Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
EXOSC10	5394	broad.mit.edu	37	1	11128077	11128077	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11128077C>G	uc001asa.2	-	24	2665	c.2615G>C	c.(2614-2616)GGA>GCA	p.G872A	EXOSC10_uc001asb.2_Missense_Mutation_p.G847A	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1	872					CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GTCTGACTTTCCAGTTGGAAA	0.527													37	164	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12921762	12921762	+	3'UTR	SNP	A	C	C	rs2473041		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12921762A>C	uc001aum.1	+	4						NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ataattccaaaatttttatta	0.139													3	7	---	---	---	---	PASS
PADI4	23569	broad.mit.edu	37	1	17668532	17668532	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17668532C>T	uc001baj.2	+	7	775	c.747C>T	c.(745-747)TTC>TTT	p.F249F	PADI4_uc009vpc.2_Silent_p.F249F	NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	249					chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	ACATGGACTTCTACGTGGAGG	0.602													3	51	---	---	---	---	PASS
FAM54B	56181	broad.mit.edu	37	1	26153147	26153147	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26153147C>A	uc001bkq.3	+	5	491	c.281C>A	c.(280-282)CCT>CAT	p.P94H	FAM54B_uc001bkr.3_Missense_Mutation_p.P94H|FAM54B_uc010oet.1_Missense_Mutation_p.P127H|FAM54B_uc009vrz.2_Missense_Mutation_p.P91H|FAM54B_uc001bks.3_Missense_Mutation_p.P94H|FAM54B_uc001bkt.3_Missense_Mutation_p.P94H|FAM54B_uc001bku.3_Missense_Mutation_p.P91H|FAM54B_uc001bkv.3_5'UTR	NM_001099625	NP_001093095	Q9H019	FA54B_HUMAN	hypothetical protein LOC56181 isoform a	94										pancreas(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)		AAACCCAGCCCTCTGATTGTC	0.597													14	29	---	---	---	---	PASS
FAF1	11124	broad.mit.edu	37	1	51121125	51121125	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51121125T>C	uc009vyx.1	-	9	796	c.733A>G	c.(733-735)ACA>GCA	p.T245A	FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Missense_Mutation_p.T245A	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1	245					apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		GAGTCGTCTGTAGCAGAAGTT	0.388													6	405	---	---	---	---	PASS
NRD1	4898	broad.mit.edu	37	1	52266344	52266344	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52266344C>T	uc001ctc.3	-	23	2851	c.2529G>A	c.(2527-2529)CAG>CAA	p.Q843Q	NRD1_uc009vzb.2_Silent_p.Q538Q|NRD1_uc001ctd.3_Silent_p.Q775Q|NRD1_uc001cte.2_Silent_p.Q711Q|NRD1_uc001ctf.2_Silent_p.Q775Q|NRD1_uc010ong.1_RNA	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	774					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						CAATAATGAGCTGAAACAGTA	0.378													4	228	---	---	---	---	PASS
TMEM59	9528	broad.mit.edu	37	1	54506474	54506474	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54506474A>C	uc001cwp.2	-	6	912	c.662T>G	c.(661-663)TTT>TGT	p.F221C	TMEM59_uc001cwn.2_Missense_Mutation_p.F85C|TMEM59_uc001cwo.2_Missense_Mutation_p.F84C|TMEM59_uc001cwq.2_Missense_Mutation_p.F222C|TMEM59_uc001cwr.2_Missense_Mutation_p.F154C|TMEM59_uc001cws.1_Missense_Mutation_p.F233C	NM_004872	NP_004863	Q9BXS4	TMM59_HUMAN	thymic dendritic cell-derived factor 1	221	Extracellular (Potential).					Golgi membrane|integral to membrane					0						ATCTTCAAGAAAATTCCTGTG	0.343													66	259	---	---	---	---	PASS
JUN	3725	broad.mit.edu	37	1	59247909	59247909	+	Silent	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59247909G>C	uc001cze.2	-	1	1877	c.834C>G	c.(832-834)GCC>GCG	p.A278A	uc001czf.2_5'Flank|uc010oop.1_5'Flank	NM_002228	NP_002219	P05412	JUN_HUMAN	jun oncogene	278					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding				0	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)	CCTCCAGCCGGGCGATTCTCT	0.562			A		sarcoma						OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	130	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87041054	87041054	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87041054C>T	uc009wcs.2	+	11	1767	c.1723C>T	c.(1723-1725)CCA>TCA	p.P575S	CLCA4_uc009wct.2_Missense_Mutation_p.P338S|CLCA4_uc009wcu.2_Missense_Mutation_p.P395S	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	575						apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		CAAAGCGAACCCAGAAACATT	0.378													4	128	---	---	---	---	PASS
DBT	1629	broad.mit.edu	37	1	100681606	100681606	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100681606C>G	uc001dta.2	-	6	738	c.705G>C	c.(703-705)ATG>ATC	p.M235I	DBT_uc010oug.1_Missense_Mutation_p.M54I	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase	235					branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		TAGGAACAGTCATGTCTTTTG	0.373													12	708	---	---	---	---	PASS
SIKE1	80143	broad.mit.edu	37	1	115322762	115322762	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115322762T>C	uc001efo.3	-	2	314	c.234A>G	c.(232-234)ACA>ACG	p.T78T	SIKE1_uc001efp.3_Silent_p.T82T	NM_025073	NP_079349	Q9BRV8	SIKE1_HUMAN	suppressor of IKK epsilon isoform 2	78	Potential.					cytosol	protein binding				0						CTCTAATCTGTGTGTTCTCTT	0.383													7	465	---	---	---	---	PASS
RFX5	5993	broad.mit.edu	37	1	151318787	151318787	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151318787C>T	uc001exv.1	-	3	224	c.10G>A	c.(10-12)GAT>AAT	p.D4N	RFX5_uc001exw.1_Missense_Mutation_p.D4N|RFX5_uc009wmr.1_Missense_Mutation_p.D4N|RFX5_uc010pcx.1_Missense_Mutation_p.D4N	NM_001025603	NP_001020774	P48382	RFX5_HUMAN	regulatory factor X, 5	4						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCAGGCTCATCTTCTGCCATC	0.602													3	35	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155932492	155932492	+	Silent	SNP	C	G	G	rs75834511	byFrequency	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155932492C>G	uc001fmt.2	-	9	1111	c.993G>C	c.(991-993)GCG>GCC	p.A331A	ARHGEF2_uc001fmr.2_Silent_p.A303A|ARHGEF2_uc001fms.2_Silent_p.A330A|ARHGEF2_uc001fmu.2_Silent_p.A375A|ARHGEF2_uc010pgt.1_Silent_p.A304A|ARHGEF2_uc010pgu.1_Silent_p.A376A	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	331	DH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACATCTGCTCCGCACTAGGAC	0.537													17	86	---	---	---	---	PASS
OR10J5	127385	broad.mit.edu	37	1	159505240	159505240	+	Silent	SNP	A	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159505240A>C	uc010piw.1	-	1	558	c.558T>G	c.(556-558)CTT>CTG	p.L186L		NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)					CAATGCAAGAAAGTTTCATGA	0.393													12	77	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173526501	173526501	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173526501C>T	uc001giz.2	-	10	1616	c.1193G>A	c.(1192-1194)CGA>CAA	p.R398Q	SLC9A11_uc009wwe.2_5'UTR|SLC9A11_uc010pmq.1_RNA	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	398					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						TTCCACTTTTCGTTCAGCGAG	0.363													47	313	---	---	---	---	PASS
CDC73	79577	broad.mit.edu	37	1	193181526	193181526	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193181526G>A	uc001gtb.2	+	13	1316	c.1073G>A	c.(1072-1074)CGA>CAA	p.R358Q		NM_024529	NP_078805	Q6P1J9	CDC73_HUMAN	parafibromin	358					cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						ATAGGATCTCGAACACCCATT	0.279									Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				42	303	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205084987	205084987	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205084987T>C	uc001hbu.1	-	2	174	c.44A>G	c.(43-45)GAG>GGG	p.E15G	RBBP5_uc010prd.1_Missense_Mutation_p.E50G|RBBP5_uc001hbv.1_Missense_Mutation_p.E15G|RBBP5_uc010pre.1_5'UTR	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	15					histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			TACTCTTACCTCTGGATAGTT	0.378													76	452	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207304992	207304992	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207304992C>T	uc001hfo.2	+	8	1185	c.991C>T	c.(991-993)CGC>TGC	p.R331C		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	331	Sushi 5.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						GTTAAGGTACCGCTGTCATCC	0.443													41	265	---	---	---	---	PASS
TAF5L	27097	broad.mit.edu	37	1	229730080	229730080	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229730080C>T	uc001htq.2	-	5	1900	c.1734G>A	c.(1732-1734)CTG>CTA	p.L578L		NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	578					histone H3 acetylation|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				TTCCAGTCACCAGAAGAAGGT	0.507													9	109	---	---	---	---	PASS
SLC35F3	148641	broad.mit.edu	37	1	234458836	234458836	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234458836C>T	uc001hwa.1	+	7	1341	c.1113C>T	c.(1111-1113)CTC>CTT	p.L371L	SLC35F3_uc001hvy.1_Silent_p.L440L	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	371	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GTTTTCTCCTCCTGCTCCTGC	0.562											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	151	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235904812	235904812	+	Silent	SNP	G	A	A	rs141534829	byFrequency	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235904812G>A	uc001hxj.2	-	31	8443	c.8268C>T	c.(8266-8268)CAC>CAT	p.H2756H	LYST_uc009xga.1_Silent_p.H392H	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	2756					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTTGTGCAGCGTGGGCTGGCG	0.438									Chediak-Higashi_syndrome				6	528	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004613	248004613	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004613C>T	uc001idn.1	-	1	586	c.586G>A	c.(586-588)GAG>AAG	p.E196K		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATGGTCACCTCGGTGATATAA	0.478													5	113	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33174014	33174014	+	Splice_Site	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33174014T>C	uc002ros.2	+	2	565	c.565_splice	c.e2+2	p.P189_splice		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GCACCAAACGTAAGTTGCCAT	0.582													4	142	---	---	---	---	PASS
C2orf89	129293	broad.mit.edu	37	2	85066361	85066361	+	Silent	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85066361G>T	uc010ysl.1	-	4	992	c.903C>A	c.(901-903)ATC>ATA	p.I301I	C2orf89_uc002sou.3_Silent_p.I252I|C2orf89_uc002sov.2_RNA|C2orf89_uc010fgc.1_Silent_p.I301I	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	301	Extracellular (Potential).					integral to membrane				ovary(1)	1						TCCGCTTGTAGATCAGCTCCC	0.507													32	157	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	113999705	113999705	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113999705G>A	uc010yxt.1	-	6	647	c.481C>T	c.(481-483)CCC>TCC	p.P161S	PAX8_uc010yxu.1_Missense_Mutation_p.P161S|PAX8_uc010yxv.1_Missense_Mutation_p.P161S|PAX8_uc002tjm.2_Missense_Mutation_p.P161S|PAX8_uc002tjn.2_Missense_Mutation_p.P161S|PAX8_uc010fku.1_Missense_Mutation_p.P161S|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	161					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						GCTGAGCTGGGGACTGCAGTG	0.642			T	PPARG	follicular thyroid		Thyroid dysgenesis 						3	33	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118704388	118704388	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118704388T>C	uc002tlj.2	-	16	1421	c.1295A>G	c.(1294-1296)AAG>AGG	p.K432R	CCDC93_uc010fld.1_Missense_Mutation_p.K432R	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	432										large_intestine(1)|ovary(1)	2						AGCCTTTACCTTTTCATCTCC	0.418													7	526	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832626	130832626	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832626C>T	uc010fmh.2	-	17	2819	c.2419G>A	c.(2419-2421)GAG>AAG	p.E807K		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	807	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						AGGGTGGCCTCGGTCAGCAGG	0.587													9	26	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141356243	141356243	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141356243A>G	uc002tvj.1	-	43	8123	c.7151T>C	c.(7150-7152)CTA>CCA	p.L2384P		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2384	Extracellular (Potential).|LDL-receptor class B 26.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATTTTTCCTAGACTGCCATC	0.378										TSP Lung(27;0.18)			6	507	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160206389	160206389	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160206389G>C	uc002uao.2	-	28	5045	c.4693C>G	c.(4693-4695)CGA>GGA	p.R1565G	BAZ2B_uc002uap.2_Missense_Mutation_p.R1529G	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1565					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CAGGGTGTTCGTGGCAAAAGA	0.458													17	217	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160628524	160628524	+	Silent	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160628524C>A	uc002ubb.3	-	39	5529	c.5460G>T	c.(5458-5460)ACG>ACT	p.T1820T	LY75_uc010fos.2_Silent_p.T1764T|CD302_uc002uba.2_Silent_p.T179T|CD302_uc010zco.1_Silent_p.T121T	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TCAAAATTACCGTGCTAGCAA	0.368													5	319	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179500354	179500354	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179500354T>C	uc010zfg.1	-	176	34217	c.33993A>G	c.(33991-33993)AAA>AAG	p.K11331K	TTN_uc010zfh.1_Silent_p.K5026K|TTN_uc010zfi.1_Silent_p.K4959K|TTN_uc010zfj.1_Silent_p.K4834K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12258							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGAGTATCTTTTGCTATAT	0.388													7	515	---	---	---	---	PASS
SLC19A3	80704	broad.mit.edu	37	2	228563604	228563604	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228563604T>G	uc002vpi.2	-	3	916	c.827A>C	c.(826-828)AAA>ACA	p.K276T	SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Missense_Mutation_p.K272T	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN	solute carrier family 19, member 3	276	Cytoplasmic (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GAAAAGACGTTTTGAGGAGTA	0.468													23	116	---	---	---	---	PASS
SLC6A6	6533	broad.mit.edu	37	3	14489106	14489106	+	Silent	SNP	C	T	T	rs137993719		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14489106C>T	uc010heg.2	+	12	672	c.381C>T	c.(379-381)TCC>TCT	p.S127S	SLC6A6_uc003byp.2_Silent_p.S127S|SLC6A6_uc010hef.1_RNA|SLC6A6_uc003byq.2_Silent_p.S127S|SLC6A6_uc003byr.2_RNA	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter	127	Helical; Name=3; (Potential).				cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						GCTATGCCTCCGTTGTAATTG	0.547													5	197	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14862883	14862883	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14862883G>A	uc003bzc.2	+	1	2415	c.2305G>A	c.(2305-2307)GCT>ACT	p.A769T	FGD5_uc011avk.1_Missense_Mutation_p.A769T	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	769					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CTTCCCCAGCGCTGACACTTC	0.592													8	44	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52668807	52668807	+	Nonsense_Mutation	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668807G>C	uc003des.2	-	11	1124	c.1112C>G	c.(1111-1113)TCA>TGA	p.S371*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.S371*|PBRM1_uc003der.2_Nonsense_Mutation_p.S339*|PBRM1_uc003det.2_Nonsense_Mutation_p.S371*|PBRM1_uc003deu.2_Nonsense_Mutation_p.S371*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.S371*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.S371*|PBRM1_uc003dey.2_Nonsense_Mutation_p.S371*|PBRM1_uc003dez.1_Nonsense_Mutation_p.S371*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.S269*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	371					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.S371fs*14(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCTGCTTCTGACTCTCCCTC	0.368			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								18	92	---	---	---	---	PASS
KBTBD8	84541	broad.mit.edu	37	3	67054073	67054073	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67054073A>G	uc003dmy.2	+	3	735	c.682A>G	c.(682-684)AGA>GGA	p.R228G	KBTBD8_uc011bfv.1_Intron	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN	T-cell activation kelch repeat protein	228	BACK.									ovary(2)|large_intestine(1)|breast(1)	4		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		ACAGAATGAAAGAGAAGTGCA	0.373													6	260	---	---	---	---	PASS
PLSCR1	5359	broad.mit.edu	37	3	146239399	146239399	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146239399T>C	uc003evx.3	-	7	1058	c.670A>G	c.(670-672)AGA>GGA	p.R224G	PLSCR1_uc003evy.3_Missense_Mutation_p.R217G|PLSCR1_uc011bnn.1_Missense_Mutation_p.R143G|PLSCR1_uc003evz.3_Intron	NM_021105	NP_066928	O15162	PLS1_HUMAN	phospholipid scramblase 1	224	Cytoplasmic.				phospholipid scrambling|platelet activation|response to virus	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding			ovary(2)	2						ACATCCTCTCTTTTCTCATTT	0.368													8	664	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151100523	151100523	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151100523G>T	uc003eyp.2	+	31	4603	c.4565G>T	c.(4564-4566)CGC>CTC	p.R1522L	MED12L_uc011bnz.1_Missense_Mutation_p.R1382L|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Missense_Mutation_p.R685L	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1522					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGCAACTCCGCCTAAATTTG	0.388													10	170	---	---	---	---	PASS
MFSD1	64747	broad.mit.edu	37	3	158545109	158545109	+	Silent	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158545109A>T	uc003fcl.1	+	15	1407	c.1377A>T	c.(1375-1377)ATA>ATT	p.I459I	MFSD1_uc003fcm.1_RNA|MFSD1_uc003fcn.1_Silent_p.I362I|MFSD1_uc011bow.1_Silent_p.I420I|MFSD1_uc011box.1_Silent_p.I386I	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing	459					transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGGAAGAAATAAAATTTTCCC	0.284													64	275	---	---	---	---	PASS
CCDC149	91050	broad.mit.edu	37	4	24810062	24810062	+	Silent	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24810062G>A	uc011bxr.1	-	13	1683	c.1539C>T	c.(1537-1539)GAC>GAT	p.D513D	CCDC149_uc003grc.2_Silent_p.D513D|CCDC149_uc003grb.2_RNA|CCDC149_uc003grd.2_3'UTR|CCDC149_uc003gra.1_5'Flank|CCDC149_uc011bxq.1_Silent_p.D386D	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1	513											0		Breast(46;0.173)				TCCCTTTGCCGTCTTCCGGTG	0.617													7	22	---	---	---	---	PASS
LGI2	55203	broad.mit.edu	37	4	25032128	25032128	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25032128A>G	uc003grf.2	-	1	287	c.188T>C	c.(187-189)ATC>ACC	p.I63T		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	63	LRRNT.					extracellular region					0		Breast(46;0.173)				CAGGGAGCTGATGTCGCCCGG	0.716													3	8	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69817431	69817431	+	Silent	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69817431G>A	uc003hef.2	-	1	79	c.48C>T	c.(46-48)TTC>TTT	p.F16F	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	16						integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						AGCCAACACAGAAGAGCTGCA	0.473													9	54	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	256578	256578	+	3'UTR	SNP	T	C	C	rs150891426		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:256578T>C	uc003jao.3	+	15					SDHA_uc011clw.1_3'UTR|SDHA_uc003jap.3_3'UTR|SDHA_uc003jaq.3_3'UTR|SDHA_uc003jar.3_3'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TTTGTAATTATGTATAATAGC	0.468									Familial_Paragangliomas				6	65	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	482713	482713	+	Silent	SNP	G	A	A	rs150200197		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:482713G>A	uc003jbe.2	-	7	1418	c.1306C>T	c.(1306-1308)CTG>TTG	p.L436L	SLC9A3_uc011clx.1_Silent_p.L436L	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	436	Helical; Name=M/M10; (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CTGACGAACAGGTTCTTCTCC	0.652													11	18	---	---	---	---	PASS
MED10	84246	broad.mit.edu	37	5	6372701	6372701	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6372701A>T	uc003jdo.2	-	4	366	c.323T>A	c.(322-324)CTG>CAG	p.L108Q		NM_032286	NP_115662	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	108					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(1)	1						TTGAATCAACAGGCTTTTAAA	0.393													52	178	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10426508	10426508	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10426508G>A	uc003jet.1	+	24	2563	c.2380G>A	c.(2380-2382)GCA>ACA	p.A794T	MARCH6_uc011cmu.1_Missense_Mutation_p.A746T|MARCH6_uc003jeu.1_Missense_Mutation_p.A492T|MARCH6_uc011cmv.1_Missense_Mutation_p.A689T	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	794	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TCAGGTTTACGCAAATGGCAT	0.413													14	781	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26881222	26881222	+	3'UTR	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26881222A>G	uc003jgs.1	-	12					CDH9_uc011cnv.1_3'UTR	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TTCCACTAATATTGATTAAGT	0.398													31	126	---	---	---	---	PASS
CDC20B	166979	broad.mit.edu	37	5	54415634	54415634	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54415634A>C	uc003jpo.1	-	11	1629	c.1454T>G	c.(1453-1455)TTT>TGT	p.F485C	CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Missense_Mutation_p.F443C	NM_152623	NP_689836	Q86Y33	CD20B_HUMAN	CDC20 cell division cycle 20 homolog B isoform	485											0		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			CTTACCAAAAAACCCACCTGA	0.463													54	206	---	---	---	---	PASS
IQGAP2	10788	broad.mit.edu	37	5	75932958	75932958	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75932958C>T	uc003kek.2	+	16	2102	c.1880C>T	c.(1879-1881)TCA>TTA	p.S627L	IQGAP2_uc010izv.2_Missense_Mutation_p.S180L|IQGAP2_uc011csv.1_Missense_Mutation_p.S180L|IQGAP2_uc003kel.2_Missense_Mutation_p.S180L	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	627	WW.				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ACACCTGAATCATGCTTGTAT	0.388													51	328	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79033431	79033431	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79033431C>T	uc003kgc.2	+	2	8915	c.8843C>T	c.(8842-8844)TCT>TTT	p.S2948F		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2948						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGTATCATTTCTGAAGGCTGT	0.378													7	87	---	---	---	---	PASS
PKD2L2	27039	broad.mit.edu	37	5	137257415	137257415	+	Silent	SNP	T	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137257415T>G	uc003lby.2	+	9	1475	c.1419T>G	c.(1417-1419)ACT>ACG	p.T473T	PKD2L2_uc003lbw.1_Silent_p.T473T|PKD2L2_uc003lbx.2_Intron|PKD2L2_uc011cyi.1_Silent_p.T81T	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	473	Helical; (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACTTCATCACTTTCATCTTTT	0.294													116	618	---	---	---	---	PASS
SH3TC2	79628	broad.mit.edu	37	5	148418045	148418045	+	Missense_Mutation	SNP	G	A	A	rs146143252		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148418045G>A	uc003lpu.2	-	8	966	c.814C>T	c.(814-816)CGC>TGC	p.R272C	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_Translation_Start_Site|SH3TC2_uc010jgx.2_Missense_Mutation_p.R265C|SH3TC2_uc003lpv.1_Translation_Start_Site|SH3TC2_uc011dbz.1_Missense_Mutation_p.R157C	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	272	SH3.						binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTTACAGCGTCCTCTGCCT	0.448													5	146	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161277823	161277823	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161277823A>T	uc010jiw.2	+	3	475	c.7A>T	c.(7-9)AAA>TAA	p.K3*	GABRA1_uc010jix.2_Nonsense_Mutation_p.K3*|GABRA1_uc010jiy.2_Nonsense_Mutation_p.K3*|GABRA1_uc003lyx.3_Nonsense_Mutation_p.K3*|GABRA1_uc010jiz.2_Nonsense_Mutation_p.K3*|GABRA1_uc010jja.2_Nonsense_Mutation_p.K3*|GABRA1_uc010jjb.2_Nonsense_Mutation_p.K3*	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	3					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	CGCGATGAGGAAAAGTCCAGG	0.468													36	176	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180424341	180424341	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180424341T>C	uc003mmr.2	+	3	654	c.526T>C	c.(526-528)TCT>CCT	p.S176P		NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	176	Ig-like V-type.|Extracellular (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			ACAGGATTTGTCTTCAGACTC	0.507													7	314	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25777032	25777032	+	Intron	SNP	T	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25777032T>A	uc003nfe.2	+						SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Silent_p.P160P|SLC17A4_uc003nfg.2_Intron|SLC17A4_uc010jqa.2_Intron	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						TTTGTCCTCCTACCCCAGGGG	0.552													18	101	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27419840	27419840	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27419840T>C	uc003njj.2	-	5	2309	c.1498A>G	c.(1498-1500)AAG>GAG	p.K500E	ZNF184_uc010jqv.2_Missense_Mutation_p.K500E|ZNF184_uc003nji.2_Missense_Mutation_p.K500E	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	500					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TCAAAGGGCTTTTCTCTCGTG	0.383													5	192	---	---	---	---	PASS
GTPBP2	54676	broad.mit.edu	37	6	43592732	43592732	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43592732A>T	uc003ovs.2	-	6	810	c.773T>A	c.(772-774)TTC>TAC	p.F258Y	GTPBP2_uc010jyv.2_Missense_Mutation_p.F170Y|GTPBP2_uc003ovt.1_Missense_Mutation_p.F258Y	NM_019096	NP_061969	Q9BX10	GTPB2_HUMAN	GTP binding protein 2	258							GTP binding|GTPase activity			liver(1)|skin(1)	2	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CAGGTCGATGAAGGTGATCAT	0.582													22	97	---	---	---	---	PASS
GSTA2	2939	broad.mit.edu	37	6	52622679	52622679	+	Silent	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52622679G>A	uc003pay.2	-	2	217	c.67C>T	c.(67-69)CTG>TTG	p.L23L		NM_000846	NP_000837	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	23	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)	GCTGCAGCCAGGAGCCACCGG	0.483													40	208	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56350189	56350189	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56350189C>G	uc003pdf.2	-	82	14799	c.14771G>C	c.(14770-14772)AGA>ACA	p.R4924T	DST_uc003pcz.3_Missense_Mutation_p.R4746T|DST_uc011dxj.1_Missense_Mutation_p.R4775T|DST_uc011dxk.1_Missense_Mutation_p.R4786T|DST_uc003pcy.3_Missense_Mutation_p.R4420T|DST_uc003pda.3_Missense_Mutation_p.R116T	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6832	Spectrin 19.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGGTTCAACTCTATATAACCA	0.408													6	278	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64423156	64423156	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64423156G>A	uc003pep.1	+	15	5698	c.5672G>A	c.(5671-5673)CGG>CAG	p.R1891Q	PHF3_uc003pen.2_Missense_Mutation_p.R1803Q|PHF3_uc011dxs.1_Missense_Mutation_p.R1160Q	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1891					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAAGACATTCGGAGGCCAGAA	0.498													5	63	---	---	---	---	PASS
IRAK1BP1	134728	broad.mit.edu	37	6	79607607	79607607	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79607607A>G	uc003pim.2	+	3	548	c.443A>G	c.(442-444)AAG>AGG	p.K148R	IRAK1BP1_uc010kbg.1_RNA|IRAK1BP1_uc003pin.2_Missense_Mutation_p.K61R	NM_001010844	NP_001010844	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1	148					I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus					0		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		CTTGTTGAAAAGCTAGATAGC	0.338													8	513	---	---	---	---	PASS
FIG4	9896	broad.mit.edu	37	6	110053850	110053850	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110053850A>G	uc003ptt.2	+	5	672	c.457A>G	c.(457-459)ATA>GTA	p.I153V	FIG4_uc011eau.1_Missense_Mutation_p.I7V	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	153					cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		GTATCTACGAATATTTCAAAA	0.274													67	356	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117665413	117665413	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117665413A>T	uc003pxp.1	-	27	4533	c.4334T>A	c.(4333-4335)CTG>CAG	p.L1445Q	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1445	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGCTAGAGACAGAAACGCTTT	0.338			T	GOPC|ROS1	glioblastoma|NSCLC								66	377	---	---	---	---	PASS
DCBLD1	285761	broad.mit.edu	37	6	117853545	117853545	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117853545T>C	uc003pxs.2	+	6	833	c.708T>C	c.(706-708)GTT>GTC	p.V236V	GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Silent_p.V236V	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	236	LCCL.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		CCAATGGTGTTCTTTCGAGGG	0.433													8	704	---	---	---	---	PASS
TAAR2	9287	broad.mit.edu	37	6	132938953	132938953	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132938953A>G	uc003qdl.1	-	2	392	c.392T>C	c.(391-393)ATT>ACT	p.I131T	TAAR2_uc010kfr.1_Missense_Mutation_p.I86T	NM_001033080	NP_001028252	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	131	Helical; Name=3; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		AAGATGAAAAATGGATGTTAT	0.338													22	102	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136932484	136932484	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136932484C>A	uc003qhc.2	-	18	2818	c.2457G>T	c.(2455-2457)AAG>AAT	p.K819N	MAP3K5_uc011edj.1_Missense_Mutation_p.K66N|MAP3K5_uc011edk.1_Missense_Mutation_p.K664N	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	819	Protein kinase.				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGTCAGAGATCTTGAGAACAC	0.373													76	373	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160227045	160227045	+	Silent	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160227045G>C	uc003qsx.1	+	7	630	c.459G>C	c.(457-459)GTG>GTC	p.V153V	PNLDC1_uc003qsy.1_Silent_p.V164V	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	153	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TCAAGGTGGTGATTGACGAAG	0.517													13	177	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1478560	1478560	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1478560G>A	uc003skj.3	-	10	2185	c.2038C>T	c.(2038-2040)CTT>TTT	p.L680F	MICALL2_uc003skh.3_5'UTR|MICALL2_uc003ski.3_Missense_Mutation_p.L167F	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	680						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		TCCGGCCGAAGCCAGTTGTCA	0.672													9	36	---	---	---	---	PASS
GTF2IRD1	9569	broad.mit.edu	37	7	73973274	73973274	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73973274C>A	uc003uaq.2	+	21	2629	c.2236C>A	c.(2236-2238)CTG>ATG	p.L746M	GTF2IRD1_uc010lbq.2_Missense_Mutation_p.L763M|GTF2IRD1_uc003uap.2_Missense_Mutation_p.L731M|GTF2IRD1_uc003uar.1_Missense_Mutation_p.L731M	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	746	GTF2I-like 4.					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CATCGAGGGGCTGCCCCCAGG	0.597													15	36	---	---	---	---	PASS
RHBDD2	57414	broad.mit.edu	37	7	75517559	75517559	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75517559C>T	uc003udw.1	+	4	1071	c.987C>T	c.(985-987)GGC>GGT	p.G329G	RHBDD2_uc003udv.1_Silent_p.G188G	NM_001040456	NP_001035546	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a	329						integral to membrane	serine-type endopeptidase activity				0						CCTCCCTGGGCATCCAGCCCC	0.652													3	20	---	---	---	---	PASS
DBF4	10926	broad.mit.edu	37	7	87536596	87536596	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87536596T>C	uc003ujf.1	+	12	1647	c.1143T>C	c.(1141-1143)TCT>TCC	p.S381S	DBF4_uc003ujh.1_Silent_p.S121S|DBF4_uc003ujg.1_Silent_p.S157S|DBF4_uc011khf.1_Silent_p.S148S	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase	381					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AACATATTTCTCAGAAAGATT	0.373													5	171	---	---	---	---	PASS
KRIT1	889	broad.mit.edu	37	7	91855963	91855963	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91855963T>C	uc003ulq.1	-	9	1194	c.1023A>G	c.(1021-1023)TTA>TTG	p.L341L	KRIT1_uc010lev.1_Silent_p.L134L|KRIT1_uc003ulr.1_Silent_p.L341L|KRIT1_uc003uls.1_Silent_p.L341L|KRIT1_uc003ult.1_Silent_p.L293L|KRIT1_uc003ulu.1_Silent_p.L341L|KRIT1_uc003ulv.1_Silent_p.L341L	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1	341	ANK 2.				angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTCCTTTCTCTAACAATATGC	0.348									Familial_Cerebral_Cavernous_Angioma				83	438	---	---	---	---	PASS
DNAJC2	27000	broad.mit.edu	37	7	102982379	102982379	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102982379T>C	uc003vbo.2	-	2	338	c.87A>G	c.(85-87)GAA>GAG	p.E29E	DNAJC2_uc003vbn.2_5'UTR|DNAJC2_uc010lix.2_Silent_p.E29E|DNAJC2_uc003vbp.2_Intron|DNAJC2_uc003vbq.1_RNA|DNAJC2_uc003vbr.1_Silent_p.E29E	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	29	Epitope (recognized by CD8(+) cytotoxic T-lymphocytes).				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						TTCCCACAGGTTCAACTTGAC	0.393													6	210	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124386657	124386657	+	Silent	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386657G>T	uc003vli.2	-	2	2415	c.1764C>A	c.(1762-1764)ACC>ACA	p.T588T		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	588	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CGAGTTCCGTGGTGTACTCGT	0.502													5	210	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141762388	141762388	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141762388C>T	uc003vwy.2	+	35	4197	c.4143C>T	c.(4141-4143)GCC>GCT	p.A1381A		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1381	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTTATGTGGCCTTCCCAGACT	0.388													21	145	---	---	---	---	PASS
LMBR1	64327	broad.mit.edu	37	7	156476499	156476499	+	3'UTR	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156476499A>G	uc003wmw.3	-	17					LMBR1_uc003wmv.3_3'UTR|LMBR1_uc003wmx.3_3'UTR|LMBR1_uc010lqn.2_3'UTR|LMBR1_uc011kvx.1_3'UTR	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		GTATTTACCAACATGAGCAAA	0.343													2	0	---	---	---	---	PASS
POLB	5423	broad.mit.edu	37	8	42220155	42220155	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42220155A>G	uc003xoz.1	+	11	760	c.647A>G	c.(646-648)GAG>GGG	p.E216G	POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Missense_Mutation_p.E62G	NM_002690	NP_002681	P06746	DPOLB_HUMAN	DNA-directed DNA polymerase beta	216					DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	CAGGTTGTGGAGCAGTTACAA	0.313								DNA_polymerases_(catalytic_subunits)					6	211	---	---	---	---	PASS
NDRG1	10397	broad.mit.edu	37	8	134270635	134270635	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134270635C>T	uc003yuh.2	-	7	1010	c.424G>A	c.(424-426)GGC>AGC	p.G142S	NDRG1_uc003yuf.1_5'Flank|NDRG1_uc003yug.2_Missense_Mutation_p.G142S|NDRG1_uc010mee.2_Missense_Mutation_p.G61S|NDRG1_uc010mef.2_Missense_Mutation_p.G76S|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	142					cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ATGTAGGCGCCTGCTCCTGTT	0.428													60	191	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140631062	140631062	+	Silent	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140631062G>A	uc003yvf.1	-	2	628	c.564C>T	c.(562-564)CAC>CAT	p.H188H	KCNK9_uc003yvg.1_Silent_p.H188H|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	188	Extracellular (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			AGTAGTAGGCGTGGAAGAAGC	0.592													5	61	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114184459	114184459	+	Silent	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114184459A>T	uc004bfe.1	-	15	1821	c.1821T>A	c.(1819-1821)ACT>ACA	p.T607T	KIAA0368_uc010muc.1_Silent_p.T429T	NM_001080398	NP_001073867			KIAA0368 protein												0						CTATATCCTTAGTGAATAAAT	0.378													48	131	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131741573	131741573	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131741573C>T	uc004bws.1	+	13	1258	c.1236C>T	c.(1234-1236)GCC>GCT	p.A412A		NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	412					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						AAGTATTGGCCGACCCTTCTC	0.343													4	156	---	---	---	---	PASS
WAC	51322	broad.mit.edu	37	10	28900809	28900809	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28900809C>G	uc001iuf.2	+	10	1480	c.1395C>G	c.(1393-1395)ATC>ATG	p.I465M	WAC_uc001iud.2_Missense_Mutation_p.I420M|WAC_uc001iue.2_Missense_Mutation_p.I155M|WAC_uc001iug.2_Missense_Mutation_p.I362M|WAC_uc001iuh.2_Missense_Mutation_p.I417M	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil	465					cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						CAGTCCCTATCAAACCTTTGA	0.403													15	262	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52587921	52587921	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52587921T>C	uc001jjj.2	-	7	927	c.739A>G	c.(739-741)ATT>GTT	p.I247V	A1CF_uc010qhn.1_Missense_Mutation_p.I255V|A1CF_uc001jji.2_Missense_Mutation_p.I247V|A1CF_uc001jjh.2_Missense_Mutation_p.I255V|A1CF_uc010qho.1_Missense_Mutation_p.I255V|A1CF_uc009xov.2_Missense_Mutation_p.I247V	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	247	RRM 3.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TCCTTTTCAATCATCTCTTCA	0.269													7	597	---	---	---	---	PASS
PIPSL	266971	broad.mit.edu	37	10	95719558	95719558	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95719558G>C	uc009xuj.2	-	1	2115	c.1596C>G	c.(1594-1596)AAC>AAG	p.N532K		NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						GGCCCACGTTGTTCTCAGGGT	0.527													8	144	---	---	---	---	PASS
C10orf76	79591	broad.mit.edu	37	10	103789421	103789421	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103789421A>G	uc009xwy.1	-	5	490	c.388T>C	c.(388-390)TTT>CTT	p.F130L	C10orf76_uc001kui.2_Missense_Mutation_p.F130L	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591	130						integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GCCTTGTCAAAGCCCATCAGC	0.493													43	242	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904779	55904779	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904779C>T	uc010riz.1	-	1	416	c.416G>A	c.(415-417)CGG>CAG	p.R139Q		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					GAGGCAGAGCCGCCGAGACAC	0.473													6	199	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64427892	64427892	+	Silent	SNP	T	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64427892T>G	uc001oar.2	-	12	2740	c.2301A>C	c.(2299-2301)GGA>GGC	p.G767G	NRXN2_uc001oas.2_Silent_p.G736G|NRXN2_uc001oaq.2_Silent_p.G434G	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CCATCATGAGTCCGTAGGCCC	0.592													12	67	---	---	---	---	PASS
B3GNT6	192134	broad.mit.edu	37	11	76750646	76750646	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76750646C>T	uc001oxw.2	+	2	139	c.51C>T	c.(49-51)CTC>CTT	p.L17L		NM_138706	NP_619651	Q6ZMB0	B3GN6_HUMAN	UDP-GlcNAc:betaGal	17	Helical; Signal-anchor for type II membrane protein; (Potential).				O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity				0						TGGCCTGCCTCCTGGTGGGCG	0.642											OREG0021252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	29	---	---	---	---	PASS
CD3E	916	broad.mit.edu	37	11	118185183	118185183	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118185183C>A	uc001psq.3	+	8	797	c.541C>A	c.(541-543)CCA>ACA	p.P181T		NM_000733	NP_000724	P07766	CD3E_HUMAN	CD3E antigen, epsilon polypeptide precursor	181	Cytoplasmic (Potential).|ITAM.				G-protein coupled receptor protein signaling pathway|signal complex assembly|T cell costimulation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	external side of plasma membrane|integral to plasma membrane	protein heterodimerization activity|protein kinase binding|receptor signaling complex scaffold activity|receptor signaling protein activity|SH3 domain binding|T cell receptor binding|transmembrane receptor activity			ovary(2)	2	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GGAGAGGCCACCACCTGTTCC	0.557													9	59	---	---	---	---	PASS
CD3E	916	broad.mit.edu	37	11	118185184	118185184	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118185184C>T	uc001psq.3	+	8	798	c.542C>T	c.(541-543)CCA>CTA	p.P181L		NM_000733	NP_000724	P07766	CD3E_HUMAN	CD3E antigen, epsilon polypeptide precursor	181	Cytoplasmic (Potential).|ITAM.				G-protein coupled receptor protein signaling pathway|signal complex assembly|T cell costimulation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	external side of plasma membrane|integral to plasma membrane	protein heterodimerization activity|protein kinase binding|receptor signaling complex scaffold activity|receptor signaling protein activity|SH3 domain binding|T cell receptor binding|transmembrane receptor activity			ovary(2)	2	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GAGAGGCCACCACCTGTTCCC	0.562													10	59	---	---	---	---	PASS
TMEM117	84216	broad.mit.edu	37	12	44537365	44537365	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44537365G>A	uc001rod.2	+	4	514	c.448G>A	c.(448-450)GAA>AAA	p.E150K	TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Missense_Mutation_p.E150K	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	150						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		CATCCGAAATGAAAGTTTCAT	0.403													45	336	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44913983	44913983	+	Silent	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44913983A>G	uc001rog.2	-	19	2800	c.2205T>C	c.(2203-2205)CCT>CCC	p.P735P	NELL2_uc001rof.3_Silent_p.P734P|NELL2_uc001roh.2_Silent_p.P735P|NELL2_uc009zkd.2_Silent_p.P687P|NELL2_uc010skz.1_Silent_p.P785P|NELL2_uc010sla.1_Silent_p.P758P	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	735	VWFC 4.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CATCTGGGCAAGGCAGGGGCC	0.557													4	57	---	---	---	---	PASS
PLEKHA9	51054	broad.mit.edu	37	12	45567285	45567285	+	Silent	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45567285G>A	uc001rom.1	-	3	1401	c.864C>T	c.(862-864)GCC>GCT	p.A288A	PLEKHA9_uc009zke.2_Silent_p.A288A	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)		GCCACAAGAGGGCTTCAGTCG	0.448													5	266	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46355548	46355548	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46355548C>T	uc001rox.2	-	3	441	c.154G>A	c.(154-156)GAA>AAA	p.E52K	SFRS2IP_uc001roy.1_Missense_Mutation_p.E116K|SFRS2IP_uc009zki.1_RNA|SFRS2IP_uc001roz.2_Missense_Mutation_p.E52K	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	52	RING-type; degenerate.				spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		AAACCAACTTCCTTTTCTAAT	0.353													32	271	---	---	---	---	PASS
KRT79	338785	broad.mit.edu	37	12	53216799	53216799	+	Splice_Site	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53216799C>T	uc001sbb.2	-	7	1400	c.1367_splice	c.e7+1	p.R456_splice	KRT79_uc001sba.2_Splice_Site_p.R227_splice	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L							keratin filament	structural molecule activity			ovary(2)|skin(2)	4						GGGGCCACCACCTGCTCTCCT	0.647													5	24	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53346304	53346304	+	Intron	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53346304G>C	uc001sbe.2	+						KRT18_uc009zmn.1_3'UTR|KRT18_uc001sbf.1_3'UTR|KRT18_uc001sbg.2_Intron|KRT18_uc009zmo.2_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18						anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						TCTCCCCCTTGAAGAAAGCAA	0.493													6	54	---	---	---	---	PASS
ZNF740	283337	broad.mit.edu	37	12	53579212	53579212	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53579212T>G	uc001scb.3	+	4	595	c.201T>G	c.(199-201)GAT>GAG	p.D67E		NM_001004304	NP_001004304	Q8NDX6	ZN740_HUMAN	zinc finger protein 740	67					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|protein binding|zinc ion binding				0						GCCGCAAAGATGATGACAGCT	0.443													19	211	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121655012	121655012	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121655012C>T	uc001tzr.2	+	2	514	c.210C>T	c.(208-210)GGC>GGT	p.G70G	P2RX4_uc010szr.1_RNA|P2RX4_uc010szs.1_RNA|P2RX4_uc009zxc.2_Silent_p.G70G|P2RX4_uc001tzs.2_Silent_p.G86G|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	70	Extracellular (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGGTCAAGGGCGTGGCTGTGA	0.498													54	339	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28913409	28913409	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28913409A>T	uc001usb.3	-	17	2669	c.2384T>A	c.(2383-2385)CTA>CAA	p.L795Q	FLT1_uc001usa.3_Missense_Mutation_p.L13Q	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	795	Cytoplasmic (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TATAATTGATAGGTAGTCAGT	0.403													5	181	---	---	---	---	PASS
PSMB11	122706	broad.mit.edu	37	14	23511574	23511574	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23511574C>A	uc010ake.1	+	1	199	c.140C>A	c.(139-141)GCC>GAC	p.A47D		NM_001099780	NP_001093250	A5LHX3	PSB11_HUMAN	proteasome beta 11 subunit precursor	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		CCCAGACTGGCCCACGGCACC	0.647													7	15	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38643311	38643311	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38643311T>C	uc001zka.3	+	7	1116	c.781T>C	c.(781-783)TAC>CAC	p.Y261H		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	261	KBD.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CTATGCAGACTACAGACATCC	0.378									Legius_syndrome				31	143	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49085538	49085538	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49085538T>C	uc001zwy.2	-	7	846	c.812A>G	c.(811-813)CAC>CGC	p.H271R	CEP152_uc001zwz.2_Missense_Mutation_p.H271R|CEP152_uc001zxa.1_Missense_Mutation_p.H178R	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	271	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TACAAGCTGGTGATTCAGATA	0.234													10	651	---	---	---	---	PASS
AAGAB	79719	broad.mit.edu	37	15	67524205	67524205	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67524205C>T	uc002aqk.3	-	5	587	c.482G>A	c.(481-483)CGA>CAA	p.R161Q	AAGAB_uc002aql.2_Missense_Mutation_p.R52Q|AAGAB_uc010uju.1_Missense_Mutation_p.R52Q	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34	161					protein transport	cytoplasm					0						TTGGACAATTCGCTTTACTCC	0.373													56	261	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79310141	79310141	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79310141T>C	uc002beq.2	-	12	2089	c.1714A>G	c.(1714-1716)AAG>GAG	p.K572E	RASGRF1_uc002bep.2_Missense_Mutation_p.K572E|RASGRF1_uc010blm.1_Missense_Mutation_p.K494E|RASGRF1_uc002ber.3_Missense_Mutation_p.K572E|RASGRF1_uc010unh.1_5'UTR	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	572	PH 2.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						CACGCTGCCTTCTCCTGTCTG	0.542													5	152	---	---	---	---	PASS
PGPEP1L	145814	broad.mit.edu	37	15	99511748	99511748	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99511748C>T	uc002bum.2	-	5	756	c.550G>A	c.(550-552)GAA>AAA	p.E184K	PGPEP1L_uc010bop.2_3'UTR|PGPEP1L_uc002bun.2_RNA	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein	184					proteolysis		cysteine-type peptidase activity				0						GAGTTTTCTTCGAACTGGGCT	0.532													27	144	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71712665	71712665	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71712665C>T	uc002fax.2	-	7	1267	c.1261G>A	c.(1261-1263)GAT>AAT	p.D421N	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Missense_Mutation_p.D421N|PHLPP2_uc002fay.1_Missense_Mutation_p.D421N	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	421	LRR 8.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						TACCTTAAATCCACATGCTTG	0.378													6	259	---	---	---	---	PASS
PABPN1L	390748	broad.mit.edu	37	16	88931430	88931430	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88931430C>A	uc010vpe.1	-	4	566	c.566G>T	c.(565-567)GGT>GTT	p.G189V	PABPN1L_uc010vpd.1_Missense_Mutation_p.G189V|PABPN1L_uc002fmi.2_Missense_Mutation_p.G189V|PABPN1L_uc002fmj.2_Intron	NM_001080487	NP_001073956	A6NDY0	EPAB2_HUMAN	similar to poly(A)binding protein nuclear-like	189	RRM.					cytoplasm	nucleotide binding|RNA binding				0						CCACACTGACCCCTTGGGGTG	0.552													4	10	---	---	---	---	PASS
WDR81	124997	broad.mit.edu	37	17	1633695	1633695	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1633695G>T	uc002fti.2	+	2	269	c.8G>T	c.(7-9)CGC>CTC	p.R3L	WDR81_uc002fth.2_Missense_Mutation_p.R179L|WDR81_uc010vqp.1_Missense_Mutation_p.R27L|WDR81_uc002ftj.2_Missense_Mutation_p.R1230L|WDR81_uc010vqq.1_5'UTR	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4	3										skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AAGATGGTCCGCTGGCTGTCT	0.537													5	20	---	---	---	---	PASS
FBXO39	162517	broad.mit.edu	37	17	6684202	6684202	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6684202A>C	uc010vtg.1	+	2	1135	c.1015A>C	c.(1015-1017)ACT>CCT	p.T339P		NM_153230	NP_694962	Q8N4B4	FBX39_HUMAN	F-box protein 39	339										ovary(1)|skin(1)	2						CTTCCGGCACACTCTGCAGGT	0.547													5	27	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28268766	28268766	+	5'UTR	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28268766G>C	uc002het.2	+	1					EFCAB5_uc010wbi.1_Intron|EFCAB5_uc010wbj.1_Intron|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_RNA	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a								calcium ion binding			ovary(1)|skin(1)	2						ATTAATACTGGTCTAGTAATA	0.383													12	142	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35487038	35487038	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35487038A>G	uc002hnm.2	-	46	5866	c.5675T>C	c.(5674-5676)GTT>GCT	p.V1892A	ACACA_uc002hnk.2_Missense_Mutation_p.V1814A|ACACA_uc002hnl.2_Missense_Mutation_p.V1834A|ACACA_uc002hnn.2_Missense_Mutation_p.V1892A|ACACA_uc002hno.2_Missense_Mutation_p.V1929A|ACACA_uc010cuy.2_Missense_Mutation_p.V537A|ACACA_uc010wdc.1_Missense_Mutation_p.V18A	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1892	Carboxyltransferase.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GACAGTGAAAACCCCTTCAAA	0.552													23	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	36332811	36332811	+	RNA	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36332811G>T	uc002how.1	-	1		c.879C>A								Homo sapiens cDNA FLJ35311 fis, clone PROST2010382.																		tctgtaaattggggataatta	0.244													4	144	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56084396	56084396	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56084396C>T	uc002ivi.2	-	1	312	c.103G>A	c.(103-105)GTG>ATG	p.V35M	SFRS1_uc002ivj.2_Missense_Mutation_p.V35M	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	35	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		TTGTAGAACACGTCCTCAATG	0.602													15	100	---	---	---	---	PASS
LOC727896	727896	broad.mit.edu	37	18	2946402	2946402	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2946402T>C	uc010wyu.1	-	1	220	c.133A>G	c.(133-135)AGA>GGA	p.R45G	LPIN2_uc002klo.2_Intron	NR_026659				Homo sapiens cDNA clone IMAGE:4614712, containing frame-shift errors.												0						GTTGTTCTTCTCTTACAGCAA	0.448													5	95	---	---	---	---	PASS
C18orf19	125228	broad.mit.edu	37	18	13671930	13671930	+	Silent	SNP	A	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13671930A>T	uc010dlh.2	-	4	948	c.516T>A	c.(514-516)CCT>CCA	p.P172P	C18orf19_uc010dlg.2_Intron|C18orf19_uc010dli.2_Silent_p.P172P|C18orf19_uc002ksj.3_Silent_p.P172P|C18orf19_uc010dlj.2_Intron	NM_001098801	NP_001092271	Q96ND0	CR019_HUMAN	hypothetical protein LOC125228	172	DUF1279.					integral to membrane				breast(2)	2						CCACACTGTCAGGTAACCCAA	0.368													8	196	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30977130	30977130	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30977130C>T	uc002kxn.2	-	3	243	c.101G>A	c.(100-102)TGG>TAG	p.W34*	C18orf34_uc010xbr.1_Nonsense_Mutation_p.W34*|C18orf34_uc010dmf.1_Nonsense_Mutation_p.W34*|C18orf34_uc002kxo.2_Nonsense_Mutation_p.W34*|C18orf34_uc002kxp.2_Nonsense_Mutation_p.W34*	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	34										ovary(1)	1						TGTCCTTGACCATGCCTTCTC	0.294													6	342	---	---	---	---	PASS
HDHD2	84064	broad.mit.edu	37	18	44660874	44660874	+	Silent	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44660874A>G	uc002lcs.2	-	3	436	c.303T>C	c.(301-303)GAT>GAC	p.D101D	HDHD2_uc002lct.2_Silent_p.D11D	NM_032124	NP_115500	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain	101							hydrolase activity				0						TACCTTTGAAATCAGGTAGTG	0.353													6	188	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63530053	63530053	+	Silent	SNP	C	T	T	rs138789170	byFrequency	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63530053C>T	uc002ljz.2	+	11	2089	c.1764C>T	c.(1762-1764)GAC>GAT	p.D588D	CDH7_uc002lka.2_Silent_p.D588D|CDH7_uc002lkb.2_Silent_p.D588D	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	588	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GTGATGCTGACGGCGTAGCCC	0.522													16	68	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1792020	1792020	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1792020G>A	uc002ltw.2	-	19	2404	c.2170C>T	c.(2170-2172)CGG>TGG	p.R724W	ATP8B3_uc002ltv.2_Missense_Mutation_p.R677W|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	724	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTGTGCCCGGTTCTGCAGC	0.677													5	17	---	---	---	---	PASS
ZNF846	162993	broad.mit.edu	37	19	9868360	9868360	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9868360G>C	uc002mmb.1	-	6	1924	c.1393C>G	c.(1393-1395)CTT>GTT	p.L465V	ZNF846_uc010xky.1_Intron|ZNF846_uc010xkz.1_Intron|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_Missense_Mutation_p.L336V	NM_001077624	NP_001071092	Q147U1	ZN846_HUMAN	zinc finger protein 846	465	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGCATATTAAGATTTGTGGAA	0.443													21	119	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10599946	10599946	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10599946A>G	uc002moq.1	-	5	1786	c.1630T>C	c.(1630-1632)TGG>CGG	p.W544R	KEAP1_uc002mop.1_Intron|KEAP1_uc002mor.1_Missense_Mutation_p.W544R	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	544	Kelch 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			ACGAAAGTCCACGTCTCTGTT	0.602													10	42	---	---	---	---	PASS
PRKACA	5566	broad.mit.edu	37	19	14204026	14204026	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14204026C>G	uc002myc.2	-	10	1154	c.954G>C	c.(952-954)AAG>AAC	p.K318N	SAMD1_uc010xnl.1_5'Flank|PRKACA_uc002myb.2_Missense_Mutation_p.K310N	NM_002730	NP_002721	P17612	KAPCA_HUMAN	cAMP-dependent protein kinase catalytic subunit	318	AGC-kinase C-terminal.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|regulation of insulin secretion|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|cAMP-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1						GGCCTTTAAACTTTGGTATGA	0.433													35	155	---	---	---	---	PASS
ZNF260	339324	broad.mit.edu	37	19	37004897	37004897	+	3'UTR	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37004897G>A	uc002oee.1	-	4					ZNF260_uc002oed.1_3'UTR|ZNF260_uc010eey.1_3'UTR|ZNF260_uc002oef.1_3'UTR	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					CATTCATAGAGAACTTTAATG	0.348													21	86	---	---	---	---	PASS
LEUTX	342900	broad.mit.edu	37	19	40276649	40276649	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40276649C>T	uc010xvg.1	+	3	546	c.381C>T	c.(379-381)TCC>TCT	p.S127S		NM_001143832	NP_001137304	A8MZ59	LEUTX_HUMAN	leucine twenty homeobox	127						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTTGGGCCTCCACTCTCTTTG	0.463													5	194	---	---	---	---	PASS
VRK3	51231	broad.mit.edu	37	19	50512561	50512561	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50512561A>G	uc002prg.2	-	4	319	c.221T>C	c.(220-222)TTA>TCA	p.L74S	VRK3_uc002prh.1_Missense_Mutation_p.L74S|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Missense_Mutation_p.L74S|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Missense_Mutation_p.L74S|VRK3_uc010ent.1_5'UTR|VRK3_uc002prl.2_Missense_Mutation_p.L74S|VRK3_uc010ybn.1_Missense_Mutation_p.L74S	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1	74						nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GAAGAGGGATAATCGGGGAGA	0.463													5	213	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57336061	57336061	+	5'UTR	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57336061G>A	uc002qnu.2	-	1					ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_5'UTR|PEG3_uc002qnv.2_5'UTR|PEG3_uc002qnw.2_Intron|PEG3_uc002qnx.2_Intron|PEG3_uc010etr.2_5'UTR	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1						apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AACCAAACATGAGTCAACAGG	0.488													12	79	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1552650	1552650	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1552650G>A	uc010gai.2	-	3	566	c.467C>T	c.(466-468)GCG>GTG	p.A156V	SIRPB1_uc002wfk.3_Intron	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	156	Ig-like C1-type 1.|Extracellular (Potential).				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						GGCCCTCACCGCAGGGCCCGA	0.507													8	215	---	---	---	---	PASS
TGM3	7053	broad.mit.edu	37	20	2293558	2293558	+	Silent	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2293558T>C	uc002wfx.3	+	5	652	c.555T>C	c.(553-555)ATT>ATC	p.I185I		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	185					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	AAGAAGACATTCTCAGCATCT	0.473													6	189	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40065870	40065870	+	Intron	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40065870T>C	uc002xka.1	-						CHD6_uc002xkb.1_Missense_Mutation_p.Y137C	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TCTTTCTTAATATGAAAGACG	0.363													42	299	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40126106	40126106	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40126106T>C	uc002xka.1	-	8	1188	c.1010A>G	c.(1009-1011)GAG>GGG	p.E337G	CHD6_uc002xkd.2_Missense_Mutation_p.E315G|CHD6_uc002xkc.2_3'UTR	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	337	Chromo 1.				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CTTTTCGAGCTCTTCCATTGT	0.408													87	222	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51589805	51589805	+	5'UTR	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51589805C>T	uc002xwo.2	+	1						NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			GCTGGGGCGCCAGAAGTGGGA	0.687													3	18	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10910388	10910388	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10910388G>T	uc002yip.1	-	22	1736	c.1368C>A	c.(1366-1368)AAC>AAA	p.N456K	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.N438K|TPTE_uc002yir.1_Missense_Mutation_p.N418K|TPTE_uc010gkv.1_Missense_Mutation_p.N318K	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	456	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTGTTGTAATGTTATCAAGTA	0.323													35	464	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41416162	41416162	+	Silent	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41416162C>T	uc002yyq.1	-	31	5678	c.5226G>A	c.(5224-5226)GCG>GCA	p.A1742A	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1742	Cytoplasmic (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AGCGGTTTCTCGCTGTGGGCC	0.602													12	142	---	---	---	---	PASS
PI4KAP1	728233	broad.mit.edu	37	22	20386644	20386644	+	RNA	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20386644G>A	uc010gse.1	-	11		c.1758C>T			PI4KAP1_uc010gsf.1_RNA|PI4KAP1_uc010gsg.1_RNA|PI4KAP1_uc010gsh.1_RNA|PI4KAP1_uc002zsc.3_RNA|PI4KAP1_uc011ahn.1_RNA					Homo sapiens cDNA FLJ11279 fis, clone PLACE1009444, highly similar to PHOSPHATIDYLINOSITOL 4-KINASE ALPHA (EC 2.7.1.67).												0						CGAGATTGCCGCCCGGCGAGC	0.567													8	21	---	---	---	---	PASS
SCARF2	91179	broad.mit.edu	37	22	20783904	20783904	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20783904G>A	uc002zsj.1	-	8	1448	c.1343C>T	c.(1342-1344)GCG>GTG	p.A448V	SCARF2_uc002zsk.1_Missense_Mutation_p.A448V	NM_153334	NP_699165	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2 isoform 1	448	Helical; (Potential).				cell adhesion	integral to membrane	protein binding|receptor activity			breast(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GACGAGCAGCGCGCCCGCGCC	0.682													6	35	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42608574	42608574	+	Missense_Mutation	SNP	C	G	G	rs141527051		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42608574C>G	uc003bcj.1	-	1	2872	c.2738G>C	c.(2737-2739)GGT>GCT	p.G913A	TCF20_uc003bck.1_Missense_Mutation_p.G913A|TCF20_uc003bnt.2_Missense_Mutation_p.G913A	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	913					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GGACACCAAACCACCAGGAAG	0.473													4	48	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32583892	32583892	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32583892G>A	uc004dda.1	-	16	2163	c.1919C>T	c.(1918-1920)ACG>ATG	p.T640M	DMD_uc004dcz.2_Missense_Mutation_p.T517M|DMD_uc004dcy.1_Missense_Mutation_p.T636M|DMD_uc004ddb.1_Missense_Mutation_p.T632M|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.T632M	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	640	Spectrin 3.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCATGCTTCCGTCTTCTGGGT	0.398													10	330	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	48159092	48159092	+	Silent	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48159092G>T	uc010nib.1	-	6	528	c.441C>A	c.(439-441)ACC>ACA	p.T147T		NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		TCTTCTCAGAGGTAGTTGGTT	0.512													34	261	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50147057	50147057	+	Silent	SNP	G	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50147057G>T	uc010njr.1	-	5	1128	c.1068C>A	c.(1066-1068)ATC>ATA	p.I356I		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	356	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CTTCACAGATGATGGCATCTC	0.443													25	58	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106065256	106065256	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106065256C>T	uc004emo.2	+	4	575	c.410C>T	c.(409-411)CCT>CTT	p.P137L	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emm.2_Missense_Mutation_p.P137L|TBC1D8B_uc004emn.2_Missense_Mutation_p.P137L	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	137						intracellular	calcium ion binding|Rab GTPase activator activity	p.P137S(1)		ovary(2)|central_nervous_system(1)|skin(1)	4						GAAGATGATCCTGAGAAATTT	0.328													4	175	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													3	6	---	---	---	---	
SLC2A5	6518	broad.mit.edu	37	1	9098230	9098230	+	Intron	DEL	C	-	-	rs875996	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9098230delC	uc001apo.2	-						SLC2A5_uc010nzy.1_Intron|SLC2A5_uc010nzz.1_Intron|SLC2A5_uc010oaa.1_Intron|SLC2A5_uc010oab.1_Intron	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated						carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGGGCAAACGGCAGTGTAC	0.622													4	2	---	---	---	---	
NMNAT1	64802	broad.mit.edu	37	1	10012417	10012417	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10012417delT	uc001aqp.2	+							NM_022787	NP_073624	Q9HAN9	NMNA1_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	nucleoplasm	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity|protein binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		GCCAAAACTGTTAACACCATA	0.308													4	2	---	---	---	---	
TNFRSF8	943	broad.mit.edu	37	1	12201837	12201837	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12201837delT	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron|TNFRSF8_uc001atr.2_Intron|TNFRSF8_uc001ats.2_Intron	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTGGGTGGTTTTTTTTTGG	0.224													3	3	---	---	---	---	
DHRS3	9249	broad.mit.edu	37	1	12651324	12651324	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12651324delG	uc001auc.2	-						DHRS3_uc001aub.2_Intron|DHRS3_uc009vnm.2_Intron|DHRS3_uc001aud.3_Intron|DHRS3_uc001aue.1_Intron	NM_004753	NP_004744	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3						retinol metabolic process|visual perception	integral to membrane	electron carrier activity|NADP-retinol dehydrogenase activity|nucleotide binding			skin(1)	1	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	CTGCTGGGCTGCTGAAGCCTA	0.602													4	2	---	---	---	---	
LAPTM5	7805	broad.mit.edu	37	1	31207777	31207777	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31207777delT	uc001bsc.2	-							NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5						transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		ggcatcttagttttctctgcg	0.010													5	3	---	---	---	---	
C1orf94	84970	broad.mit.edu	37	1	34645478	34645478	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34645478delT	uc001bxs.3	+						C1orf94_uc001bxt.2_Intron	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b								protein binding				0		Myeloproliferative disorder(586;0.0393)				gccagagctgtttagctttta	0.070													4	2	---	---	---	---	
TRAPPC3	27095	broad.mit.edu	37	1	36615490	36615490	+	5'Flank	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36615490delC	uc001bzx.2	-						TRAPPC3_uc001bzy.2_5'Flank	NM_014408	NP_055223	O43617	TPPC3_HUMAN	trafficking protein particle complex 3							endoplasmic reticulum	guanylate cyclase activity|heme binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0393)				CCCAAGATGTCCCAGAAAACT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39305002	39305003	+	IGR	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39305002_39305003insT								POU3F1 (792552 upstream) : RRAGC (12 downstream)																							GGTCTCCAGAATTTTTTTTTTT	0.391													7	4	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	45067826	45067826	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45067826delA	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						CAAGAACAGGAAAAAAAATAA	0.493													4	2	---	---	---	---	
ATPAF1	64756	broad.mit.edu	37	1	47119195	47119196	+	Intron	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47119195_47119196insA	uc001cqh.2	-						ATPAF1_uc001cqg.2_Intron|ATPAF1_uc009vyk.2_Intron|ATPAF1_uc010omg.1_Intron|ATPAF1_uc001cqi.2_Intron	NM_022745	NP_073582	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly						protein complex assembly	mitochondrion	protein binding				0	Acute lymphoblastic leukemia(166;0.155)					ACATCAGTAAGAAAAAAAAGAC	0.411													4	2	---	---	---	---	
DMRTA2	63950	broad.mit.edu	37	1	50885623	50885623	+	Intron	DEL	C	-	-	rs5774087		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50885623delC	uc010ona.1	-						DMRTA2_uc010onb.1_Intron	NM_032110	NP_115486	Q96SC8	DMTA2_HUMAN	DMRT-like family A2						sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						CTCCTCAGAACCCCAACTACC	0.577													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	52575728	52575728	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52575728delT								BTF3L4 (21638 upstream) : ZFYVE9 (32318 downstream)																							GGCATCCttcttagtgtctag	0.289													4	2	---	---	---	---	
ZYG11A	440590	broad.mit.edu	37	1	53347539	53347540	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53347539_53347540insT	uc001cuk.2	+						ZYG11A_uc001cul.2_Intron	NM_001004339	NP_001004339	Q6WRX3	ZY11A_HUMAN	zyg-11 homolog A								binding				0						TTCTCATCAGCTTTTTTTTTTT	0.188													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58748863	58748864	+	Intron	DEL	CC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58748863_58748864delCC	uc001cyt.1	-							NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						GCCTCAGTAGCCCATCCATCTG	0.495													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62613792	62613793	+	Intron	INS	-	AAAAAAAAA	AAAAAAAAA	rs76388958		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62613792_62613793insAAAAAAAAA	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						gacactgtctttaaaaaaaaaa	0.005													4	3	---	---	---	---	
USP1	7398	broad.mit.edu	37	1	62914561	62914561	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62914561delT	uc001daj.1	+						USP1_uc001dak.1_Intron|USP1_uc001dal.1_Intron	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1						DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		tttcttctccttttttttttg	0.109													4	2	---	---	---	---	
ATG4C	84938	broad.mit.edu	37	1	63307785	63307785	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63307785delT	uc001dat.2	+						ATG4C_uc001dau.2_Intron	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8						autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						TACTTCTACATTTTTTTGGTC	0.274													4	2	---	---	---	---	
ROR1	4919	broad.mit.edu	37	1	64507577	64507577	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64507577delG	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						TACTTAACCtggggcagaggt	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64775852	64775852	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64775852delG								UBE2U (65825 upstream) : CACHD1 (160624 downstream)																							AGAAGGAAAAGGGGGAATTGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81674303	81674303	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81674303delC								None (None upstream) : LPHN2 (97542 downstream)																							TGCAGGAAGTCCTGCAAGGGA	0.512													4	2	---	---	---	---	
CLCA1	1179	broad.mit.edu	37	1	86942477	86942478	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86942477_86942478insT	uc001dlt.2	+						CLCA1_uc001dls.1_Intron	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor						calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TTTTTTTTAACTGTACCAACTA	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	109990291	109990291	+	IGR	DEL	G	-	-	rs60868774	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109990291delG								PSMA5 (21254 upstream) : SYPL2 (18809 downstream)																							TTGGGCAGAAGGAAGGAGGGT	0.448													4	2	---	---	---	---	
GSTM2	2946	broad.mit.edu	37	1	110204971	110204971	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110204971delC	uc001dyi.2	+						GSTM4_uc001dyh.2_Intron	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1						glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CAGGATCCTTCTGTCTTCCAC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143534418	143534418	+	IGR	DEL	A	-	-	rs2872278	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143534418delA								None (None upstream) : LOC100286793 (113221 downstream)																							gactgcccccacaccattaga	0.000													5	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145215207	145215208	+	Intron	DEL	CT	-	-	rs111871027		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145215207_145215208delCT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ACTTGCTGGCCTCACTTAGTAC	0.386													4	4	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153995962	153995962	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153995962delT	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AAttcttttcttttttttttg	0.159													4	3	---	---	---	---	
THBS3	7059	broad.mit.edu	37	1	155173633	155173633	+	Intron	DEL	T	-	-	rs72426166		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155173633delT	uc001fix.2	-						RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Intron|THBS3_uc001fiz.2_Intron|THBS3_uc001fiy.2_Intron|THBS3_uc010pfu.1_Intron|THBS3_uc010pfv.1_Intron|THBS3_uc001fja.2_Intron	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor						cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TATATCCCCAttttttttttt	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	169055482	169055482	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169055482delG								MGC4473 (293362 upstream) : ATP1B1 (20465 downstream)																							TGTGGAGTGAGGTGGCAGTGA	0.488													4	2	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169281556	169281556	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169281556delT	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_Intron	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					ccttgagtcatttttgctgac	0.144													4	2	---	---	---	---	
METTL11B	149281	broad.mit.edu	37	1	170136296	170136297	+	Intron	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170136296_170136297delGT	uc009wvv.1	+							NM_001136107	NP_001129579	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B								methyltransferase activity				0						TGATTTTGGGGTGTGTGTGTGA	0.401													4	2	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181630242	181630243	+	Intron	DEL	GA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181630242_181630243delGA	uc001gow.2	+						CACNA1E_uc009wxs.2_Intron	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						gagcacaagggagaagcacatt	0.149													4	2	---	---	---	---	
FAM5C	339479	broad.mit.edu	37	1	190282415	190282415	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190282415delT	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TGGTAATGCCTTTTTTTTGAT	0.338													4	2	---	---	---	---	
CFHR1	3078	broad.mit.edu	37	1	196782796	196782796	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196782796delA	uc001gtm.2	+							NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor						complement activation	extracellular space					0						aaataatttgaaaaatggaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207184903	207184903	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207184903delT								FCAMR (40933 upstream) : C1orf116 (6963 downstream)																							AAtttttttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	210461679	210461680	+	IGR	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210461679_210461680delCA								SERTAD4 (45241 upstream) : HHAT (39926 downstream)																							ccagaacaggcaggagctgagg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211700630	211700630	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211700630delT								RD3 (34371 upstream) : SLC30A1 (47751 downstream)																							CCCCTGATCCTTTAGGTCCAT	0.547													4	2	---	---	---	---	
NVL	4931	broad.mit.edu	37	1	224456027	224456028	+	Intron	INS	-	CA	CA	rs143263991	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224456027_224456028insCA	uc001hok.2	-						NVL_uc001hol.2_Intron|NVL_uc010pvd.1_Intron|NVL_uc010pve.1_Intron|NVL_uc010pvf.1_Intron	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1							aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		ctattattatccagtctaaatg	0.025													7	6	---	---	---	---	
CDC42BPA	8476	broad.mit.edu	37	1	227183949	227183949	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227183949delA	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Intron|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				GCCCAGCCCTATCCCAGAACA	0.323													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245608413	245608413	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245608413delG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TGCAGACTCTGGAAGCAAGCA	0.438													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246304776	246304777	+	Intron	INS	-	A	A	rs147124303	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246304776_246304777insA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CACCTTGACAGATGGTGCATTC	0.322													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	1974272	1974273	+	Intron	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1974272_1974273insA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TTGCAATGGACAGAGATCTCCA	0.594													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9221495	9221495	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9221495delG								MBOAT2 (77619 upstream) : ASAP2 (125399 downstream)																							aaaaaaaaaagaaaagaaaaa	0.169													4	2	---	---	---	---	
C2orf43	60526	broad.mit.edu	37	2	21000848	21000849	+	Intron	DEL	AC	-	-	rs111544765		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21000848_21000849delAC	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744	Q9H6V9	CB043_HUMAN	hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGacacaaacacacacacac	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	25575609	25575609	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25575609delC								DNMT3A (10150 upstream) : DTNB (24505 downstream)																							TCTGCTGCTTCTCCAGAGGGA	0.443													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28518370	28518370	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28518370delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_5'Flank	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GTGAATAGGCttttttttttg	0.164													3	3	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29456860	29456860	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29456860delT	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	ggatagggagttTTTTTTTGT	0.214			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38663608	38663609	+	IGR	DEL	AC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38663608_38663609delAC								ATL2 (59176 upstream) : HNRPLL (126719 downstream)																							TAGACCCACTACACACACAGGT	0.495													4	2	---	---	---	---	
DYNC2LI1	51626	broad.mit.edu	37	2	44022744	44022744	+	Intron	DEL	A	-	-	rs1025448	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44022744delA	uc002rtk.2	+						DYNC2LI1_uc002rtj.2_Intron|DYNC2LI1_uc002rtl.2_Intron|DYNC2LI1_uc010ynz.1_Intron	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AAAATAGAATAAAAAAAAACC	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89890323	89890323	+	5'Flank	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89890323delT	uc010yts.1	+											RecName: Full=Ig kappa chain V-II region Cum;																		CTTCAGATCCTTCTTCCCTTG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96526069	96526070	+	Intron	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96526069_96526070insA	uc002sva.1	-						uc002suz.1_Intron|uc002svb.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		ataggtcctgtaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113459634	113459634	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113459634delC								SLC20A1 (38236 upstream) : CKAP2L (35810 downstream)																							atccacctctccccacccatg	0.025													4	2	---	---	---	---	
SAP130	79595	broad.mit.edu	37	2	128735861	128735861	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128735861delA	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron|SAP130_uc002tpq.1_Intron	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		acaaaatcttaaaaaaaaaaa	0.085													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130260177	130260177	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130260177delC								None (None upstream) : LOC389033 (420258 downstream)																							GTGAGACACTCCACCACAGCA	0.418													4	2	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149838863	149838863	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149838863delG	uc010zbu.1	+						KIF5C_uc002tws.1_Intron|KIF5C_uc002twt.2_Intron	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTTTCTACCTGGAAAATGGGT	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156791609	156791609	+	IGR	DEL	T	-	-	rs16839799	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156791609delT								None (None upstream) : NR4A2 (389337 downstream)																							aagcaaaaaataagagggaag	0.124													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170100356	170100358	+	Intron	DEL	ACC	-	-	rs35544194		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170100356_170100358delACC	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATGACTCTAGACCAAAGCCAAGC	0.433													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176433353	176433353	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176433353delA								ATP5G3 (386863 upstream) : KIAA1715 (357057 downstream)																							TTAAAGGAGTAAAAAAACCTC	0.458													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177849549	177849549	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177849549delG								MIR1246 (383769 upstream) : HNRNPA3 (227873 downstream)																							caaacttgcaggagacaaggg	0.025													4	2	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209354640	209354640	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209354640delG	uc002vdb.2	+						PTH2R_uc010zjb.1_Intron|PTH2R_uc010fuo.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		ccttttgcctggactgctttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227125857	227125857	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227125857delA								KIAA1486 (530386 upstream) : IRS1 (470177 downstream)																							aattggttctaaaagaaagag	0.000													4	2	---	---	---	---	
COL6A3	1293	broad.mit.edu	37	2	238305660	238305661	+	Intron	INS	-	GATAGATA	GATAGATA	rs150558878	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238305660_238305661insGATAGATA	uc002vwl.2	-						COL6A3_uc002vwo.2_Intron|COL6A3_uc010znj.1_Intron|COL6A3_uc002vwq.2_Intron|COL6A3_uc002vwr.2_Intron|COL6A3_uc010znk.1_Intron	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor						axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		gttagatagatgatagatagat	0.203													6	4	---	---	---	---	
STK25	10494	broad.mit.edu	37	2	242435659	242435662	+	Intron	DEL	AAGG	-	-	rs33918796		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242435659_242435662delAAGG	uc002wbm.2	-						STK25_uc002wbk.2_Intron|STK25_uc002wbl.2_3'UTR|STK25_uc002wbn.2_Intron|STK25_uc002wbo.2_Intron|STK25_uc010zos.1_Intron|STK25_uc010zot.1_Intron|STK25_uc002wbp.2_Intron|STK25_uc010fzo.2_Intron|STK25_uc010zou.1_Intron|STK25_uc010zov.1_Intron	NM_006374	NP_006365	O00506	STK25_HUMAN	serine/threonine kinase 25						response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GGGTCCAAACAAGGAAGAGGATGC	0.618													4	3	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10078368	10078368	+	Intron	DEL	T	-	-	rs113017725		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10078368delT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc003buv.2_Intron	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CAAAACAGAATTTTTTTTTTT	0.184			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
ARPP21	10777	broad.mit.edu	37	3	35716643	35716644	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35716643_35716644insT	uc003cgb.2	+						ARPP21_uc003cga.2_Intron|ARPP21_uc003cfz.2_Intron	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD							cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						GGGAATTTGCATTTTTTTTTTA	0.361													4	2	---	---	---	---	
SLC22A14	9389	broad.mit.edu	37	3	38359472	38359472	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38359472delT	uc010hhc.1	+						SLC22A14_uc003cib.2_Intron|SLC22A14_uc011ayo.1_Intron	NM_004803	NP_004794	Q9Y267	S22AE_HUMAN	organic cation transporter like 4							integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GTGGACCAACTTCAAAGACAG	0.348													4	2	---	---	---	---	
CACNA2D2	9254	broad.mit.edu	37	3	50433886	50433886	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50433886delC	uc003daq.2	-						CACNA2D2_uc003dap.2_Intron	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha						energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	ttctccaggtcctgtagggcc	0.139													4	2	---	---	---	---	
GRM2	2912	broad.mit.edu	37	3	51751347	51751348	+	Intron	DEL	AC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51751347_51751348delAC	uc010hlv.2	+						GRM2_uc003dbo.3_Intron|GRM2_uc010hlu.2_Intron	NM_000839	NP_000830	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2 isoform a						synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)	acacagatatacacacacacct	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	65275375	65275375	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65275375delA								ADAMTS9 (602010 upstream) : MAGI1 (64532 downstream)																							AGGACAGACCAAGGGCAGTGA	0.408													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65950420	65950420	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65950420delC	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TGACCAGAATCCCCAGGAATC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70644243	70644244	+	IGR	DEL	TC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70644243_70644244delTC								MITF (626757 upstream) : FOXP1 (360493 downstream)																							CTTTCTTTCTTCTCTCTCTCTC	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	82573028	82573028	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82573028delT								GBE1 (762078 upstream) : None (None downstream)																							ACTCAGAACATTTTTTTTTTC	0.413													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149375377	149375377	+	5'Flank	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149375377delC	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_Intron|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TAACTGCACTCGGGGCTTGCT	0.572													4	2	---	---	---	---	
EIF2A	83939	broad.mit.edu	37	3	150299795	150299795	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150299795delT	uc003eya.2	+						SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron|EIF2A_uc003eyd.2_Intron|uc003eye.1_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TACTGAACACttttttttttt	0.144													4	3	---	---	---	---	
DHX36	170506	broad.mit.edu	37	3	154006414	154006414	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154006414delA	uc003ezy.3	-						DHX36_uc010hvq.2_Intron|DHX36_uc003ezz.3_Intron	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36							cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGCCTACAATAAAAAAAAATG	0.224													7	4	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170174249	170174250	+	Intron	INS	-	T	T	rs112851745		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170174249_170174250insT	uc011bpt.1	+							NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			aaagtatttGAttttttttttt	0.005													5	3	---	---	---	---	
SLC7A14	57709	broad.mit.edu	37	3	170216267	170216267	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170216267delA	uc003fgz.2	-						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			ATGCCTGTGGAAAAAAAAACA	0.269													3	3	---	---	---	---	
SLC7A14	57709	broad.mit.edu	37	3	170236576	170236576	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170236576delA	uc003fgz.2	-						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			tttagagcttaaaaatgagca	0.000													4	2	---	---	---	---	
IL1RAP	3556	broad.mit.edu	37	3	190264727	190264727	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190264727delA	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		ATGTGGCCACAAAATGCCCCC	0.423													4	2	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	57746	57746	+	Intron	DEL	A	-	-	rs111852468		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57746delA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CTGGAAAAACAAAAGGGTTTT	0.303													3	3	---	---	---	---	
PIGG	54872	broad.mit.edu	37	4	502199	502199	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:502199delG	uc003gak.3	+						PIGG_uc003gaj.3_Intron|PIGG_uc011bux.1_Intron|PIGG_uc010ibf.2_Intron|PIGG_uc003gal.3_Intron|PIGG_uc003gai.2_Intron|PIGG_uc011buw.1_Intron|PIGG_uc003gam.2_Intron|PIGG_uc003gan.2_Intron	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						GAAGCCTGGTGGGTGCCCCCA	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	7124907	7124907	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7124907delT								FLJ36777 (19804 upstream) : SORCS2 (69467 downstream)																							tccttttttctttttttttga	0.249													5	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7689081	7689081	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7689081delG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TATCTGGGGTGGGGCAGGAGG	0.547													4	2	---	---	---	---	
CLNK	116449	broad.mit.edu	37	4	10576925	10576925	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10576925delC	uc003gmo.3	-						CLNK_uc003gmp.2_Intron	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						tgccagcacacccagctcacg	0.065													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21405749	21405750	+	Intron	INS	-	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21405749_21405750insG	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				ttcctctgcctgggggggctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	22979798	22979799	+	IGR	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22979798_22979799delGT								GBA3 (158607 upstream) : PPARGC1A (813846 downstream)																							gggagagggggtgacctgaaag	0.000													4	2	---	---	---	---	
KIAA1211	57482	broad.mit.edu	37	4	57184745	57184745	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57184745delA	uc003hbk.2	+						KIAA1211_uc010iha.2_Intron	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					TTTTCTCCCCAAATCTATCAC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	81173317	81173318	+	IGR	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81173317_81173318insT								PRDM8 (47837 upstream) : FGF5 (14424 downstream)																							ACATTCAACTCTTTTTTTTAGC	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	81925268	81925268	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81925268delA								C4orf22 (40372 upstream) : BMP3 (26851 downstream)																							TAGGAACAAGAAAAAAAAAAA	0.478													4	3	---	---	---	---	
ABCG2	9429	broad.mit.edu	37	4	89054064	89054064	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89054064delA	uc003hrg.2	-						ABCG2_uc003hrh.2_Intron|ABCG2_uc003hrf.2_5'Flank|ABCG2_uc003hri.1_Intron|ABCG2_uc003hrj.1_Intron|ABCG2_uc003hrk.1_Intron	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2						cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	ctacttaaagaaaaaaaaaaa	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	102321562	102321562	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102321562delA								PPP3CA (52934 upstream) : BANK1 (19556 downstream)																							ATCTGATGACAAAAAAGGGGG	0.413													4	2	---	---	---	---	
QRFPR	84109	broad.mit.edu	37	4	122301334	122301334	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301334delC	uc010inj.1	-						QRFPR_uc010ink.1_Intron|QRFPR_uc003ids.2_Intron|QRFPR_uc010inl.1_Intron	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103							plasma membrane	neuropeptide Y receptor activity				0						gacagacagacgagagaggag	0.244													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130281525	130281526	+	IGR	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130281525_130281526insT								C4orf33 (247683 upstream) : None (None downstream)																							GGGTGGCTTGATTTTTTTGCTT	0.436													4	2	---	---	---	---	
ARFIP1	27236	broad.mit.edu	37	4	153736334	153736334	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153736334delT	uc003imz.2	+						ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Intron|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					cttctgcttctttTTTTTTAA	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160637890	160637890	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160637890delG								RAPGEF2 (356591 upstream) : None (None downstream)																							TGGCAGGAATGGGTTAACTCA	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	168794680	168794680	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168794680delA								SPOCK3 (638939 upstream) : ANXA10 (219027 downstream)																							AACCAGCCCCAAAATGCAACA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1929639	1929640	+	IGR	DEL	AT	-	-	rs144970792		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1929639_1929640delAT								IRX4 (46759 upstream) : IRX2 (816641 downstream)																							ATTGTGTAGCATATGTGTTGTG	0.193													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6557700	6557700	+	IGR	DEL	T	-	-	rs11298047		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6557700delT								UBE2QL1 (64995 upstream) : LOC255167 (24587 downstream)																							aaattccaaattccttgaccg	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10962798	10962799	+	IGR	INS	-	AG	AG	rs144196101	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10962798_10962799insAG								DAP (201411 upstream) : CTNND2 (9153 downstream)																							ctctcatacccagagagagaga	0.000													2	4	---	---	---	---	
LMBRD2	92255	broad.mit.edu	37	5	36109758	36109759	+	Intron	INS	-	AA	AA			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36109758_36109759insAA	uc003jkb.1	-							NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2							integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATACACAAATTTATGTatttat	0.153													9	4	---	---	---	---	
LMBRD2	92255	broad.mit.edu	37	5	36109760	36109761	+	Intron	INS	-	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36109760_36109761insC	uc003jkb.1	-							NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2							integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACACAAATTTATGTatttattc	0.158													9	4	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37185444	37185444	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37185444delA	uc011cpa.1	-						C5orf42_uc011coy.1_5'Flank|C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc011cpb.1_Intron	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TATGCCCTGGAAAAAAAAAAC	0.274													4	2	---	---	---	---	
C9	735	broad.mit.edu	37	5	39337085	39337085	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39337085delT	uc003jlv.3	-							NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TTGTGTCTTGTTTTTTTTTTC	0.124													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39433164	39433165	+	IGR	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39433164_39433165delGT								DAB2 (7829 upstream) : None (None downstream)																							tgtgttaagcgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44748530	44748530	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44748530delA								FGF10 (359746 upstream) : MRPS30 (60497 downstream)																							Tttttggtgtaaaatggcgta	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56334038	56334039	+	IGR	DEL	AG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56334038_56334039delAG								MIER3 (66537 upstream) : GPBP1 (135736 downstream)																							AGTTCGCCACAGAGAGAGagag	0.054													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	60607474	60607474	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60607474delC								C5orf43 (149172 upstream) : ZSWIM6 (20626 downstream)																							TGCCCCCCGTCACCAAAAGAA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	74319759	74319759	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74319759delG								FAM169A (127971 upstream) : GCNT4 (3531 downstream)																							GCTGCTCTGTGGGAAGGTTGT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	80190536	80190536	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80190536delC								MSH3 (17903 upstream) : RASGRF2 (66022 downstream)																							agtagcatctccccccataca	0.000													4	2	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94876165	94876165	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94876165delA	uc003klb.2	-						TTC37_uc010jbf.1_Intron	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						attaaaaaTTAAAAAAaaaac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95600196	95600196	+	IGR	DEL	G	-	-	rs10709093		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95600196delG								MIR583 (185280 upstream) : PCSK1 (125923 downstream)																							GTCAGGGTCTGAGTTTGTGGG	0.388													2	4	---	---	---	---	
GIN1	54826	broad.mit.edu	37	5	102432045	102432045	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102432045delA	uc003koa.1	-						GIN1_uc003kob.1_Intron|GIN1_uc003koc.1_Intron	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN	zinc finger, H2C2 domain containing						DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		actctgtctcaaaaaaaaaaT	0.179													4	3	---	---	---	---	
CAMK4	814	broad.mit.edu	37	5	110797893	110797897	+	Intron	DEL	AATTA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110797893_110797897delAATTA	uc011cvj.1	+						CAMK4_uc003kpf.2_Intron|CAMK4_uc010jbv.2_Intron	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		ccatttgcctaattaacttctctag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121428130	121428130	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121428130delT								LOX (14075 upstream) : ZNF474 (37085 downstream)																							AGAGGAAGGGTTGCAGCAAGG	0.562											OREG0016742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ADAMTS19	171019	broad.mit.edu	37	5	129000952	129000952	+	Intron	DEL	G	-	-	rs76942465		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129000952delG	uc003kvb.1	+						ADAMTS19_uc010jdh.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGATTTTTTTGTTTGTTTTAC	0.363													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134776833	134776834	+	IGR	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134776833_134776834insA								H2AFY (41256 upstream) : C5orf20 (3071 downstream)																							TGAGCTAAGCCAAAATATTCAC	0.455													4	2	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135610164	135610164	+	Intron	DEL	A	-	-	rs66630545		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135610164delA	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTCTCTTTGAAAAAAAAAAG	0.294													4	2	---	---	---	---	
LARS	51520	broad.mit.edu	37	5	145518292	145518292	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145518292delA	uc003lnx.1	-						LARS_uc011dbq.1_Intron|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Intron	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	actctgtctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
SH3TC2	79628	broad.mit.edu	37	5	148210598	148210598	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148210598delT	uc003lpp.1	-							NM_024577		Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATCGTGAGTTTTTTTTTTG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	155126897	155126897	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155126897delT								KIF4B (729212 upstream) : SGCD (8166 downstream)																							CTGGTTGCCCTTTAATTGTGG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172128439	172128442	+	IGR	DEL	AAAC	-	-	rs140489348		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172128439_172128442delAAAC								NEURL1B (9908 upstream) : DUSP1 (66660 downstream)																							ttcttcacttaaacaaatGACCAC	0.260													4	2	---	---	---	---	
AACSL	729522	broad.mit.edu	37	5	178214987	178214988	+	Intron	INS	-	C	C	rs143276462	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178214987_178214988insC	uc011dgl.1	-						AACSL_uc003mjk.2_Intron					Homo sapiens acetoacetyl-CoA synthetase-like, mRNA (cDNA clone IMAGE:3945810), partial cds.												0						TTAAGACCGTTCCGTGTCACTA	0.525													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	24123167	24123168	+	IGR	INS	-	CCTG	CCTG	rs143751584	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24123167_24123168insCCTG								None (None upstream) : NRSN1 (3246 downstream)																							GACAATTGTGCCAGGACTTGAA	0.401													2	4	---	---	---	---	
MRPS10	55173	broad.mit.edu	37	6	42188223	42188223	+	5'Flank	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42188223delC	uc003osa.3	-						MRPS10_uc011dup.1_5'Flank	NM_018141	NP_060611	P82664	RT10_HUMAN	mitochondrial ribosomal protein S10						translation	actin cytoskeleton|mitochondrion|ribosome	structural constituent of ribosome				0	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00528)			agttttcctgcccctcaggct	0.189													4	2	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46522547	46522548	+	Intron	DEL	TT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46522547_46522548delTT	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						CACCAAGTCCTTTTTTTATGGT	0.411													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57469140	57469141	+	Intron	INS	-	ACAC	ACAC	rs112377419		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57469140_57469141insACAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ggatttcatttacacgttatac	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57511048	57511049	+	Intron	INS	-	TA	TA	rs10643529		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57511048_57511049insTA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGGTTTTTAAGTCTGACTTACT	0.213													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57562257	57562257	+	IGR	DEL	G	-	-	rs67219435		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57562257delG								PRIM2 (48882 upstream) : GUSBL2 (683902 downstream)																							aagcttccacgtttttcctgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	68487625	68487626	+	IGR	INS	-	CG	CG	rs145318720	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68487625_68487626insCG								None (None upstream) : BAI3 (858006 downstream)																							ctctctctcctctctctctctc	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	78088926	78088926	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78088926delT								None (None upstream) : HTR1B (83022 downstream)																							ggtgatgcccttgcccaggtt	0.000													4	2	---	---	---	---	
PHIP	55023	broad.mit.edu	37	6	79701024	79701024	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79701024delT	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		AGAAATTGGATTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89315426	89315426	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89315426delG								CNR1 (439659 upstream) : RNGTT (4563 downstream)																							gatggagcctgggtcactgct	0.000													4	2	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90361650	90361650	+	Intron	DEL	A	-	-	rs5878105		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90361650delA	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CACAACTATTAACATCCATTA	0.418													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	91022816	91022816	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91022816delA								BACH2 (16254 upstream) : MAP3K7 (202537 downstream)																							CATGCTTCTCAAAGCCCTAGT	0.527													4	2	---	---	---	---	
RTN4IP1	84816	broad.mit.edu	37	6	107029547	107029547	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107029547delT	uc003prj.2	-						RTN4IP1_uc010kdd.2_Intron|RTN4IP1_uc003prk.2_Intron	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor							mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		CAAGGACATCTTTTTTTGTTG	0.403													4	2	---	---	---	---	
FYN	2534	broad.mit.edu	37	6	112052062	112052062	+	Intron	DEL	A	-	-	rs139930218		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112052062delA	uc003pvj.2	-						FYN_uc003pvi.2_Intron|FYN_uc003pvk.2_Intron	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a						axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	AAGAGAAAAGAAAAACAAAAA	0.428													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123051618	123051618	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123051618delT								PKIB (4101 upstream) : FABP7 (49028 downstream)																							ACTATGAACATTTTTAGAGAA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130899179	130899179	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130899179delC								TMEM200A (134971 upstream) : LOC285733 (249145 downstream)																							caaaacaaaacaaaaACACCT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138241011	138241011	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138241011delT								TNFAIP3 (36566 upstream) : PERP (168631 downstream)																							CCCAGCAAGGTTACAGCTTTC	0.378													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152900644	152900644	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152900644delT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATTGTGTCACTtttttttctt	0.040										HNSCC(10;0.0054)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153626415	153626420	+	IGR	DEL	CCTTCT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153626415_153626420delCCTTCT								RGS17 (174026 upstream) : OPRM1 (705216 downstream)																							ttcctcttccccttctccttctcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164832754	164832755	+	IGR	DEL	TG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164832754_164832755delTG								QKI (837862 upstream) : C6orf118 (860400 downstream)																							CTTGTGTGTCTGTGACTCCGGC	0.609													4	2	---	---	---	---	
PDGFA	5154	broad.mit.edu	37	7	554605	554611	+	Intron	DEL	AGACCCC	-	-	rs113408277		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:554605_554611delAGACCCC	uc003sir.2	-						PDGFA_uc003sis.2_Intron|PDGFA_uc003sit.1_5'Flank	NM_002607	NP_002598	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha isoform 1						actin cytoskeleton organization|angiogenesis|cell projection assembly|embryo development|hair follicle development|lung alveolus development|negative chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|organ morphogenesis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of DNA replication|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of MAP kinase activity|positive regulation of mesenchymal cell proliferation|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|regulation of actin cytoskeleton organization|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling|regulation of peptidyl-tyrosine phosphorylation|regulation of smooth muscle cell migration|skin development	cell surface|endoplasmic reticulum lumen|extracellular space|Golgi membrane|microvillus|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		GGAGCGGCCAAGACCCCAGACGGTGCC	0.618													3	3	---	---	---	---	
CBX3	11335	broad.mit.edu	37	7	26252044	26252045	+	3'UTR	DEL	CC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26252044_26252045delCC	uc003sxt.2	+	6					CBX3_uc003sxu.2_3'UTR|CBX3_uc003sxv.2_3'UTR	NM_007276	NP_009207	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding			ovary(1)	1						GTAGTTGCTTCCTTTATCAGAA	0.347													2	5	---	---	---	---	
NOD1	10392	broad.mit.edu	37	7	30477996	30477996	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30477996delT	uc003tav.2	-							NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain						activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						tggacctcagttgccccatct	0.090													4	2	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30818379	30818380	+	Intron	DEL	TG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30818379_30818380delTG	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						ATTGGCGTGTTGTGTGTGTGTG	0.574													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40192303	40192303	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40192303delT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						AATTAAGGTGttttttttttt	0.154													7	4	---	---	---	---	
PKD1L1	168507	broad.mit.edu	37	7	47831911	47831912	+	Intron	INS	-	T	T	rs151120143		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47831911_47831912insT	uc003tny.1	-						C7orf69_uc003tnz.3_5'Flank|C7orf69_uc003toa.1_5'Flank	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						TAgatttctgggtttttttttg	0.188													4	2	---	---	---	---	
LANCL2	55915	broad.mit.edu	37	7	55479297	55479297	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55479297delA	uc003tqp.2	+							NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2						negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TTAACAAAGCAAAGCAACAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57698974	57698975	+	IGR	DEL	AC	-	-	rs145904451	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57698974_57698975delAC								ZNF716 (165709 upstream) : None (None downstream)																							TAAAAAATGTACAGTGAGGGAA	0.272													4	2	---	---	---	---	
ZNF107	51427	broad.mit.edu	37	7	64143528	64143531	+	Intron	DEL	TCTC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64143528_64143531delTCTC	uc003ttd.2	+						ZNF107_uc003tte.2_Intron|uc003ttf.2_Intron	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				actcacgctgtctctctctaaggg	0.000													6	4	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	70003526	70003527	+	Intron	DEL	AG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70003526_70003527delAG	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		aaaaaaagaaaGAGAGAGAGAG	0.163													6	3	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83117502	83117502	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83117502delA	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				GCCAGACAATAAAGGGGGAAC	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84409531	84409533	+	IGR	DEL	TGG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84409531_84409533delTGG								SEMA3A (585314 upstream) : SEMA3D (215341 downstream)																							ggcagcagcatggtggtggtggg	0.000													4	2	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98658522	98658522	+	Intron	DEL	A	-	-	rs77409197		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98658522delA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			AAAGTGACTGAAAAAAAAAAA	0.308													6	4	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101047532	101047532	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101047532delC	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					aactctgcagccactcacttc	0.000													4	2	---	---	---	---	
FAM185A	222234	broad.mit.edu	37	7	102439714	102439714	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102439714delG	uc011klf.1	+						FAM185A_uc011klg.1_Intron|FAM185A_uc011klh.1_Intron	NM_001145268	NP_001138740	Q8N0U4	F185A_HUMAN	hypothetical protein LOC222234 isoform 1												0						TAATTAAAATGGGGTTGTGAT	0.378													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103140928	103140928	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103140928delA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCTGCTTAAGAAAAAAAAAAG	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	112222337	112222338	+	IGR	INS	-	G	G	rs150216504	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112222337_112222338insG								C7orf53 (91402 upstream) : TMEM168 (183451 downstream)																							GACATGTGTTTGGGGCAAGGAG	0.436													3	3	---	---	---	---	
MET	4233	broad.mit.edu	37	7	116399807	116399807	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116399807delT	uc003vij.2	+						MET_uc010lkh.2_Intron|MET_uc011knh.1_Intron|MET_uc011kni.1_Intron|MET_uc011knj.1_Intron	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TGAGACAGTGTTTTTTTATGT	0.234			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				4	2	---	---	---	---	
C7orf58	79974	broad.mit.edu	37	7	120725124	120725125	+	Intron	DEL	TA	-	-	rs145913925		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120725124_120725125delTA	uc003vjq.3	+						C7orf58_uc003vjr.1_Intron|C7orf58_uc003vjs.3_Intron|C7orf58_uc003vjt.3_Intron|C7orf58_uc010lkk.1_Intron	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TTGTTACAGCTATATTCACCGT	0.391													3	3	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127292577	127292578	+	Intron	INS	-	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127292577_127292578insG	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CTCCACCTTCCGCCAGCCTGCT	0.619													6	4	---	---	---	---	
SLC13A4	26266	broad.mit.edu	37	7	135385241	135385241	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135385241delG	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0						TCTTCCTAGTGGGGCCGAAGT	0.393													4	2	---	---	---	---	
DGKI	9162	broad.mit.edu	37	7	137494650	137494650	+	Intron	DEL	A	-	-	rs72309821		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137494650delA	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						acccagttggaaaaaaaaaaa	0.184													6	4	---	---	---	---	
PARP12	64761	broad.mit.edu	37	7	139724293	139724293	+	3'UTR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139724293delA	uc003vvl.1	-	12					PARP12_uc003vvk.1_3'UTR|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12							nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					GTTTAAAAAGAAAAGGAAAGG	0.413													28	18	---	---	---	---	
LOC100124692	100124692	broad.mit.edu	37	7	141872114	141872115	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141872114_141872115insT	uc003vxa.2	+							NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0						AAATAAACTGACTTTCCATTTA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143913122	143913122	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143913122delT								ARHGEF35 (20386 upstream) : OR2A1 (15884 downstream)																							TCATCTCTAATTTTTTTTGGC	0.279													4	2	---	---	---	---	
ACTR3B	57180	broad.mit.edu	37	7	152498092	152498092	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152498092delT	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		TTAAGCAGACTTTTTTTTTTT	0.294													5	6	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158032297	158032297	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158032297delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGCCACCATCAAAAGCTTCTC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23329631	23329632	+	IGR	DEL	GT	-	-	rs72446955		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23329631_23329632delGT								ENTPD4 (14387 upstream) : SLC25A37 (56731 downstream)																							CACAGTTGTAgtgtgtgtgtgt	0.312											OREG0018637	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
CHRNA2	1135	broad.mit.edu	37	8	27327114	27327114	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27327114delG	uc010lur.2	-						CHRNA2_uc011lal.1_Intron|CHRNA2_uc010lus.2_Intron	NM_000742	NP_000733	Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha							cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(1)	1		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Gallamine Triethiodide(DB00483)|Levallorphan(DB00504)|Mecamylamine(DB00657)|Metocurine(DB01336)|Metocurine Iodide(DB00416)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Rocuronium(DB00728)|Tubocurarine(DB01199)	CTCCAGAGCTGGGAGAGGGGA	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66900076	66900095	+	IGR	DEL	CAGGTTATGTGCAGCAAAAG	-	-	rs111392270		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66900076_66900095delCAGGTTATGTGCAGCAAAAG								PDE7A (146321 upstream) : DNAJC5B (33696 downstream)																							ACTACATACTCAGGTTATGTGCAGCAAAAGCAGGGGTCTT	0.355													4	2	---	---	---	---	
PAG1	55824	broad.mit.edu	37	8	81980188	81980188	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81980188delG	uc003ybz.2	-							NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			TCTCTTTTTTGGggggcaatc	0.209													4	2	---	---	---	---	
EBAG9	9166	broad.mit.edu	37	8	110565856	110565857	+	Intron	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110565856_110565857insA	uc003ynf.2	+						EBAG9_uc010mcn.1_Intron|EBAG9_uc003yng.2_Intron	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated						apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			GTTTATAATTCTGAGTCCTAAG	0.252													9	4	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113315463	113315463	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113315463delA	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAATCCTGGGAAAAAAACTTG	0.204										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123713101	123713101	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123713101delT								None (None upstream) : ZHX2 (80800 downstream)																							CCCATGACTCttttttttttt	0.264													4	2	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133395295	133395296	+	Intron	DEL	CT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133395295_133395296delCT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CTTCCTAAAACTCTCTCATTCT	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143271092	143271092	+	IGR	DEL	A	-	-	rs117679493	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143271092delA								MIR1302-7 (403418 upstream) : NCRNA00051 (8625 downstream)																							CTCCAGGAAGAGGGCCTGCTG	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	3065815	3065815	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3065815delT								KIAA0020 (221685 upstream) : RFX3 (158834 downstream)																							atgaaaattctacctaactta	0.134													4	2	---	---	---	---	
C9orf68	55064	broad.mit.edu	37	9	4644899	4644899	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4644899delT	uc011llz.1	-						C9orf68_uc003zik.2_Intron|C9orf68_uc003zil.2_Intron|C9orf68_uc010mhj.2_Intron|C9orf68_uc011lly.1_Intron|C9orf68_uc003zim.2_Intron	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN	hypothetical protein LOC55064												0		Breast(48;0.0456)		GBM - Glioblastoma multiforme(50;0.0222)		AATCTCATGATTCTAGCAcag	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	31644575	31644576	+	IGR	INS	-	A	A	rs35544561		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31644575_31644576insA								None (None upstream) : ACO1 (740025 downstream)																							TTTTTTTTTTTAATTCATCCTT	0.386													4	2	---	---	---	---	
UNC13B	10497	broad.mit.edu	37	9	35367640	35367641	+	Intron	INS	-	C	C	rs149773210	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35367640_35367641insC	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ATTAAGTTACTCCTAGGCTTGA	0.287													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67337092	67337092	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67337092delT								AQP7P1 (47600 upstream) : FAM27B (455838 downstream)																							ataaaaatgcttcaacaagca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68428787	68428787	+	IGR	DEL	T	-	-	rs78281943		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68428787delT								FAM27B (634598 upstream) : MIR1299 (573452 downstream)																							TTTCTAACTCTGGTTCTAATA	0.254													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93292691	93292692	+	Intron	DEL	TT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93292691_93292692delTT	uc004aqt.1	-											Homo sapiens cDNA FLJ46333 fis, clone TESTI4045701.																		ACTCAGGAACtttttttttttt	0.163													6	4	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101749790	101749790	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101749790delT	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				TATTTTGGGCTTTTGGCGTGA	0.522													4	2	---	---	---	---	
TNC	3371	broad.mit.edu	37	9	117817801	117817802	+	Intron	INS	-	A	A	rs141967387	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117817801_117817802insA	uc004bjj.3	-						TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GCCCGCCAATCAGCCCATGAAG	0.505													4	2	---	---	---	---	
PAPPA	5069	broad.mit.edu	37	9	119102069	119102069	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119102069delT	uc004bjn.2	+						PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TTGTCAGCCCTTTAACTTCTG	0.512													4	2	---	---	---	---	
RABGAP1	23637	broad.mit.edu	37	9	125719097	125719097	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125719097delG	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc004bnm.1_Intron	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						GAAATATCTTGGCCTTGAATA	0.299													4	2	---	---	---	---	
ENTPD2	954	broad.mit.edu	37	9	139944970	139944970	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139944970delG	uc004ckw.1	-	6	851	c.795delC	c.(793-795)TGCfs	p.C265fs	ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Frame_Shift_Del_p.C265fs	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	265	Extracellular (Potential).					integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCCTCGGCCAGCAGGGGTGGA	0.642											OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4128380	4128380	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4128380delG	uc001ihc.1	+											Homo sapiens cDNA FLJ31241 fis, clone KIDNE2004985.																		TGTGAAGGGAGGGTCTGAGGC	0.433													4	2	---	---	---	---	
UPF2	26019	broad.mit.edu	37	10	12076804	12076805	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12076804_12076805insT	uc001ila.2	-						UPF2_uc001ilb.2_Intron|UPF2_uc001ilc.2_Intron|UPF2_uc009xiz.1_Intron	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				attccgtctcaaaataaataaa	0.134													4	2	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	14446423	14446424	+	Intron	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14446423_14446424delCA	uc001imv.2	-						FRMD4A_uc001imw.1_Intron			Q9P2Q2	FRM4A_HUMAN	Homo sapiens mRNA for KIAA1294 protein, partial cds.							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						GCTTATGTGTCACCCATGCCAA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	18382614	18382614	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18382614delA								SLC39A12 (50393 upstream) : CACNB2 (46992 downstream)																							ATGGGGATTCAAAGTAAAGTG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45400182	45400182	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45400182delG	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																		TGCATGGCCTGGGAGTCAGTC	0.468													4	2	---	---	---	---	
DKK1	22943	broad.mit.edu	37	10	54074083	54074084	+	5'UTR	INS	-	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54074083_54074084insC	uc001jjr.2	+	1					uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor						negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						TGGGACCGCAGGGGGCTCCCGG	0.649											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
ADK	132	broad.mit.edu	37	10	76157062	76157062	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76157062delT	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	AGAATTGAGGTTTTTTTTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82013983	82013983	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82013983delT								ANXA11 (48550 upstream) : MAT1A (17594 downstream)																							GGCACAGAGCTTCTGACCAGC	0.567													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114809106	114809107	+	Intron	DEL	AC	-	-	rs144374886	byFrequency	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114809106_114809107delAC	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		gtaaagctcaacaacatcgacc	0.000													5	3	---	---	---	---	
INPP5F	22876	broad.mit.edu	37	10	121565564	121565564	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121565564delT	uc001leo.2	+							NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F								phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		GTGCCTTCTGTTTTTTTACAT	0.239													6	3	---	---	---	---	
FOXI2	399823	broad.mit.edu	37	10	129537314	129537314	+	3'UTR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129537314delG	uc009yas.2	+	2					uc009yar.1_5'Flank	NM_207426	NP_997309	Q6ZQN5	FOXI2_HUMAN	forkhead box I2						epidermal cell fate specification|otic placode formation|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				CCCACGTGTTGGCGTTGAAGG	0.687													4	2	---	---	---	---	
KRTAP5-6	440023	broad.mit.edu	37	11	1717714	1717714	+	5'Flank	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1717714delC	uc001lua.2	+							NM_001012416	NP_001012416	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6							keratin filament					0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TTGAATAGGACCCCCTCATTC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	2373751	2373751	+	Intron	DEL	T	-	-	rs34141522		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2373751delT	uc001lwe.2	-											Homo sapiens, clone IMAGE:4940779, mRNA.																		catttctctctttcttgcatt	0.000													1	5	---	---	---	---	
SBF2	81846	broad.mit.edu	37	11	10018419	10018419	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10018419delA	uc001mib.2	-						SBF2_uc001mif.3_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TCATCTCTGTAAAAACATTCA	0.119													4	2	---	---	---	---	
PLEKHA7	144100	broad.mit.edu	37	11	16876763	16876763	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16876763delA	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						TGGGTCACTGAAAAAAAAAAT	0.438													4	2	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17489560	17489561	+	Intron	INS	-	TGG	TGG	rs148296139	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17489560_17489561insTGG	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CAGCCAGGCCCTGGTTAATGAA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22006582	22006582	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22006582delC								NELL1 (409355 upstream) : ANO5 (208140 downstream)																							GCAGTCCCTTCCAGGGAATTC	0.413													4	2	---	---	---	---	
BBOX1	8424	broad.mit.edu	37	11	27147033	27147033	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27147033delA	uc001mre.1	+						BBOX1_uc009yih.1_Intron|BBOX1_uc001mrg.1_Intron	NM_003986	NP_003977	O75936	BODG_HUMAN	gamma-butyrobetaine dioxygenase						carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)	TGAATGAATGAAAAAAAAGAG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45535895	45535896	+	IGR	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45535895_45535896insA								SYT13 (228011 upstream) : CHST1 (134531 downstream)																							GACCCAAAGGGAAGATGGGAGA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47352083	47352084	+	IGR	DEL	CT	-	-	rs11570124		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47352083_47352084delCT								MADD (501 upstream) : MYBPC3 (874 downstream)																							CCTGGCTGCACTCTCAGGGAAT	0.574													4	4	---	---	---	---	
CDC42BPG	55561	broad.mit.edu	37	11	64592215	64592215	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64592215delT	uc001obs.3	-							NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						CTCAAAGTCCttttttttttc	0.249													4	2	---	---	---	---	
PITPNM1	9600	broad.mit.edu	37	11	67262282	67262283	+	Intron	INS	-	GA	GA	rs67466581		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67262282_67262283insGA	uc001olx.2	-						PITPNM1_uc001olw.2_Intron|PITPNM1_uc001oly.2_Intron|PITPNM1_uc001olz.2_Intron	NM_004910	NP_004901	O00562	PITM1_HUMAN	phosphatidylinositol transfer protein,						brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity			lung(2)|central_nervous_system(1)	3						CGAGAGTGGGCGAGTGGGCGAG	0.703													9	6	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113618699	113618700	+	Intron	DEL	TA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113618699_113618700delTA	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AAGGAAACACTAAAAAGAAGCA	0.248													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118378045	118378045	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118378045delC	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		tttctagcaacccacaagggt	0.010			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								4	2	---	---	---	---	
MCAM	4162	broad.mit.edu	37	11	119187759	119187761	+	In_Frame_Del	DEL	CAG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119187759_119187761delCAG	uc001pwf.2	-	1	80_82	c.51_53delCTG	c.(49-54)TGCTGT>TGT	p.17_18CC>C		NM_006500	NP_006491	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	17_18					anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane				ovary(2)|breast(1)|central_nervous_system(1)	4		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GACGCGAGGACAGCAGCAGCAGG	0.744													4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120823920	120823921	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120823920_120823921insT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	TTCTGCACCTCTGCCTCCTGTC	0.619											OREG0021429	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
C11orf63	79864	broad.mit.edu	37	11	122776167	122776167	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122776167delT	uc001pym.2	+						C11orf63_uc001pyl.1_3'UTR	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1											ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CCAACTGGTATTTTTTTTTAA	0.343													4	2	---	---	---	---	
MLF2	8079	broad.mit.edu	37	12	6858469	6858471	+	Intron	DEL	GGA	-	-	rs72078765		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6858469_6858471delGGA	uc010sfi.1	-						MLF2_uc001qqp.2_Intron|MLF2_uc009zey.1_Intron	NM_005439	NP_005430	Q15773	MLF2_HUMAN	myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1						GGATCAAGGTGGAGAAGGGTGTA	0.478													7	7	---	---	---	---	
MLF2	8079	broad.mit.edu	37	12	6868997	6868997	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6868997delA	uc009zey.1	-							NM_005439	NP_005430	Q15773	MLF2_HUMAN	myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1						CTGAAGATGTAAAAAAAAAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	7384919	7384919	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7384919delT								PEX5 (13752 upstream) : ACSM4 (72009 downstream)																							tcttgcttgattttttttttt	0.000													5	3	---	---	---	---	
ETNK1	55500	broad.mit.edu	37	12	22804047	22804048	+	Intron	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22804047_22804048delGT	uc001rft.2	+						ETNK1_uc009ziz.2_Intron	NM_018638	NP_061108	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1 isoform A						phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|ethanolamine kinase activity				0						cagttctgtggtgtaatgtaca	0.000													4	2	---	---	---	---	
DDX23	9416	broad.mit.edu	37	12	49227553	49227553	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49227553delT	uc001rsm.2	-							NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						CAGTAGAAACTTTTTTTTTTT	0.388													4	2	---	---	---	---	
ARF3	377	broad.mit.edu	37	12	49332451	49332452	+	3'UTR	INS	-	GA	GA	rs148694584	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49332451_49332452insGA	uc001rsr.2	-	5					ARF3_uc010smc.1_3'UTR	NM_001659	NP_001650	P61204	ARF3_HUMAN	ADP-ribosylation factor 3						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity				0						ACCCAGAGGGTGAGAGAGAGAG	0.490													5	4	---	---	---	---	
ACVR1B	91	broad.mit.edu	37	12	52388698	52388698	+	3'UTR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52388698delG	uc001rzn.2	+	9					ACVR1B_uc010snn.1_3'UTR	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor						G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	ATGCCACAGTGGTACTCTGTG	0.587													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	67044913	67044913	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67044913delT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		ATGCATATACTTTTTGGTTTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70314354	70314355	+	IGR	INS	-	CA	CA	rs146966213	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70314354_70314355insCA								RAB3IP (97372 upstream) : CNOT2 (322422 downstream)																							ccaggtgagcccactctctagg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77781202	77781202	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77781202delA								E2F7 (321842 upstream) : NAV3 (443867 downstream)																							ATGAGACATGAAAAAAATGTG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80690470	80690471	+	IGR	DEL	AC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80690470_80690471delAC								PPP1R12A (361235 upstream) : PTPRQ (147655 downstream)																							GTTAAAAATGACTTTTTATTTT	0.213													6	4	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92415480	92415480	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92415480delA	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				AAAAGACCAGAAAAAAACACA	0.373			T	MYC	BCLL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	102895079	102895082	+	IGR	DEL	TCAA	-	-	rs148077578		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102895079_102895082delTCAA								IGF1 (20701 upstream) : PAH (337022 downstream)																							ggattctgtctcaatcaatcaatc	0.142													4	4	---	---	---	---	
KIAA1033	23325	broad.mit.edu	37	12	105537223	105537224	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105537223_105537224insT	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						ACTAGGAATTAGGAGATTTTAA	0.252													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106649420	106649421	+	IGR	INS	-	TGG	TGG	rs143447651	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106649420_106649421insTGG								CKAP4 (7707 upstream) : TCP11L2 (47160 downstream)																							gaggaggatgatggtgattatt	0.163													4	3	---	---	---	---	
CMKLR1	1240	broad.mit.edu	37	12	108699756	108699756	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108699756delA	uc009zuw.2	-						CMKLR1_uc001tmw.2_Intron|CMKLR1_uc001tmv.2_Intron|CMKLR1_uc009zuv.2_Intron	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a						chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						CCCCCCACCCAAAATATTCAC	0.547													4	2	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110256121	110256121	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110256121delC	uc001tpk.1	-						TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						taaacatcctccaaaacaaaa	0.279													4	2	---	---	---	---	
TBX5	6910	broad.mit.edu	37	12	114803652	114803653	+	Intron	INS	-	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114803652_114803653insG	uc001tvo.2	-						TBX5_uc001tvp.2_Intron|TBX5_uc001tvq.2_Intron	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1						cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		aaaaaaaaagaaaaaaaaaagt	0.149													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119858097	119858097	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119858097delA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TTCTTATGACAAAAAAAATAC	0.299													4	2	---	---	---	---	
DHX37	57647	broad.mit.edu	37	12	125473494	125473494	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125473494delG	uc001ugy.2	-	1	174	c.75delC	c.(73-75)CCCfs	p.P25fs		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	25							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GGGGCGGCTCGGGGGGGCCCT	0.711													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	130971256	130971257	+	Intron	INS	-	A	A	rs34292897		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130971256_130971257insA	uc001uil.2	-						RIMBP2_uc001uim.2_Intron	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		agatctttgagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131721950	131721950	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131721950delA								LOC116437 (24475 upstream) : SFRS8 (473685 downstream)																							TACCATTGTCAATAGTGGAGG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132642978	132642979	+	IGR	DEL	AC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132642978_132642979delAC								NOC4L (5992 upstream) : GALNT9 (37939 downstream)																							cacacacactacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	24931146	24931147	+	IGR	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24931146_24931147delCA								C1QTNF9 (34481 upstream) : PARP4 (63928 downstream)																							acacgttcatcacacactcatc	0.059													4	2	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	24995651	24995652	+	Intron	DEL	TG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24995651_24995652delTG	uc001upl.2	-							NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCAAGTGCCCTGTGCCCGCCAC	0.510													4	2	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25074195	25074195	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25074195delA	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		taaaagaattaaaaaaaaaaC	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49788884	49788884	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49788884delC								FNDC3A (4970 upstream) : MLNR (5590 downstream)																							TCTCCACCATCCCCCTTGGTA	0.507													4	2	---	---	---	---	
TDRD3	81550	broad.mit.edu	37	13	61019078	61019078	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61019078delA	uc001via.2	+						TDRD3_uc010aef.2_Intron|TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		TTTCAACATTAAAAAAAAAAG	0.338													4	2	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74419744	74419744	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74419744delA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TATGGTAAGTAAAAATACACT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88542299	88542299	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88542299delT								SLITRK5 (210431 upstream) : None (None downstream)																							ACTCACCTCATTTTTTTTTTA	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98149063	98149063	+	IGR	DEL	T	-	-	rs11325251		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98149063delT								RAP2A (28812 upstream) : IPO5 (456866 downstream)																							AGTACCTTTCTGTAGCACTtc	0.328													1	6	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109771189	109771189	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109771189delA	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CAATACAATGAAAAAAAAAAG	0.338													4	2	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109859336	109859337	+	3'UTR	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109859336_109859337delGT	uc001vqt.1	+	35					MYO16_uc010agk.1_3'UTR	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATGAGATCCCgtgtgtgtgtgt	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114940920	114940920	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114940920delC								RASA3 (42825 upstream) : CDC16 (59442 downstream)																							CTCCCAGCTTCTTTAGCTCAG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22806049	22806049	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22806049delA	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GAGCCTTGGCAAAATCTGCTG	0.448													4	2	---	---	---	---	
RALGAPA1	253959	broad.mit.edu	37	14	36192011	36192012	+	Intron	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36192011_36192012insA	uc001wti.2	-						RALGAPA1_uc001wtj.2_Intron|RALGAPA1_uc010tpv.1_Intron|RALGAPA1_uc010tpw.1_Intron|RALGAPA1_uc001wtk.1_Intron	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						TTATTGTACACATTTTAAATAG	0.223													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49673609	49673609	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49673609delA								None (None upstream) : SDCCAG1 (359418 downstream)																							TTTTGGAGTCAAAAAAAAAAA	0.413													4	3	---	---	---	---	
DLGAP5	9787	broad.mit.edu	37	14	55644260	55644260	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55644260delT	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						GAATAGAATCttttttttttt	0.174													8	4	---	---	---	---	
EXOC5	10640	broad.mit.edu	37	14	57688675	57688675	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57688675delA	uc001xct.2	-						EXOC5_uc001xcs.2_Intron|EXOC5_uc010trg.1_Intron|EXOC5_uc010trh.1_Intron	NM_006544	NP_006535	O00471	EXOC5_HUMAN	SEC10 protein						exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3						CTTAGTTTTTAATACTTCTCT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	59458585	59458586	+	IGR	DEL	AG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59458585_59458586delAG								DACT1 (343549 upstream) : DAAM1 (196813 downstream)																							atggatagatagaGagagagac	0.010													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64461572	64461572	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64461572delA	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TATTTGTTAGAAAAAAAAACC	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66335583	66335583	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66335583delT								FUT8 (125622 upstream) : C14orf53 (617526 downstream)																							gtgagagaggttttttttttg	0.000													4	4	---	---	---	---	
SPTLC2	9517	broad.mit.edu	37	14	78021964	78021964	+	Intron	DEL	T	-	-	rs151267420	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78021964delT	uc001xub.2	-							NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TTACTGCttcttttttttttc	0.134													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	96560323	96560323	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96560323delT								C14orf132 (190 upstream) : BDKRB2 (110812 downstream)																							attctgatgcttttcctgccc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97565937	97565937	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97565937delA								VRK1 (217987 upstream) : C14orf64 (826010 downstream)																							ATGCACAATGAAAATGGAACC	0.294													4	2	---	---	---	---	
MARK3	4140	broad.mit.edu	37	14	103964627	103964627	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103964627delT	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron|MARK3_uc010tyb.1_Intron|MARK3_uc010awq.2_Intron|MARK3_uc001ynd.2_5'Flank	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			CTTTTCTTACTTTTTTTTGAT	0.234													5	3	---	---	---	---	
PPP1R13B	23368	broad.mit.edu	37	14	104279570	104279570	+	Intron	DEL	A	-	-	rs11362801		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104279570delA	uc001yof.1	-						PPP1R13B_uc001yog.1_Intron	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1						apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CAGCAATGTTAAAAAAAAAAA	0.209													4	4	---	---	---	---	
C14orf180	400258	broad.mit.edu	37	14	105054842	105054843	+	Intron	INS	-	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105054842_105054843insG	uc001yow.1	+						C14orf180_uc010tyh.1_Intron|C14orf180_uc010awy.1_3'UTR	NM_001008404	NP_001008404	Q8N912	CN180_HUMAN	hypothetical protein LOC400258							integral to membrane					0		Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CCCCATCCCTTCCCCACCAGCC	0.693													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105670870	105670871	+	IGR	DEL	GT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105670870_105670871delGT								NUDT14 (23210 upstream) : BRF1 (4752 downstream)																							GCGAGCAGACGTGTGTGCGGAT	0.599													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106962711	106962711	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106962711delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ACTGATTTCTGCTTTTACCTC	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22539625	22539626	+	IGR	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22539625_22539626delCA								MIR1268 (26345 upstream) : GOLGA8DP (162659 downstream)																							acacacataccacacagataca	0.069													4	2	---	---	---	---	
GOLGA8DP	100132979	broad.mit.edu	37	15	22709278	22709278	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22709278delA	uc010axw.2	-						GOLGA8DP_uc010axx.2_Intron|uc010tzw.1_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E												0						TCTGGATTCCAaaaaaaaaag	0.498													4	2	---	---	---	---	
ARHGAP11B	89839	broad.mit.edu	37	15	30956187	30956188	+	Intron	INS	-	T	T	rs148771096	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30956187_30956188insT	uc001zeu.2	+							NM_001039841		Q3KRB8	RHGBB_HUMAN	Rho GTPase activating protein 11B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TCCCATCACTCTTTTTTTTCTT	0.252													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	50435786	50435787	+	IGR	DEL	AG	-	-	rs151264657		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50435786_50435787delAG								ATP8B4 (24367 upstream) : SLC27A2 (38606 downstream)																							ttgactatacagagtcagccgt	0.015													4	5	---	---	---	---	
DPP8	54878	broad.mit.edu	37	15	65738954	65738955	+	3'UTR	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65738954_65738955insT	uc002aov.2	-	20					DPP8_uc002aow.2_3'UTR|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_3'UTR|DPP8_uc002aoy.2_3'UTR|DPP8_uc002aoz.2_3'UTR|DPP8_uc010bhj.2_3'UTR|DPP8_uc010bhi.2_3'UTR	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						GTGCTAATGTCttttttttttt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	74128390	74128390	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74128390delT								C15orf59 (84574 upstream) : TBC1D21 (37578 downstream)																							tgaaagggacttTTTTTTTTT	0.179													4	3	---	---	---	---	
EFTUD1	79631	broad.mit.edu	37	15	82521690	82521691	+	Intron	INS	-	G	G			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82521690_82521691insG	uc002bgt.1	-						EFTUD1_uc002bgu.1_Intron	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain						mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						TGACCATTTGTGGGTCATATTA	0.406													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84059113	84059113	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84059113delA								BNC1 (105645 upstream) : SH3GL3 (56978 downstream)																							CTTCTTGAAGAAAAAAAAAAA	0.368													8	5	---	---	---	---	
PDE8A	5151	broad.mit.edu	37	15	85626541	85626541	+	Intron	DEL	T	-	-	rs111559370		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85626541delT	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			AAGAAAAGCCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
NTRK3	4916	broad.mit.edu	37	15	88541564	88541564	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88541564delC	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron|NTRK3_uc002bmg.2_Intron|NTRK3_uc010bni.2_Intron	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGATGCTGCTCCTAAAAGCCC	0.448			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92120270	92120270	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92120270delA								SV2B (281622 upstream) : SLCO3A1 (276668 downstream)																							GCATCTGGCTAACAAATTCCT	0.473													4	2	---	---	---	---	
FAM174B	400451	broad.mit.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	-	-	rs68056278		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93198679_93198684delTGGAGC	uc010boe.2	-	1	348_353	c.206_211delGCTCCA	c.(205-213)AGCTCCAAC>AAC	p.SS69del	FAM174B_uc002bsl.3_Intron	NM_207446	NP_997329	Q3ZCQ3	F174B_HUMAN	hypothetical protein LOC400451	69_70	Extracellular (Potential).					integral to membrane					0						CCACTGCTGTTGGAGCTGGAGCTGCC	0.578													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98661645	98661645	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98661645delT								ARRDC4 (144578 upstream) : FAM169B (318746 downstream)																							ctttgagcccttttttttttc	0.104													6	3	---	---	---	---	
CRAMP1L	57585	broad.mit.edu	37	16	1683105	1683105	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1683105delA	uc010uvh.1	+						CRAMP1L_uc002cmf.2_Intron	NM_020825	NP_065876	Q96RY5	CRML_HUMAN	Crm, cramped-like							nucleus	DNA binding				0						CAGATGTCTCACATTCTGACC	0.562													4	2	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15714051	15714051	+	Intron	DEL	A	-	-	rs8044762		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15714051delA	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						acaaacaaacaaaAAAAACAA	0.149													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15939589	15939590	+	Intron	DEL	GA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15939589_15939590delGA	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002deb.3_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						gaaaaagaaggagagagagaga	0.267			T	CBFB	AML								4	2	---	---	---	---	
IQCK	124152	broad.mit.edu	37	16	19757809	19757809	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19757809delA	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K											skin(1)	1						TCATGGTGATAAGgctgtggg	0.080													4	2	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27838226	27838226	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27838226delC	uc002doz.2	-						GSG1L_uc010bya.1_Intron|GSG1L_uc010bxz.1_Intron|GSG1L_uc002doy.2_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						TGCATGGGCTCAAGCAGCTGC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33537914	33537914	+	IGR	DEL	A	-	-	rs111565786		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537914delA								SLC6A10P (641451 upstream) : MIR1826 (427594 downstream)																							AGCTGAGTGTAAAAAAAGTCA	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33537920	33537921	+	IGR	DEL	AG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537920_33537921delAG								SLC6A10P (641457 upstream) : MIR1826 (427587 downstream)																							GTGTAAAAAAAGTCAAAGTACA	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33984595	33984595	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33984595delA								MIR1826 (19003 upstream) : UBE2MP1 (419207 downstream)																							tgcacacaccacaaagaagtt	0.000													4	2	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47545360	47545361	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47545360_47545361insT	uc002eev.3	+						PHKB_uc010vgi.1_Intron|PHKB_uc002eeu.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				AGTTGCTGTGCATGTGAAATAT	0.317													4	2	---	---	---	---	
CCDC113	29070	broad.mit.edu	37	16	58314754	58314754	+	3'UTR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58314754delT	uc002ene.2	+	9					PRSS54_uc002enf.2_Intron|PRSS54_uc002eng.2_Intron|PRSS54_uc010vie.1_Intron|CCDC113_uc010vid.1_3'UTR	NM_014157	NP_054876	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113 isoform 1							protein complex					0						TCTAGAAATGTTTTACGCTGG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	62577974	62577974	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62577974delT								CDH8 (507938 upstream) : None (None downstream)																							TGTGGAGAGCTTTTTAGCCAA	0.284													3	3	---	---	---	---	
CALB2	794	broad.mit.edu	37	16	71403681	71403682	+	Intron	INS	-	GAG	GAG	rs143039963	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71403681_71403682insGAG	uc002faa.3	+						CALB2_uc010vme.1_Intron|CALB2_uc002fac.3_Intron	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1								calcium ion binding				0		Ovarian(137;0.125)				ACAAAGCCTCCGAGAAGAATGT	0.535													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86230483	86230484	+	IGR	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86230483_86230484delCA								IRF8 (274274 upstream) : LOC732275 (134972 downstream)																							TTTGAGTGTTCAACACTCTTCA	0.441													4	2	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89441204	89441205	+	Intron	INS	-	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89441204_89441205insC	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CACAGagctgaccccgaacacc	0.218													4	2	---	---	---	---	
RABEP1	9135	broad.mit.edu	37	17	5282787	5282788	+	Intron	DEL	CT	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5282787_5282788delCT	uc002gbm.3	+						RABEP1_uc010vsw.1_Intron|RABEP1_uc002gbl.3_Intron|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						ttcttcctcccTCTGTTGCCAC	0.267													5	3	---	---	---	---	
STX8	9482	broad.mit.edu	37	17	9351632	9351632	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9351632delA	uc002glx.2	-							NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						acagagaggcaaaaagtctga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21338266	21338266	+	IGR	DEL	C	-	-	rs148232145		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21338266delC								KCNJ12 (15087 upstream) : C17orf51 (93306 downstream)																							GAGACCAGAACCTTTACATAT	0.488													2	7	---	---	---	---	
GFAP	2670	broad.mit.edu	37	17	42991734	42991735	+	Intron	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42991734_42991735delCA	uc002ihq.2	-						GFAP_uc002ihr.2_Intron|GFAP_uc010wjg.1_Intron	NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1							cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				CTCACTGTTGcacacacacaca	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47668599	47668600	+	IGR	DEL	CT	-	-	rs35329706		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47668599_47668600delCT								NXPH3 (7430 upstream) : SPOP (7648 downstream)																							agccactgaccttatttccact	0.149													4	5	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49133432	49133432	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49133432delA	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CCAAACTCATAAAAAAACAAA	0.343													4	2	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56649643	56649643	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56649643delA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					acaaacaaacaaaACATCCAA	0.199													4	2	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56649649	56649651	+	Intron	DEL	TCC	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56649649_56649651delTCC	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					aaacaaaACATCCAAACCCACAA	0.187													4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59480290	59480291	+	Intron	DEL	AT	-	-	rs61046721		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480290_59480291delAT	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						ggaagaaCCGATagagagagag	0.139													4	3	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59480314	59480332	+	Intron	DEL	AGAGAGAGAGAGAGAGAGA	-	-	rs112242392	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480314_59480332delAGAGAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						agagagagagagagagagagagagagagaaagtggagag	0.256													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68857798	68857798	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68857798delC								KCNJ2 (681617 upstream) : None (None downstream)																							gccatgggagcccaccctttg	0.000													4	2	---	---	---	---	
MRPS7	51081	broad.mit.edu	37	17	73262098	73262098	+	3'UTR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73262098delT	uc002jnm.3	+	5					MRPS7_uc002jnn.3_3'UTR	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7 precursor						translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome			central_nervous_system(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			ATGTAGTTCCTTTGTAAGGGT	0.512													4	2	---	---	---	---	
PYCR1	5831	broad.mit.edu	37	17	79894283	79894284	+	Intron	DEL	AG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79894283_79894284delAG	uc002kcr.1	-						PYCR1_uc002kcq.1_Intron|PYCR1_uc002kcp.2_Intron|PYCR1_uc002kcs.1_Intron|PYCR1_uc010wvd.1_Intron|PYCR1_uc002kct.1_Intron|PYCR1_uc002kcu.1_Intron|PYCR1_uc010wve.1_5'Flank	NM_006907	NP_008838	P32322	P5CR1_HUMAN	pyrroline-5-carboxylate reductase 1 isoform 1						cellular response to oxidative stress|proline biosynthetic process	mitochondrial matrix	binding|pyrroline-5-carboxylate reductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		L-Proline(DB00172)|NADH(DB00157)	tggtatttttagtagagacggg	0.000													3	3	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11879163	11879163	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11879163delT	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_Intron	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						TGTCCATAAGTTTTTTTTTTA	0.234													5	3	---	---	---	---	
TTC39C	125488	broad.mit.edu	37	18	21645119	21645119	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21645119delG	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1						GAGGAGGGTTGGGAAGAAAAG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29339505	29339505	+	IGR	DEL	G	-	-	rs113697942		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29339505delG								B4GALT6 (74819 upstream) : MCART2 (154 downstream)																							aaaaaaaaaagaaagaaagaa	0.308													4	2	---	---	---	---	
POLI	11201	broad.mit.edu	37	18	51808178	51808178	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51808178delT	uc002lfj.3	+						POLI_uc010xds.1_Intron|POLI_uc002lfk.3_Intron|POLI_uc002lfl.1_Intron|POLI_uc010dpg.2_5'Flank	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota						DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		gccaaccttcttttttttctg	0.000								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
NFATC1	4772	broad.mit.edu	37	18	77197271	77197271	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77197271delA	uc010xfg.1	+						NFATC1_uc002lnc.1_Intron|NFATC1_uc010xff.1_Intron|NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfi.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		TGCTCCTGGGAAACCAAAGAT	0.622													4	2	---	---	---	---	
CCDC151	115948	broad.mit.edu	37	19	11532993	11532994	+	Intron	DEL	TG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11532993_11532994delTG	uc002mrs.2	-						CCDC151_uc002mrr.2_Intron|CCDC151_uc010dxz.2_Intron|RGL3_uc002mrn.2_5'Flank|RGL3_uc002mrm.2_5'Flank|RGL3_uc002mro.2_5'Flank|RGL3_uc002mrp.2_5'Flank|RGL3_uc002mrq.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151											ovary(1)	1						GGGCTTCCCCTGTGGGCGGGGC	0.678													4	2	---	---	---	---	
FCHO1	23149	broad.mit.edu	37	19	17899288	17899289	+	3'UTR	INS	-	CAGC	CAGC			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17899288_17899289insCAGC	uc010ebb.2	+	28					FCHO1_uc002nhg.3_3'UTR|FCHO1_uc002nhh.2_3'UTR|FCHO1_uc010xpw.1_3'UTR|FCHO1_uc002nhi.2_3'UTR|FCHO1_uc002nhj.2_3'UTR	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						CCTCCCCCTCATGCCAACCCCA	0.535													3	3	---	---	---	---	
FCHO1	23149	broad.mit.edu	37	19	17899292	17899293	+	3'UTR	DEL	CA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17899292_17899293delCA	uc010ebb.2	+	28					FCHO1_uc002nhg.3_3'UTR|FCHO1_uc002nhh.2_3'UTR|FCHO1_uc010xpw.1_3'UTR|FCHO1_uc002nhi.2_3'UTR|FCHO1_uc002nhj.2_3'UTR	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						CCCCTCATGCCAACCCCACACA	0.530													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	19944580	19944580	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19944580delT								ZNF506 (12020 upstream) : ZNF253 (32134 downstream)																							ATGTTTAATCttttttttttt	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23446084	23446085	+	Intron	INS	-	GA	GA	rs139493226	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23446084_23446085insGA	uc002nrc.1	-											Homo sapiens cDNA FLJ12978 fis, clone NT2RP2006321.																		atacaatatatgagagtggtga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28529804	28529805	+	IGR	DEL	TG	-	-	rs140543160		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28529804_28529805delTG								LOC148189 (244956 upstream) : LOC148145 (926235 downstream)																							TCACTTATTCtgtgtgtgtgtg	0.297													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28927578	28927579	+	RNA	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28927578_28927579insA	uc002nsa.1	-	10		c.1829_1830insT								Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		CACTGCCTGGTGAAAATATACT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29982897	29982897	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29982897delA	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																		GAACAACAACAAAAAAAAAAC	0.468													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35270676	35270676	+	IGR	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35270676delC								ZNF599 (6542 upstream) : ZNF30 (147131 downstream)																							CTAAAGAATTCCCCATATTCT	0.428													4	2	---	---	---	---	
HPN	3249	broad.mit.edu	37	19	35556034	35556034	+	Intron	DEL	T	-	-	rs113406953		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35556034delT	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	ccTATTGTGGTTTTTTTTTTA	0.299													5	3	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49964655	49964655	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964655delA	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		gaggggctggagtctggactc	0.000													4	2	---	---	---	---	
PTPRH	5794	broad.mit.edu	37	19	55717070	55717071	+	Intron	INS	-	C	C			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55717070_55717071insC	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Intron	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GCCCAGCTctgcactgtccagt	0.262													7	4	---	---	---	---	
ZIM2	23619	broad.mit.edu	37	19	57287026	57287026	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57287026delA	uc002qnr.2	-						uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TCCTAATCTGAAAAAAAAAAA	0.368													3	3	---	---	---	---	
C20orf103	24141	broad.mit.edu	37	20	9492321	9492321	+	5'Flank	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9492321delT	uc002wni.1	+						C20orf103_uc010zrc.1_5'Flank	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor							integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			CCTGTCTTACTTTTTTTTCCC	0.408													4	3	---	---	---	---	
C20orf12	55184	broad.mit.edu	37	20	18373881	18373881	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18373881delT	uc010zsa.1	-						C20orf12_uc010zrz.1_Intron|C20orf12_uc002wqp.3_Intron|C20orf12_uc002wqr.3_Intron|C20orf12_uc002wqs.3_Intron|C20orf12_uc002wqq.3_Intron	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				GAGGAAGACCTTTTCCACCAG	0.567													4	2	---	---	---	---	
DTD1	92675	broad.mit.edu	37	20	18720586	18720587	+	Intron	INS	-	T	T	rs141910290	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18720586_18720587insT	uc002wrf.3	+							NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						GAGAGTCAGCATTACATCACTG	0.436													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23623027	23623028	+	IGR	DEL	GA	-	-	rs148665356	by1000genomes	TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23623027_23623028delGA								CST3 (4453 upstream) : CST4 (43249 downstream)																							GAGTGGAAGGGAGAGAGAGAGA	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25582262	25582263	+	IGR	INS	-	TG	TG			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25582262_25582263insTG								NINL (16109 upstream) : NANP (11312 downstream)																							Ccacacacatacacaaccatct	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25582266	25582267	+	IGR	INS	-	CG	CG			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25582266_25582267insCG								NINL (16113 upstream) : NANP (11308 downstream)																							acacatacacaaccatctcaca	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25582267	25582268	+	IGR	INS	-	TCTCT	TCTCT			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25582267_25582268insTCTCT								NINL (16114 upstream) : NANP (11307 downstream)																							cacatacacaaccatctcacac	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29590215	29590216	+	IGR	INS	-	T	T	rs142088020		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29590215_29590216insT								None (None upstream) : FRG1B (21663 downstream)																							tgtcttcttagtttggttattt	0.015													4	2	---	---	---	---	
PLUNC	51297	broad.mit.edu	37	20	31828337	31828340	+	Intron	DEL	GATG	-	-	rs10677320		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31828337_31828340delGATG	uc002wyv.2	+						PLUNC_uc002wyt.3_Intron|PLUNC_uc002wyu.3_Intron	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated						innate immune response	extracellular region	lipid binding				0						AGCGTGGAAAgatggatggatgga	0.240													11	5	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33210336	33210336	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33210336delA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						aaacaaaaacaaaaaaaaaGT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39071511	39071512	+	IGR	DEL	TG	-	-	rs9798531		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39071511_39071512delTG								None (None upstream) : MAFB (243007 downstream)																							CACATTTCTCtgtgtgtgtgtg	0.421													4	2	---	---	---	---	
PLCG1	5335	broad.mit.edu	37	20	39770518	39770519	+	Intron	INS	-	TG	TG			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39770518_39770519insTG	uc002xjp.1	+						PLCG1_uc002xjo.1_Intron	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CTCCAGACTCTTGTGTGTGTGT	0.500													4	2	---	---	---	---	
PLCG1	5335	broad.mit.edu	37	20	39794631	39794631	+	Intron	DEL	C	-	-	rs74464491		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39794631delC	uc002xjp.1	+						PLCG1_uc002xjo.1_Intron|PLCG1_uc010zwe.1_Intron|PLCG1_uc010ggf.2_5'Flank	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CTCTGTCTCACCCCCCCCCCA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49963887	49963888	+	IGR	INS	-	TGC	TGC			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49963887_49963888insTGC								KCNG1 (324212 upstream) : NFATC2 (43878 downstream)																							agtgatgctgatggtagtgatg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55668836	55668836	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55668836delG								TFAP2C (454500 upstream) : BMP7 (74973 downstream)																							CATTTCCCTTGCATCTCCAGT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57962313	57962313	+	IGR	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57962313delG								EDN3 (61267 upstream) : PHACTR3 (190251 downstream)																							GAGGAGGCTCGGGGGGGCTGG	0.577													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11086728	11086728	+	Intron	DEL	T	-	-	rs113801023		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11086728delT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		taactgtcaatttttttttga	0.080													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114563	11114564	+	IGR	INS	-	A	A			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114563_11114564insA								BAGE (15626 upstream) : None (None downstream)																							CTTAGGACAGGAAAAAAGCTCT	0.436													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11179612	11179613	+	IGR	INS	-	T	T	rs71639665		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11179612_11179613insT								BAGE (80675 upstream) : None (None downstream)																							GAATAGTTGGAttttttttttc	0.168													5	3	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19711317	19711317	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19711317delT	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TCTGCTCACATTTTTTTTTTC	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	27995296	27995296	+	IGR	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27995296delT								CYYR1 (49715 upstream) : ADAMTS1 (213312 downstream)																							tatgtgatactttttttttcc	0.000													4	2	---	---	---	---	
PIGP	51227	broad.mit.edu	37	21	38442125	38442125	+	Intron	DEL	T	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38442125delT	uc002yvw.1	-						PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				TGTATTAGTCTTTTTTTTTAA	0.294													4	2	---	---	---	---	
BACE2	25825	broad.mit.edu	37	21	42647760	42647760	+	3'UTR	DEL	A	-	-	rs35121758		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42647760delA	uc002yyw.2	+	9					BACE2_uc002yyx.2_3'UTR|BACE2_uc002yyy.2_3'UTR|BACE2_uc010goo.2_RNA	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A						membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				AAAAATAATTAAAAAAAAAAC	0.383													4	2	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28541485	28541485	+	Intron	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28541485delG	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						GTTAGAATCTGGGGCGGGTTT	0.413													4	2	---	---	---	---	
CCDC117	150275	broad.mit.edu	37	22	29170059	29170059	+	Intron	DEL	T	-	-	rs67314143		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29170059delT	uc003aeb.2	+						CCDC117_uc011aki.1_Intron|CCDC117_uc011akj.1_Intron|CCDC117_uc011akk.1_Intron	NM_173510	NP_775781	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117											breast(1)	1						tttgtttttgttttttttttt	0.109													5	3	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29763450	29763450	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29763450delC	uc003afj.2	-						AP1B1_uc003afi.2_5'Flank|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						AATCTATCAACCTTTTttttt	0.179													4	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1477915	1477917	+	Intron	DEL	TTA	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1477915_1477917delTTA	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ataataaATGTTATTATTCAATG	0.128													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	9374005	9374005	+	5'Flank	DEL	G	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9374005delG	uc004csk.2	-											DQ576926																		AGGTAGAAGAGGGTATTGGAT	0.448													4	2	---	---	---	---	
PHEX	5251	broad.mit.edu	37	X	22201565	22201567	+	Intron	DEL	ATG	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22201565_22201567delATG	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						GCTTTGAAAAATGATAGATAATG	0.409													4	2	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31462469	31462469	+	Intron	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31462469delA	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAACTAATATAAAATATCCTA	0.189													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	43267855	43267855	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43267855delA								PPP1R2P9 (630369 upstream) : MAOA (247554 downstream)																							GCTGGACTGTAAAAAAAAAAG	0.383													4	2	---	---	---	---	
WDR13	64743	broad.mit.edu	37	X	48457474	48457474	+	Intron	DEL	C	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48457474delC	uc004dkh.1	+						WDR13_uc010nif.1_Intron|WDR13_uc004dki.1_Intron|WDR13_uc004dkj.1_Intron|WDR13_uc004dkk.1_Intron|WDR13_uc004dkl.3_Intron|WDR13_uc011mme.1_5'Flank	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein							cytoplasm|nucleus				ovary(2)	2						agataaTATGCCAAGTAAACC	0.169													4	2	---	---	---	---	
HAUS7	55559	broad.mit.edu	37	X	152734390	152734391	+	Intron	INS	-	T	T			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152734390_152734391insT	uc004fho.1	-						HAUS7_uc004fhl.2_Intron|HAUS7_uc004fhm.2_Intron|HAUS7_uc004fhn.1_Intron|HAUS7_uc004fhp.1_Intron|HAUS7_uc011myq.1_Intron	NM_017518	NP_059988	Q99871	HAUS7_HUMAN	HAUS augmin-like complex subunit 7						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding				0						GGACTAGCCCAGCACCGCCAGG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9936396	9936396	+	IGR	DEL	A	-	-			TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9936396delA								TTTY22 (285542 upstream) : None (None downstream)																							TTTTCCTGACACTTCTCCTTG	0.478													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9936398	9936398	+	IGR	DEL	T	-	-	rs113260873		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9936398delT								TTTY22 (285544 upstream) : None (None downstream)																							TTCCTGACACTTCTCCTTGTC	0.473													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9945223	9945224	+	IGR	INS	-	T	T	rs147580695		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9945223_9945224insT								TTTY22 (294369 upstream) : None (None downstream)																							tatcagataaatttaacaatga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960883	9960883	+	IGR	DEL	A	-	-	rs146746526		TCGA-B0-4815-01A-01D-1501-10	TCGA-B0-4815-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960883delA								TTTY22 (310029 upstream) : None (None downstream)																							TTGGCTAAACAAGATGTTTGC	0.473													7	4	---	---	---	---	
