.S1086T	ZMYM1_uc001byn.2_Missense_Mutation_p.S1086T|ZMYM1_uc010ohu.1_Missense_Mutation_p.S1067T|ZMYM1_uc001byo.2_Missense_Mutation_p.S726T|ZMYM1_uc009vut.2_Missense_Mutation_p.S1011T	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	1086						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACTGAGAACTCATTTTCTAC	0.403													79	191	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35580688	35580688	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35580688C>T	uc001bym.2	+	11	3405	c.3257C>T	c.(3256-3258)TCA>TTA	p.S1086L	ZMYM1_uc001byn.2_Missense_Mutation_p.S1086L|ZMYM1_uc010ohu.1_Missense_Mutation_p.S1067L|ZMYM1_uc001byo.2_Missense_Mutation_p.S726L|ZMYM1_uc009vut.2_Missense_Mutation_p.S1011L	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	1086						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACTGAGAACTCATTTTCTACC	0.403													78	187	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39913180	39913180	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39913180T>C	uc010oiu.1	+	46	15142	c.15011T>C	c.(15010-15012)CTA>CCA	p.L5004P	MACF1_uc010ois.1_Missense_Mutation_p.L4502P	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGGCTCACTCTAGCAGAGCAG	0.413													5	224	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	56197585	56197585	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56197585C>T	uc001cyi.1	+	3	973	c.540C>T	c.(538-540)ACC>ACT	p.T180T						SubName: Full=cDNA FLJ45337 fis, clone BRHIP3007960;																		atcaagtgacctctaaggctg	0.000													4	226	---	---	---	---	PASS
LPAR3	23566	broad.mit.edu	37	1	85279513	85279513	+	3'UTR	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85279513G>A	uc001dkl.2	-	2					LPAR3_uc009wcj.1_3'UTR	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						TGGGTGGGCCGAGAGGCATCC	0.473													4	98	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114500893	114500893	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114500893T>C	uc001eem.2	+	8	2122	c.1961T>C	c.(1960-1962)GTA>GCA	p.V654A	HIPK1_uc001eel.2_Missense_Mutation_p.V654A|HIPK1_uc001een.2_Missense_Mutation_p.V654A|HIPK1_uc001eeo.2_Missense_Mutation_p.V280A|HIPK1_uc001eep.2_Missense_Mutation_p.V260A	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	654					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATTTATAGTATGTCCACCT	0.468													5	323	---	---	---	---	PASS
WARS2	10352	broad.mit.edu	37	1	119588254	119588254	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119588254A>G	uc001ehn.2	-	3	408	c.380T>C	c.(379-381)CTT>CCT	p.L127P	WARS2_uc010oxf.1_Missense_Mutation_p.L33P|WARS2_uc001ehm.2_Missense_Mutation_p.L127P|WARS2_uc010oxg.1_Missense_Mutation_p.L70P|WARS2_uc010oxh.1_Missense_Mutation_p.L127P|WARS2_uc010oxi.1_Missense_Mutation_p.L33P	NM_015836	NP_056651	Q9UGM6	SYWM_HUMAN	mitochondrial tryptophanyl tRNA synthetase 2	127					tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity				0	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	CATGCAGGAAAGGATCCAACT	0.353													7	355	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813815A>G	uc009wig.1	+	10	1138	c.1062A>G	c.(1060-1062)GCA>GCG	p.A354A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.A354A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.A285A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.A285A|NBPF9_uc010oyg.1_Silent_p.A319A|NBPF9_uc009wii.1_Silent_p.A83A|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.A14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	354	Potential.					cytoplasm					0						AGAAGCTTGCAGAGCAGCTGA	0.532													5	75	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	146398425	146398425	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146398425C>A	uc001emp.3	+	13	2422	c.1224C>A	c.(1222-1224)GAC>GAA	p.D408E	uc010ozk.1_5'UTR	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672	137											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGAGCCGGACAAGTCCCAGG	0.587													5	38	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156843581	156843581	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156843581C>A	uc001fqh.1	+	8	1063	c.1007C>A	c.(1006-1008)GCA>GAA	p.A336E	NTRK1_uc001fqf.1_Missense_Mutation_p.A306E|NTRK1_uc009wsi.1_Missense_Mutation_p.A41E|NTRK1_uc001fqi.1_Missense_Mutation_p.A336E|NTRK1_uc009wsk.1_Missense_Mutation_p.A336E	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	336	Ig-like C2-type 2.|Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CTGGAGCCGGCAGCCAATGAG	0.622			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			4	30	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207787831	207787831	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207787831G>T	uc001hfy.2	+	32	5448	c.5308G>T	c.(5308-5310)GAA>TAA	p.E1770*	CR1_uc001hfx.2_Nonsense_Mutation_p.E2220*	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1770	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TCCAGTGTGTGAACGTGAGTA	0.408													13	627	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247031057	247031057	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247031057A>G	uc001ibu.1	-	24	3152	c.3145T>C	c.(3145-3147)TTG>CTG	p.L1049L	AHCTF1_uc001ibv.1_Silent_p.L1058L|AHCTF1_uc009xgs.1_5'UTR|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1049					cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GATCTTGTCAACACAGTTCCT	0.368													7	524	---	---	---	---	PASS
DTNB	1838	broad.mit.edu	37	2	25642241	25642241	+	Intron	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25642241C>A	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_3'UTR|DTNB_uc002rgp.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTACAACACCATGGGGAGAA	0.443													30	65	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26750703	26750703	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26750703T>C	uc002rhk.2	-	3	351	c.224A>G	c.(223-225)AAC>AGC	p.N75S		NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	75	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTTACTTGTTGCTGAAGAC	0.567													5	151	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32891760	32891760	+	Silent	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32891760T>C	uc002rom.2	+	7	1095	c.864T>C	c.(862-864)GAT>GAC	p.D288D	TTC27_uc010ymx.1_Silent_p.D238D	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	288							protein binding			central_nervous_system(1)	1						TGATTCTAGATGTAAGAAGGG	0.383													7	528	---	---	---	---	PASS
ACTR2	10097	broad.mit.edu	37	2	65492266	65492266	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65492266T>C	uc002sdq.2	+	8	1186	c.971T>C	c.(970-972)CTT>CCT	p.L324P	ACTR2_uc010yqf.1_Missense_Mutation_p.L269P|ACTR2_uc002sdp.2_Missense_Mutation_p.L329P|ACTR2_uc010yqg.1_Missense_Mutation_p.L272P	NM_005722	NP_005713	P61160	ARP2_HUMAN	actin-related protein 2 isoform b	324					cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding				0						CTTAAACAGCTTTACTTAGAA	0.368													7	430	---	---	---	---	PASS
MRPS5	64969	broad.mit.edu	37	2	95773989	95773989	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95773989C>A	uc002sub.2	-	5	786	c.568G>T	c.(568-570)GAG>TAG	p.E190*	MRPS5_uc002suc.2_RNA|MRPS5_uc010yud.1_Nonsense_Mutation_p.E190*	NM_031902	NP_114108	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	190					translation	mitochondrion|ribosome	protein binding|RNA binding|structural constituent of ribosome			ovary(2)|central_nervous_system(1)	3						CATCCTCGCTCCCGTTTAACC	0.532													143	300	---	---	---	---	PASS
MALL	7851	broad.mit.edu	37	2	110849254	110849254	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110849254A>G	uc002tfk.2	-	2	973	c.199T>C	c.(199-201)TTT>CTT	p.F67L	MALL_uc010fju.2_Intron	NM_005434	NP_005425	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	67	MARVEL.|Helical; (Potential).				cholesterol homeostasis	clathrin-coated vesicle|Golgi membrane|integral to membrane|membrane raft|plasma membrane	protein binding			ovary(1)|skin(1)	2				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		GAGATGAGAAACGAGGTGAGC	0.468													7	381	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112754993	112754993	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112754993T>G	uc002thk.1	+	10	1666	c.1544T>G	c.(1543-1545)ATT>AGT	p.I515S	MERTK_uc002thl.1_Missense_Mutation_p.I339S	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	515	Helical; (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TTTATTTTGATTGGGTTGATT	0.458													14	560	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520998	131520998	+	Silent	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520998G>A	uc002trw.2	+	2	1543	c.1353G>A	c.(1351-1353)CCG>CCA	p.P451P	FAM123C_uc010fmv.2_Silent_p.P451P|FAM123C_uc010fms.1_Silent_p.P451P|FAM123C_uc010fmt.1_Silent_p.P451P|FAM123C_uc010fmu.1_Silent_p.P451P	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	451										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		TGTCAGGGCCGGCCCTGGGGA	0.662													3	10	---	---	---	---	PASS
CCNT2	905	broad.mit.edu	37	2	135700192	135700192	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135700192C>T	uc002tuc.1	+	5	473	c.441C>T	c.(439-441)ATC>ATT	p.I147I	CCNT2_uc002tub.1_Silent_p.I147I|CCNT2_uc010zbf.1_5'UTR|CCNT2_uc002tud.1_5'UTR	NM_058241	NP_490595	O60583	CCNT2_HUMAN	cyclin T2 isoform b	147					cell cycle|cell division|interspecies interaction between organisms|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein kinase binding			ovary(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.107)		GTTTTGAGATCACCATTGAAC	0.333													8	435	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152354182	152354182	+	Intron	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152354182G>T	uc010fnx.2	-						NEB_uc002txr.2_Intron|RIF1_uc002txp.2_Intron|NEB_uc010zbz.1_Silent_p.P30P|NEB_uc002txq.2_Silent_p.P109P|NEB_uc010zca.1_Intron|NEB_uc010zcb.1_Intron|NEB_uc002txt.3_3'UTR	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTCCATCTCGGGAGTGACAG	0.353													8	732	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153515490	153515490	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153515490T>C	uc002tyh.3	-	24	2562	c.2540A>G	c.(2539-2541)AAG>AGG	p.K847R	PRPF40A_uc002tyg.3_Missense_Mutation_p.K303R|PRPF40A_uc010zcd.1_Missense_Mutation_p.K798R	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	874					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						CTTACTTTTCTTCTTATGCTT	0.328													7	432	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183623959	183623959	+	Silent	SNP	T	C	C	rs140227116		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183623959T>C	uc002uow.1	+	21	2485	c.2070T>C	c.(2068-2070)CAT>CAC	p.H690H	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Silent_p.H644H|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	690	Thioredoxin 4.				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GGAAAAATCATTGGGTGATTG	0.383													327	433	---	---	---	---	PASS
GAL3ST2	64090	broad.mit.edu	37	2	242741353	242741353	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242741353G>T	uc002wcj.1	+	3	408	c.277G>T	c.(277-279)GGC>TGC	p.G93C		NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	93	Lumenal (Potential).				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CGTCCACCTGGGCTACCCCTG	0.652													9	17	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191501	10191501	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191501T>A	uc003bvc.2	+	3	707	c.494T>A	c.(493-495)GTT>GAT	p.V165D	VHL_uc003bvd.2_Missense_Mutation_p.V124D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	165	Interaction with Elongin BC complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V165I(1)|p.V165D(1)|p.V165_V166insV(1)|p.V166fs*5(1)|p.V165fs*5(1)|p.V166fs*8(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGCCTCCAGGTTGTCCGGAGC	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				79	93	---	---	---	---	PASS
TBC1D5	9779	broad.mit.edu	37	3	17255705	17255705	+	Silent	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17255705T>C	uc003cbf.2	-	18	3411	c.1746A>G	c.(1744-1746)AAA>AAG	p.K582K	TBC1D5_uc010heu.2_Silent_p.K169K|TBC1D5_uc010hev.2_Silent_p.K604K|TBC1D5_uc003cbe.2_Silent_p.K582K|TBC1D5_uc010hew.1_Silent_p.K556K	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b	582						intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						TTACAGATTCTTTTCTGCCCA	0.383													6	269	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97868326	97868326	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97868326G>T	uc003dsg.1	+	1	97	c.97G>T	c.(97-99)GTA>TTA	p.V33L		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GGCATTCTTGGTAATATATCT	0.413													7	392	---	---	---	---	PASS
ITGB5	3693	broad.mit.edu	37	3	124567183	124567183	+	Missense_Mutation	SNP	G	T	T	rs137996041	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124567183G>T	uc003eho.2	-	4	881	c.584C>A	c.(583-585)CCG>CAG	p.P195Q		NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor	195	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		CTGGTACCTCGGTGCCGTGTA	0.498													5	214	---	---	---	---	PASS
TFDP2	7029	broad.mit.edu	37	3	141697436	141697436	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141697436T>C	uc003eun.3	-	7	824	c.445A>G	c.(445-447)ACA>GCA	p.T149A	TFDP2_uc003euk.3_Missense_Mutation_p.T62A|TFDP2_uc010hur.2_Missense_Mutation_p.T88A|TFDP2_uc003eul.3_Missense_Mutation_p.T88A|TFDP2_uc011bnf.1_Missense_Mutation_p.T52A|TFDP2_uc011bng.1_Missense_Mutation_p.T13A|TFDP2_uc003eum.3_Missense_Mutation_p.T88A	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	149	Potential.				cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						TTGTACGATGTTGTACCTTTT	0.388													12	530	---	---	---	---	PASS
GNB4	59345	broad.mit.edu	37	3	179132741	179132741	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179132741C>T	uc003fjv.3	-	6	642	c.362G>A	c.(361-363)TGC>TAC	p.C121Y	GNB4_uc003fju.3_Missense_Mutation_p.C32Y	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4	121	WD 2.				cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			ATATATAGAGCAGATGTTGTC	0.468													6	226	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196803457	196803457	+	Intron	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196803457G>T	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Missense_Mutation_p.Q702K|DLG1_uc011bue.1_Missense_Mutation_p.Q668K|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_RNA	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ACATACTTACGGTCAGCATCA	0.458													6	432	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1956923	1956923	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1956923T>C	uc003gdz.3	+	13	2550	c.2374T>C	c.(2374-2376)TAT>CAT	p.Y792H	WHSC1_uc003geb.3_Missense_Mutation_p.Y792H|WHSC1_uc003gec.3_Missense_Mutation_p.Y792H|WHSC1_uc003ged.3_Missense_Mutation_p.Y792H|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Missense_Mutation_p.Y11H|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_Missense_Mutation_p.Y140H	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	792					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CCCCGTTGCCTATCACAGCGG	0.542			T	IGH@	MM								6	404	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46043143	46043143	+	Silent	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46043143T>C	uc003gxb.2	-	9	1412	c.1260A>G	c.(1258-1260)GAA>GAG	p.E420E		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	420	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTCTGCAGTCTTCAAAGCAAC	0.418													7	498	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56348952	56348952	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56348952T>C	uc003haz.1	-	5	927	c.1A>G	c.(1-3)ATG>GTG	p.M1V	CLOCK_uc003hba.1_Missense_Mutation_p.M1V	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	1					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GTAAACAACATAACATACTAC	0.279													5	309	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73148931	73148931	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73148931A>G	uc003hgk.1	-	22	3577	c.3540T>C	c.(3538-3540)TCT>TCC	p.S1180S		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1180					collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTCTTGCCTGAGAAGAAGCAC	0.468													7	461	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82377759	82377759	+	Intron	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82377759C>A	uc003hmi.1	-						RASGEF1B_uc003hmj.1_Intron|RASGEF1B_uc010ijq.1_Intron|RASGEF1B_uc003hmk.2_Missense_Mutation_p.A162S	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CCCACCCAGGCTCTGCCTGGG	0.483													10	151	---	---	---	---	PASS
NPNT	255743	broad.mit.edu	37	4	106863727	106863727	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106863727C>A	uc003hya.2	+	8	1232	c.1027C>A	c.(1027-1029)CCA>ACA	p.P343T	NPNT_uc011cfc.1_Missense_Mutation_p.P360T|NPNT_uc011cfd.1_Missense_Mutation_p.P373T|NPNT_uc011cfe.1_Missense_Mutation_p.P373T|NPNT_uc010ilt.1_Missense_Mutation_p.P343T|NPNT_uc011cff.1_Missense_Mutation_p.P343T|NPNT_uc010ilu.1_Missense_Mutation_p.P239T	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	343	Pro-rich.				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		AACACCTCTACCACCTACAAC	0.532													91	206	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153245430	153245430	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153245430C>T	uc003ims.2	-	11	1910	c.1761G>A	c.(1759-1761)ATG>ATA	p.M587I	FBXW7_uc011cii.1_Missense_Mutation_p.M587I|FBXW7_uc003imt.2_Missense_Mutation_p.M587I|FBXW7_uc011cih.1_Missense_Mutation_p.M411I|FBXW7_uc003imq.2_Missense_Mutation_p.M507I|FBXW7_uc003imr.2_Missense_Mutation_p.M469I	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	587	WD 6.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTTTGAGTTCCATTCCACTTG	0.413			Mis|N|D|F		colorectal|endometrial|T-ALL								6	423	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155156296	155156296	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155156296C>G	uc003inw.2	-	25	8143	c.8143G>C	c.(8143-8145)GGG>CGG	p.G2715R		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2715					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAGCCTTCCCCTTGATCTCCT	0.512													67	159	---	---	---	---	PASS
SAP30	8819	broad.mit.edu	37	4	174298500	174298500	+	3'UTR	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174298500T>A	uc003itd.2	+	4						NM_003864	NP_003855	O75446	SAP30_HUMAN	Sin3A-associated protein, 30kDa						transcription, DNA-dependent	histone deacetylase complex	DNA binding|metal ion binding|protein binding|transcription corepressor activity			ovary(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		TTGAGACTAATAACTTGGATG	0.323													101	259	---	---	---	---	PASS
CCT5	22948	broad.mit.edu	37	5	10262697	10262697	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10262697C>T	uc003jeq.2	+	9	1455	c.1284C>T	c.(1282-1284)TCC>TCT	p.S428S	CCT5_uc003jer.2_Silent_p.S428S|CCT5_uc010its.2_Silent_p.S428S|CCT5_uc011cmr.1_Silent_p.S373S|CCT5_uc011cms.1_Silent_p.S390S|CCT5_uc011cmt.1_Silent_p.S335S	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	428					'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						CTGAGATATCCTGTGCCCTGG	0.537													5	312	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41012760	41012760	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41012760G>C	uc003jmj.3	-	30	3550	c.3060C>G	c.(3058-3060)AAC>AAG	p.N1020K	HEATR7B2_uc003jmi.3_Missense_Mutation_p.N575K	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1020							binding			ovary(6)|central_nervous_system(2)	8						TACAAGTGGGGTTGAGGCTCT	0.458													90	204	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41153926	41153926	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41153926A>G	uc003jmk.2	-	15	2486	c.2276T>C	c.(2275-2277)CTC>CCC	p.L759P	C6_uc003jml.1_Missense_Mutation_p.L759P	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	759	C5b-binding domain.|Sushi 2.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTCACAGGTGAGAGAGTTTGA	0.473													5	119	---	---	---	---	PASS
IQGAP2	10788	broad.mit.edu	37	5	75866461	75866461	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75866461G>T	uc003kek.2	+	4	582	c.360G>T	c.(358-360)ATG>ATT	p.M120I		NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	120	CH.				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TAAGAGCGATGGAGTCTATTG	0.448													114	313	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179221063	179221063	+	3'UTR	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179221063C>T	uc003mkn.1	+	5					LTC4S_uc003mko.2_5'UTR	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAGCCCGTGCCACCACACCG	0.637													13	21	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32084267	32084267	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32084267C>T	uc003nzn.2	-	17	1905	c.1872G>A	c.(1870-1872)ATG>ATA	p.M624I	TNXB_uc010jts.1_Intron|ATF6B_uc003nzm.1_Missense_Mutation_p.M197I|ATF6B_uc003nzo.2_Missense_Mutation_p.M621I	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	624	Lumenal (Potential).				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CATTGGGGGCCATGGCAGGCA	0.632													50	68	---	---	---	---	PASS
WASF1	8936	broad.mit.edu	37	6	110426688	110426688	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110426688T>C	uc003ptv.1	-	8	1472	c.635A>G	c.(634-636)GAG>GGG	p.E212G	WASF1_uc003ptw.1_Missense_Mutation_p.E212G|WASF1_uc003ptx.1_Missense_Mutation_p.E212G|WASF1_uc003pty.1_Missense_Mutation_p.E212G|WASF1_uc003ptz.1_Missense_Mutation_p.E212G	NM_003931	NP_003922	Q92558	WASF1_HUMAN	Wiskott-Aldrich syndrome protein family member	212					actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TTCAGCCAGCTCTGGACCTTG	0.428													6	255	---	---	---	---	PASS
AMD1	262	broad.mit.edu	37	6	111213609	111213609	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111213609A>G	uc003puk.1	+	6	900	c.578A>G	c.(577-579)TAC>TGC	p.Y193C	AMD1_uc011eay.1_Missense_Mutation_p.Y124C|AMD1_uc011eaz.1_Missense_Mutation_p.Y164C|AMD1_uc011eba.1_Missense_Mutation_p.Y73C|AMD1_uc003pul.1_Missense_Mutation_p.Y45C	NM_001634	NP_001625	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1 isoform 1	193					spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	GACCAGTTCTACATGAAAGAT	0.408													21	311	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119283120	119283120	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119283120C>A	uc003pyj.2	-	17	3495	c.3147G>T	c.(3145-3147)AAG>AAT	p.K1049N	FAM184A_uc003pyk.3_Missense_Mutation_p.K880N|FAM184A_uc003pyl.3_Missense_Mutation_p.K845N|FAM184A_uc003pyi.2_RNA	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	1049										ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						TATCATTCTTCTTCTTTTGCT	0.408													6	321	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123104810	123104810	+	Intron	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123104810G>T	uc003pzf.2	+						FABP7_uc003pze.1_3'UTR	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	TTTAAAATTCGGTGACTGAAG	0.338													6	548	---	---	---	---	PASS
IFNGR1	3459	broad.mit.edu	37	6	137528135	137528135	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137528135C>T	uc003qho.2	-	2	268	c.165G>A	c.(163-165)CAG>CAA	p.Q55Q	IFNGR1_uc011edm.1_Silent_p.Q27Q|IFNGR1_uc011edn.1_Silent_p.Q45Q	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	55	Extracellular (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	AAACAGGGACCTGTGGCATGA	0.358													13	414	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152783703	152783703	+	Intron	SNP	T	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152783703T>G	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_3'UTR|SYNE1_uc003qow.2_Intron|SYNE1_uc003qox.1_Intron|SYNE1_uc003qoz.2_Intron|SYNE1_uc003qoy.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGTCATGTCTTTTTTATGTTC	0.323										HNSCC(10;0.0054)			6	17	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83021907	83021907	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83021907C>A	uc003uhy.1	-	14	2097	c.1631G>T	c.(1630-1632)TGC>TTC	p.C544F		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	544					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				ATACCGGGAGCAGGATATGCC	0.473													56	109	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117417736	117417736	+	Silent	SNP	A	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117417736A>T	uc003vjf.2	-	8	2699	c.2607T>A	c.(2605-2607)GCT>GCA	p.A869A		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	869	ANK 5.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AATTTCCATGAGCTGGTATTC	0.468													58	139	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128496822	128496822	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128496822C>T	uc003vnz.3	+	45	7617	c.7408C>T	c.(7408-7410)CCC>TCC	p.P2470S	FLNC_uc003voa.3_Missense_Mutation_p.P2437S	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2470	Filamin 22.|Interaction with INPPL1.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CCGCTTCATCCCCCACGAGAA	0.602													6	166	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135282778	135282778	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135282778A>G	uc003vsw.2	+	15	2128	c.2097A>G	c.(2095-2097)GAA>GAG	p.E699E		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	699					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CCCGGTGTGAAGAATACCCAT	0.413													8	436	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148543626	148543626	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148543626T>C	uc003wfd.1	-	3	348	c.182A>G	c.(181-183)AAA>AGA	p.K61R	EZH2_uc011kug.1_Missense_Mutation_p.K61R|EZH2_uc003wfb.1_Missense_Mutation_p.K61R|EZH2_uc003wfc.1_Missense_Mutation_p.K61R|EZH2_uc011kuh.1_Missense_Mutation_p.K61R|EZH2_uc011kui.1_Missense_Mutation_p.K61R|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	61	Interaction with DNMT1, DNMT3A and DNMT3B.|Interaction with EED (By similarity).				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CCTTCGCTGTTTCCATTCTTG	0.383			Mis		DLBCL								7	470	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17513562	17513562	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17513562G>A	uc003wxv.2	-	9	3392	c.2918C>T	c.(2917-2919)ACC>ATC	p.T973I	MTUS1_uc003wxt.2_Missense_Mutation_p.T220I|MTUS1_uc011kyg.1_Missense_Mutation_p.T118I|MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.T919I|MTUS1_uc003wxs.2_Missense_Mutation_p.T139I	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	973	Potential.					Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		CTCACAGGTGGTTGAAGCAGT	0.418													23	468	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53055509	53055509	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53055509G>A	uc003xqz.2	-	12	2305	c.2149C>T	c.(2149-2151)CTC>TTC	p.L717F	ST18_uc011ldq.1_Missense_Mutation_p.L364F|ST18_uc011ldr.1_Missense_Mutation_p.L682F|ST18_uc011lds.1_Missense_Mutation_p.L622F|ST18_uc003xra.2_Missense_Mutation_p.L717F	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	717						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TCCTTTTTGAGATCTCTTGCA	0.423													6	549	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898082	104898082	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898082C>A	uc003yls.2	+	2	830	c.589C>A	c.(589-591)CAG>AAG	p.Q197K	RIMS2_uc003ylp.2_Missense_Mutation_p.Q419K|RIMS2_uc003ylw.2_Missense_Mutation_p.Q227K|RIMS2_uc003ylq.2_Missense_Mutation_p.Q227K|RIMS2_uc003ylr.2_Missense_Mutation_p.Q227K	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	450					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCGAGAGGCTCAGGGACCAAG	0.478										HNSCC(12;0.0054)			5	155	---	---	---	---	PASS
DENND3	22898	broad.mit.edu	37	8	142185524	142185524	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142185524G>T	uc003yvy.2	+	14	2539	c.2261G>T	c.(2260-2262)GGC>GTC	p.G754V	DENND3_uc010mep.2_Missense_Mutation_p.G715V|DENND3_uc003yvz.1_Missense_Mutation_p.G438V	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	754										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GGAAGGCCAGGCTACTTGGAG	0.468											OREG0019025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	106	---	---	---	---	PASS
TYRP1	7306	broad.mit.edu	37	9	12698513	12698513	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12698513C>T	uc003zkv.3	+	4	949	c.771C>T	c.(769-771)GTC>GTT	p.V257V		NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor	257	Lumenal, melanosome (Potential).				melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GGAAAAATGTCTGTGATATCT	0.433									Oculocutaneous_Albinism				209	385	---	---	---	---	PASS
C9orf11	54586	broad.mit.edu	37	9	27297126	27297126	+	5'UTR	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27297126C>T	uc003zql.2	-	1					C9orf11_uc011lnq.1_5'UTR|C9orf11_uc003zqm.2_5'UTR	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		CCCAGCAGGTCCTGTGTCTAA	0.438													13	39	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90113920	90113920	+	5'UTR	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90113920G>A	uc004apc.2	+	2					DAPK1_uc004ape.2_5'UTR|DAPK1_uc004apd.2_5'UTR|DAPK1_uc011ltg.1_5'UTR|DAPK1_uc011lth.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						CTACGGAGGCGCAGGAGCGGT	0.507									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				5	211	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	116925055	116925055	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116925055A>G	uc011lxl.1	+	2	123	c.123A>G	c.(121-123)GGA>GGG	p.G41G		NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	41					cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						CCACCCAAGGAGCTCCTGAAG	0.552													7	473	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													12	368	---	---	---	---	PASS
LCN12	286256	broad.mit.edu	37	9	139849846	139849846	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139849846T>C	uc004ckb.2	+	6	586	c.574T>C	c.(574-576)TGT>CGT	p.C192R	LCN12_uc004ckc.2_3'UTR	NM_178536	NP_848631	Q6JVE5	LCN12_HUMAN	lipocalcin 12 precursor	192					lipid metabolic process	extracellular region	binding|transporter activity				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGCCAGCGTCTGTTGAAGGAT	0.632													33	70	---	---	---	---	PASS
C9orf173	441476	broad.mit.edu	37	9	140147247	140147247	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140147247G>A	uc004cmk.1	+	5	635	c.623G>A	c.(622-624)GGC>GAC	p.G208D	C9orf173_uc004cmj.1_Missense_Mutation_p.G209D|C9orf173_uc011meu.1_Intron|C9orf173_uc010ncd.1_RNA|C9orf173_uc011mev.1_Intron|C9orf173_uc004cml.1_Intron|COBRA1_uc004cmm.3_5'Flank			Q8N7X2	CI173_HUMAN	SubName: Full=LOC441476 protein;	209										pancreas(1)	1						AGGGGGCTGGGCCTCAGGGTG	0.662													5	11	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29769470	29769470	+	Silent	SNP	C	T	T	rs146808407		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29769470C>T	uc001iut.1	-	29	6126	c.5373G>A	c.(5371-5373)ACG>ACA	p.T1791T	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Silent_p.T705T|SVIL_uc001iuu.1_Silent_p.T1365T|SVIL_uc009xlc.2_Silent_p.T583T	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1791	Gelsolin-like 3.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				ACTAACCTGCCGTGCTCACCA	0.562													5	128	---	---	---	---	PASS
SYT15	83849	broad.mit.edu	37	10	46961958	46961958	+	3'UTR	SNP	C	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46961958C>G	uc001jea.2	-	8					SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_3'UTR|SYT15_uc010qfp.1_RNA	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						AACCGCGGTGCTGGGCGAAGG	0.642													6	23	---	---	---	---	PASS
RUFY2	55680	broad.mit.edu	37	10	70105789	70105789	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70105789T>C	uc001job.2	-	17	2084	c.1757A>G	c.(1756-1758)AAG>AGG	p.K586R	RUFY2_uc001jnz.1_RNA|RUFY2_uc001joa.2_Missense_Mutation_p.K141R	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	600	FYVE-type.					nucleus	metal ion binding			ovary(1)	1						TGAGAATTCCTTTTCACAAAG	0.323													8	686	---	---	---	---	PASS
KIAA1279	26128	broad.mit.edu	37	10	70748679	70748679	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70748679G>A	uc001joy.2	+	1	187	c.91G>A	c.(91-93)GAA>AAA	p.E31K		NM_015634	NP_056449	Q96EK5	KBP_HUMAN	KIF1 binding protein	31					cell differentiation|mitochondrial transport|nervous system development	mitochondrion	kinesin binding			ovary(1)	1						TCCGGAGAAGGAACCATACAA	0.622											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	43	---	---	---	---	PASS
AIFM2	84883	broad.mit.edu	37	10	71874016	71874016	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71874016C>A	uc010qjg.1	-	8	1053	c.1040G>T	c.(1039-1041)GGC>GTC	p.G347V	AIFM2_uc001jqp.1_Missense_Mutation_p.G347V	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like	347					apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1						CATGAGCCGGCCCACATAGAA	0.572													5	28	---	---	---	---	PASS
C10orf27	219793	broad.mit.edu	37	10	72536949	72536949	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72536949T>C	uc001jrj.1	-	7	1040	c.650A>G	c.(649-651)GAA>GGA	p.E217G	C10orf27_uc010qjm.1_Missense_Mutation_p.E218G|C10orf27_uc009xqh.1_RNA|C10orf27_uc010qjn.1_Missense_Mutation_p.E216G|C10orf27_uc009xqi.1_RNA|C10orf27_uc010qjo.1_Missense_Mutation_p.E237G	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph	217					cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						CTGGACTCCTTCATGTCTGCT	0.612													4	57	---	---	---	---	PASS
C10orf27	219793	broad.mit.edu	37	10	72541707	72541707	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72541707T>C	uc001jrj.1	-	4	517	c.127A>G	c.(127-129)ATC>GTC	p.I43V	C10orf27_uc010qjm.1_Missense_Mutation_p.I43V|C10orf27_uc009xqh.1_RNA|C10orf27_uc010qjn.1_Missense_Mutation_p.I43V|C10orf27_uc009xqi.1_RNA|C10orf27_uc010qjo.1_Missense_Mutation_p.I32V|C10orf27_uc009xqj.1_Missense_Mutation_p.I32V|C10orf27_uc010qjp.1_Missense_Mutation_p.I32V	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph	43					cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						ATCCCTGGGATCACCAGTTCT	0.592													33	98	---	---	---	---	PASS
ANXA11	311	broad.mit.edu	37	10	81915581	81915581	+	3'UTR	SNP	T	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81915581T>G	uc001kbq.1	-	17					ANXA11_uc010qlx.1_3'UTR|ANXA11_uc001kbr.1_3'UTR|ANXA11_uc001kbs.1_3'UTR|ANXA11_uc001kbt.1_3'UTR|ANXA11_uc010qly.1_3'UTR|ANXA11_uc009xsq.1_3'UTR|ANXA11_uc001kbu.1_3'UTR	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11						cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TGCCGGCAGGTGGGCAGAAGT	0.512													9	61	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104111129	104111129	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104111129C>T	uc001kux.1	+	5	652	c.412C>T	c.(412-414)CAG>TAG	p.Q138*	GBF1_uc001kuw.2_Nonsense_Mutation_p.Q138*|GBF1_uc001kuy.1_Nonsense_Mutation_p.Q138*|GBF1_uc001kuz.1_Nonsense_Mutation_p.Q138*	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	138					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GAAAATCCTTCAGGTAAGCGA	0.517													43	81	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104129720	104129720	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104129720A>G	uc001kux.1	+	26	3555	c.3315A>G	c.(3313-3315)AGA>AGG	p.R1105R	GBF1_uc001kuy.1_Silent_p.R1105R|GBF1_uc001kuz.1_Silent_p.R1106R	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1105					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		AGGCCAAGAGAGTGGCCTTAG	0.488													5	152	---	---	---	---	PASS
FAM160B1	57700	broad.mit.edu	37	10	116621368	116621368	+	3'UTR	SNP	A	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116621368A>C	uc001lcb.2	+	17					FAM160B1_uc001lcc.2_Intron	NM_020940	NP_065991	Q5W0V3	F16B1_HUMAN	hypothetical protein LOC57700 isoform a											lung(1)	1						ACTCAGTTCCACCCAGCCACA	0.383													15	59	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129911780	129911780	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129911780G>C	uc001lke.2	-	8	1762	c.1567C>G	c.(1567-1569)CCT>GCT	p.P523A	MKI67_uc001lkf.2_Missense_Mutation_p.P163A|MKI67_uc009yav.1_Missense_Mutation_p.P98A|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	523					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGCGTATTAGGAGGCAAGTTT	0.448													124	303	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68312436	68312436	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68312436C>T	uc001onw.2	+	4	625	c.358C>T	c.(358-360)CTT>TTT	p.L120F	SAPS3_uc010rqb.1_Missense_Mutation_p.L29F|SAPS3_uc001onv.2_Missense_Mutation_p.L120F|SAPS3_uc001ony.3_Missense_Mutation_p.L120F|SAPS3_uc001onx.2_Missense_Mutation_p.L120F|SAPS3_uc009ysh.2_Missense_Mutation_p.L120F|SAPS3_uc001onu.2_Missense_Mutation_p.L120F|SAPS3_uc010rqc.1_Missense_Mutation_p.L29F	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	120					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			GAATCCACTACTTGCCAGTTT	0.388													9	461	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71735322	71735322	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71735322T>C	uc001orl.1	-	5	378	c.206A>G	c.(205-207)CAG>CGG	p.Q69R	NUMA1_uc001ork.1_Missense_Mutation_p.Q69R|NUMA1_uc001orm.1_Missense_Mutation_p.Q69R|NUMA1_uc009ysx.1_Missense_Mutation_p.Q69R|NUMA1_uc001oro.1_Missense_Mutation_p.Q69R|NUMA1_uc009ysy.1_Missense_Mutation_p.Q69R|NUMA1_uc001orp.2_Missense_Mutation_p.Q69R|NUMA1_uc001orq.2_Missense_Mutation_p.Q69R	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	69					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GTGCTTACTCTGCAGAAAACT	0.483			T	RARA	APL								31	95	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104872776	104872776	+	Silent	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104872776G>A	uc010rva.1	-	5	728	c.696C>T	c.(694-696)GAC>GAT	p.D232D	CASP5_uc010ruz.1_Silent_p.D245D|CASP5_uc010rvb.1_Silent_p.D174D|CASP5_uc010rvc.1_Silent_p.D90D|CASP5_uc009yxh.2_Silent_p.D14D|CASP5_uc010rvd.1_Silent_p.D14D	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	232					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GATTCTTTTCGTCAACCACAG	0.453													9	344	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965729	111965729	+	3'UTR	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965729T>A	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	AATTGATGTATGCCTCTTTGC	0.408			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				4	12	---	---	---	---	PASS
LOC100288778	100288778	broad.mit.edu	37	12	88906	88906	+	Silent	SNP	A	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88906A>T	uc010scy.1	+	7	882	c.327A>T	c.(325-327)CCA>CCT	p.P109P	LOC100288778_uc010scz.1_RNA|LOC100288778_uc010sdc.1_RNA|LOC100288778_uc010sdd.1_Silent_p.P109P|LOC100288778_uc010sde.1_Silent_p.P109P|LOC100288778_uc010sdf.1_Silent_p.P109P|LOC100288778_uc010sdg.1_Silent_p.P109P|LOC100288778_uc010sdh.1_RNA					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0						ccccaccaccacccccaGCTC	0.512													5	20	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32975511	32975511	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32975511C>T	uc001rlj.3	-	9	1976	c.1861G>A	c.(1861-1863)GAG>AAG	p.E621K	PKP2_uc001rlk.3_Missense_Mutation_p.E577K|PKP2_uc010skj.1_Missense_Mutation_p.E577K	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	621					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TCTGGGAGCTCTGCCTCCAGC	0.413													145	371	---	---	---	---	PASS
KRT2	3849	broad.mit.edu	37	12	53039024	53039024	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53039024C>A	uc001sat.2	-	9	1732	c.1699G>T	c.(1699-1701)GGT>TGT	p.G567C		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	567	Tail.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		CCAGAACCACCGCCAGAGCCA	0.577													5	174	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57554852	57554852	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57554852T>C	uc001snd.2	+	13	2622	c.2156T>C	c.(2155-2157)TTC>TCC	p.F719S		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	719	LDL-receptor class B 7.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGGATGCCTTCTACGACCGC	0.582													14	34	---	---	---	---	PASS
PIP4K2C	79837	broad.mit.edu	37	12	57989804	57989804	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57989804A>G	uc001sou.2	+	4	634	c.503A>G	c.(502-504)AAC>AGC	p.N168S	PIP4K2C_uc001sot.2_Missense_Mutation_p.N168S|PIP4K2C_uc010srs.1_Missense_Mutation_p.N150S|PIP4K2C_uc010srt.1_Intron	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	168	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					AACCTCTCCAACTATCACCAG	0.493													11	387	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68716858	68716858	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68716858T>C	uc001stz.2	-	5	932	c.796A>G	c.(796-798)AGG>GGG	p.R266G	MDM1_uc010stc.1_Missense_Mutation_p.R221G|MDM1_uc009zqv.1_5'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	266						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		AATACCTTCCTTTCAGGAGAC	0.333													9	770	---	---	---	---	PASS
GLIPR1	11010	broad.mit.edu	37	12	75884198	75884198	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884198G>T	uc001sxs.2	+	3	581	c.433G>T	c.(433-435)GAT>TAT	p.D145Y	GLIPR1_uc009zsb.1_Missense_Mutation_p.Q168H	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor	145					cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						TGTTTGGGCAGATAGTTACAA	0.388													8	498	---	---	---	---	PASS
DGKH	160851	broad.mit.edu	37	13	42773767	42773767	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42773767C>T	uc001uyl.1	+	19	2372	c.2351C>T	c.(2350-2352)TCA>TTA	p.S784L	DGKH_uc010tfh.1_Missense_Mutation_p.S784L|DGKH_uc001uym.1_Missense_Mutation_p.S784L|DGKH_uc010tfi.1_Missense_Mutation_p.S539L|DGKH_uc010tfj.1_Missense_Mutation_p.S639L|DGKH_uc001uyn.1_RNA|DGKH_uc001uyo.1_Missense_Mutation_p.S639L|DGKH_uc001uyp.2_RNA	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2	784					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GCAAAAATTTCATTAGAATTT	0.284													35	103	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389397	20389397	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389397T>C	uc010tkw.1	+	1	632	c.632T>C	c.(631-633)TTC>TCC	p.F211S		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	211	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTAAGCACTTTCTCTCTCTTG	0.418													7	498	---	---	---	---	PASS
ABHD12B	145447	broad.mit.edu	37	14	51345464	51345464	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51345464C>T	uc001wys.2	+	3	249	c.234C>T	c.(232-234)TTC>TTT	p.F78F	ABHD12B_uc001wyq.2_5'UTR|ABHD12B_uc001wyr.2_Intron|ABHD12B_uc010any.2_RNA	NM_181533	NP_853511	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B isoform b	78							hydrolase activity			breast(1)	1	all_epithelial(31;0.00481)|Breast(41;0.148)					ACTTTCCAGTCAAAGCCCCAT	0.383													5	234	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70530579	70530579	+	Intron	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70530579T>C	uc001xly.2	-						SLC8A3_uc001xlu.2_Intron|SLC8A3_uc001xlv.2_Intron|SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Missense_Mutation_p.M618V|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron|SLC8A3_uc001xma.2_Intron	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GGGCCCATCATCTCAATGAAG	0.343													7	601	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86089112	86089112	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86089112C>T	uc001xvr.2	+	2	2021	c.1254C>T	c.(1252-1254)ACC>ACT	p.T418T	FLRT2_uc010atd.2_Silent_p.T418T	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	418	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AAAGAGTGACCCCACCTATTT	0.488													6	182	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99932102	99932102	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99932102G>A	uc001ygc.2	-	2	211	c.41C>T	c.(40-42)ACT>ATT	p.T14I	SETD3_uc001ygd.2_Missense_Mutation_p.T14I|SETD3_uc001ygf.2_Missense_Mutation_p.T14I	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	14					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TGTAGCACCAGTGCCAGATTT	0.428													125	289	---	---	---	---	PASS
RCOR1	23186	broad.mit.edu	37	14	103193027	103193027	+	3'UTR	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103193027C>T	uc001ymb.2	+	12						NM_015156	NP_055971	Q9UKL0	RCOR1_HUMAN	REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1						TCCATGTTGGCGCCACTTCCC	0.532													18	21	---	---	---	---	PASS
OR4N3P	390539	broad.mit.edu	37	15	22414067	22414067	+	Silent	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22414067T>C	uc001yuf.2	+	1	366	c.366T>C	c.(364-366)AAT>AAC	p.N122N		NM_001080841	NP_001074310			RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;												0						TGGTCTTCAATAGTGGCCTGA	0.502													5	263	---	---	---	---	PASS
ZSCAN29	146050	broad.mit.edu	37	15	43653850	43653850	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43653850A>G	uc001zrk.1	-	5	2127	c.1980T>C	c.(1978-1980)TTT>TTC	p.F660F	ZSCAN29_uc001zrj.1_Silent_p.F540F|ZSCAN29_uc010bdf.1_3'UTR|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Silent_p.F270F	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	660					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		AGTTTGGACCAAAGCTTTTGC	0.453													112	306	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76222396	76222396	+	Intron	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76222396T>A	uc002bbk.2	+						FBXO22_uc002bbj.1_Missense_Mutation_p.V267D|FBXO22_uc002bbl.2_Intron	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a						ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						GAAAAGTATGTCTTGTGTGCT	0.383													153	345	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77059317	77059317	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77059317A>G	uc002bby.2	-	10	1420	c.1361T>C	c.(1360-1362)ATT>ACT	p.I454T	SCAPER_uc002bbx.2_Missense_Mutation_p.I208T|SCAPER_uc002bbz.1_Missense_Mutation_p.I325T|SCAPER_uc002bca.1_Missense_Mutation_p.I319T|SCAPER_uc002bcb.1_Missense_Mutation_p.I460T|SCAPER_uc002bcc.1_Missense_Mutation_p.I454T	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	453	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TTCAGCTTCAATTTCTCTAGT	0.333													246	584	---	---	---	---	PASS
MAN2A2	4122	broad.mit.edu	37	15	91454153	91454153	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91454153A>C	uc010bnz.2	+	12	1952	c.1837A>C	c.(1837-1839)ACC>CCC	p.T613P	MAN2A2_uc010boa.2_Missense_Mutation_p.T655P|MAN2A2_uc002bqc.2_Missense_Mutation_p.T613P|MAN2A2_uc010uql.1_Missense_Mutation_p.T275P|MAN2A2_uc010uqm.1_Missense_Mutation_p.T192P|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	613	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGACAAGGAGACCTACCACTT	0.607													7	50	---	---	---	---	PASS
PKD1L3	342372	broad.mit.edu	37	16	72033601	72033601	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72033601G>C	uc010vmm.1	-	1	277	c.277C>G	c.(277-279)CAA>GAA	p.Q93E		NM_181536	NP_853514			polycystin 1-like 3 precursor												0						TTGTTGTCTTGATGCTTTTTC	0.368													84	232	---	---	---	---	PASS
LOC283922	283922	broad.mit.edu	37	16	74372644	74372644	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74372644A>G	uc002fcr.2	-	9	1661	c.315T>C	c.(313-315)CCT>CCC	p.P105P	LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TACCCTTGTCAGGGGGAACAA	0.443													28	165	---	---	---	---	PASS
ZNF287	57336	broad.mit.edu	37	17	16455177	16455177	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16455177C>T	uc002gqi.2	-	6	2732	c.2279G>A	c.(2278-2280)CGT>CAT	p.R760H		NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287	753					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		CCATTAATTACGATGTTTGGC	0.373													11	406	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	16721400	16721400	+	RNA	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16721400A>G	uc002gqq.1	-	6		c.1770T>C								full-length cDNA clone CS0DI013YN06 of Placenta Cot 25-normalized of Homo sapiens (human).																		GGGATCTTCTAGTGGGATCCG	0.602													8	28	---	---	---	---	PASS
PRR11	55771	broad.mit.edu	37	17	57247138	57247138	+	Nonsense_Mutation	SNP	C	T	T	rs112751476		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57247138C>T	uc002ixf.1	+	2	104	c.25C>T	c.(25-27)CGA>TGA	p.R9*	PRR11_uc002ixg.1_RNA	NM_018304	NP_060774	Q96HE9	PRR11_HUMAN	proline rich 11	9										ovary(2)	2	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ACAACGAAGACGAAAGCTAAA	0.299													6	512	---	---	---	---	PASS
NOL4	8715	broad.mit.edu	37	18	31538197	31538197	+	Intron	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31538197A>G	uc010dmi.2	-						NOL4_uc010xbs.1_Intron|NOL4_uc002kxr.3_Intron|NOL4_uc010xbt.1_Intron|NOL4_uc010dmh.2_Intron|NOL4_uc010xbu.1_Intron|NOL4_uc002kxt.3_Intron|NOL4_uc010xbv.1_Intron|NOL4_uc010xbw.1_Silent_p.S300S	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4							nucleolus	RNA binding			ovary(3)	3						GTGTGGCAGGACTCACATTAA	0.418													5	93	---	---	---	---	PASS
FZR1	51343	broad.mit.edu	37	19	3533336	3533336	+	Silent	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3533336G>A	uc010dtk.2	+	11	1321	c.1287G>A	c.(1285-1287)AAG>AAA	p.K429K	FZR1_uc002lxt.2_Silent_p.K429K|FZR1_uc002lxv.2_Silent_p.K340K	NM_001136198	NP_001129670	Q9UM11	FZR_HUMAN	Fzr1 protein isoform 1	429	WD 6.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding			lung(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTCTGGAAGTACCCCTCCC	0.652													13	36	---	---	---	---	PASS
ALKBH7	84266	broad.mit.edu	37	19	6374925	6374925	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6374925C>A	uc002meo.1	+	4	995	c.607C>A	c.(607-609)CGC>AGC	p.R203S		NM_032306	NP_115682	Q9BT30	ALKB7_HUMAN	spermatogenesis associated 11 precursor	203						extracellular region|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CGTGATCTGCCGCTCCCTCCC	0.607													3	29	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089041	9089041	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089041C>A	uc002mkp.2	-	1	2978	c.2774G>T	c.(2773-2775)AGT>ATT	p.S925I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	925	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AACTGAGGTACTGCTCGTAGC	0.493													82	181	---	---	---	---	PASS
DKKL1	27120	broad.mit.edu	37	19	49869088	49869088	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49869088G>T	uc002pnk.2	+	4	577	c.363G>T	c.(361-363)GAG>GAT	p.E121D		NM_014419	NP_055234	Q9UK85	DKKL1_HUMAN	dickkopf-like 1 precursor	121					anatomical structure morphogenesis	extracellular space	protein binding|signal transducer activity				0		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		TGATCTCCGAGAATGTGGTGG	0.552													54	115	---	---	---	---	PASS
KLK10	5655	broad.mit.edu	37	19	51518692	51518692	+	Missense_Mutation	SNP	C	T	T	rs142960865		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51518692C>T	uc002puy.2	-	5	740	c.659G>A	c.(658-660)CGG>CAG	p.R220Q	KLK10_uc002puz.2_Missense_Mutation_p.R220Q|KLK10_uc002pva.2_Missense_Mutation_p.R220Q	NM_145888	NP_665895	O43240	KLK10_HUMAN	kallikrein-related peptidase 10 preproprotein	220	Peptidase S1.				cell cycle|proteolysis	extracellular region	serine-type endopeptidase activity			lung(2)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GTCCTGGCCCCGGTCCAGTCC	0.567													48	107	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53879109	53879109	+	5'UTR	SNP	G	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53879109G>A	uc010ydx.1	+	3					ZNF525_uc010eqn.2_5'UTR|ZNF525_uc002qbl.2_RNA	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		CTCTATACAGGGACGTGATGC	0.463													5	200	---	---	---	---	PASS
GPCPD1	56261	broad.mit.edu	37	20	5559074	5559074	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5559074T>C	uc002wme.3	-	8	870	c.657A>G	c.(655-657)ATA>ATG	p.I219M	GPCPD1_uc002wmd.3_Missense_Mutation_p.I38M	NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN	hypothetical protein LOC56261	219					glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0						CCATCGTCTGTATGCTGTACT	0.448													54	140	---	---	---	---	PASS
REM1	28954	broad.mit.edu	37	20	30064149	30064149	+	Translation_Start_Site	SNP	G	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30064149G>T	uc002wwa.2	+	2	185	c.-99G>T	c.(-101--97)CAGGA>CATGA			NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM						small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CAGCTCATCAGGACACTATAG	0.502													4	83	---	---	---	---	PASS
ACTR5	79913	broad.mit.edu	37	20	37383750	37383750	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37383750A>G	uc002xjd.2	+	4	951	c.926A>G	c.(925-927)AAT>AGT	p.N309S		NM_024855	NP_079131	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog	309	Potential.				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding				0		Myeloproliferative disorder(115;0.00878)				CAGGAGCTCAATGCCCGGCGG	0.607													20	61	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45494961	45494961	+	Silent	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45494961A>G	uc002zea.2	+	9	1396	c.1227A>G	c.(1225-1227)AAA>AAG	p.K409K	TRAPPC10_uc010gpo.2_Silent_p.K120K	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	409					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						TGTCAGAGAAAGGACCTAACT	0.413													7	509	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011526	46011526	+	Silent	SNP	T	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011526T>A	uc002zfm.2	-	1	861	c.840A>T	c.(838-840)ACA>ACT	p.T280T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	280	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						GGCAGCATGATGTGGAAGCCC	0.652													5	38	---	---	---	---	PASS
MICAL3	57553	broad.mit.edu	37	22	18371966	18371966	+	Silent	SNP	C	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18371966C>A	uc002zng.3	-	13	2078	c.1725G>T	c.(1723-1725)GTG>GTT	p.V575V	MICAL3_uc011agl.1_Silent_p.V575V|MICAL3_uc002znh.2_Silent_p.V575V|MICAL3_uc002znj.1_Silent_p.V275V|MICAL3_uc002znk.1_Silent_p.V575V|MICAL3_uc002znl.1_Silent_p.V208V|MICAL3_uc002znm.2_Silent_p.V76V|MICAL3_uc010grf.2_Silent_p.V575V	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	575	CH.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		TATTCTTCTCCACATTTTGCT	0.438													5	230	---	---	---	---	PASS
LZTR1	8216	broad.mit.edu	37	22	21351285	21351285	+	Intron	SNP	C	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21351285C>G	uc002zto.2	+						LZTR1_uc002ztn.2_Intron|LZTR1_uc011ahy.1_Intron|LZTR1_uc002ztp.2_Silent_p.L118L	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTTCAGGACTCGCTTCCCCTT	0.642													7	26	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22664115	22664115	+	RNA	SNP	A	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22664115A>T	uc011aim.1	+	30		c.1972A>T			LOC96610_uc011aiq.1_RNA					Parts of antibodies, mostly variable regions.												0						TGTTTAATTCAGCCTTGGAAG	0.413													6	27	---	---	---	---	PASS
ENTHD1	150350	broad.mit.edu	37	22	40283733	40283733	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40283733A>G	uc003ayg.2	-	2	271	c.20T>C	c.(19-21)GTG>GCG	p.V7A		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	7										ovary(2)|skin(1)	3	Melanoma(58;0.0749)					AAAGTTTTTCACTTGTCTCCT	0.388													6	189	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42607162	42607162	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42607162C>T	uc003bcj.1	-	1	4284	c.4150G>A	c.(4150-4152)GAT>AAT	p.D1384N	TCF20_uc003bck.1_Missense_Mutation_p.D1384N|TCF20_uc003bnt.2_Missense_Mutation_p.D1384N	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1384					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GACAGTATATCATCAAGCGTA	0.483													58	157	---	---	---	---	PASS
MAGEB4	4115	broad.mit.edu	37	X	30260747	30260747	+	Silent	SNP	C	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30260747C>G	uc004dcb.2	+	1	579	c.495C>G	c.(493-495)GCC>GCG	p.A165A	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	165	MAGE.									ovary(1)	1						TTGGCCTTGCCTTGAAGGAGG	0.532													26	16	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122755227	122755227	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122755227T>C	uc004etu.2	-	31	4029	c.3997A>G	c.(3997-3999)AAG>GAG	p.K1333E	THOC2_uc010nqt.1_RNA|THOC2_uc004etw.1_Missense_Mutation_p.K154E	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1333	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TTTTCTTCCTTCTTGAATTTT	0.393													9	662	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128948700	128948700	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128948700A>G	uc004euv.2	-	5	928	c.559T>C	c.(559-561)TTC>CTC	p.F187L	ZDHHC9_uc004euw.2_Missense_Mutation_p.F187L|ZDHHC9_uc004eux.1_Missense_Mutation_p.F187L|ZDHHC9_uc004euy.1_Missense_Mutation_p.F114L	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9	187	Helical; (Potential).|DHHC-type.					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						GAAAGGATGAAGAGGTAGAAG	0.517													6	321	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	155254961	155254961	+	Silent	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155254961C>T	uc004fnx.3	+	9	1171	c.717C>T	c.(715-717)CGC>CGT	p.R239R		NM_182905	NP_878908			WAS protein family homolog 1																		CCTTTGCCCGCGTGTCAGACT	0.642													5	11	---	---	---	---	PASS
ZFY	7544	broad.mit.edu	37	Y	2829144	2829144	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2829144C>T	uc004fqj.2	+	3	412	c.91C>T	c.(91-93)CAG>TAG	p.Q31*	ZFY_uc010nwd.1_Nonsense_Mutation_p.Q31*|ZFY_uc011nan.1_Intron|ZFY_uc010nwe.2_Nonsense_Mutation_p.Q5*	NM_003411	NP_003402	P08048	ZFY_HUMAN	zinc finger protein, Y-linked isoform 1	31					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGATGGTGATCAGATTGTTGT	0.318													236	130	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13303	13303	+	RNA	SNP	C	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13303C>T	uc004cox.3	+	1		c.967C>T			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TCAACCAACCACACCTAGCAT	0.433													6	278	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10394369	10394369	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10394369delC	uc001aqx.3	+						KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGTTGGTCTTCGTCAACAGTT	0.453													20	9	---	---	---	---	
AHDC1	27245	broad.mit.edu	37	1	27869520	27869520	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27869520delC	uc009vsy.2	-							NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1								DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		AGTGACCTCTCGAGGTTTCAA	0.602													4	2	---	---	---	---	
PTAFR	5724	broad.mit.edu	37	1	28504249	28504249	+	5'Flank	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28504249delT	uc001bpl.2	-						PTAFR_uc001bpm.3_Intron|PTAFR_uc009vte.2_Intron	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor						chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		TACTTTCTTCTTTTTTTTTTT	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34850947	34850948	+	IGR	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34850947_34850948insA								C1orf94 (166218 upstream) : MIR552 (284252 downstream)																							tatgcaaagagaaaaaaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37713442	37713442	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37713442delG								GRIK3 (213598 upstream) : ZC3H12A (226677 downstream)																							GTGTGCGTTCGATGATTATGG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	50687027	50687027	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50687027delC								ELAVL4 (19487 upstream) : DMRTA2 (196202 downstream)																							aacactgactccccggcctca	0.080													4	2	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52765466	52765466	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52765466delC	uc001cto.2	+						ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						tggcaattggcccccaggcag	0.000													4	2	---	---	---	---	
TTC4	7268	broad.mit.edu	37	1	55183676	55183676	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55183676delA	uc001cxx.3	+						C1orf175_uc001cxq.2_Intron|TTC4_uc001cxw.3_Intron|TTC4_uc001cxv.2_Intron	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4								binding				0						TAGCAGGAGTAAGGCAGTAGA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61449487	61449487	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61449487delC								C1orf87 (910061 upstream) : NFIA (93459 downstream)																							TCCCTGCCTTCCCCAGGTGCG	0.368													4	2	---	---	---	---	
TM2D1	83941	broad.mit.edu	37	1	62190373	62190373	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62190373delA	uc001czz.1	-							NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor						apoptosis					ovary(1)	1						GCACACTGATAAAAAAGAAAA	0.323													4	2	---	---	---	---	
DR1	1810	broad.mit.edu	37	1	93823880	93823881	+	Intron	INS	-	G	G	rs72512581		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93823880_93823881insG	uc001dpu.2	+						DR1_uc010otj.1_Intron	NM_001938	NP_001929	Q01658	NC2B_HUMAN	down-regulator of transcription 1						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex	sequence-specific DNA binding|TBP-class protein binding|transcription corepressor activity				0		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		ctctgttgccatatggggctat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	97115902	97115902	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97115902delA								None (None upstream) : PTBP2 (71273 downstream)																							GGCCTAGGACAAAAAAAAACG	0.453													4	2	---	---	---	---	
SASS6	163786	broad.mit.edu	37	1	100598134	100598135	+	Intron	DEL	CC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100598134_100598135delCC	uc001dsu.2	-						SASS6_uc009wdz.2_Intron|CCDC76_uc001dsv.2_5'Flank|CCDC76_uc010ouf.1_5'Flank|CCDC76_uc009wea.2_5'Flank	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		TCTGCAACGGCCGACTTGGTGA	0.540													11	7	---	---	---	---	
AMY2B	280	broad.mit.edu	37	1	104118399	104118399	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104118399delA	uc001duq.2	+						AMY2B_uc010ouo.1_Intron|LOC648740_uc001dur.2_Intron|AMY2B_uc001dus.1_Intron	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor						carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AGCCCACAGGAAAAAAAAAAA	0.254													5	3	---	---	---	---	
KCND3	3752	broad.mit.edu	37	1	112523116	112523116	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112523116delA	uc001ebu.1	-						KCND3_uc001ebv.1_Intron	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related							sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		TTTGGCCAGGAAAAAAAAAAA	0.403													3	4	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116193	145116193	+	3'UTR	DEL	G	-	-	rs66989703		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116193delG	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						AGCACTGGCTGGGGCATTCTC	0.428													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145253765	145253766	+	Intron	DEL	AA	-	-	rs66968024		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145253765_145253766delAA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ccttcacgataaaaaaaaaaac	0.000													5	5	---	---	---	---	
CDC42SE1	56882	broad.mit.edu	37	1	151027836	151027836	+	Intron	DEL	A	-	-	rs10612597		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151027836delA	uc001ewo.2	-						CDC42SE1_uc001ewp.2_Intron	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1						phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AACACTGGACAAAGAAAGGAC	0.473													4	2	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153854258	153854259	+	Intron	INS	-	GT	GT	rs146390017	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153854258_153854259insGT	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGGTTTTTTTCgtgtgtgtgtg	0.322													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154880301	154880301	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154880301delT								KCNN3 (37547 upstream) : PMVK (16908 downstream)																							AGTTTTTCCCTTTTCAGTTTA	0.433													4	2	---	---	---	---	
SEMA4A	64218	broad.mit.edu	37	1	156143903	156143903	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156143903delA	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					aatccgtctcaaaaaaaaaaa	0.080													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159564701	159564702	+	IGR	INS	-	A	A	rs140197770	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159564701_159564702insA								APCS (6041 upstream) : CRP (117378 downstream)																							GCAACCAGTAGAAAAAAAagag	0.401													3	7	---	---	---	---	
PRDX6	9588	broad.mit.edu	37	1	173453551	173453551	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173453551delT	uc001giy.1	+							NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6						cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						tacttcagtatttaccatcca	0.000													4	2	---	---	---	---	
PLXNA2	5362	broad.mit.edu	37	1	208253669	208253669	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208253669delT	uc001hgz.2	-							NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ACCCTTTGTCTTTTTTTTTGT	0.438													2	5	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217006360	217006361	+	Intron	INS	-	TTTC	TTTC	rs150910799	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217006360_217006361insTTTC	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TTGtaaattaattttatttttt	0.233													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	231229611	231229611	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231229611delT								FAM89A (53616 upstream) : TRIM67 (69063 downstream)																							GGATGCGACCTTTTAAAATGC	0.478													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240280280	240280280	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240280280delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			gttctttcggtttttttttta	0.000													4	2	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242383609	242383613	+	Intron	DEL	AAAAG	-	-	rs113967982		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242383609_242383613delAAAAG	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			aaagaaaactaaaagaaaagaaaag	0.268													4	2	---	---	---	---	
ZNF670	93474	broad.mit.edu	37	1	247207552	247207552	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247207552delA	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990	Q9BS34	ZN670_HUMAN	zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			AAATAATTGGAAAAAAAAAAC	0.239													4	3	---	---	---	---	
TRIM58	25893	broad.mit.edu	37	1	248030914	248030915	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248030914_248030915insA	uc001ido.2	+						OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ggctgaggcagggaggtggagg	0.010													7	4	---	---	---	---	
OR2T2	401992	broad.mit.edu	37	1	248615879	248615880	+	5'Flank	DEL	CA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248615879_248615880delCA	uc001iek.1	+							NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			gatgacctttcacagatgatga	0.020													4	2	---	---	---	---	
MATN3	4148	broad.mit.edu	37	2	20205423	20205424	+	Intron	INS	-	AAAG	AAAG	rs140894448	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20205423_20205424insAAAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCACCAAAAAAGAATAATACT	0.267													10	6	---	---	---	---	
GPR113	165082	broad.mit.edu	37	2	26542104	26542104	+	5'Flank	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26542104delC	uc002rhe.3	-						GPR113_uc010yky.1_5'Flank|GPR113_uc002rhb.1_Intron|GPR113_uc010eyk.1_Intron|GPR113_uc002rhc.1_Intron|GPR113_uc002rhd.1_Intron	NM_001145168	NP_001138640	Q8IZF5	GP113_HUMAN	G-protein coupled receptor 113 isoform 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCACCTGGAGCCCACATGCCC	0.582													4	2	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29697897	29697897	+	Intron	DEL	A	-	-	rs10712512		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29697897delA	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GCTCCTGTGTACCCCCTGCTC	0.542			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				7	7	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42949036	42949036	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42949036delA	uc002rso.1	+						MTA3_uc002rsp.1_Intron	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CATGTTGGAGAAAAAAAAATC	0.214													4	2	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43989806	43989806	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43989806delA	uc010yny.1	+							NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATTATTTTTTAAAAGTGTTAA	0.274													4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54871514	54871514	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54871514delA	uc002rxu.2	+	20	4309	c.4060delA	c.(4060-4062)AAAfs	p.K1354fs	SPTBN1_uc002rxx.2_Frame_Shift_Del_p.K1341fs	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1354	Spectrin 11.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			GGTGAAGGAGAAACTCACTGG	0.443													194	111	---	---	---	---	
KIAA1841	84542	broad.mit.edu	37	2	61324558	61324558	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61324558delT	uc002saw.3	+						KIAA1841_uc002sax.3_Intron|KIAA1841_uc002say.2_Intron	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a												0			Epithelial(17;0.193)			tgcaattcactttttttttgg	0.090													6	3	---	---	---	---	
XPO1	7514	broad.mit.edu	37	2	61728900	61728901	+	Intron	INS	-	AT	AT	rs79333867		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61728900_61728901insAT	uc002sbj.2	-						XPO1_uc010fcl.2_Intron|XPO1_uc010ypn.1_Intron|XPO1_uc002sbk.2_Intron	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1						intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AAGAATCCAACAGAGTCCAGTC	0.223													6	6	---	---	---	---	
FAM161A	84140	broad.mit.edu	37	2	62081526	62081526	+	5'Flank	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62081526delT	uc010ypo.1	-						FAM161A_uc002sbm.3_5'Flank|FAM161A_uc002sbn.3_5'Flank|FAM161A_uc010fcm.1_5'Flank|FAM161A_uc010fcn.1_5'Flank	NM_032180	NP_115556	Q3B820	F161A_HUMAN	hypothetical protein LOC84140						response to stimulus|visual perception	centrosome				large_intestine(2)|ovary(1)	3						AAAAGAACGCTTTTTTATTAA	0.473													4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63122414	63122416	+	Intron	DEL	ATC	-	-	rs72274435		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63122414_63122416delATC	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			tgtaaattCTatcatcatcatca	0.143									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73786441	73786442	+	Intron	INS	-	TA	TA	rs143326908	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73786441_73786442insTA	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjg.2_Intron|ALMS1_uc002sjh.1_Intron	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TATTAGGTTACTATATATATAT	0.248													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91976432	91976432	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91976432delA								GGT8P (6279 upstream) : FKSG73 (152727 downstream)																							TAAGGCACATAATGAGCAATT	0.299													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95601435	95601436	+	Intron	INS	-	A	A	rs77444100		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95601435_95601436insA	uc002stv.1	-											Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																		ACACTTTTTTTAAAAAAAAAAA	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95720110	95720110	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95720110delT								MAL (375 upstream) : MRPS5 (32843 downstream)																							CATCAGCGTGTTCCTGGGCAG	0.443													4	2	---	---	---	---	
FAM178B	51252	broad.mit.edu	37	2	97632126	97632127	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97632126_97632127insA	uc002sxl.3	-							NM_001122646	NP_001116118	Q8IXR5	F178B_HUMAN	hypothetical protein LOC51252 isoform A												0						CATCAGAGCCcacacctttccc	0.257													4	2	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100287723	100287723	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100287723delC	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						GGAGTGAAGTCATTCTACATT	0.388													4	2	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	110065484	110065484	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110065484delG	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						TCTGTGAAGAGGCCAGGTCTG	0.552													4	2	---	---	---	---	
ACTR3	10096	broad.mit.edu	37	2	114688657	114688657	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114688657delT	uc002tkx.1	+						ACTR3_uc010yyc.1_Intron|ACTR3_uc010yyd.1_Intron	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog						cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						ATTCAGGGTATTTTTTTTTTA	0.303													4	2	---	---	---	---	
CCDC93	54520	broad.mit.edu	37	2	118707282	118707282	+	Intron	DEL	A	-	-	rs72838007	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118707282delA	uc002tlj.2	-						CCDC93_uc010fld.1_Intron	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93											large_intestine(1)|ovary(1)	2						TTCaaaaattaaaaaaaaaaa	0.303													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147045769	147045769	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147045769delT								None (None upstream) : PABPC1P2 (298856 downstream)																							ACCACATTGATTTTTTTAAAT	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	158201887	158201887	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158201887delC								ERMN (17741 upstream) : CYTIP (69244 downstream)																							actgcctgcacccaggtgatt	0.000													4	2	---	---	---	---	
DPP4	1803	broad.mit.edu	37	2	162862571	162862571	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162862571delT	uc002ubz.2	-						DPP4_uc010fpb.2_Intron	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TACTCATACCTTTCCACACTC	0.418													4	2	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173867749	173867750	+	Intron	INS	-	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173867749_173867750insC	uc002uhv.3	+						RAPGEF4_uc002uhw.3_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TTAGACTTGGTTTTTTTTAGCA	0.436													4	2	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178860027	178860027	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178860027delT	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TGTTTAGAGATTATTGCCACC	0.378									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				4	2	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183029170	183029170	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183029170delG	uc002uoq.1	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc010zfq.1_Intron	NM_005019	NP_005010	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 1						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			ctctctgagtgggcaaaaaat	0.000													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													11	7	---	---	---	---	
NAB1	4664	broad.mit.edu	37	2	191513340	191513341	+	5'Flank	INS	-	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191513340_191513341insT	uc002usb.2	+						NAB1_uc010fsc.2_5'Flank	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			CTCACACATAATTTTTTTTTTT	0.455													4	2	---	---	---	---	
SF3B1	23451	broad.mit.edu	37	2	198261249	198261249	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198261249delA	uc002uue.2	-							NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGGTCAGTTTAAAAAAGTTGA	0.259													4	2	---	---	---	---	
KIAA1486	57624	broad.mit.edu	37	2	226378591	226378591	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226378591delA	uc002voe.2	+						KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		GATAGTTCAGAAAGGGTAGGC	0.313													4	2	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1425349	1425349	+	Intron	DEL	A	-	-	rs75980293		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1425349delA	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		aaacaaaaacaaaaaaaaaca	0.000													4	2	---	---	---	---	
GRM7	2917	broad.mit.edu	37	3	7024300	7024300	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7024300delA	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	aactcaaaagaaaaaaaaaaa	0.015													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	13285700	13285700	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13285700delT								IQSEC1 (171083 upstream) : NUP210 (72037 downstream)																							CAACTGATAAttttttttttt	0.199													6	3	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	55091557	55091557	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55091557delT	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		AAATGTGAGATTTTTTTTGTT	0.373													3	3	---	---	---	---	
CADPS	8618	broad.mit.edu	37	3	62703707	62703708	+	Intron	INS	-	T	T	rs141987064	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62703707_62703708insT	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		tcttagagtaattttttttttc	0.000													5	6	---	---	---	---	
CLDND1	56650	broad.mit.edu	37	3	98239732	98239732	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98239732delA	uc003dsp.2	-						CLDND1_uc003dso.2_Intron|CLDND1_uc003dsq.2_Intron|CLDND1_uc003dss.2_Intron|CLDND1_uc003dsr.2_Intron|CLDND1_uc003dst.2_Intron|CLDND1_uc003dsu.2_Intron|CLDND1_uc003dsv.2_Intron	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a							integral to membrane				ovary(1)	1						AGTAAATAAGAAAAAAAAAAG	0.308													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112852649	112852649	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112852649delC								C3orf17 (114094 upstream) : BOC (77763 downstream)																							agtatgtgttcacttcgggct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	115184038	115184039	+	IGR	INS	-	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115184038_115184039insT								ZBTB20 (317911 upstream) : GAP43 (158112 downstream)																							TGTGCTCCCTATTTTTTATTAG	0.238													4	2	---	---	---	---	
ADPRH	141	broad.mit.edu	37	3	119304061	119304061	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119304061delT	uc003ecs.2	+						ADPRH_uc010hqv.2_Intron|ADPRH_uc011bjb.1_Intron|ADPRH_uc003ect.2_Intron	NM_001125	NP_001116	P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase						protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding			ovary(1)	1		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		AAGTGGAAACTTTTTTTTGTC	0.463													4	3	---	---	---	---	
NR1I2	8856	broad.mit.edu	37	3	119501398	119501403	+	Intron	DEL	AGGAGA	-	-	rs112670229		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119501398_119501403delAGGAGA	uc003edj.2	+						NR1I2_uc003edi.2_Intron|NR1I2_uc003edk.2_5'Flank	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2						drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	AAATCACCACAGGAGAAGCCTTAACT	0.471													2	5	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	123899653	123899653	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123899653delC	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TGGCCCCTTGCCCACGTTTAT	0.428													4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130871047	130871047	+	Intron	DEL	T	-	-	rs150507740	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130871047delT	uc003eny.2	+						NEK11_uc003enx.2_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron|NEK11_uc011blm.1_Intron|NEK11_uc010hto.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ACTTTTTTGGTTTTTTTTTTG	0.323													8	4	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140188368	140188368	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140188368delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AAGgtcacctcccccaggaag	0.209										HNSCC(16;0.037)			4	2	---	---	---	---	
SLC25A36	55186	broad.mit.edu	37	3	140689553	140689553	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140689553delA	uc003etr.2	+						SLC25A36_uc003ets.2_Intron|SLC25A36_uc003etq.2_Intron|SLC25A36_uc011bmz.1_Intron	NM_001104647	NP_001098117	Q96CQ1	S2536_HUMAN	solute carrier family 25, member 36 isoform a						response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						TTTTGCTTTTAAAAGAATCTG	0.303													5	3	---	---	---	---	
SAMD7	344658	broad.mit.edu	37	3	169643156	169643157	+	Intron	INS	-	A	A	rs63706563		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169643156_169643157insA	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			tgctttcacttAAAAAAAAAAA	0.149													9	5	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169898352	169898353	+	Intron	INS	-	T	T	rs79280679		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169898352_169898353insT	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron|PHC3_uc003fgp.3_Intron|PHC3_uc003fgq.3_Intron|PHC3_uc003fgr.1_5'Flank	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTATGCTTCTGTTTTTTTTTTT	0.292													4	3	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170994098	170994098	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170994098delC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			ttttcaggaaccagtggatct	0.214													3	3	---	---	---	---	
PCGF3	10336	broad.mit.edu	37	4	725112	725113	+	Intron	DEL	GC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:725112_725113delGC	uc011bva.1	+						PCGF3_uc003gbc.1_Intron|PCGF3_uc003gbd.1_Intron|PCGF3_uc003gbe.2_Intron|PCGF3_uc010ibh.2_Intron|PCGF3_uc003gbg.1_5'Flank|PCGF3_uc003gbh.2_5'Flank	NM_006315	NP_006306	Q3KNV8	PCGF3_HUMAN	ring finger protein 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	zinc ion binding				0						AGTGCGGGGTGCAGAGGGCTGG	0.658													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1615629	1615629	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1615629delG								CRIPAK (225847 upstream) : FAM53A (25980 downstream)																							CTGTACCTCAGGTCCCACGCA	0.363													4	2	---	---	---	---	
CRMP1	1400	broad.mit.edu	37	4	5895864	5895865	+	5'Flank	DEL	CA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5895864_5895865delCA	uc003gis.2	-							NM_001014809	NP_001014809	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 1						axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		CAGAGATGACCACACACACACA	0.490													4	2	---	---	---	---	
NCAPG	64151	broad.mit.edu	37	4	17826669	17826670	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17826669_17826670delAA	uc003gpp.2	+	10	1638_1639	c.1462_1463delAA	c.(1462-1464)AAAfs	p.K488fs	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	488					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		TGTAAGAAAGAAAGAACTCAAG	0.391													174	85	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38474153	38474154	+	IGR	INS	-	A	A	rs141184669	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38474153_38474154insA								TBC1D1 (333360 upstream) : FLJ13197 (140168 downstream)																							agaactacaagaaaagaCAGGA	0.153													3	4	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	55087241	55087242	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55087241_55087242insA	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	aactccatctcaaaaaaaaaaa	0.213			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	69493671	69493671	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69493671delT								YTHDC1 (277847 upstream) : UGT2B15 (18645 downstream)																							TACTTTGTAGTTTTTTTTTTT	0.274													4	3	---	---	---	---	
BTC	685	broad.mit.edu	37	4	75717179	75717180	+	Intron	INS	-	CA	CA	rs36045508		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75717179_75717180insCA	uc003hig.2	-							NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor						positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			ttccacCATCTcacacacacac	0.099													5	3	---	---	---	---	
LARP1B	55132	broad.mit.edu	37	4	129036098	129036098	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129036098delT	uc003iga.2	+						LARP1B_uc003ifz.1_Intron|LARP1B_uc003igb.1_Intron	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2								RNA binding				0						ATGTTAtttattttttttttt	0.129													5	3	---	---	---	---	
KIAA0922	23240	broad.mit.edu	37	4	154453599	154453599	+	Intron	DEL	A	-	-	rs13126509		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154453599delA	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				Ctttttttttaaaaaaaaaaa	0.199													5	5	---	---	---	---	
PPID	5481	broad.mit.edu	37	4	159634049	159634050	+	Intron	DEL	AA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159634049_159634050delAA	uc003iqc.2	-							NM_005038	NP_005029	Q08752	PPID_HUMAN	peptidylprolyl isomerase D						protein folding	cytoplasm|intermediate filament cytoskeleton	cyclosporin A binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		GTGCTTTGAGAAAAAAAGGCAA	0.347													4	2	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164449736	164449737	+	3'UTR	INS	-	TGTT	TGTT	rs144407064	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164449736_164449737insTGTT	uc003iqs.1	-	8					MARCH1_uc003iqr.1_3'UTR	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GGCATTTGGTCTGTTTGTTTTT	0.371													4	3	---	---	---	---	
C4orf27	54969	broad.mit.edu	37	4	170662823	170662823	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170662823delG	uc003isl.3	-							NM_017867	NP_060337	Q9NWY4	CD027_HUMAN	hypothetical protein LOC54969							nucleus				ovary(1)|pancreas(1)	2		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		GTGATTAAATGGTAAACAAGA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	175028776	175028778	+	Intron	DEL	GAG	-	-	rs139101875		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175028776_175028778delGAG	uc003ito.1	-											Homo sapiens cDNA FLJ43267 fis, clone IMR322007704.																		taaatcaggagagaagacggaca	0.000													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183215288	183215288	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183215288delA	uc010irv.1	+									Q9P273	TEN3_HUMAN	Homo sapiens ODZ3 (ODZ3) mRNA, partial cds.						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TGGCTGAGTTAAAAAAAAAAA	0.428													2	5	---	---	---	---	
MIER3	166968	broad.mit.edu	37	5	56260617	56260618	+	Intron	INS	-	C	C	rs146798367	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56260617_56260618insC	uc003jre.2	-						MIER3_uc003jrf.2_Intron|MIER3_uc003jrg.2_Intron			Q7Z3K6	MIER3_HUMAN	Homo sapiens cDNA FLJ61352 complete cds, weakly similar to Mesoderm induction early response protein 1.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		GATGAAGACCACTGCCCCCACT	0.510													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57358474	57358474	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57358474delT								ACTBL2 (579838 upstream) : PLK2 (391338 downstream)																							CTTTCTTTTCTTTTTTCTCTG	0.418													4	5	---	---	---	---	
CWC27	10283	broad.mit.edu	37	5	64074137	64074138	+	Intron	DEL	TC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64074137_64074138delTC	uc003jtn.1	+						CWC27_uc003jtl.2_Intron|CWC27_uc003jtm.2_Intron|CWC27_uc010iwt.1_Intron	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						ttgctttctttctctctctctc	0.099													4	2	---	---	---	---	
MBLAC2	153364	broad.mit.edu	37	5	89766310	89766310	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89766310delG	uc003kjp.2	-							NM_203406	NP_981951	Q68D91	MBLC2_HUMAN	beta-lactamase-like								hydrolase activity|metal ion binding				0						aaaaaaagaaggggggacaag	0.000													4	2	---	---	---	---	
ARSK	153642	broad.mit.edu	37	5	94938845	94938845	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94938845delA	uc003kld.2	+						ARSK_uc010jbg.2_Intron|ARSK_uc011cum.1_Intron	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K precursor							extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CTGAAAATCTAAAAAAAAAAT	0.294													3	3	---	---	---	---	
CAST	831	broad.mit.edu	37	5	96109662	96109663	+	3'UTR	INS	-	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96109662_96109663insC	uc003klu.2	+	32					CAST_uc003klt.2_3'UTR|CAST_uc003klv.2_3'UTR|CAST_uc003klw.2_3'UTR|CAST_uc003klx.2_3'UTR|CAST_uc003kly.2_3'UTR|CAST_uc003kmb.2_3'UTR|CAST_uc003kmc.2_3'UTR|CAST_uc003kmd.2_3'UTR|CAST_uc003kme.2_3'UTR|CAST_uc003kmf.2_3'UTR|CAST_uc003kmh.2_3'UTR|CAST_uc010jbj.2_3'UTR|CAST_uc003kmj.2_3'UTR|CAST_uc003kmk.2_Intron|ERAP1_uc003kml.2_Intron|ERAP1_uc010jbm.1_Intron	NM_001750	NP_001741	P20810	ICAL_HUMAN	calpastatin isoform a								calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CTTGTTAACCTCCCCCCCAAAT	0.406													4	2	---	---	---	---	
ZNF608	57507	broad.mit.edu	37	5	124080873	124080873	+	5'Flank	DEL	G	-	-	rs67159920		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124080873delG	uc003ktq.1	-						ZNF608_uc003ktr.1_5'Flank|ZNF608_uc003kts.1_Intron|ZNF608_uc003ktt.1_Intron	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608							intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTCCTGTGAAGGGGGGGGGAA	0.433													3	3	---	---	---	---	
CDC23	8697	broad.mit.edu	37	5	137524389	137524390	+	3'UTR	DEL	AA	-	-	rs79925684		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137524389_137524390delAA	uc003lcl.2	-	16						NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTTGGGGGCCAAAAAAAAAAAG	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143091436	143091436	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143091436delG								NR3C1 (276359 upstream) : HMHB1 (100290 downstream)																							ttttatgtttgtttttttaaa	0.224													16	7	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	156015999	156016000	+	Intron	DEL	TG	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156015999_156016000delTG	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAATCTATATtgtgtgtgtgtg	0.257													6	3	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	169960192	169960193	+	Intron	INS	-	GT	GT	rs149514034	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169960192_169960193insGT	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGGTCACTGAGTGTGTGTGTG	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9749734	9749740	+	Intron	DEL	TCATCAT	-	-	rs143656990		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9749734_9749740delTCATCAT	uc003myg.1	-						uc010jog.1_Intron|uc003myh.1_Intron|uc003myi.2_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																		TCTCAAATCATCATCATAAAAATTAAA	0.353													5	4	---	---	---	---	
SYCP2L	221711	broad.mit.edu	37	6	10906543	10906543	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10906543delA	uc003mzo.2	+						SYCP2L_uc011din.1_Intron|SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GTTTTTAAAGAAAAAAAAAAC	0.338													5	6	---	---	---	---	
GFOD1	54438	broad.mit.edu	37	6	13408142	13408145	+	Intron	DEL	CCAA	-	-	rs68037309		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13408142_13408145delCCAA	uc003nat.1	-						GFOD1_uc003nas.1_Intron	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain							extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			CTGTACTCACCCAACCAACTGACT	0.475													5	3	---	---	---	---	
VARS2	57176	broad.mit.edu	37	6	30884231	30884232	+	Intron	DEL	GT	-	-	rs66691369		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30884231_30884232delGT	uc003nsc.1	+						VARS2_uc003nsd.2_Intron|VARS2_uc011dmx.1_Intron|VARS2_uc011dmy.1_Intron|VARS2_uc011dmz.1_Intron|VARS2_uc011dna.1_Intron|VARS2_uc011dnb.1_Intron|VARS2_uc011dnc.1_Intron|VARS2_uc011dnd.1_5'Flank	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial						valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						TAGAATATTCgtgtgtgtgtgt	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33887721	33887722	+	IGR	DEL	GA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33887721_33887722delGA								MLN (115928 upstream) : MIR1275 (80027 downstream)																							GGTGGCTAGTgagagagagaga	0.376													4	2	---	---	---	---	
SFRS3	6428	broad.mit.edu	37	6	36570082	36570082	+	3'UTR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36570082delT	uc003omj.2	+	6					SFRS3_uc003omk.2_RNA	NM_003017	NP_003008	P84103	SRSF3_HUMAN	splicing factor, arginine/serine-rich 3						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						CGGAAGTGTGTTTTTTTTTAA	0.318			T	BCL6	follicular lymphoma								3	3	---	---	---	---	
KCNK17	89822	broad.mit.edu	37	6	39278094	39278094	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39278094delG	uc003ooo.2	-						KCNK17_uc003oop.2_Intron	NM_031460	NP_113648	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17							integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2						CCCTGTGTGTGGGGAGGATGG	0.592											OREG0017413	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57340583	57340584	+	Intron	DEL	TG	-	-	rs151087376		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57340583_57340584delTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtgcctaacatgtgcaaaacac	0.035													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95672046	95672046	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95672046delT								None (None upstream) : MANEA (353367 downstream)																							gcatgtcacattttttttttt	0.000													11	5	---	---	---	---	
TUBE1	51175	broad.mit.edu	37	6	112396203	112396206	+	Intron	DEL	AGTT	-	-	rs143220594		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112396203_112396206delAGTT	uc003pvq.2	-						TUBE1_uc003pvr.2_Intron	NM_016262	NP_057346	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1						centrosome cycle|microtubule-based movement|protein polymerization	microtubule|pericentriolar material	GTP binding|GTPase activity|structural constituent of cytoskeleton			ovary(1)	1		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		TATTAGTGAAAGTTAGTATCAGAA	0.225													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116181764	116181764	+	IGR	DEL	T	-	-	rs79532905		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116181764delT								None (None upstream) : FRK (80929 downstream)																							ACACCTGAGCTTTTTTTTTCT	0.333													4	2	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	125092031	125092031	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125092031delA	uc003pzo.2	+						NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		AAATAATACCAAAAAAAGCCA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	129883890	129883890	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129883890delT								LAMA2 (46182 upstream) : ARHGAP18 (14351 downstream)																							AATCATTTGATTTAAATGTGG	0.333													4	2	---	---	---	---	
HBS1L	10767	broad.mit.edu	37	6	135303873	135303873	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135303873delT	uc003qez.2	-						HBS1L_uc003qey.2_Intron|HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein						signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		CACACTTTACTTTTTTTTTTT	0.184													9	4	---	---	---	---	
C6orf217	100131814	broad.mit.edu	37	6	136015605	136015605	+	Intron	DEL	T	-	-	rs144698166		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136015605delT	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0						aatggaaagattttttttttt	0.045													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145242812	145242812	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145242812delC								UTRN (68644 upstream) : EPM2A (703634 downstream)																							cacgtttgaacccccttttct	0.015													4	2	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160450998	160450998	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160450998delT	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		cacggacagatttttttttgg	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164084606	164084607	+	IGR	INS	-	C	C	rs147983179	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164084606_164084607insC								QKI (89714 upstream) : None (None downstream)																							CTGTTGGGTCGCCCACTCCTGA	0.401													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164515517	164515518	+	IGR	INS	-	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164515517_164515518insT								QKI (520625 upstream) : None (None downstream)																							CCTATTATCAGTTTTTTTTTTT	0.292													3	3	---	---	---	---	
UNC93A	54346	broad.mit.edu	37	6	167707852	167707852	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167707852delA	uc003qvq.2	+						UNC93A_uc003qvr.2_Intron	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TTCTCCCACCAGCTTCAGAGG	0.622													6	3	---	---	---	---	
UNC93A	54346	broad.mit.edu	37	6	167707858	167707859	+	Intron	INS	-	TC	TC			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167707858_167707859insTC	uc003qvq.2	+						UNC93A_uc003qvr.2_Intron	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CACCAGCTTCAGAGGAGGCTCC	0.614													6	3	---	---	---	---	
UNC93A	54346	broad.mit.edu	37	6	167707861	167707861	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167707861delG	uc003qvq.2	+						UNC93A_uc003qvr.2_Intron	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CAGCTTCAGAGGAGGCTCCCA	0.607													6	3	---	---	---	---	
HEATR2	54919	broad.mit.edu	37	7	811592	811592	+	Intron	DEL	T	-	-	rs34980331		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:811592delT	uc010krz.1	+						HEATR2_uc003siz.2_Intron|HEATR2_uc003sja.2_3'UTR|HEATR2_uc003sjb.2_Intron|HEATR2_uc003sjc.2_Intron	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2								protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		ATAGGAAAGATTTTTTTTTTT	0.398													6	4	---	---	---	---	
SNX13	23161	broad.mit.edu	37	7	17930332	17930332	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17930332delA	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron|SNX13_uc003stx.1_Intron|SNX13_uc003sty.2_Intron			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					GCCTAGatttaaaaaaaaaaa	0.303													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	21147956	21147957	+	IGR	DEL	GT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21147956_21147957delGT								RPL23P8 (280517 upstream) : SP4 (319732 downstream)																							ACAAGCCGGAGTGTGTGTGTGT	0.495													6	3	---	---	---	---	
LOC646762	646762	broad.mit.edu	37	7	29691528	29691529	+	Intron	INS	-	A	A	rs149705058	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29691528_29691529insA	uc003tad.3	-							NR_024278				Homo sapiens cDNA: FLJ23070 fis, clone LNG05629.												0						AGAGTTTGGTGAATAATGCGTG	0.455													4	4	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40883108	40883108	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40883108delA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron|C7orf10_uc003thp.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45755956	45755956	+	3'UTR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45755956delC	uc003tne.3	+	20						NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGTCCCTGCTCCTGTGCTTTC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46120375	46120375	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46120375delT								IGFBP3 (159504 upstream) : None (None downstream)																							CGCTGAATCCTTTTTTTTTCC	0.214													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56699457	56699457	+	IGR	DEL	A	-	-	rs78077053		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56699457delA								DKFZp434L192 (134480 upstream) : ZNF479 (487871 downstream)																							TTCATAGTCCAAAAAAAAAAT	0.294													8	6	---	---	---	---	
TYW1	55253	broad.mit.edu	37	7	66519690	66519690	+	Intron	DEL	T	-	-	rs11314136		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66519690delT	uc003tvn.2	+						TYW1_uc010lai.2_Intron	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				atttGCCTTATTTGCCTGCAA	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	69006573	69006573	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69006573delT								None (None upstream) : AUTS2 (57332 downstream)																							tttccaCTAATTTTTTTTTTC	0.015													5	5	---	---	---	---	
PTPN12	5782	broad.mit.edu	37	7	77201859	77201861	+	Intron	DEL	TTG	-	-	rs77520029		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77201859_77201861delTTG	uc003ugh.2	+						PTPN12_uc011kgp.1_Intron|PTPN12_uc011kgq.1_Intron|PTPN12_uc010ldq.1_Intron|PTPN12_uc010ldr.1_Intron	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type							soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						CTTCATCCTTTTGTTGTTCTACA	0.315													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100614843	100614843	+	IGR	DEL	C	-	-	rs67310012		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100614843delC								ACHE (120304 upstream) : MUC12 (33232 downstream)																							ACCTCCTTTACCCCCACCCGG	0.592													2	4	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101039752	101039752	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101039752delT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					TAAGCAtttcttttttttttg	0.269													4	2	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104376954	104376955	+	Intron	INS	-	CA	CA	rs140158383	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104376954_104376955insCA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						GTTTGCATGCCcacacacacac	0.371													8	5	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	107056276	107056277	+	Intron	DEL	TG	-	-	rs147772106	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107056276_107056277delTG	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						cacgtatgtatgtatgtgtgtg	0.040													4	4	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121638300	121638301	+	Intron	DEL	GT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121638300_121638301delGT	uc003vjy.2	+						PTPRZ1_uc003vjz.2_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TAAAATAAGAGTGACTAAACAT	0.297													4	2	---	---	---	---	
RBM28	55131	broad.mit.edu	37	7	127952991	127952991	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127952991delT	uc003vmp.2	-						RBM28_uc003vmo.2_Intron|RBM28_uc011koj.1_Intron	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28						mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						GGAAAGCATGTTATGGGGAAT	0.338													4	2	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	131896039	131896039	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131896039delC	uc003vra.3	-							NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						GGTGCTCGTGCCCACCCAGTG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	132404818	132404818	+	Intron	DEL	T	-	-	rs35529188		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132404818delT	uc003vrd.1	+											Homo sapiens cDNA FLJ40288 fis, clone TESTI2028098.																		CGATGTGGGATTTTTTTTTCT	0.294													4	2	---	---	---	---	
LUC7L2	51631	broad.mit.edu	37	7	139094048	139094048	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139094048delA	uc003vux.2	+						LUC7L2_uc011kqs.1_Intron|LUC7L2_uc011kqt.1_Intron|LUC7L2_uc003vuy.2_Intron|LUC7L2_uc003vuz.1_Intron|LUC7L2_uc003vva.2_Intron	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2								enzyme binding|metal ion binding				0	Melanoma(164;0.242)					GTTTTCACTTAAAAAAAAAAA	0.100													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142128679	142128680	+	Intron	INS	-	A	A	rs35100255	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142128679_142128680insA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		AGGAAGGCGATGGGCAGATAGG	0.490													4	4	---	---	---	---	
MTMR7	9108	broad.mit.edu	37	8	17228371	17228371	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17228371delA	uc003wxm.2	-							NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7								protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		GGGAGACTCTAAAAAAACAAG	0.403													4	2	---	---	---	---	
SLC39A14	23516	broad.mit.edu	37	8	22273947	22273947	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22273947delT	uc003xbq.3	+						SLC39A14_uc011kzg.1_Intron|SLC39A14_uc003xbp.3_Intron|SLC39A14_uc011kzh.1_Intron	NM_001128431	NP_001121903	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter),							endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		CCTAATCACCttttttttgga	0.244													4	4	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	26214345	26214345	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26214345delA	uc003xeu.2	+						PPP2R2A_uc003xek.2_Intron|PPP2R2A_uc011laf.1_Intron	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		ctcatcatccacttctgacac	0.124													4	2	---	---	---	---	
ADAM2	2515	broad.mit.edu	37	8	39605407	39605407	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39605407delA	uc003xnj.2	-						ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CTAAGACTTCAATAGTTTCCT	0.279													4	2	---	---	---	---	
IDO2	169355	broad.mit.edu	37	8	39850510	39850510	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39850510delC	uc010lwy.1	+						IDO2_uc003xno.1_Intron|IDO2_uc010lwz.1_Intron|IDO2_uc003xnp.1_Intron	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1						tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						GAAGACAGAACCAGCCCGGTC	0.507													4	2	---	---	---	---	
KCNB2	9312	broad.mit.edu	37	8	73777986	73777987	+	Intron	INS	-	T	T	rs147496191	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73777986_73777987insT	uc003xzb.2	+							NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			ctcactgcctcttacttatcct	0.168													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75705499	75705499	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75705499delA								MIR2052 (87517 upstream) : PI15 (31273 downstream)																							CGCTGAACTCAAAAAAATGAC	0.289													6	3	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250888	86250889	+	Intron	DEL	TC	-	-	rs36103318		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250888_86250889delTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttctttctttctttctttctt	0.069													11	5	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	441038	441038	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:441038delT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		tcagccAGTATTTTTTTTTCC	0.229													1	5	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18681698	18681699	+	Intron	INS	-	TT	TT	rs151259731		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18681698_18681699insTT	uc003zne.3	+						ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CCTCGTGTGGGGGGGGGGGGCG	0.426													4	2	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33509340	33509340	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33509340delA	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						cgtctctatgaaaaaaaaaat	0.000													4	2	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37727705	37727705	+	Intron	DEL	G	-	-	rs66640478		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37727705delG	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		GGGTAGTTATGGGGGGTGATG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44742109	44742110	+	IGR	INS	-	TG	TG	rs145005151	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44742109_44742110insTG								None (None upstream) : FAM27C (248126 downstream)																							tgtgtggattatgtgtgtgtat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77812677	77812677	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77812677delA								OSTF1 (50564 upstream) : PCSK5 (692883 downstream)																							CTATTCTGGTAACAGTGTCCT	0.353													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82190107	82190108	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82190107_82190108insA	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						TTTACAGATCGAAAAAAAATAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	85757189	85757189	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85757189delT								RASEF (79146 upstream) : FRMD3 (100716 downstream)																							aaggaagaaatttttggagaa	0.035													4	2	---	---	---	---	
AGTPBP1	23287	broad.mit.edu	37	9	88165096	88165097	+	Intron	DEL	GT	-	-	rs35611324		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88165096_88165097delGT	uc011ltd.1	-						AGTPBP1_uc004aod.3_Intron|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						GAGTTTGTGAGTGTGTGTGTGT	0.406													4	3	---	---	---	---	
ZNF484	83744	broad.mit.edu	37	9	95626728	95626728	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95626728delA	uc004asu.1	-						ANKRD19_uc004asr.3_Intron|ZNF484_uc011lub.1_Intron|ZNF484_uc010mrb.1_Intron|ZNF484_uc004asv.1_Intron	NM_031486	NP_113674	Q5JVG2	ZN484_HUMAN	zinc finger protein 484 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						gaacaacaacaaaaaaaaaag	0.000													12	8	---	---	---	---	
C9orf43	257169	broad.mit.edu	37	9	116186801	116186801	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116186801delT	uc004bho.3	+						C9orf43_uc004bhp.2_Intron	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN	hypothetical protein LOC257169												0						TATttctttcttttttttttt	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	121166290	121166291	+	IGR	INS	-	A	A	rs145875458	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121166290_121166291insA								TLR4 (686526 upstream) : DBC1 (762617 downstream)																							ggagcatgttcagggcacgttt	0.000													7	6	---	---	---	---	
PTPLA	9200	broad.mit.edu	37	10	17632097	17632097	+	3'UTR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17632097delT	uc001ipg.2	-	7						NM_014241	NP_055056	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like, member A						fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity			central_nervous_system(1)|skin(1)	2						TTAGCAAAAGTTTTTTTTTCC	0.264													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	22498484	22498485	+	IGR	INS	-	AGA	AGA	rs140751641	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22498484_22498485insAGA								DNAJC1 (205834 upstream) : COMMD3 (106814 downstream)																							CAATGCCTATCAGATCACAGCA	0.455													3	6	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27404680	27404680	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27404680delA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						AAATAGAGGGAAACAGTAAAG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28307126	28307126	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28307126delG								ARMC4 (19149 upstream) : MPP7 (32797 downstream)																							CTCTCTCTTTGGGTTTCTCTC	0.368													4	2	---	---	---	---	
GPRIN2	9721	broad.mit.edu	37	10	46992532	46992533	+	5'Flank	INS	-	CGG	CGG	rs144512403	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46992532_46992533insCGG	uc001jec.2	+							NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth												0						GGGGTAGCCGCCGGCGCGGAGA	0.668													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	48582103	48582104	+	IGR	DEL	TG	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48582103_48582104delTG								GDF10 (142937 upstream) : FRMPD2L1 (261939 downstream)																							GGCCCAGGGCTGAAGCTGCAGA	0.495													4	2	---	---	---	---	
IPMK	253430	broad.mit.edu	37	10	60028838	60028839	+	5'Flank	INS	-	C	C	rs140962691	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60028838_60028839insC	uc001jkb.2	-						CISD1_uc001jkc.3_5'Flank	NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						CTTCCTTATGGCCAGGACAGCT	0.634													6	3	---	---	---	---	
OIT3	170392	broad.mit.edu	37	10	74658127	74658127	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74658127delA	uc001jte.1	+						OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor							nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					gtgagtctttaatcctaacct	0.075													4	2	---	---	---	---	
CCNJ	54619	broad.mit.edu	37	10	97816250	97816250	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97816250delT	uc001klm.2	+						uc001klg.1_Intron|uc001klj.1_Intron|uc009xvb.1_Intron|CCNJ_uc010qoq.1_Intron|CCNJ_uc001kln.2_Intron	NM_019084	NP_061957	Q5T5M9	CCNJ_HUMAN	cyclin J isoform 2							nucleus				ovary(1)	1				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		ATTTCAAGCATTTTTTTTTAG	0.368													4	2	---	---	---	---	
SCD	6319	broad.mit.edu	37	10	102111105	102111105	+	Intron	DEL	C	-	-	rs77607180		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102111105delC	uc001kqy.2	+							NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		GAGAGCGTTGCCCGGTGAGAG	0.547													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120123450	120123450	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120123450delG								C10orf84 (21611 upstream) : PRLHR (229466 downstream)																							ggggaaacgtgggcaggagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130350385	130350386	+	IGR	INS	-	T	T	rs143099880	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130350385_130350386insT								MKI67 (425917 upstream) : MGMT (915068 downstream)																							GTCTTCCCTCCTCCTGCAGAGA	0.540													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131250176	131250177	+	IGR	INS	-	CTT	CTT	rs143511607	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131250176_131250177insCTT								None (None upstream) : MGMT (15277 downstream)																							AGTCACTCCTCTAACCCACTCA	0.431													3	3	---	---	---	---	
EBF3	253738	broad.mit.edu	37	10	131736349	131736349	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131736349delA	uc001lki.1	-							NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CGCAAACTGTAAAGAGACCAC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133565146	133565146	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133565146delA								TCERG1L (455162 upstream) : PPP2R2D (182814 downstream)																							taattgtgagaaaaaaaaaac	0.040													4	2	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134405275	134405295	+	Intron	DEL	GGAGCTCAGATCTCCTTTCCC	-	-	rs112603932		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134405275_134405295delGGAGCTCAGATCTCCTTTCCC	uc001llp.2	+						INPP5A_uc001llo.1_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GCAGGTGCAGGGAGCTCAGATCTCCTTTCCCGGAGCTGCGC	0.575													5	4	---	---	---	---	
KRTAP5-5	439915	broad.mit.edu	37	11	1649551	1649552	+	5'Flank	INS	-	C	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1649551_1649552insC	uc001lty.2	+							NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5							keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AAGCAAATGTATCAAGCACTGG	0.510													9	4	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12517892	12517893	+	Intron	INS	-	GAGTGCATGCATGCAT	GAGTGCATGCATGCAT	rs138094049	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12517892_12517893insGAGTGCATGCATGCAT	uc001mki.2	+						PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		TATTGTTGCAAGAGTGCATGCA	0.510													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15813934	15813934	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15813934delC								INSC (545182 upstream) : SOX6 (174062 downstream)																							aaaatatcttctccttgagcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	25608401	25608402	+	IGR	INS	-	T	T	rs148125198	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25608401_25608402insT								LUZP2 (504219 upstream) : ANO3 (602427 downstream)																							caaaatgacaattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27816706	27816706	+	IGR	DEL	A	-	-	rs141399051		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27816706delA								BDNF (73101 upstream) : KIF18A (225457 downstream)																							gttaaaaacgaAAAAAAAAAA	0.000													3	3	---	---	---	---	
CSTF3	1479	broad.mit.edu	37	11	33163765	33163765	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33163765delA	uc001muh.2	-						CSTF3_uc001mui.2_Intron|CSTF3_uc001muj.2_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						actcagagagaaaaaaaaaag	0.055													8	4	---	---	---	---	
CAT	847	broad.mit.edu	37	11	34473842	34473842	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34473842delA	uc001mvm.2	+						CAT_uc009ykc.1_Intron	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase						hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	AAGCCGTGGGAAAGGCAGAAA	0.348													53	43	---	---	---	---	
SPI1	6688	broad.mit.edu	37	11	47380277	47380278	+	Intron	DEL	CA	-	-	rs72160162		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47380277_47380278delCA	uc001nfc.1	-						SPI1_uc001nfb.1_Intron|SLC39A13_uc001nfd.2_Intron|SPI1_uc009ylp.1_Frame_Shift_Del_p.C198fs	NM_003120	NP_003111	P17947	SPI1_HUMAN	hematopoietic transcription factor PU.1 isoform						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of erythrocyte differentiation	nucleus	protein binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)	2				Lung(87;0.0967)		ggcaaacatgcacacacacaca	0.307													4	3	---	---	---	---	
INTS5	80789	broad.mit.edu	37	11	62417596	62417596	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62417596delT	uc001nud.2	-							NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5						snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						cataagAGAAttttttttttt	0.020													6	3	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63901268	63901268	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63901268delC	uc001nyh.2	-							NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						CTCCCTTGTTCCCCCTTGCAG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	72957159	72957159	+	IGR	DEL	A	-	-	rs111911517		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72957159delA								P2RY2 (9766 upstream) : P2RY6 (18411 downstream)																							ccacttcagtaaaaaaAAAAA	0.219													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	98493657	98493657	+	IGR	DEL	C	-	-	rs111836089		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98493657delC								None (None upstream) : CNTN5 (398214 downstream)																							TGTTTTTTGACCACCTATTGT	0.269													4	2	---	---	---	---	
ACAT1	38	broad.mit.edu	37	11	108018332	108018332	+	3'UTR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108018332delT	uc001pjy.2	+	12						NM_000019	NP_000010	P24752	THIL_HUMAN	acetyl-Coenzyme A acetyltransferase 1 precursor						acetoacetic acid biosynthetic process|branched chain family amino acid catabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	acetyl-CoA C-acetyltransferase activity|metal ion binding			ovary(3)	3		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	CCTTGAAAAGTTTGATACATT	0.259													4	2	---	---	---	---	
RDX	5962	broad.mit.edu	37	11	110135839	110135840	+	Intron	INS	-	G	G	rs12576698		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110135839_110135840insG	uc001pku.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		tttttgttttttttttttttgt	0.079													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110360149	110360149	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110360149delA								FDX1 (24545 upstream) : ARHGAP20 (87617 downstream)																							acgctttttgaaaaaaacata	0.124													4	2	---	---	---	---	
CEP164	22897	broad.mit.edu	37	11	117241635	117241635	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117241635delA	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc010rxk.1_Intron|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_Intron	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		tcaaaaaaataaaaaaaaaaa	0.214													4	2	---	---	---	---	
TMPRSS13	84000	broad.mit.edu	37	11	117784310	117784311	+	Intron	INS	-	TG	TG	rs113086470		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117784310_117784311insTG	uc001prs.1	-						TMPRSS13_uc009yzr.1_Intron|TMPRSS13_uc001prt.1_Intron|TMPRSS13_uc001pru.1_Intron	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		CAATCTGCTCCAGACTCATAGG	0.406													7	4	---	---	---	---	
TMPRSS4	56649	broad.mit.edu	37	11	117964355	117964356	+	Intron	DEL	CT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117964355_117964356delCT	uc010rxo.1	+						TMPRSS4_uc010rxp.1_Intron|TMPRSS4_uc010rxq.1_Intron|TMPRSS4_uc010rxr.1_Intron|TMPRSS4_uc010rxs.1_Intron|TMPRSS4_uc009yzu.2_Intron	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CCTAAGACCACTCTCTCAGAAA	0.292													4	2	---	---	---	---	
CCDC84	338657	broad.mit.edu	37	11	118884214	118884214	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118884214delC	uc001pul.2	+						CCDC84_uc010ryk.1_Intron|CCDC84_uc010ryl.1_Intron|CCDC84_uc010rym.1_Intron	NM_198489	NP_940891	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84											ovary(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		cgctctgtcgcccaggctgga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119784288	119784288	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119784288delA								PVRL1 (184853 upstream) : TRIM29 (197707 downstream)																							agacacgtggaggcagactga	0.000													4	2	---	---	---	---	
PRDM10	56980	broad.mit.edu	37	11	129808855	129808855	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129808855delC	uc001qfm.2	-						PRDM10_uc001qfj.2_Intron|PRDM10_uc001qfk.2_Intron|PRDM10_uc001qfl.2_Intron|PRDM10_uc010sbx.1_Intron|PRDM10_uc001qfn.2_Intron|PRDM10_uc009zct.1_Intron	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		tgctgtttcACCCCCACAAGT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134856676	134856676	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134856676delA								B3GAT1 (574864 upstream) : None (None downstream)																							CTTGTAAAGTAACCTTTGTTT	0.294													4	2	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5766990	5766991	+	Intron	INS	-	CA	CA	rs142845354	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5766990_5766991insCA	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						TCACAGAATGGCATGTTCAAGG	0.465													2	4	---	---	---	---	
ALG10B	144245	broad.mit.edu	37	12	38710365	38710365	+	5'Flank	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38710365delT	uc001rln.3	+						ALG10B_uc001rlo.3_5'Flank|ALG10B_uc010skk.1_5'Flank	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				AAGAAGCGGCTTTTTTTTTTT	0.507											OREG0021733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48691928	48691928	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48691928delG								OR10AD1 (94853 upstream) : H1FNT (30835 downstream)																							tcacttttgtggtcatttttg	0.000													4	2	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51825389	51825389	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51825389delT	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		CCTTGTGGAATTTTTTTTTTG	0.483													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	84190517	84190517	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84190517delT								TMTC2 (662454 upstream) : None (None downstream)																							AAAGTGTGCATTCCTGTTGAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105940834	105940834	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105940834delT								C12orf75 (175539 upstream) : NUAK1 (516291 downstream)																							tcttacatcctgcctttgccc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113877374	113877374	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113877374delA								SDSL (1294 upstream) : LHX5 (23320 downstream)																							AATATTGAGGAAAGGGTAGGA	0.493											OREG0022142	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120146289	120146289	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120146289delT	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GAtttatttattttttttttt	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121548368	121548368	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121548368delA								OASL (71588 upstream) : P2RX7 (22310 downstream)																							AGGTCTTTACAAAGGGATTCC	0.279											OREG0022199	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
GLT1D1	144423	broad.mit.edu	37	12	129348881	129348881	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129348881delG	uc010tbh.1	+						GLT1D1_uc001uhx.1_Intron|GLT1D1_uc001uhy.1_Intron	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		GAGACAGGCTGGGAAGGCAGA	0.522													4	2	---	---	---	---	
SFRS8	6433	broad.mit.edu	37	12	132214442	132214442	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132214442delC	uc001uja.1	+						SFRS8_uc010tbn.1_Intron|SFRS8_uc001ujb.1_Intron|SFRS8_uc001uiz.1_Intron	NM_004592	NP_004583	Q12872	SFSWA_HUMAN	splicing factor, arginine/serine-rich 8						mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)		CTTTGCACTTCCCTTTTAGCA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42094768	42094768	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42094768delG								C13orf15 (49755 upstream) : KIAA0564 (46194 downstream)																							TGGAGGCCCAGGGGATGGAGG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88747524	88747525	+	IGR	INS	-	G	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88747524_88747525insG								SLITRK5 (415656 upstream) : None (None downstream)																							GCATTTTTTTTCAATACTGTTT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101422498	101422498	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101422498delT								TMTC4 (95395 upstream) : NALCN (283632 downstream)																							TTTCCACTACTTTTTTTTTTG	0.433													7	4	---	---	---	---	
FGF14	2259	broad.mit.edu	37	13	102543276	102543276	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102543276delT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCAAGAGCCTTTTTTTTTTC	0.458													15	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114074045	114074045	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114074045delA								GRTP1 (55582 upstream) : ADPRHL1 (2215 downstream)																							ggcagcagttaaaaaggcgca	0.060													4	2	---	---	---	---	
SLC7A7	9056	broad.mit.edu	37	14	23244438	23244442	+	Intron	DEL	CTTAT	-	-	rs71421155		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23244438_23244442delCTTAT	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TACTTTTTGCCTTATCTTAGAGCAG	0.429													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28311114	28311115	+	IGR	INS	-	T	T	rs143273411	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28311114_28311115insT								None (None upstream) : FOXG1 (925172 downstream)																							ctagttgctggtggttgccagc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	55280463	55280463	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55280463delC								SAMD4A (20430 upstream) : GCH1 (28261 downstream)																							CTTGCTATTTCATAAAAGCAC	0.468													4	2	---	---	---	---	
PRKCH	5583	broad.mit.edu	37	14	61858314	61858315	+	Intron	INS	-	TACTT	TACTT	rs141143597	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61858314_61858315insTACTT	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTGTGGAACTCTACGTCTTTGG	0.361													5	3	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89647259	89647260	+	Intron	INS	-	GCAGAGAACATGCATGGA	GCAGAGAACATGCATGGA	rs140257053	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647259_89647260insGCAGAGAACATGCATGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						agagacagagggcagagacaga	0.173													6	3	---	---	---	---	
PPP4R4	57718	broad.mit.edu	37	14	94716456	94716457	+	Intron	INS	-	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94716456_94716457insT	uc001ycs.1	+							NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						GGGTCAAATTATCTAGACTAGA	0.366													262	117	---	---	---	---	
GLRX5	51218	broad.mit.edu	37	14	96002080	96002080	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96002080delT	uc001yem.1	+						SNHG10_uc001yek.2_5'Flank|SNHG10_uc001yel.2_5'Flank	NM_016417	NP_057501	Q86SX6	GLRX5_HUMAN	glutaredoxin 5						cell redox homeostasis|hemopoiesis	mitochondrion	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding|protein disulfide oxidoreductase activity				0		all_cancers(154;0.135)		Epithelial(152;0.133)|COAD - Colon adenocarcinoma(157;0.21)|all cancers(159;0.212)		CTCTGCACGGTTAGGAAACTC	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21926084	21926084	+	IGR	DEL	G	-	-	rs77197518		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21926084delG								NF1P1 (791459 upstream) : LOC646214 (6430 downstream)																							ATAGGAGTCTGGGTTCACAGC	0.468													4	2	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40894859	40894860	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40894859_40894860insA	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		taattttgtattttggtagaga	0.000													4	3	---	---	---	---	
TMEM62	80021	broad.mit.edu	37	15	43473707	43473707	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43473707delT	uc001zqr.2	+						TMEM62_uc010bda.2_Intron|TMEM62_uc001zqt.2_Intron	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62							integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		CTAAAATACAtttttttttcc	0.179													4	2	---	---	---	---	
COPS2	9318	broad.mit.edu	37	15	49436173	49436174	+	Intron	INS	-	A	A	rs619506		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49436173_49436174insA	uc001zxf.2	-						COPS2_uc001zxh.2_Intron|COPS2_uc010ufa.1_Intron	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		acagagcgggGGAAAAAAAAAA	0.124													4	3	---	---	---	---	
AP4E1	23431	broad.mit.edu	37	15	51207351	51207353	+	Intron	DEL	ATT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51207351_51207353delATT	uc001zyx.1	+						AP4E1_uc010ufi.1_Intron|AP4E1_uc010ufj.1_Intron|AP4E1_uc010ufk.1_Intron	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CATGTATCACATTATAACCAAAT	0.291													4	2	---	---	---	---	
ALDH1A2	8854	broad.mit.edu	37	15	58471708	58471709	+	Intron	INS	-	TG	TG	rs147605496	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58471708_58471709insTG	uc010ugw.1	-						AQP9_uc010ugx.1_Intron|AQP9_uc002aez.2_Intron	NM_170697	NP_733798	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TTGTGGTATGAtgtgtgtgtgt	0.307													3	3	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65856307	65856307	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65856307delA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						actccatctcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66442386	66442387	+	Intron	DEL	TT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66442386_66442387delTT	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CATTTCACTCTTTGACTGAGTC	0.574													4	2	---	---	---	---	
CPEB1	64506	broad.mit.edu	37	15	83221050	83221050	+	Intron	DEL	T	-	-	rs67298411		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83221050delT	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_Intron|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron|CPEB1_uc002bip.2_Intron	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAAAGGTTGCTTTTTTTTTTT	0.443													3	4	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84707098	84707098	+	3'UTR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84707098delG	uc002bjz.3	+	30					ADAMTSL3_uc010bmu.1_3'UTR	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCTCTGGATAGGCTGTCACAC	0.413													4	2	---	---	---	---	
IQGAP1	8826	broad.mit.edu	37	15	91033686	91033701	+	Intron	DEL	GACTATGAAGGATGGC	-	-	rs72258709		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91033686_91033701delGACTATGAAGGATGGC	uc002bpl.1	+						IQGAP1_uc010uqg.1_Intron	NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AATGGACGGTGACTATGAAGGATGGCGACTATGAAG	0.449													5	4	---	---	---	---	
NPRL3	8131	broad.mit.edu	37	16	187993	187993	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:187993delT	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1						ATGATTTTAATTTTTTTTTTC	0.373													4	2	---	---	---	---	
C16orf91	283951	broad.mit.edu	37	16	1479062	1479064	+	Intron	DEL	GCA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1479062_1479064delGCA	uc010uvd.1	-							NM_001010878	NP_001010878	Q4G0I0	CSMT1_HUMAN	hypothetical protein LOC283951							integral to membrane					0						CTCACCTGGGGCATGGGCTCCCT	0.665													7	5	---	---	---	---	
TCEB2	6923	broad.mit.edu	37	16	2825271	2825271	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2825271delT	uc002crn.2	-						TCEB2_uc002crm.2_Intron	NM_007108	NP_009039	Q15370	ELOB_HUMAN	elongin B isoform a						positive regulation of viral transcription|protein complex assembly|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|nucleoplasm	protein binding				0						TGGTTGCTTCTTTTTTAAAAA	0.299													5	4	---	---	---	---	
DNAJA3	9093	broad.mit.edu	37	16	4475326	4475326	+	5'Flank	DEL	A	-	-	rs71402535		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4475326delA	uc002cwk.2	+						DNAJA3_uc002cwl.2_5'Flank|DNAJA3_uc010uxk.1_5'Flank	NM_005147	NP_005138	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3						activation of caspase activity|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of cell proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|neuromuscular junction development|positive regulation of apoptosis|positive regulation of protein ubiquitination|protein folding|protein folding|protein stabilization|response to heat|response to interferon-gamma	cytosol|mitochondrial matrix|mitochondrial nucleoid|nucleus	ATP binding|heat shock protein binding|interferon-gamma receptor binding|metal ion binding|NF-kappaB binding|protein kinase binding			ovary(2)|breast(2)	4						actctctgtcaaaaaaaaaaa	0.209													10	7	---	---	---	---	
COQ7	10229	broad.mit.edu	37	16	19085557	19085557	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19085557delA	uc002dfr.2	+						COQ7_uc002dfs.2_Intron	NM_016138	NP_057222	Q99807	COQ7_HUMAN	COQ7 protein						ubiquinone biosynthetic process	mitochondrial inner membrane|nucleus	oxidoreductase activity|transition metal ion binding			skin(1)	1						tcagtactttaaaaaaaaagg	0.000													4	3	---	---	---	---	
ZNF267	10308	broad.mit.edu	37	16	31928043	31928044	+	3'UTR	INS	-	TT	TT			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31928043_31928044insTT	uc002ecs.3	+	4						NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						TAGAGAAACACTATAGATGTAA	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32177847	32177848	+	IGR	DEL	TT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32177847_32177848delTT								HERC2P4 (13973 upstream) : TP53TG3B (506993 downstream)																							GATGCAATTGTTGACTCACCAA	0.361													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32177850	32177851	+	IGR	DEL	AC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32177850_32177851delAC								HERC2P4 (13976 upstream) : TP53TG3B (506990 downstream)																							GCAATTGTTGACTCACCAAGCT	0.366													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33941390	33941391	+	IGR	INS	-	T	T	rs148453508		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33941390_33941391insT								None (None upstream) : MIR1826 (24117 downstream)																							AATTTGTGGGATTTTTAAAAGC	0.317													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55005886	55005887	+	IGR	DEL	TC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005886_55005887delTC								IRX5 (37493 upstream) : IRX6 (352584 downstream)																							tctctttctttctctctttctt	0.000													9	5	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65527367	65527368	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65527367_65527368insA	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		AGGTGCCTTTTTTCTTAATTAC	0.337													4	2	---	---	---	---	
DDX19A	55308	broad.mit.edu	37	16	70399235	70399236	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70399235_70399236insA	uc002eyv.2	+						DDX19B_uc010vly.1_Intron|DDX19A_uc002eys.2_Intron|DDX19A_uc010cfq.1_Intron|DDX19A_uc010cfr.2_Intron|DDX19A_uc010cfs.2_Intron|DDX19A_uc010vlz.1_Intron|DDX19A_uc010vma.1_Intron	NM_018332	NP_060802	Q9NUU7	DD19A_HUMAN	DDX19-like protein						mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)				TTCGGTTGATTAAAAAAAAAAA	0.371													3	3	---	---	---	---	
PHLPP2	23035	broad.mit.edu	37	16	71710659	71710659	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71710659delT	uc002fax.2	-						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Intron	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						CTCTGTTTACttttttttttt	0.144													11	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80201653	80201653	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80201653delA								MAF (567031 upstream) : DYNLRB2 (373201 downstream)																							TTCCTGTGCTAAGCCTGATTT	0.507													4	2	---	---	---	---	
ZDHHC7	55625	broad.mit.edu	37	16	85017206	85017206	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85017206delG	uc002fiq.2	-						ZDHHC7_uc010voi.1_Intron|ZDHHC7_uc002fir.1_Intron	NM_017740	NP_060210	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7 isoform 2							integral to membrane	acyltransferase activity|protein binding|zinc ion binding			large_intestine(1)	1						GCCGCAATATGGGGAAGCTGT	0.478													4	2	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16596641	16596641	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16596641delT	uc002gqk.1	+							NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						tttttttttgttttttttttg	0.100													5	3	---	---	---	---	
SLC47A2	146802	broad.mit.edu	37	17	19584540	19584540	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19584540delA	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					acaaacaaacaaaaaaaaaaa	0.244													5	5	---	---	---	---	
UTP6	55813	broad.mit.edu	37	17	30219042	30219042	+	Intron	DEL	A	-	-	rs75602236		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30219042delA	uc002hgr.2	-						UTP6_uc010cst.2_Intron|UTP6_uc010wbw.1_Intron	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66						rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				actccgtctcaaaaaaaaaag	0.124													4	3	---	---	---	---	
KRT34	3885	broad.mit.edu	37	17	39537783	39537783	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39537783delA	uc002hwm.2	-							NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34						epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				AAACACTTCCAAAAAAAACCA	0.363													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39805937	39805938	+	Intron	DEL	CA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39805937_39805938delCA	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		acacgcagctcacacacacaca	0.282													4	2	---	---	---	---	
MRPL10	124995	broad.mit.edu	37	17	45905670	45905670	+	Intron	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45905670delC	uc002ilz.2	-						MRPL10_uc010wky.1_Intron|MRPL10_uc002ily.2_Intron	NM_145255	NP_660298	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10 precursor						ribosome biogenesis|translation	mitochondrial large ribosomal subunit	structural constituent of ribosome			ovary(1)	1						ATTCAGGAGGCCCACCCAATC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49429413	49429413	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49429413delA								UTP18 (54123 upstream) : CA10 (278262 downstream)																							cacattcttgaaaaagctttt	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53768204	53768204	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53768204delT								MMD (268863 upstream) : TMEM100 (28786 downstream)																							GGAGGTGGCCTTTTCTAAATA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55216821	55216821	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55216821delA								AKAP1 (18112 upstream) : MSI2 (116391 downstream)																							TTGCAAACTTAAAAAAAAAAG	0.403													6	4	---	---	---	---	
BRIP1	83990	broad.mit.edu	37	17	59941018	59941018	+	5'Flank	DEL	A	-	-	rs67822529		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59941018delA	uc002izk.1	-							NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						GAAGTCTCCGAAAAAAAAAAA	0.522			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61673450	61673450	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61673450delT								DCAF7 (1811 upstream) : TACO1 (4793 downstream)																							GAGAATTTAAttttttttttt	0.239													9	4	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64681109	64681109	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64681109delT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	AGGGTTGATGTTTTAGTGGGC	0.453													4	2	---	---	---	---	
FAM104A	84923	broad.mit.edu	37	17	71225112	71225113	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71225112_71225113insA	uc002jji.3	-						FAM104A_uc002jjj.3_Intron	NM_032837	NP_116226	Q969W3	F104A_HUMAN	hypothetical protein LOC84923 isoform 2												0			LUSC - Lung squamous cell carcinoma(166;0.197)			GGAGCCTGATCAAAATTTGCTA	0.470													4	2	---	---	---	---	
MGAT5B	146664	broad.mit.edu	37	17	74936257	74936257	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74936257delA	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						acaaatggggaaactgaggcc	0.189													4	2	---	---	---	---	
GAA	2548	broad.mit.edu	37	17	78081273	78081273	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78081273delG	uc002jxo.2	+						GAA_uc002jxp.2_Intron|GAA_uc002jxq.2_Intron	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	CAGGGCACCAGGGCCCGGGGG	0.721													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10197269	10197269	+	IGR	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10197269delG								VAPA (237252 upstream) : APCDD1 (257356 downstream)																							GAGGAGAAGTGGAAGGGCGTT	0.567													5	5	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10742799	10742800	+	Intron	INS	-	GTGC	GTGC	rs148838040	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10742799_10742800insGTGC	uc002kos.1	-						FAM38B_uc002kot.1_Intron			Q9H5I5	PIEZ2_HUMAN	SubName: Full=cDNA FLJ45725 fis, clone HCHON2009766; Flags: Fragment;							integral to membrane	ion channel activity			ovary(1)	1						TACATATTtgtgtgtgtgtgtg	0.262													4	2	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14808187	14808187	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14808187delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						CTAGGACTTATTTTTTTTTTG	0.333													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29845668	29845668	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29845668delA								MEP1B (45304 upstream) : FAM59A (1809 downstream)																							TTACAAAAAGAAAAAAAACGC	0.338													4	4	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42620288	42620289	+	Intron	INS	-	TAG	TAG	rs150044374	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42620288_42620289insTAG	uc010dni.2	+							NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		acttgatggattagtagcacct	0.163									Schinzel-Giedion_syndrome				4	2	---	---	---	---	
LIPG	9388	broad.mit.edu	37	18	47096076	47096076	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47096076delT	uc002ldv.2	+						LIPG_uc002ldu.1_Intron|LIPG_uc010xdh.1_Intron	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor						cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						CACAAGaaacttttttttttt	0.104													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59247507	59247507	+	IGR	DEL	A	-	-	rs7228899	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59247507delA								CDH20 (25142 upstream) : RNF152 (234797 downstream)																							GCTGAAACTGAACACAGCTCC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64123032	64123033	+	IGR	INS	-	G	G	rs150308063	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64123032_64123033insG								CDH7 (574858 upstream) : CDH19 (48288 downstream)																							ttttttttttttttgtttattt	0.000													15	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75075927	75075927	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75075927delT								GALR1 (93833 upstream) : None (None downstream)																							TTTCTCTCCATTTGGCAGGCA	0.473													4	2	---	---	---	---	
GAMT	2593	broad.mit.edu	37	19	1398602	1398602	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1398602delT	uc002lsj.2	-						uc002lsi.1_5'Flank	NM_000156	NP_000147	Q14353	GAMT_HUMAN	guanidinoacetate N-methyltransferase isoform a						creatine biosynthetic process|muscle contraction	cytosol	guanidinoacetate N-methyltransferase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Lung NSC(49;0.000195)|Breast(49;0.000231)|all_lung(49;0.000247)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Creatine(DB00148)	gcccagctagttttttgtatt	0.000													4	2	---	---	---	---	
C3	718	broad.mit.edu	37	19	6707071	6707071	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6707071delA	uc002mfm.2	-							NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CCCTGTCCCCACCCCGTGGGA	0.687													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22937568	22937568	+	IGR	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22937568delT								ZNF492 (87096 upstream) : ZNF99 (1441 downstream)																							GTATAAATTGTTTATTAAGAA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29227038	29227038	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29227038delC								LOC148189 (942190 upstream) : LOC148145 (229002 downstream)																							ctctcagcctcccccaagcta	0.000													1	5	---	---	---	---	
ZFP82	284406	broad.mit.edu	37	19	36898503	36898503	+	Intron	DEL	A	-	-	rs72206370		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36898503delA	uc002ody.1	-							NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						TTCTGAATTCAAACACAAAGT	0.358													4	2	---	---	---	---	
BBC3	27113	broad.mit.edu	37	19	47732436	47732437	+	Intron	DEL	AC	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47732436_47732437delAC	uc002pgf.3	-						BBC3_uc010xyl.1_Intron|BBC3_uc010eky.2_Intron|BBC3_uc010ekz.2_Intron|hsa-mir-3191|MI0014236_5'Flank	NM_014417	NP_055232	Q9BXH1	BBC3_HUMAN	BCL2 binding component 3 isoform 4						activation of caspase activity|activation of pro-apoptotic gene products|cellular response to hypoxia|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of growth|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|positive regulation of thymocyte apoptosis|protein insertion into mitochondrial membrane involved in induction of apoptosis|reduction of endoplasmic reticulum calcium ion concentration|release of cytochrome c from mitochondria|release of sequestered calcium ion into cytosol	cytosol|mitochondrial outer membrane	protein binding|protein binding				0		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)		GCAAACACAAACACACACACAC	0.515													5	3	---	---	---	---	
IRF3	3661	broad.mit.edu	37	19	50163242	50163249	+	Intron	DEL	ACACACAC	-	-	rs10626585		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50163242_50163249delACACACAC	uc010end.1	-						IRF3_uc002pos.1_Intron|IRF3_uc002pot.1_Intron|IRF3_uc002pox.1_Intron|IRF3_uc002poy.1_Intron|IRF3_uc002pou.2_Intron|IRF3_uc002pov.2_Intron|IRF3_uc002pow.2_Intron	NM_001571	NP_001562	Q14653	IRF3_HUMAN	interferon regulatory factor 3						interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTGTAGTTTTacacacacacacacacac	0.394													4	2	---	---	---	---	
IGLON5	402665	broad.mit.edu	37	19	51823928	51823929	+	Intron	DEL	TG	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51823928_51823929delTG	uc002pwc.2	+							NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor							extracellular region					0						tgcaaaggtttgtgtgtgtgtg	0.188													6	3	---	---	---	---	
TNNI3	7137	broad.mit.edu	37	19	55663540	55663541	+	Intron	DEL	TC	-	-	rs72301544		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55663540_55663541delTC	uc002qjg.3	-						TNNT1_uc002qjb.3_5'Flank|TNNT1_uc002qjc.3_5'Flank|TNNT1_uc002qje.3_5'Flank|TNNT1_uc002qjd.3_5'Flank|TNNT1_uc002qjf.2_5'Flank|TNNI3_uc010yft.1_Intron	NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac						cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		tcatgtactttctgtctttccc	0.208													5	5	---	---	---	---	
CST2	1470	broad.mit.edu	37	20	23806229	23806229	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23806229delT	uc002wtq.1	-							NM_001322	NP_001313	P09228	CYTT_HUMAN	cystatin SA precursor							extracellular region	cysteine-type endopeptidase inhibitor activity				0						ACACTGACTCTTTTTACCCAT	0.483													4	2	---	---	---	---	
FAM182A	284800	broad.mit.edu	37	20	26057337	26057337	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26057337delT	uc010gdq.2	+							NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0						GTTTCAGTACTTTTTTTTTGG	0.448													4	2	---	---	---	---	
POFUT1	23509	broad.mit.edu	37	20	30800084	30800084	+	Intron	DEL	T	-	-	rs6089214		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30800084delT	uc002wxp.2	+						POFUT1_uc002wxo.2_Intron|POFUT1_uc010ztt.1_Intron|POFUT1_uc010ztu.1_Intron	NM_015352	NP_056167	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1 isoform 1						fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity			breast(1)	1			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ttcttttttcttttttttttt	0.214													9	4	---	---	---	---	
DSN1	79980	broad.mit.edu	37	20	35396635	35396636	+	Intron	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35396635_35396636insA	uc010gfr.2	-						DSN1_uc002xfz.2_Intron|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Intron|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Intron|DSN1_uc002xgb.2_Intron	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				CATCTAAACTTAAAAAAAAAAA	0.193													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44056080	44056081	+	IGR	INS	-	GTG	GTG	rs143824542	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44056080_44056081insGTG								PIGT (1196 upstream) : WFDC2 (42313 downstream)																							GGACTTAACACGTGTTCCTTAT	0.505													2	4	---	---	---	---	
EYA2	2139	broad.mit.edu	37	20	45603526	45603526	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45603526delT	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				GTTGGGTGCCTTTTTGAAGGT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55114971	55114971	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55114971delA								C20orf107 (3397 upstream) : TFAP2C (89387 downstream)																							acaaGCAAacaaaaaaaaact	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56031577	56031578	+	IGR	INS	-	TTTTG	TTTTG	rs138213018	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56031577_56031578insTTTTG								RBM38 (47193 upstream) : CTCFL (32302 downstream)																							acttgactcctttttgttttgt	0.000													10	6	---	---	---	---	
COL20A1	57642	broad.mit.edu	37	20	61956557	61956557	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61956557delA	uc011aau.1	+						COL20A1_uc011aav.1_Intron	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					TGTGACCCAGAGGGGCCACAG	0.662													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAGGAAAAGTTATGTATAT	0.124													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	27797137	27797137	+	IGR	DEL	C	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27797137delC								APP (253691 upstream) : CYYR1 (41392 downstream)																							gagatgagttcagacaaattg	0.000													4	2	---	---	---	---	
CYYR1	116159	broad.mit.edu	37	21	27896237	27896237	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27896237delT	uc002ymd.2	-						CYYR1_uc011ack.1_Intron|CYYR1_uc002yme.2_Intron	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0						ACTGGGACTATTTCCCCATAA	0.313													4	2	---	---	---	---	
FAM3B	54097	broad.mit.edu	37	21	42717950	42717950	+	Intron	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42717950delA	uc002yzb.1	+						FAM3B_uc002yza.2_Intron|FAM3B_uc002yzc.1_Intron|FAM3B_uc002yzd.1_Intron|FAM3B_uc011aeq.1_3'UTR	NM_058186	NP_478066	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B						apoptosis|insulin secretion	extracellular space	cytokine activity				0		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				CCttttttttaaaaaaaaaaa	0.318													4	3	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45815583	45815584	+	Intron	INS	-	G	G	rs67276218		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45815583_45815584insG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						agggctgtggaggatgtggagg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16955063	16955065	+	IGR	DEL	ATT	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16955063_16955065delATT								OR11H1 (505259 upstream) : CCT8L2 (116583 downstream)																							TATGTCTCTCATTATTTTGGTAA	0.187													12	8	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26180373	26180373	+	Intron	DEL	G	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26180373delG	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						aagtagagtagggggcccatt	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34543770	34543771	+	IGR	INS	-	G	G	rs146109654	by1000genomes	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34543770_34543771insG								LARGE (225186 upstream) : ISX (918358 downstream)																							gtccatgagatggcatgttgtg	0.198													11	6	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44177789	44177792	+	Intron	DEL	TATA	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44177789_44177792delTATA	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				AGTGAGTTTTTATATATAtaagcc	0.025													4	2	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16608663	16608663	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16608663delT	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					TGTACTTATATTTTTTTTTTC	0.363													4	2	---	---	---	---	
NCRNA00182	100302692	broad.mit.edu	37	X	73393541	73393542	+	Intron	DEL	TG	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73393541_73393542delTG	uc010nlq.1	-											Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						tgtgcgtatatgtgtgtgtgtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	101033639	101033640	+	IGR	INS	-	A	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101033639_101033640insA								ARMCX2 (118776 upstream) : NXF5 (53445 downstream)																							TGTGGATGTTTAAAAAAAAAAA	0.421													4	2	---	---	---	---	
RHOXF2B	727940	broad.mit.edu	37	X	119209632	119209632	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119209632delT	uc004esj.3	-						uc004esi.1_Intron	NM_032498	NP_115887	P0C7M4	RHF2B_HUMAN	Rhox homeobox family, member 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TCAGTACTCATTTTTTTTTCC	0.274													4	2	---	---	---	---	
CLIC2	1193	broad.mit.edu	37	X	154521949	154521949	+	Intron	DEL	T	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154521949delT	uc004fnf.2	-						CLIC2_uc010nvj.1_Intron	NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2						signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tagtcccagctactcgggagg	0.000													6	4	---	---	---	---	
CLIC2	1193	broad.mit.edu	37	X	154521951	154521952	+	Intron	INS	-	T	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154521951_154521952insT	uc004fnf.2	-						CLIC2_uc010nvj.1_Intron	NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2						signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gtcccagctactcgggaggctg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9954147	9954147	+	IGR	DEL	A	-	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9954147delA								TTTY22 (303293 upstream) : None (None downstream)																							caaaaaaaataaaaataaaat	0.000													3	4	---	---	---	---	
