Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MACF1	23499	broad.mit.edu	37	1	39919424	39919424	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39919424G>A	uc010oiu.1	+	53	16248	c.16117G>A	c.(16117-16119)GCA>ACA	p.A5373T	MACF1_uc010ois.1_Missense_Mutation_p.A4871T	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6829	Spectrin 17.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CGTTAACTCAGCAGTAGCCAT	0.443													16	74	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39919425	39919425	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39919425C>T	uc010oiu.1	+	53	16249	c.16118C>T	c.(16117-16119)GCA>GTA	p.A5373V	MACF1_uc010ois.1_Missense_Mutation_p.A4871V	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6829	Spectrin 17.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTTAACTCAGCAGTAGCCATG	0.443													15	77	---	---	---	---	PASS
C1orf228	339541	broad.mit.edu	37	1	45191175	45191175	+	3'UTR	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45191175C>T	uc001cmf.2	+	12						NM_001145636	NP_001139108	Q6PIY5	CA228_HUMAN	hypothetical protein LOC339541								binding				0						CCACTTGGCTCCAGGGGGGAG	0.607													5	9	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62740313	62740313	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62740313C>T	uc001dah.3	-	3	840	c.463G>A	c.(463-465)GGA>AGA	p.G155R	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	155										ovary(3)|skin(2)|lung(1)	6						TGGGGCCGTCCACTCCCAAAA	0.642													3	10	---	---	---	---	PASS
WDR78	79819	broad.mit.edu	37	1	67340463	67340463	+	Splice_Site	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67340463C>T	uc001dcx.2	-	5	856	c.800_splice	c.e5+1	p.T267_splice	WDR78_uc001dcy.2_Splice_Site_p.T267_splice|WDR78_uc001dcz.2_Splice_Site_p.T267_splice|WDR78_uc009waw.2_Intron|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						ACCATACATACGTTACTTTCT	0.403													94	345	---	---	---	---	PASS
WLS	79971	broad.mit.edu	37	1	68620838	68620838	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68620838T>C	uc001def.1	-	4	881	c.610A>G	c.(610-612)AAT>GAT	p.N204D	uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Missense_Mutation_p.N202D|WLS_uc001deg.1_Missense_Mutation_p.N113D|WLS_uc009wbf.1_Missense_Mutation_p.N159D	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1	204	Lumenal (Potential).|Interacts with Wnt proteins (By similarity).				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						TTCTTCTCATTCACAGGCAGC	0.428													7	582	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	72163743	72163743	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72163743C>T	uc001dfw.2	-	4	715	c.615G>A	c.(613-615)GCG>GCA	p.A205A	NEGR1_uc001dfv.2_Silent_p.A77A|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	205	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CATCATTTTCCGCACTGCATT	0.348													6	505	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	76107489	76107489	+	Intron	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76107489T>C	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron|uc001dgv.2_RNA	NM_001130058	NP_001123530	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						AAAAAGACAATCACATAAAGG	0.368													83	366	---	---	---	---	PASS
FUBP1	8880	broad.mit.edu	37	1	78425928	78425928	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78425928G>C	uc001dii.2	-	16	1606	c.1517C>G	c.(1516-1518)GCT>GGT	p.A506G	FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_Missense_Mutation_p.A527G	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein	506	Pro-rich.				transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						TCCCTGGGGAGCATATGGGGC	0.433													29	82	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82372717	82372717	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82372717C>A	uc001dit.3	+	4	270	c.89C>A	c.(88-90)GCT>GAT	p.A30D	LPHN2_uc001dis.2_Missense_Mutation_p.A30D|LPHN2_uc001diu.2_Missense_Mutation_p.A30D|LPHN2_uc001div.2_Missense_Mutation_p.A30D|LPHN2_uc009wcd.2_Missense_Mutation_p.A30D	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	30					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		AGCAGAGCAGCTTTACCATTT	0.348													16	81	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92184975	92184975	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92184975C>A	uc001doh.2	-	10	1926	c.1460G>T	c.(1459-1461)TGC>TTC	p.C487F	TGFBR3_uc009wde.2_Missense_Mutation_p.C264F|TGFBR3_uc010osy.1_Missense_Mutation_p.C445F|TGFBR3_uc001doi.2_Missense_Mutation_p.C486F|TGFBR3_uc001doj.2_Missense_Mutation_p.C486F	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	487	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CTTGGCCTTGCAGGTAGGATC	0.542													9	48	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113633959	113633959	+	Silent	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113633959T>C	uc001edf.1	+	2	457	c.259T>C	c.(259-261)TTG>CTG	p.L87L	LRIG2_uc009wgn.1_5'UTR	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	87	LRR 1.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCATAATCGGTTGTCTAACTG	0.299													66	276	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145295505	145295505	+	Silent	SNP	G	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145295505G>C	uc001end.3	+	2	293	c.258G>C	c.(256-258)CTG>CTC	p.L86L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Silent_p.L86L|NOTCH2NL_uc010oyh.1_RNA|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	86											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGAGCAGCTGAAGCAAGCTG	0.512													4	75	---	---	---	---	PASS
S100A11	6282	broad.mit.edu	37	1	152005123	152005123	+	3'UTR	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152005123A>T	uc001ezn.2	-	3					uc001ezm.1_Intron	NM_005620	NP_005611	P31949	S10AB_HUMAN	S100 calcium binding protein A11						negative regulation of cell proliferation|negative regulation of DNA replication|signal transduction	cytoplasm|nucleus|ruffle	calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|S100 beta binding				0	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TTTGAAGGCCAGGGCCAAGGG	0.567													6	30	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152080550	152080550	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152080550G>T	uc001ezp.2	-	2	5143	c.5143C>A	c.(5143-5145)CAG>AAG	p.Q1715K	TCHH_uc009wne.1_Missense_Mutation_p.Q1715K	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1715	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGCGCAGCTGCTGTTCCTCC	0.577													8	48	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	157014204	157014204	+	5'UTR	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157014204A>T	uc001fqo.2	-	1					ARHGEF11_uc001fqn.2_5'UTR	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ATTTTTGAGCAAGGTGAGAGG	0.488													37	192	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171605058	171605058	+	3'UTR	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605058A>G	uc001ghu.2	-	3					MYOC_uc010pmk.1_3'UTR	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor						anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TACAGCTTGGAGGCTTTTCAC	0.552													5	153	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947442	237947442	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947442C>T	uc001hyl.1	+	90	12550	c.12430C>T	c.(12430-12432)CGC>TGC	p.R4144C	RYR2_uc010pya.1_Missense_Mutation_p.R559C	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4144					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGCGCCAAACGCATCGAGAG	0.498													9	42	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27591499	27591499	+	Intron	SNP	A	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27591499A>C	uc002rkb.2	-						EIF2B4_uc002rjz.2_Intron|EIF2B4_uc002rka.2_Intron|EIF2B4_uc002rkc.2_Intron|EIF2B4_uc002rkd.2_Intron|EIF2B4_uc002rke.2_Intron|EIF2B4_uc002rkf.1_Missense_Mutation_p.W143G|SNX17_uc010ylj.1_5'Flank|SNX17_uc002rkg.1_5'Flank|SNX17_uc010ylk.1_5'Flank|SNX17_uc010eza.1_5'Flank|SNX17_uc002rki.1_5'Flank|SNX17_uc002rkh.1_5'Flank|SNX17_uc010yll.1_5'Flank|SNX17_uc010ylm.1_5'Flank|SNX17_uc010yln.1_5'Flank|SNX17_uc010ylo.1_5'Flank|SNX17_uc010ylp.1_5'Flank|SNX17_uc010ylq.1_5'Flank	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,						myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTCTAGCCAGGCACCAAAC	0.502													56	243	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43805654	43805654	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43805654A>T	uc002rsw.3	-	9	1166	c.814T>A	c.(814-816)TTG>ATG	p.L272M	THADA_uc002rsx.3_Missense_Mutation_p.L272M|THADA_uc002rsy.3_RNA|THADA_uc002rsz.2_Translation_Start_Site|THADA_uc002rta.2_Translation_Start_Site|THADA_uc002rtb.1_Missense_Mutation_p.L272M|THADA_uc002rtc.3_Missense_Mutation_p.L272M|THADA_uc002rtd.2_Missense_Mutation_p.L272M	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	272							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GCACTTACCAAATGAGGAATC	0.264													32	109	---	---	---	---	PASS
PPP3R1	5534	broad.mit.edu	37	2	68413748	68413748	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68413748T>C	uc002sei.1	-	5	709	c.317A>G	c.(316-318)TAT>TGT	p.Y106C		NM_000945	NP_000936	P63098	CANB1_HUMAN	protein phosphatase 3, regulatory subunit B,	106	EF-hand 3.|3.				activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)	ATTGGAAATATAGCCATCTTT	0.338													6	464	---	---	---	---	PASS
AAK1	22848	broad.mit.edu	37	2	69702945	69702945	+	3'UTR	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69702945G>A	uc002sfp.2	-	22						NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1							coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0						ACTCCGTAATGAAAATGTATT	0.423													5	25	---	---	---	---	PASS
DQX1	165545	broad.mit.edu	37	2	74746760	74746760	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74746760A>C	uc010yrw.1	-	10	1894	c.1729T>G	c.(1729-1731)TTG>GTG	p.L577V	DQX1_uc002smc.2_Missense_Mutation_p.L138V	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	577						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						GGTAGGGACAAGGGAAGTTCA	0.522													42	204	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90139123	90139123	+	RNA	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90139123G>A	uc010fhm.2	+	17		c.2035G>A								Parts of antibodies, mostly variable regions.																		GAGGGTCCTCGCTCAGCTCCT	0.532													18	100	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182780265	182780265	+	Missense_Mutation	SNP	C	T	T	rs150320682		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182780265C>T	uc002uoi.2	+	11	2220	c.1898C>T	c.(1897-1899)ACA>ATA	p.T633I	SSFA2_uc002uoh.2_Missense_Mutation_p.T633I|SSFA2_uc002uoj.2_Missense_Mutation_p.T633I|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.T480I|SSFA2_uc002uol.2_Missense_Mutation_p.T480I|SSFA2_uc002uom.2_Missense_Mutation_p.T101I	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	633						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			CCAGCAGAGACAGTAGAGCTA	0.408													4	162	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198260796	198260796	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198260796C>A	uc002uue.2	-	23	3571	c.3523G>T	c.(3523-3525)GAT>TAT	p.D1175Y		NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	1175	HEAT 11.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATTAAAGCATCTTCAAGTAAC	0.308													49	143	---	---	---	---	PASS
C2orf52	151477	broad.mit.edu	37	2	232378289	232378289	+	5'UTR	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232378289T>C	uc002vrx.1	-	2						NR_024079				RecName: Full=Uncharacterized protein C2orf52;												0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;5.72e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		CTTCCCCATCTTCTACCTCCT	0.378													8	569	---	---	---	---	PASS
ALPI	248	broad.mit.edu	37	2	233322764	233322764	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233322764C>A	uc002vst.3	+	8	990	c.913C>A	c.(913-915)CCC>ACC	p.P305T	ALPI_uc002vsu.3_Missense_Mutation_p.P216T	NM_001631	NP_001622	P09923	PPBI_HUMAN	intestinal alkaline phosphatase precursor	305					phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding			central_nervous_system(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CACACTGGACCCCTCCCTGAT	0.632													11	47	---	---	---	---	PASS
ITPR1	3708	broad.mit.edu	37	3	4825557	4825557	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4825557G>A	uc003bqa.2	+	48	6772	c.6424G>A	c.(6424-6426)GGA>AGA	p.G2142R	ITPR1_uc010hca.1_Missense_Mutation_p.G2127R|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Missense_Mutation_p.G1112R	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	2190	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		CCAAGTGGACGGAGATGAAGC	0.502													4	218	---	---	---	---	PASS
TRIM71	131405	broad.mit.edu	37	3	32859529	32859529	+	5'UTR	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32859529C>T	uc003cff.2	+	1						NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						tcctcctcctcctcttcctcT	0.522													3	8	---	---	---	---	PASS
CCR4	1233	broad.mit.edu	37	3	32994984	32994984	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32994984A>G	uc003cfg.1	+	2	238	c.70A>G	c.(70-72)AGT>GGT	p.S24G		NM_005508	NP_005499	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	24	Extracellular (Potential).				chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response	integral to plasma membrane				lung(1)	1						TCTGTATGAAAGTATCCCCAA	0.458													6	233	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52637689	52637689	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52637689C>A	uc003des.2	-	17	2639	c.2627G>T	c.(2626-2628)CGT>CTT	p.R876L	PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Missense_Mutation_p.R876L|PBRM1_uc003der.2_Missense_Mutation_p.R844L|PBRM1_uc003det.2_Missense_Mutation_p.R891L|PBRM1_uc003deu.2_Missense_Mutation_p.R891L|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.R876L|PBRM1_uc010hmk.1_Missense_Mutation_p.R876L|PBRM1_uc003dey.2_Missense_Mutation_p.R876L|PBRM1_uc003dez.1_Missense_Mutation_p.R876L|PBRM1_uc003dfb.1_Missense_Mutation_p.R789L|PBRM1_uc003dfa.1_Missense_Mutation_p.R222L	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	876					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.R876fs*39(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAGTTCATCACGAATTTTAAT	0.353			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								75	218	---	---	---	---	PASS
AP2M1	1173	broad.mit.edu	37	3	183898259	183898259	+	Intron	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183898259A>T	uc011bqx.1	+						AP2M1_uc003fmw.2_Intron|AP2M1_uc003fmx.2_Intron|AP2M1_uc003fmy.2_Intron|AP2M1_uc011bqy.1_5'UTR|AP2M1_uc011bqz.1_5'Flank	NM_004068	NP_004059	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit						axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity				0	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGCTCAAGCAGTTTCCTTTT	0.567													3	15	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13610222	13610222	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13610222T>A	uc003gmz.1	-	8	1791	c.1674A>T	c.(1672-1674)GAA>GAT	p.E558D	BOD1L_uc010idr.1_Translation_Start_Site	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	558	Lys-rich.						DNA binding			ovary(5)|breast(1)	6						CTTTAAGGACTTCTTTAATTC	0.333													82	335	---	---	---	---	PASS
SEL1L3	23231	broad.mit.edu	37	4	25819801	25819801	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25819801G>T	uc003gru.3	-	9	1675	c.1523C>A	c.(1522-1524)CCC>CAC	p.P508H		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	508						integral to membrane	binding				0						GAACAAGCTGGGGTGTTTGTC	0.552													38	138	---	---	---	---	PASS
RBPJ	3516	broad.mit.edu	37	4	26432360	26432360	+	Missense_Mutation	SNP	C	G	G	rs1064382		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26432360C>G	uc003grx.1	+	12	1470	c.1234C>G	c.(1234-1236)CGA>GGA	p.R412G	RBPJ_uc003gry.1_Missense_Mutation_p.R397G|RBPJ_uc003grz.1_Missense_Mutation_p.R412G|RBPJ_uc003gsa.1_Missense_Mutation_p.R398G|RBPJ_uc003gsb.1_Missense_Mutation_p.R399G|RBPJ_uc003gsc.1_Missense_Mutation_p.P363R|uc003gsd.2_5'Flank	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of	412	IPT/TIG.				DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				TTCTGCATTCCGAGAAGGTTG	0.438													36	109	---	---	---	---	PASS
KLB	152831	broad.mit.edu	37	4	39436298	39436298	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39436298G>T	uc003gua.2	+	2	1391	c.1294G>T	c.(1294-1296)GCC>TCC	p.A432S	KLB_uc011byj.1_Missense_Mutation_p.A432S	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	432	Extracellular (Potential).|Glycosyl hydrolase-1 1.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						AGACACCACGGCCATCTACAT	0.393													17	52	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87643378	87643378	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87643378A>C	uc003hpz.2	+	10	1879	c.1399A>C	c.(1399-1401)ACA>CCA	p.T467P	PTPN13_uc003hpy.2_Missense_Mutation_p.T467P|PTPN13_uc003hqa.2_Missense_Mutation_p.T467P|PTPN13_uc003hqb.2_Missense_Mutation_p.T467P	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	467						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ACAATATGAAACACCCTTTGA	0.383													58	165	---	---	---	---	PASS
ABCE1	6059	broad.mit.edu	37	4	146044650	146044650	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146044650A>G	uc003ijx.2	+	16	1978	c.1538A>G	c.(1537-1539)AAG>AGG	p.K513R	ABCE1_uc003ijy.2_Missense_Mutation_p.K513R|ABCE1_uc010iot.2_RNA	NM_001040876	NP_001035809	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E, member 1	513	ABC transporter 2.				interspecies interaction between organisms|response to virus|RNA catabolic process	mitochondrion	ATP binding|ATPase activity|electron carrier activity|iron-sulfur cluster binding|ribonuclease inhibitor activity			skin(1)	1	all_hematologic(180;0.151)					CATGCAAAAAAGACAGCCTTT	0.373													5	245	---	---	---	---	PASS
KIAA1430	57587	broad.mit.edu	37	4	186111741	186111741	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186111741A>G	uc003ixf.3	-	2	757	c.610T>C	c.(610-612)TCT>CCT	p.S204P	KIAA1430_uc003ixg.2_Missense_Mutation_p.S204P	NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587	204	Ser-rich.										0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		GATGACTTAGATGACGGAGAC	0.328													8	393	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35759818	35759818	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35759818T>C	uc003jjo.2	+	25	3728	c.3617T>C	c.(3616-3618)CTT>CCT	p.L1206P	SPEF2_uc003jjp.1_Missense_Mutation_p.L692P	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1206					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAAAGCCAGCTTAGGTAAGGC	0.318													19	115	---	---	---	---	PASS
ZNF131	7690	broad.mit.edu	37	5	43123452	43123452	+	Intron	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43123452G>A	uc011cpw.1	+						ZNF131_uc010ivl.1_Intron|ZNF131_uc003jnj.3_Intron|ZNF131_uc003jnk.2_Intron|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron|ZNF131_uc003jnm.2_3'UTR	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATAAATCAAAGAAGCCATTTT	0.299													10	192	---	---	---	---	PASS
RAB3C	115827	broad.mit.edu	37	5	57913493	57913493	+	Silent	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57913493G>A	uc003jrp.2	+	2	145	c.48G>A	c.(46-48)AGG>AGA	p.R16R		NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	16					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		AAGATGCCAGGTACGGCCAGA	0.398													12	61	---	---	---	---	PASS
NSA2	10412	broad.mit.edu	37	5	74069762	74069762	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74069762G>A	uc003kdk.1	+	5	675	c.592G>A	c.(592-594)GGT>AGT	p.G198S		NM_014886	NP_055701	O95478	NSA2_HUMAN	NSA2 ribosome biogenesis homolog	198					rRNA processing	nucleolus|ribonucleoprotein complex				ovary(1)	1						ACCAATACTTGGTGTAAAGAA	0.413													32	112	---	---	---	---	PASS
PAPD4	167153	broad.mit.edu	37	5	78964732	78964732	+	Silent	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78964732T>C	uc010jae.1	+	13	1507	c.1089T>C	c.(1087-1089)GCT>GCC	p.A363A	PAPD4_uc003kgb.2_Silent_p.A363A|PAPD4_uc010jaf.1_Silent_p.A363A|PAPD4_uc003kga.2_Silent_p.A359A|PAPD4_uc003kfz.2_Silent_p.A320A	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	363					histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TTAGTCCTGCTATACAGCTGC	0.388													5	516	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89949582	89949582	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89949582C>T	uc003kju.2	+	20	4287	c.4191C>T	c.(4189-4191)TCC>TCT	p.S1397S	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1397	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGACACTTTCCCTTCATTATA	0.373													7	347	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127700355	127700355	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127700355C>A	uc003kuu.2	-	18	2805	c.2366G>T	c.(2365-2367)GGT>GTT	p.G789V	FBN2_uc003kuv.2_Missense_Mutation_p.G756V	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	789	EGF-like 11; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACGGTAACTACCACGTAAGTT	0.338													53	183	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131894990	131894990	+	Silent	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131894990T>C	uc003kxi.2	+	2	531	c.144T>C	c.(142-144)TGT>TGC	p.C48C	RAD50_uc003kxg.1_5'UTR|RAD50_uc003kxh.2_5'UTR	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	48					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCATTGAATGTCTAAAATATA	0.284								Homologous_recombination					31	98	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150948482	150948482	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150948482G>A	uc003lue.3	-	1	24	c.11C>T	c.(10-12)GCC>GTC	p.A4V	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.A4V	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	4					epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCCAGCAGGGCAATAGTCAT	0.458													10	74	---	---	---	---	PASS
FKBPL	63943	broad.mit.edu	37	6	32097100	32097100	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32097100T>C	uc003nzr.2	-	2	728	c.458A>G	c.(457-459)GAG>GGG	p.E153G	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	153					response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						CCAAGTTTCCTCCCTCCATGG	0.592													8	44	---	---	---	---	PASS
MTO1	25821	broad.mit.edu	37	6	74192199	74192199	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74192199A>T	uc003pgy.3	+	10	1692	c.1568A>T	c.(1567-1569)CAA>CTA	p.Q523L	MTO1_uc010kav.2_Missense_Mutation_p.Q538L|MTO1_uc003pgz.3_Missense_Mutation_p.Q498L|MTO1_uc003pha.3_Missense_Mutation_p.Q160L|MTO1_uc003phb.3_Missense_Mutation_p.Q449L	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog	523					tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						TGTGTGTCCCAACAACGATAT	0.323													84	343	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108204350	108204350	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108204350C>T	uc003psc.3	-	17	1944	c.1675G>A	c.(1675-1677)GAA>AAA	p.E559K	SEC63_uc003psb.3_Missense_Mutation_p.E419K	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	559	Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		ACTGCAGCTTCCTAAAAGGGA	0.363													101	378	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111697218	111697218	+	Silent	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111697218T>C	uc003puy.3	-	13	2663	c.2340A>G	c.(2338-2340)CAA>CAG	p.Q780Q	REV3L_uc003pux.3_Silent_p.Q702Q|REV3L_uc003puz.3_Silent_p.Q702Q	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	780					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTTATGTTCTTGAAATTCTT	0.378								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	457	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168352940	168352940	+	Intron	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168352940T>C	uc003qwd.2	+						MLLT4_uc003qwb.1_Nonstop_Mutation_p.*1613Q|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CCCATGGGGATAGCTAGGCCC	0.502			T	MLL	AL								28	84	---	---	---	---	PASS
HOXA2	3199	broad.mit.edu	37	7	27140542	27140542	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27140542C>T	uc003syh.2	-	2	1209	c.934G>A	c.(934-936)GAC>AAC	p.D312N		NM_006735	NP_006726	O43364	HXA2_HUMAN	homeobox A2	312						nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						TCAGGACTGTCATTGTTTAGG	0.498													11	85	---	---	---	---	PASS
RBM28	55131	broad.mit.edu	37	7	127950874	127950874	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127950874C>G	uc003vmp.2	-	19	2371	c.2256G>C	c.(2254-2256)AAG>AAC	p.K752N	RBM28_uc003vmo.2_Missense_Mutation_p.K294N|RBM28_uc011koj.1_Missense_Mutation_p.K611N	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	752					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						ATTTGCTCCTCTTTGCAAGAG	0.483													92	277	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139190909	139190909	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139190909C>T	uc003yuy.2	-	10	1069	c.898G>A	c.(898-900)GCT>ACT	p.A300T	FAM135B_uc003yux.2_Missense_Mutation_p.A201T|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	300										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATCTGCTCAGCGATCTTCTCT	0.507										HNSCC(54;0.14)			5	161	---	---	---	---	PASS
NDUFB6	4712	broad.mit.edu	37	9	32571008	32571008	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32571008C>A	uc003zre.1	-	2	347	c.223G>T	c.(223-225)GTA>TTA	p.V75L	NDUFB6_uc003zrf.1_Missense_Mutation_p.V75L	NM_002493	NP_002484	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	75	Helical; (Potential).				mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)	NADH(DB00157)	GGTACAAGTACATGAGTGAAA	0.308													31	121	---	---	---	---	PASS
ZNF169	169841	broad.mit.edu	37	9	97062172	97062172	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97062172C>T	uc004aum.1	+	5	437	c.332C>T	c.(331-333)GCG>GTG	p.A111V		NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169	111						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				AGACAATATGCGCTAAGTGGC	0.498													30	67	---	---	---	---	PASS
FKTN	2218	broad.mit.edu	37	9	108363427	108363427	+	Missense_Mutation	SNP	G	A	A	rs146951171	byFrequency	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108363427G>A	uc004bcr.2	+	5	383	c.167G>A	c.(166-168)CGT>CAT	p.R56H	FKTN_uc011lvx.1_Missense_Mutation_p.R56H|FKTN_uc004bcs.2_Missense_Mutation_p.R56H|FKTN_uc011lvy.1_Missense_Mutation_p.R56H|FKTN_uc010mtm.2_Translation_Start_Site	NM_001079802	NP_001073270	O75072	FKTN_HUMAN	fukutin	56	Lumenal (Potential).				muscle organ development|negative regulation of cell proliferation|negative regulation of JNK cascade|nervous system development|regulation of protein glycosylation	cis-Golgi network|endoplasmic reticulum|extracellular space|Golgi membrane|integral to membrane|nucleus	transferase activity			breast(2)|ovary(1)	3						CTCAAACAGCGTGCAGTTAAA	0.289													39	139	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123900933	123900933	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123900933C>T	uc004bkx.1	+	14	2344	c.2313C>T	c.(2311-2313)CTC>CTT	p.L771L	CEP110_uc004bky.1_Silent_p.L375L|CEP110_uc004bkz.1_Silent_p.L219L|CEP110_uc004bla.1_Silent_p.L219L	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	771	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						ACAGTGAGCTCCATGCAAAAC	0.423													4	187	---	---	---	---	PASS
TTF1	7270	broad.mit.edu	37	9	135278153	135278153	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135278153T>C	uc004cbl.2	-	2	108	c.56A>G	c.(55-57)AAG>AGG	p.K19R	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	19	N-terminal region (NRD) (By similarity).|Poly-Lys.				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		ACACTTTTTCTTTTTCTTGTC	0.353													5	196	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7621991	7621991	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7621991C>G	uc001ijq.2	-	9	1224	c.1145G>C	c.(1144-1146)AGG>ACG	p.R382T	ITIH5_uc001ijp.2_Missense_Mutation_p.R168T|ITIH5_uc001ijr.1_Missense_Mutation_p.R382T	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	382	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GTTGAGGAGCCTGATGGCCCT	0.612													6	22	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27324608	27324608	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27324608A>C	uc001ith.2	-	24	2940	c.2768T>G	c.(2767-2769)CTA>CGA	p.L923R	ANKRD26_uc001itg.2_Missense_Mutation_p.L610R|ANKRD26_uc009xku.1_Missense_Mutation_p.L924R	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	923	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTCTAGTCTTAGCATAGCAAT	0.308													70	281	---	---	---	---	PASS
PANK1	53354	broad.mit.edu	37	10	91344174	91344174	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91344174C>A	uc001kgp.1	-	7	1942	c.1786G>T	c.(1786-1788)GAT>TAT	p.D596Y	PANK1_uc001kgn.1_Missense_Mutation_p.D371Y|PANK1_uc001kgo.1_Missense_Mutation_p.D312Y|PANK1_uc009xtu.1_Missense_Mutation_p.D398Y	NM_148977	NP_683878	Q8TE04	PANK1_HUMAN	pantothenate kinase 1 isoform alpha	596					coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity				0					Bezafibrate(DB01393)	TACTTGTCATCAGTCATTTTG	0.438													62	258	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93784687	93784687	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93784687A>G	uc001khr.2	+	35	5136	c.5038A>G	c.(5038-5040)AGC>GGC	p.S1680G		NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1680	Helicase C-terminal.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				ATTAGATGGCAGCATACCTCC	0.388													23	120	---	---	---	---	PASS
SEMA4G	57715	broad.mit.edu	37	10	102738875	102738875	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102738875A>T	uc010qpt.1	+	9	1273	c.830A>T	c.(829-831)AAG>ATG	p.K277M	SEMA4G_uc001krv.2_RNA|SEMA4G_uc001krw.1_Missense_Mutation_p.K277M|SEMA4G_uc001krx.2_Missense_Mutation_p.K277M|MRPL43_uc001kry.1_3'UTR|MRPL43_uc010qpu.1_3'UTR	NM_017893	NP_060363	Q9NTN9	SEM4G_HUMAN	semaphorin 4G	277	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CTGGGAGGGAAGAAGATCCTG	0.592													7	25	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104121544	104121544	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104121544A>G	uc001kux.1	+	14	1798	c.1558A>G	c.(1558-1560)ATG>GTG	p.M520V	GBF1_uc001kuy.1_Missense_Mutation_p.M520V|GBF1_uc001kuz.1_Missense_Mutation_p.M521V	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	520					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GATGAAGGAGATGGCACTGGA	0.463													5	153	---	---	---	---	PASS
DNHD1	144132	broad.mit.edu	37	11	6592961	6592961	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6592961C>T	uc001mdw.3	+	43	14571	c.14007C>T	c.(14005-14007)GCC>GCT	p.A4669A	DNHD1_uc001mea.3_Silent_p.A938A|DNHD1_uc001meb.2_3'UTR|DNHD1_uc001mec.2_Silent_p.A937A|DNHD1_uc010rao.1_Silent_p.A927A|DNHD1_uc009yfg.2_Silent_p.A294A	NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1	4669					microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TAGCTGGAGCCTTGCAGGACA	0.637													6	15	---	---	---	---	PASS
NXF1	10482	broad.mit.edu	37	11	62569079	62569079	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62569079C>G	uc001nvf.1	-	7	800	c.664G>C	c.(664-666)GGC>CGC	p.G222R	NXF1_uc001nvg.1_Missense_Mutation_p.G222R|NXF1_uc009yog.1_Missense_Mutation_p.G265R|NXF1_uc010rmh.1_Missense_Mutation_p.G85R	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	222	Interaction with THOC4.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						TGTTGGGAGCCATCGTATCGT	0.512													74	302	---	---	---	---	PASS
DDX6	1656	broad.mit.edu	37	11	118656817	118656817	+	Silent	SNP	G	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118656817G>T	uc001pub.2	-	2	505	c.144C>A	c.(142-144)ACC>ACA	p.T48T	DDX6_uc001puc.2_Silent_p.T48T	NM_004397	NP_004388	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6	48					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity			ovary(1)	1	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		TGATTGTGTTGGTGTTTTTCA	0.468			T	IGH@	B-NHL								6	335	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92285	92285	+	Intron	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92285C>T	uc010sdi.1	-						uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		TTGACCTCCACGAGGGCTCAG	0.577													3	10	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7527159	7527159	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7527159C>T	uc001qsy.2	-	13	3314	c.3288G>A	c.(3286-3288)GGG>GGA	p.G1096G	CD163L1_uc010sge.1_Silent_p.G1106G	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1096	SRCR 10.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						GCCAGATGGGCCCTGACCCCT	0.632											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	20	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13906548	13906548	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906548G>A	uc001rbt.2	-	3	892	c.713C>T	c.(712-714)ACC>ATC	p.T238I		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	238	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AAAGATGTAGGTGGCTTCTTC	0.512													6	260	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115117955	115117955	+	Intron	SNP	T	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115117955T>G	uc001tvt.1	-						TBX3_uc001tvu.1_Intron|TBX3_uc010syw.1_3'UTR	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2						anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTGAAGATATTTCCGCGCCAT	0.443													5	8	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130926698	130926698	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130926698G>A	uc001uil.2	-	8	1312	c.1148C>T	c.(1147-1149)ACG>ATG	p.T383M	RIMBP2_uc001uim.2_Missense_Mutation_p.T291M|RIMBP2_uc001uin.1_Missense_Mutation_p.T42M	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	383						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CACCAGCAGCGTGCACTGCAG	0.637													11	51	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35245160	35245160	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35245160A>G	uc001wsk.2	-	18	3366	c.2798T>C	c.(2797-2799)CTA>CCA	p.L933P	BAZ1A_uc001wsl.2_Missense_Mutation_p.L901P	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	933	Interaction with SMARCA5.				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AAAACGGGCTAGCTGTGCACA	0.353													4	133	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102551100	102551100	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102551100T>C	uc001yku.3	-	5	1089	c.899A>G	c.(898-900)AAT>AGT	p.N300S	HSP90AA1_uc001ykv.3_Missense_Mutation_p.N422S|HSP90AA1_uc001ykw.1_Missense_Mutation_p.N121S|HSP90AA1_uc001ykx.1_Missense_Mutation_p.N289S	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	300					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	ATCGTCGGGATTTCTGGTCCA	0.333													7	505	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102906859	102906859	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102906859G>A	uc001ylw.1	+	11	2813	c.2665G>A	c.(2665-2667)GAA>AAA	p.E889K	TECPR2_uc010awl.2_Missense_Mutation_p.E889K|TECPR2_uc010txx.1_Missense_Mutation_p.E52K	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	889							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						GCACTGGTACGAAGCCCTGCC	0.547													11	78	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63131146	63131146	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63131146T>C	uc002alb.3	+	55	7466	c.7466T>C	c.(7465-7467)GTA>GCA	p.V2489A	TLN2_uc002alc.3_Missense_Mutation_p.V882A|TLN2_uc010uic.1_Missense_Mutation_p.V105A	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2489	I/LWEQ.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GACGATGTTGTAGTGAAAACC	0.438													4	155	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63972910	63972910	+	Silent	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63972910T>C	uc002amp.2	-	35	6439	c.6291A>G	c.(6289-6291)GTA>GTG	p.V2097V		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	2097	B30.2/SPRY.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TAAAGTCATGTACTGGCCAGC	0.413													5	252	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64010772	64010772	+	Splice_Site	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64010772C>T	uc002amp.2	-	21	4126	c.3978_splice	c.e21+1	p.W1326_splice	HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TCAAACTTTACCCATCTGTCC	0.363													5	303	---	---	---	---	PASS
PPIB	5479	broad.mit.edu	37	15	64448267	64448267	+	Silent	SNP	G	A	A	rs143287832		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64448267G>A	uc002and.2	-	5	775	c.606C>T	c.(604-606)TGC>TGT	p.C202C	SNX22_uc002anc.1_3'UTR	NM_000942	NP_000933	P23284	PPIB_HUMAN	peptidylprolyl isomerase B precursor	202	PPIase cyclophilin-type.				protein folding	endoplasmic reticulum lumen|melanosome	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding				0					L-Proline(DB00172)	CGATCTTGCCGCAGTCTGCGA	0.567													18	97	---	---	---	---	PASS
PPIB	5479	broad.mit.edu	37	15	64448268	64448268	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64448268C>T	uc002and.2	-	5	774	c.605G>A	c.(604-606)TGC>TAC	p.C202Y	SNX22_uc002anc.1_3'UTR	NM_000942	NP_000933	P23284	PPIB_HUMAN	peptidylprolyl isomerase B precursor	202	PPIase cyclophilin-type.				protein folding	endoplasmic reticulum lumen|melanosome	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding				0					L-Proline(DB00172)	GATCTTGCCGCAGTCTGCGAT	0.572													18	94	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81166263	81166263	+	Silent	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81166263C>T	uc002bfw.1	+	2	303	c.43C>T	c.(43-45)CTG>TTG	p.L15L	KIAA1199_uc010unn.1_Silent_p.L15L	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	15										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						CAAGGCCATGCTGACCATCAG	0.577													3	42	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3945845	3945845	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3945845C>T	uc002fxe.2	-	39	6248	c.6184G>A	c.(6184-6186)GTG>ATG	p.V2062M	ZZEF1_uc002fxh.2_Missense_Mutation_p.V376M|ZZEF1_uc002fxi.2_Missense_Mutation_p.V297M|ZZEF1_uc002fxj.1_Missense_Mutation_p.V675M	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2062							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TGAGATGACACTTCTGAATCT	0.448													69	260	---	---	---	---	PASS
TMEM100	55273	broad.mit.edu	37	17	53798317	53798317	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53798317C>G	uc002iuj.3	-	2	426	c.115G>C	c.(115-117)GAG>CAG	p.E39Q	TMEM100_uc002iuk.3_Missense_Mutation_p.E39Q	NM_018286	NP_060756	Q9NV29	TM100_HUMAN	transmembrane protein 100	39						integral to membrane					0						AACTGAATCTCACTGACCAGA	0.567													16	55	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67993168	67993168	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67993168T>C	uc002lkr.1	+	2	1580	c.1264T>C	c.(1264-1266)TTT>CTT	p.F422L	SOCS6_uc010dqq.2_Missense_Mutation_p.F422L	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	422	SH2.				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				AAGCTTGAGCTTTCGCTCCCA	0.453													5	183	---	---	---	---	PASS
FBXO15	201456	broad.mit.edu	37	18	71749173	71749173	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71749173C>T	uc002lle.2	-	9	1360	c.1024G>A	c.(1024-1026)GGC>AGC	p.G342S	FBXO15_uc002lld.2_RNA|FBXO15_uc002llf.2_Missense_Mutation_p.G418S	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	342								p.G342G(1)		ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TTTATACAGCCATCAAAAATA	0.284													6	442	---	---	---	---	PASS
ZNF57	126295	broad.mit.edu	37	19	2917940	2917940	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2917940A>T	uc002lwr.2	+	4	1469	c.1321A>T	c.(1321-1323)ATT>TTT	p.I441F	ZNF57_uc010xha.1_Missense_Mutation_p.I409F	NM_173480	NP_775751	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	441	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		ACATGTGAGAATTCACACGCA	0.463													27	98	---	---	---	---	PASS
ZNF829	374899	broad.mit.edu	37	19	37382715	37382715	+	Silent	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37382715A>G	uc002ofa.1	-	6	1340	c.978T>C	c.(976-978)TGT>TGC	p.C326C	ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	326	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACACTGCTTACATTCATAAG	0.398													41	120	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41105107	41105107	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41105107G>A	uc002ooh.1	+	2	151	c.151G>A	c.(151-153)GCT>ACT	p.A51T	LTBP4_uc002oog.1_Silent_p.L7L|LTBP4_uc002ooi.1_5'Flank	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	51					growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTATAGCGTTGCTGTTTGTCG	0.572											OREG0025473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	50	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44739059	44739059	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44739059A>G	uc002oyu.2	+	6	681	c.476A>G	c.(475-477)GAT>GGT	p.D159G	ZNF227_uc010xwu.1_Missense_Mutation_p.D108G|ZNF227_uc002oyv.2_Missense_Mutation_p.D159G|ZNF227_uc010xwv.1_Missense_Mutation_p.D108G|ZNF227_uc010xww.1_Missense_Mutation_p.D80G|ZNF227_uc002oyw.2_Missense_Mutation_p.D131G|ZNF227_uc010ejh.2_Missense_Mutation_p.D152G|ZNF235_uc002oyx.1_Intron	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	159					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				CCTAAAGGAGATAGCTCTATT	0.383													5	163	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1585397	1585397	+	Intron	SNP	T	C	C	rs148754551	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1585397T>C	uc010gai.2	-						SIRPB1_uc002wfk.3_Intron|SIRPB1_uc002wfl.3_Missense_Mutation_p.T248A	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1						cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						CCTCGGATGGTCTCAGACAAG	0.627													6	44	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29696195	29696195	+	3'UTR	SNP	T	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29696195T>G	uc003aet.2	+	17					EWSR1_uc003aev.2_3'UTR|EWSR1_uc003aew.2_3'UTR|EWSR1_uc003aex.2_3'UTR|EWSR1_uc003aey.2_3'UTR|EWSR1_uc003aez.2_3'UTR	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						AGATTTATTTTTTAAACCAGA	0.393			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								10	25	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37931299	37931299	+	Splice_Site	SNP	G	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37931299G>C	uc004ddu.2	+	5	864	c.330_splice	c.e5-1	p.A110_splice	SYTL5_uc004ddv.2_Splice_Site_p.A110_splice|SYTL5_uc004ddx.2_Splice_Site_p.A110_splice	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1						intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						CCCTTGAGTAGGCAGCTAAGG	0.353													12	356	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50053964	50053964	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50053964C>T	uc004dox.3	+	6	3093	c.2795C>T	c.(2794-2796)GCT>GTT	p.A932V	CCNB3_uc004doy.2_Missense_Mutation_p.A932V|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	932					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					GATATGATAGCTCTGAATGAG	0.458													5	79	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53239736	53239736	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53239736C>A	uc004drz.2	-	12	2139	c.1606G>T	c.(1606-1608)GGG>TGG	p.G536W	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.G469W|KDM5C_uc004dsa.2_Missense_Mutation_p.G535W	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	536	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GAGGGCACCCCATACCAGGTC	0.517			N|F|S		clear cell renal carcinoma								85	104	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128364	83128364	+	Silent	SNP	A	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128364A>G	uc004eei.1	+	4	669	c.648A>G	c.(646-648)ACA>ACG	p.T216T	CYLC1_uc004eeh.1_Silent_p.T215T	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	216					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						TCCTACATACAAAGAACAATC	0.313													37	40	---	---	---	---	PASS
ZFY	7544	broad.mit.edu	37	Y	2847946	2847946	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2847946G>T	uc004fqj.2	+	8	2639	c.2318G>T	c.(2317-2319)CGG>CTG	p.R773L	ZFY_uc011nan.1_Missense_Mutation_p.R582L|ZFY_uc010nwe.2_Missense_Mutation_p.R696L	NM_003411	NP_003402	P08048	ZFY_HUMAN	zinc finger protein, Y-linked isoform 1	773	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TATCCTCATCGGTGTGAGTAC	0.428													3	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12630	12630	+	RNA	SNP	G	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12630G>C	uc004cox.3	+	1		c.294G>C			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TTCGTTACATGGTCCATCATA	0.368													20	212	---	---	---	---	PASS
PRKCZ	5590	broad.mit.edu	37	1	1988169	1988169	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1988169delT	uc001aiq.2	+							NM_002744	NP_002735	Q05513	KPCZ_HUMAN	protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)		tttctttgacttttttttttt	0.169													3	3	---	---	---	---	
LOC440563	440563	broad.mit.edu	37	1	13184079	13184080	+	5'Flank	INS	-	T	T	rs146762683	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13184079_13184080insT	uc010obg.1	-							NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						GAAAAGCACAACAACATTTTTG	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	21832437	21832438	+	IGR	INS	-	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21832437_21832438insC								NBPF3 (21045 upstream) : ALPL (3420 downstream)																							ttttctcttcttttcctttctt	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38718392	38718392	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38718392delG								POU3F1 (205942 upstream) : RRAGC (586623 downstream)																							GGATGGTGCTGGGGCAGGTGC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44856119	44856119	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44856119delA								ERI3 (35180 upstream) : RNF220 (14841 downstream)																							ACAAGGGCTTAAAAAAAAGTC	0.408													4	2	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	63055151	63055151	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63055151delC	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc009wah.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						atttttttttcccccgacctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	63825198	63825198	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63825198delT								FOXD3 (34401 upstream) : ALG6 (8063 downstream)																							TTTTCTCTTCTTTTTTTTTTC	0.249													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88702905	88702908	+	IGR	DEL	CTCC	-	-	rs142556581		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88702905_88702908delCTCC								LMO4 (888302 upstream) : PKN2 (447014 downstream)																							TCGCCCACAGCTCCCTTCTCAAAG	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142601757	142601758	+	IGR	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142601757_142601758insA								None (None upstream) : None (None downstream)																							aaatccatcttaaaaaatatgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143397663	143397664	+	IGR	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143397663_143397664delAA								None (None upstream) : LOC100286793 (249975 downstream)																							TTAGAGAAACAAAGAGAAGTAC	0.248													5	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852792	144852793	+	Intron	DEL	TT	-	-	rs72112087		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852792_144852793delTT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCCAAATCACTTTGTCTCAGCA	0.515			T	PDGFRB	MPD								6	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145001837	145001838	+	Intron	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145001837_145001838delAA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emi.3_5'Flank	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ggatactgttaaaagttttccc	0.084			T	PDGFRB	MPD								3	3	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154740215	154740215	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154740215delA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			CAGGCCTCGGAACCCATGATG	0.587													4	2	---	---	---	---	
GBA	2629	broad.mit.edu	37	1	155209225	155209226	+	Intron	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155209225_155209226insA	uc001fjh.2	-						RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Intron|GBA_uc010pfx.1_Intron|GBA_uc001fji.2_Intron|GBA_uc001fjj.2_Intron|GBA_uc001fjk.2_Intron|GBA_uc001fjl.2_Intron|GBA_uc010pfy.1_Intron|GBA_uc009wqk.1_Intron	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor						carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	aggaggctgaggcaggagaatc	0.000									Gaucher_disease_type_I				6	3	---	---	---	---	
C1orf192	257177	broad.mit.edu	37	1	161336572	161336572	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161336572delT	uc001gal.2	-							NM_001013625	NP_001013647	Q5VTH2	CA192_HUMAN	hypothetical protein LOC257177												0	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			ttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
PRDX6	9588	broad.mit.edu	37	1	173454855	173454855	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173454855delA	uc001giy.1	+							NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6						cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						GGAAATCTACAAAAAAAAAGT	0.363													4	2	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176571850	176571850	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176571850delA	uc001gkz.2	+						PAPPA2_uc001gky.1_Intron|PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ACTAAACAGCAAAAAAAAAAC	0.428													4	2	---	---	---	---	
RGSL1	353299	broad.mit.edu	37	1	182499673	182499674	+	Intron	INS	-	AC	AC	rs141531543	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182499673_182499674insAC	uc009wxw.2	+						RGSL1_uc010pnu.1_Intron|RGSL1_uc009wxx.1_Intron	NM_001137669	NP_001131141	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1							integral to membrane	signal transducer activity			central_nervous_system(1)	1						cacacacacatacacacacaca	0.272													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	186745730	186745730	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186745730delG								PTGS2 (96171 upstream) : PLA2G4A (52302 downstream)																							ctgcatatatggggctgaata	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193782527	193782528	+	IGR	DEL	GT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193782527_193782528delGT								CDC73 (558587 upstream) : None (None downstream)																							GCAAATTCCAGTGTGAAAAGAG	0.337													4	2	---	---	---	---	
CD55	1604	broad.mit.edu	37	1	207498723	207498723	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207498723delT	uc001hfq.3	+						CD55_uc001hfp.3_Intron|CD55_uc001hfr.3_Intron|CD55_uc010psf.1_Intron|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Intron|CD55_uc009xcg.2_5'Flank	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform						complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	ATATCAATGGTTCAGATGATG	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	210369248	210369248	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210369248delT								SYT14 (31617 upstream) : C1orf133 (35556 downstream)																							caaaacaacatttttttttcc	0.000													4	2	---	---	---	---	
C1orf95	375057	broad.mit.edu	37	1	226767829	226767830	+	Intron	INS	-	A	A	rs148114282	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226767829_226767830insA	uc010pvn.1	+							NM_001003665	NP_001003665	Q69YW2	CA095_HUMAN	hypothetical protein LOC375057							integral to membrane				ovary(1)	1	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		cattcagaagtaaaaaatgaca	0.000													4	2	---	---	---	---	
C1orf124	83932	broad.mit.edu	37	1	231475809	231475809	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231475809delA	uc001hur.2	+						EXOC8_uc001huq.2_5'Flank|C1orf124_uc001hus.2_Intron|C1orf124_uc001hut.2_Intron	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a						DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				AAAAAAAAACAAAAAAAAGGC	0.179													4	2	---	---	---	---	
DISC1	27185	broad.mit.edu	37	1	231868669	231868671	+	Intron	DEL	AGT	-	-	rs72519545		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231868669_231868671delAGT	uc001huz.2	+						TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwo.1_Intron|DISC1_uc010pwp.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				gaacagtggcagtggtggtagtg	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	235162317	235162317	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235162317delG								IRF2BP2 (417046 upstream) : TOMM20 (110343 downstream)																							acctgaggctgggcaatttgt	0.129													4	2	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235929142	235929142	+	Intron	DEL	T	-	-	rs113006318		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235929142delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			caaatacacattttttttttt	0.010									Chediak-Higashi_syndrome				8	6	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237773652	237773653	+	Intron	DEL	GA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237773652_237773653delGA	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACAGATATTGAGAGAGAGAGC	0.470													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241190121	241190121	+	Intron	DEL	G	-	-	rs147106117		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241190121delG	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			agcggggtttggggcatccaa	0.000													2	4	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9595584	9595586	+	Intron	DEL	GGA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9595584_9595586delGGA	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TCTTACAGCTGGAGCAGAAGTTA	0.266													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15300458	15300458	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15300458delG								FAM84A (509525 upstream) : NBAS (6574 downstream)																							CCGACATACTGGGGTGGCAGG	0.552													4	2	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28781573	28781574	+	Intron	DEL	TG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28781573_28781574delTG	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					tgtgtgtgtatgtgtgtgtgtg	0.332													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38062172	38062172	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38062172delT								CDC42EP3 (162846 upstream) : FAM82A1 (90290 downstream)																							ACTTCTCATCttttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	79224222	79224222	+	IGR	DEL	T	-	-	rs113306844		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79224222delT								None (None upstream) : REG3G (28604 downstream)																							CTGAATCttcttttttttttt	0.204													4	2	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89100923	89100924	+	Intron	INS	-	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89100923_89100924insG	uc010fhg.2	+						FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						AATATAAAAAAGATACATATGA	0.282													5	4	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91812282	91812283	+	Intron	INS	-	TGAG	TGAG	rs147312629		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91812282_91812283insTGAG	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						GCTAGGACTCCTAAGTTTCCTT	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103561476	103561476	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103561476delT								TMEM182 (127340 upstream) : None (None downstream)																							TCCAGTTTGGTTTTTCATTGT	0.448													4	2	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112592110	112592115	+	Intron	DEL	CAAGGT	-	-	rs72138125		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112592110_112592115delCAAGGT	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						CTATATGATACAAGGTTCCTATATGG	0.379													3	10	---	---	---	---	
IWS1	55677	broad.mit.edu	37	2	128261986	128261986	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128261986delA	uc002ton.2	-						IWS1_uc010yzl.1_Intron|uc002too.1_5'Flank	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog						transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TTCCAGTTTTAAAAAAAAAAA	0.318													2	4	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137599800	137599800	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137599800delA	uc010zbj.1	+											Homo sapiens mRNA for KIAA1679 protein, partial cds.											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTTAACTTGGAAAAAAAGAAC	0.348													4	2	---	---	---	---	
ACVR2A	92	broad.mit.edu	37	2	148684420	148684420	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148684420delT	uc002twg.2	+						ACVR2A_uc010zbn.1_Intron|ACVR2A_uc002twh.2_Intron	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor						activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GGGATAGAGATTTTTTTTTTG	0.328													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153645348	153645348	+	IGR	DEL	A	-	-	rs71396308		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153645348delA								ARL6IP6 (27581 upstream) : RPRM (688504 downstream)																							TGGACAGAGGAAAAAAAAATC	0.408													4	2	---	---	---	---	
DLX1	1745	broad.mit.edu	37	2	172951884	172951884	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172951884delA	uc002uhl.2	+						DLX1_uc002uhm.2_Intron	NM_178120	NP_835221	P56177	DLX1_HUMAN	distal-less homeobox 1 isoform 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			ACACGTGCCTAAACAACTGGA	0.557													4	2	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178804433	178804434	+	Intron	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178804433_178804434insA	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			ggaagcattacagggcaaatat	0.015									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187521418	187521418	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187521418delA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		accagagtccaaaaaaaaaat	0.095													3	5	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190558134	190558135	+	Intron	DEL	TA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190558134_190558135delTA	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			AATTAGTTCTTATAATTAACAG	0.312													4	2	---	---	---	---	
STAT4	6775	broad.mit.edu	37	2	191902545	191902545	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191902545delG	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc010zgk.1_Intron|STAT4_uc002uso.2_Intron	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			AATGGTGCCTGGAAAAGTGAC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	212230979	212230980	+	IGR	INS	-	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212230979_212230980insG								CPS1 (687150 upstream) : ERBB4 (9462 downstream)																							CTCTTGTGCTAGGAAAAAAAAA	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222160758	222160759	+	IGR	INS	-	AACTC	AACTC	rs140357672	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222160758_222160759insAACTC								None (None upstream) : EPHA4 (121990 downstream)																							TGTTCCCTCTTAAAGAAGCAAG	0.446													4	3	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230672741	230672742	+	Intron	INS	-	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230672741_230672742insC	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		gatggcagtggcacgatctcag	0.064													11	5	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230672748	230672749	+	Intron	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230672748_230672749insA	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		gtggcacgatctcagctcactg	0.054													9	4	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776114	234776115	+	Intron	INS	-	G	G			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776114_234776115insG	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						TACGAAtttctttctttctttc	0.243													9	7	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776125	234776126	+	Intron	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776125_234776126insA	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						ttctttctttctttcttttttt	0.213													5	7	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776128	234776129	+	Intron	INS	-	CC	CC			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776128_234776129insCC	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						tttctttctttctttttttTGT	0.203													7	5	---	---	---	---	
ASB18	401036	broad.mit.edu	37	2	237146804	237146804	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237146804delG	uc010znh.1	-						ASB18_uc010fyp.1_Intron	NM_212556	NP_997721	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box-containing 18						intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		cgtagacagaggaagaaataC	0.289													4	2	---	---	---	---	
SCLY	51540	broad.mit.edu	37	2	238999568	238999569	+	Intron	INS	-	AGGC	AGGC			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238999568_238999569insAGGC	uc010fyv.2	+						SCLY_uc002vxm.3_Intron|SCLY_uc002vxn.2_Intron|SCLY_uc010znq.1_Intron|SCLY_uc010znr.1_Intron	NM_016510	NP_057594	Q96I15	SCLY_HUMAN	selenocysteine lyase						cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		GGGCCTACAGGAGGCAGAGTGC	0.515													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239561441	239561441	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239561441delG								ASB1 (200551 upstream) : TWIST2 (195232 downstream)																							CAGTAGGTGTGGGGATTCTCA	0.348													4	2	---	---	---	---	
XYLB	9942	broad.mit.edu	37	3	38438325	38438325	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38438325delA	uc003cic.2	+						XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_Intron	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase						D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		tgaaatggctaaaaagtacag	0.055													4	2	---	---	---	---	
CNTN3	5067	broad.mit.edu	37	3	74444887	74444888	+	Intron	INS	-	T	T	rs139924869	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74444887_74444888insT	uc003dpm.1	-							NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ttgtgctttgcttattgtgctt	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90265885	90265885	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90265885delC								EPHA3 (734603 upstream) : None (None downstream)																							ACAGCTCAGGCCCCAGATCTT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98636777	98636778	+	IGR	INS	-	T	T	rs150789711	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98636777_98636778insT								DCBLD2 (16244 upstream) : COL8A1 (720676 downstream)																							CTGTGTTGCCATTTTTTTTTCT	0.376													4	2	---	---	---	---	
GUCA1C	9626	broad.mit.edu	37	3	108633748	108633748	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108633748delT	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						ACTCTGTTTCTTACAAGCTTT	0.438											OREG0015703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
SEMA5B	54437	broad.mit.edu	37	3	122709461	122709462	+	Intron	DEL	CA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122709461_122709462delCA	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc003egb.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		catacatgtgcacacacacaca	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	169406612	169406612	+	IGR	DEL	C	-	-	rs67340903		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169406612delC								MECOM (25049 upstream) : TERC (75786 downstream)																							ggacttcattcctcccttcat	0.000													3	4	---	---	---	---	
TNFSF10	8743	broad.mit.edu	37	3	172232952	172232952	+	Intron	DEL	A	-	-	rs35502466		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172232952delA	uc003fid.2	-						TNFSF10_uc003fie.2_Intron	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,						activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CTTTGTCCTTAAAAAAAAAAA	0.279													3	4	---	---	---	---	
KCNMB2	10242	broad.mit.edu	37	3	178261159	178261159	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178261159delC	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron	NM_181361	NP_852006	Q9Y691	KCMB2_HUMAN	calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)			TTCAACATGTCCAGTGTCTTC	0.443													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186038536	186038536	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186038536delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGAGAATGTTAAAAAAAAAAG	0.398													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188323991	188323991	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188323991delC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TCTGCTAGTTCCATATTATTT	0.463			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194265938	194265938	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194265938delA								ATP13A3 (76970 upstream) : TMEM44 (42465 downstream)																							gctaataaacaaaaaaaaatt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194492650	194492650	+	IGR	DEL	T	-	-	rs10706760		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194492650delT								FAM43A (82886 upstream) : C3orf21 (296365 downstream)																							GAAGTATGTCTGCTTTGTGGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	387580	387584	+	IGR	DEL	TCTTT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:387580_387584delTCTTT								ZNF141 (9821 upstream) : ABCA11P (31640 downstream)																							AAGAATTCTCTCTTTTCTTtagaga	0.346													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28377265	28377265	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28377265delT								None (None upstream) : None (None downstream)																							actcctcccatttttttcatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49221644	49221644	+	IGR	DEL	T	-	-	rs111396806		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49221644delT								CWH43 (157551 upstream) : None (None downstream)																							cacctgtgacttttgcggggt	0.000													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54308503	54308506	+	Intron	DEL	TATG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54308503_54308506delTATG	uc003haa.2	+						FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron|FIP1L1_uc010ign.2_Intron|FIP1L1_uc003had.2_Intron|FIP1L1_uc003hae.2_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GCTACTGttttatgtatggagaag	0.132			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	60567921	60567921	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60567921delT								None (None upstream) : None (None downstream)																							gactgtgtgattttggaaaga	0.065													4	2	---	---	---	---	
ALB	213	broad.mit.edu	37	4	74283479	74283480	+	Intron	DEL	TG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74283479_74283480delTG	uc003hgs.3	+						ALB_uc003hgw.3_Intron|ALB_uc011cbe.1_Intron|ALB_uc003hgt.3_Intron|ALB_uc010iii.2_Intron|ALB_uc003hgu.3_Intron|ALB_uc003hgv.3_Intron|ALB_uc011cbf.1_Intron|ALB_uc010iij.2_Intron|ALB_uc003hgx.3_Intron	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein						bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	AAGGAAGTAAtgtgtgtgtgtg	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	140114072	140114074	+	IGR	DEL	CTT	-	-	rs151077510		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140114072_140114074delCTT								ELF2 (15700 upstream) : C4orf49 (73243 downstream)																							gctcaggatacttcttctacaca	0.015													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	148238055	148238056	+	IGR	DEL	TA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148238055_148238056delTA								TTC29 (371021 upstream) : MIR548G (27725 downstream)																							TCCTACACCTTATATATATAAC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	151945438	151945438	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151945438delG								LRBA (8559 upstream) : RPS3A (75316 downstream)																							ACCTGAGTTTGGGTAACTGTG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179747271	179747271	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179747271delA								LOC285501 (835368 upstream) : None (None downstream)																							cttcatgaacaaggaggagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	11736	11737	+	IGR	INS	-	AA	AA			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11736_11737insAA								None (None upstream) : PLEKHG4B (128636 downstream)																							accctaaccctaaccctaaccc	0.000													4	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5305721	5305721	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5305721delG	uc003jdl.2	+							NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ACCAAGAGGAGTGTTCCAAGT	0.383													2	4	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7885675	7885676	+	Intron	INS	-	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7885675_7885676insT	uc003jed.2	+						MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACAATTGTGTGTTTTTTTTTTT	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25572689	25572689	+	IGR	DEL	A	-	-	rs35752366		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25572689delA								CDH10 (927778 upstream) : None (None downstream)																							gtctgggggtaaaaaaaggct	0.000													3	3	---	---	---	---	
HEATR7B2	133558	broad.mit.edu	37	5	41001215	41001215	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41001215delC	uc003jmj.3	-						HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2								binding			ovary(6)|central_nervous_system(2)	8						GGAAGTGTGACCAGGACCACA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44189020	44189020	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44189020delT								NNT (483353 upstream) : FGF10 (116077 downstream)																							aactcatacctttttaagctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	62734964	62734965	+	IGR	INS	-	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62734964_62734965insT								ISCA1P1 (661794 upstream) : HTR1A (521314 downstream)																							CCTTTCCTCTCTTTTTTTTCAC	0.381													4	2	---	---	---	---	
AP3B1	8546	broad.mit.edu	37	5	77458455	77458455	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77458455delA	uc003kfj.2	-							NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		CTATTTTACTAAAAAAAAAAG	0.294									Hermansky-Pudlak_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79252728	79252729	+	IGR	DEL	CA	-	-	rs144117508		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79252728_79252729delCA								CMYA5 (156680 upstream) : MTX3 (19812 downstream)																							GCCCAGGGGCCACCATCAGAAG	0.545													2	4	---	---	---	---	
MAN2A1	4124	broad.mit.edu	37	5	109064335	109064335	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109064335delA	uc003kou.1	+							NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		AAAGTAGAGGAAAAAACAGGA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117983498	117983499	+	IGR	DEL	CT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117983498_117983499delCT								None (None upstream) : DTWD2 (189072 downstream)																							agcctcctccctctctctctta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133020123	133020124	+	IGR	DEL	TC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133020123_133020124delTC								FSTL4 (71900 upstream) : C5orf15 (271075 downstream)																							ACTTGTTGCTTCTCTCTCTCCT	0.441													4	2	---	---	---	---	
CDKN2AIPNL	91368	broad.mit.edu	37	5	133738314	133738314	+	3'UTR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133738314delA	uc011cxs.1	-	3						NM_080656	NP_542387	Q96HQ2	C2AIL_HUMAN	CDKN2A interacting protein N-terminal like												0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tgtcgataagaaaaaaaaaaa	0.129													10	7	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139411270	139411271	+	Intron	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139411270_139411271delAA	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAACTCCAGAAAAGAGGCATC	0.450													4	2	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142507284	142507285	+	Intron	DEL	GT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142507284_142507285delGT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAAATATTGGTGACATTGAAA	0.376													4	2	---	---	---	---	
SPINK13	153218	broad.mit.edu	37	5	147661400	147661401	+	Intron	DEL	CT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147661400_147661401delCT	uc003lpc.2	+						uc003lpb.1_Intron|SPINK13_uc010jgt.2_Intron	NM_001040129	NP_001035218	Q1W4C9	ISK13_HUMAN	serine PI Kazal type 5-like 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0						AGTATCTCCACTCATAAACATC	0.342													4	2	---	---	---	---	
PDE6A	5145	broad.mit.edu	37	5	149300990	149300990	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149300990delT	uc003lrg.3	-							NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A						cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATTGTTGCTGTTTTTTTTTTA	0.259													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174389753	174389754	+	IGR	INS	-	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174389753_174389754insC								MSX2 (231852 upstream) : DRD1 (477922 downstream)																							tatggatgcttcccccatagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11494540	11494541	+	Intron	DEL	AG	-	-	rs149234419		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11494540_11494541delAG	uc003mzz.1	+											Homo sapiens cDNA clone IMAGE:5269873.																		GTACTTATTCAGAGTCTTTCAC	0.371													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12172242	12172242	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12172242delA								HIVEP1 (7011 upstream) : EDN1 (118287 downstream)																							CTGCTCTGAGAAAGTAGACAG	0.517													4	2	---	---	---	---	
FLJ22536	401237	broad.mit.edu	37	6	22136110	22136110	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22136110delT	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron|uc003ndm.1_3'UTR	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0						TACTGTTCTGTTTTTTTCTGA	0.333													4	2	---	---	---	---	
ALDH5A1	7915	broad.mit.edu	37	6	24503130	24503130	+	Intron	DEL	T	-	-	rs34356956		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24503130delT	uc003neg.2	+						ALDH5A1_uc003nef.2_Intron	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor						acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	GTTTTGGTTGTTTTTTTTTTT	0.239													5	3	---	---	---	---	
HFE	3077	broad.mit.edu	37	6	26094670	26094671	+	3'UTR	INS	-	TG	TG			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26094670_26094671insTG	uc003nfx.1	+	6					HFE_uc003nfy.1_3'UTR|HFE_uc010jqe.1_3'UTR|HFE_uc003nfz.1_3'UTR|HFE_uc003ngd.1_3'UTR|HFE_uc003nga.1_3'UTR|HFE_uc003ngb.1_3'UTR|HFE_uc003ngc.1_3'UTR|HFE_uc003nge.1_3'UTR|HFE_uc003ngf.1_3'UTR|uc010jqf.1_5'Flank	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor						antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						CCTAGCTGTGACCTCTCCCCTG	0.460									Hemochromatosis				5	4	---	---	---	---	
TCP11	6954	broad.mit.edu	37	6	35087761	35087761	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35087761delT	uc003okd.2	-						TCP11_uc003ojz.1_Intron|TCP11_uc003oka.2_Intron|TCP11_uc003okb.2_Intron|TCP11_uc003okc.2_Intron|TCP11_uc011dsu.1_Intron|TCP11_uc011dsv.1_Intron|TCP11_uc011dsw.1_Intron	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN	t-complex 11 isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(3)|skin(2)	5						GGAAGAAAGGTTTTTTTTTGT	0.423													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36692954	36692955	+	IGR	DEL	TT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36692954_36692955delTT								CDKN1A (37846 upstream) : CPNE5 (15600 downstream)																							TAAAACAGCAtttttttttttg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53229262	53229262	+	IGR	DEL	G	-	-	rs12194380	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53229262delG								ELOVL5 (15320 upstream) : GCLC (132878 downstream)																							GTTTttttttgtttgtttgtt	0.214													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112894124	112894124	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112894124delG								RFPL4B (221626 upstream) : None (None downstream)																							actcagatttgtacttatacc	0.065													4	2	---	---	---	---	
ADAT2	134637	broad.mit.edu	37	6	143753230	143753230	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143753230delA	uc003qjj.2	-							NM_182503	NP_872309	Q7Z6V5	ADAT2_HUMAN	deaminase domain containing 1						tRNA processing		hydrolase activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		AAATTTGTACAAAAATATTGT	0.343													4	2	---	---	---	---	
PEX3	8504	broad.mit.edu	37	6	143809982	143809983	+	Intron	DEL	TC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143809982_143809983delTC	uc003qjl.2	+							NM_003630	NP_003621	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3						protein import into peroxisome membrane|transmembrane transport	integral to peroxisomal membrane	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		aattatttattcaacagatacc	0.025													4	2	---	---	---	---	
GRM1	2911	broad.mit.edu	37	6	146625605	146625605	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146625605delA	uc010khw.1	+						GRM1_uc010khv.1_Intron|GRM1_uc003qll.2_Intron|GRM1_uc011edz.1_Intron|GRM1_uc011eea.1_Intron	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	ACTCTCTACCAAAAAAAAAGT	0.333													9	5	---	---	---	---	
ZDHHC14	79683	broad.mit.edu	37	6	158071574	158071574	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158071574delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjn.2_Intron	NM_024630	NP_078906	Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		gaacgcttgatttttttctcc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159798414	159798414	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159798414delT								FNDC1 (105275 upstream) : SOD2 (301737 downstream)																							tgaccaggagtttgccagtag	0.000													4	2	---	---	---	---	
PACRG	135138	broad.mit.edu	37	6	163181251	163181251	+	Intron	DEL	A	-	-	rs11340578		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163181251delA	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		agaaaaggttacaggtgtcag	0.109													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9539395	9539397	+	IGR	DEL	TGG	-	-	rs112246666		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9539395_9539397delTGG								NXPH1 (746803 upstream) : PER4 (134503 downstream)																							gcacactagttggaccacaaggc	0.000													3	4	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21714476	21714476	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21714476delA	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ccaactgcagaaaaaaaaaag	0.000									Kartagener_syndrome				4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36649732	36649733	+	Intron	INS	-	T	T	rs10243794		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36649732_36649733insT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						tttcttttttcttttttttttt	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63847197	63847197	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63847197delT								ZNF679 (119897 upstream) : ZNF680 (133058 downstream)																							CAAAAATAAGTTTTTTTTTAC	0.239													4	3	---	---	---	---	
ANKIB1	54467	broad.mit.edu	37	7	91937257	91937257	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91937257delA	uc003ulw.2	+							NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			cctccccagtagctgggacta	0.000													4	4	---	---	---	---	
CNPY4	245812	broad.mit.edu	37	7	99722682	99722682	+	3'UTR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99722682delG	uc003uto.2	+	6					MBLAC1_uc003utp.2_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog precursor							extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCATGACATGGCTTCTGGGG	0.522													5	3	---	---	---	---	
SLC26A5	375611	broad.mit.edu	37	7	103018469	103018469	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103018469delT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						CTTCTCCTCCTTTTTTTTCTT	0.323													5	3	---	---	---	---	
HYAL4	23553	broad.mit.edu	37	7	123504606	123504607	+	Intron	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123504606_123504607delAA	uc003vlc.2	+						HYAL4_uc011knz.1_Intron	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4						fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						TGATATGGTTAACTGTGGATAA	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131644384	131644387	+	IGR	DEL	AAGG	-	-	rs72124207		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131644384_131644387delAAGG								PODXL (403008 upstream) : PLXNA4 (163705 downstream)																							GTCAGGAAACAAGGAGGGAGGAGC	0.544													4	2	---	---	---	---	
SH2D4A	63898	broad.mit.edu	37	8	19251141	19251142	+	Intron	DEL	GA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19251141_19251142delGA	uc003wzb.2	+						SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Intron	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		GAAAAGGACTGAGACAAGTACT	0.391													4	2	---	---	---	---	
FAM160B2	64760	broad.mit.edu	37	8	21951993	21951994	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21951993_21951994delTG	uc011kyx.1	+	2	139_140	c.88_89delTG	c.(88-90)TGGfs	p.W30fs	FAM160B2_uc011kyw.1_Frame_Shift_Del_p.W30fs|FAM160B2_uc011kyy.1_RNA	NM_022749	NP_073586	Q86V87	F16B2_HUMAN	retinoic acid induced 16	30											0						CGTGGAGCACTGGAAGGGCATC	0.668													10	6	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53062819	53062820	+	Intron	DEL	TG	-	-	rs111351277		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53062819_53062820delTG	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTTATGAAAAtgtgtgtgtgtg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55765909	55765910	+	IGR	DEL	AG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55765909_55765910delAG								RP1 (83378 upstream) : XKR4 (249107 downstream)																							gaaggaaggcagagagagagag	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	73241148	73241148	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73241148delT	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																		TCTGTCTTGATTTTTTTTTTG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76248686	76248686	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76248686delA								CRISPLD1 (301895 upstream) : HNF4G (71497 downstream)																							TTGGATTGCTAAAAAAAAACA	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84950525	84950526	+	IGR	INS	-	TC	TC			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84950525_84950526insTC								None (None upstream) : RALYL (144927 downstream)																							GGGTTtgtgtgtgtgtgtgtgt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88937252	88937252	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88937252delG								DCAF4L2 (50956 upstream) : MMP16 (112210 downstream)																							ttttttttttGAGACATTTAC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101872321	101872321	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101872321delC								PABPC1 (138006 upstream) : YWHAZ (58483 downstream)																							CTCCCCTTCTCCGGCCGTGTG	0.607													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110471674	110471674	+	Intron	DEL	T	-	-	rs11356938		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110471674delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAATAAAATATTTTTTCTAAT	0.229										HNSCC(38;0.096)			3	4	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121298403	121298403	+	Intron	DEL	T	-	-	rs77603140	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121298403delT	uc003yox.2	+						COL14A1_uc003yoz.2_Intron	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			gaaatgtgcatttttTTTTTT	0.279													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127386867	127386867	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127386867delG								TRIB1 (936225 upstream) : FAM84B (177820 downstream)																							CAGTAGAGTTGGAAATGGAAT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130128250	130128250	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130128250delC								MIR1208 (965816 upstream) : GSDMC (632193 downstream)																							ACCTCCATCACCCCATCCTCC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	133578135	133578136	+	IGR	INS	-	C	C	rs144816463	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133578135_133578136insC								HPYR1 (4409 upstream) : LRRC6 (6312 downstream)																							CTGTCTCCTCTCCTCTTCTGTC	0.460													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8582111	8582111	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8582111delA	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GACAAATcagaaaaaagctcg	0.129										TSP Lung(15;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11011039	11011039	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11011039delC								PTPRD (398316 upstream) : None (None downstream)																							CAAAACCAGGCGGGAAGCTAC	0.413													4	2	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36583452	36583452	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36583452delA	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TATCATGGTTAAAAAAAAAAA	0.284													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68418028	68418029	+	IGR	DEL	AG	-	-	rs71861265		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68418028_68418029delAG								FAM27B (623839 upstream) : MIR1299 (584210 downstream)																							ATCTAGTAACAGGGTAACATTT	0.272													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430746	68430746	+	IGR	DEL	T	-	-	rs113456947		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430746delT								FAM27B (636557 upstream) : MIR1299 (571493 downstream)																							TTTTACTAGCTTCTTATATCC	0.313													6	4	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71555304	71555304	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71555304delT	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		CTTTATTAGGTTTTTAAAAGA	0.303													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73479672	73479672	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73479672delA	uc004aid.2	-						TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aie.2_Intron|TRPM3_uc004aif.2_Intron|TRPM3_uc004aig.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TGACCATAATAAAAAAAAGTT	0.284													6	3	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77425298	77425299	+	Intron	DEL	CA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77425298_77425299delCA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						AATGCAGACTCACAAAAGCAGC	0.411													4	2	---	---	---	---	
CDK5RAP2	55755	broad.mit.edu	37	9	123155438	123155438	+	Intron	DEL	C	-	-	rs3837284		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123155438delC	uc004bkf.2	-						CDK5RAP2_uc010mvi.2_Intron|CDK5RAP2_uc004bke.2_Intron|CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						agtcattcttcaagacccagt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130001049	130001049	+	IGR	DEL	A	-	-	rs113358726		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130001049delA								RALGPS1 (15606 upstream) : GARNL3 (24892 downstream)																							CTCCCTGTGGAAACCTGATCT	0.453													7	5	---	---	---	---	
GOLGA2	2801	broad.mit.edu	37	9	131023159	131023160	+	Intron	INS	-	C	C			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131023159_131023160insC	uc011maw.1	-						GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_5'Flank|uc004bun.2_5'Flank	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2							Golgi cisterna membrane	protein binding			ovary(1)	1						CCTCTCAAGCTCCCCAAACTTG	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8645747	8645747	+	IGR	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8645747delA								GATA3 (528585 upstream) : None (None downstream)																							gacagagcgcaggacagaaag	0.000													4	2	---	---	---	---	
CACNB2	783	broad.mit.edu	37	10	18828670	18828671	+	3'UTR	DEL	TT	-	-	rs58830289		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18828670_18828671delTT	uc001ipr.2	+	14					CACNB2_uc009xjz.1_3'UTR|CACNB2_uc001ips.2_3'UTR|CACNB2_uc001ipt.2_3'UTR|CACNB2_uc001ipu.2_3'UTR|CACNB2_uc001ipv.2_3'UTR|CACNB2_uc009xka.1_3'UTR|CACNB2_uc001ipw.2_3'UTR|CACNB2_uc001ipx.2_3'UTR|CACNB2_uc001ipz.2_3'UTR|CACNB2_uc001ipy.2_3'UTR|CACNB2_uc010qco.1_3'UTR|CACNB2_uc001iqa.2_3'UTR|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CCCGTTTGTGTTTTTTTTTTTT	0.376													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	27620447	27620448	+	IGR	INS	-	TT	TT	rs142562667	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27620447_27620448insTT								LOC387646 (79212 upstream) : PTCHD3 (66669 downstream)																							ACTCAGGCTTCTTTCCGCCAAG	0.465													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34420743	34420743	+	Intron	DEL	T	-	-	rs71920712		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34420743delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TTAGATATTCTTTTTTTTTTT	0.259													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	39047569	39047570	+	IGR	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39047569_39047570delAA								LOC399744 (306489 upstream) : None (None downstream)																							CATTTCTAGTAAAAAAAAAAAA	0.168													4	4	---	---	---	---	
RET	5979	broad.mit.edu	37	10	43583490	43583492	+	Intron	DEL	GTG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43583490_43583492delGTG	uc001jal.2	+						RET_uc001jak.1_Intron	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a						homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	agtggtggttgtggtggtggtgg	0.069		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47062498	47062502	+	Intron	DEL	ATAAA	-	-	rs149894739		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47062498_47062502delATAAA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						CAAATAAAAGATAAAATAAAAGATT	0.254													4	3	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51485576	51485576	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51485576delC	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|AGAP7_uc001jio.2_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		ATTGTGCTTGCCCTCTGGATT	0.358													4	2	---	---	---	---	
IPMK	253430	broad.mit.edu	37	10	59975732	59975732	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59975732delA	uc001jkb.2	-							NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						atcagtgaacaaaaaaaaaaa	0.090													4	3	---	---	---	---	
TYSND1	219743	broad.mit.edu	37	10	71908546	71908547	+	5'Flank	INS	-	AAAC	AAAC	rs146500950	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71908546_71908547insAAAC	uc001jqr.2	-						TYSND1_uc001jqq.2_5'Flank|TYSND1_uc001jqs.2_5'Flank|TYSND1_uc001jqt.2_5'Flank	NM_173555	NP_775826	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1 isoform a						proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1						accAACTcaaaaaacaaacaaa	0.173													6	5	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73320803	73320804	+	Intron	DEL	TC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73320803_73320804delTC	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						GTCCTTCTTTTCTCTCTCTCTC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82550628	82550628	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82550628delT								SH2D4B (144312 upstream) : None (None downstream)																							gatagagatatttttgtgcaa	0.000													4	2	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100401359	100401359	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100401359delA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		aaaattaattaaaaaaaaaaT	0.179													5	3	---	---	---	---	
MGMT	4255	broad.mit.edu	37	10	131459039	131459040	+	Intron	INS	-	AC	AC	rs141784755	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131459039_131459040insAC	uc001lkh.2	+							NM_002412	NP_002403	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase											ovary(1)|breast(1)	2		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)		CCCCACCCCCAacacacacaca	0.391								Direct_reversal_of_damage					3	3	---	---	---	---	
HBE1	3046	broad.mit.edu	37	11	5292071	5292071	+	5'Flank	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5292071delT	uc001mal.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTAGTGTCCTTTTTTTTTTC	0.343													7	4	---	---	---	---	
C11orf84	144097	broad.mit.edu	37	11	63583018	63583018	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63583018delC	uc001nxt.2	+							NM_138471	NP_612480	Q9BUA3	CK084_HUMAN	hypothetical protein LOC144097												0						ctggaagtatctagctagtgg	0.000													4	2	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63858407	63858407	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63858407delG	uc001nyh.2	-							NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						CTGCCCTGTAGGGGGCACTGG	0.532													4	2	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68839275	68839275	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68839275delC	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGGAACTGGGCCCCCCCCCAA	0.687													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	73492707	73492707	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73492707delT								RAB6A (20506 upstream) : MRPL48 (6210 downstream)																							GCCTCCCTACTTTTTTTTTTC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87256848	87256848	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87256848delT								TMEM135 (222280 upstream) : RAB38 (589583 downstream)																							TCTTTGGGGCTTGGTGAGAAC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91337542	91337543	+	IGR	DEL	GA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91337542_91337543delGA								MIR1261 (735172 upstream) : FAT3 (747719 downstream)																							agaacagagtgagagagagaga	0.134													4	2	---	---	---	---	
ALKBH8	91801	broad.mit.edu	37	11	107422830	107422830	+	Intron	DEL	T	-	-	rs34582611		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107422830delT	uc010rvr.1	-						ALKBH8_uc001pjk.2_5'Flank|ALKBH8_uc010rvq.1_Intron|ALKBH8_uc009yxp.2_Intron|ALKBH8_uc001pjl.2_Intron	NM_138775	NP_620130	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8						response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		ATTTCATTGATTTTTTTTCAG	0.184													5	3	---	---	---	---	
EXPH5	23086	broad.mit.edu	37	11	108438743	108438743	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108438743delG	uc001pkk.2	-							NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a						intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GCCCTATCCTGGTGGGCAGAA	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112527870	112527871	+	IGR	DEL	CT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112527870_112527871delCT								PTS (387193 upstream) : NCAM1 (304124 downstream)																							CTCCCCTCTCCTCTCTCTCTCT	0.525													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121659759	121659760	+	IGR	INS	-	GATA	GATA	rs139223899	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121659759_121659760insGATA								SORL1 (155288 upstream) : LOC399959 (300051 downstream)																							GGGTGAACCATGATATTTAAGA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126070201	126070201	+	IGR	DEL	C	-	-	rs35497957		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126070201delC								CDON (137014 upstream) : RPUSD4 (1789 downstream)																							AGCATCTGTTCCCAGACCATA	0.498													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	131169421	131169421	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131169421delC								SNX19 (383039 upstream) : NTM (70950 downstream)																							TGCAGAGAAGCCCAGCCTTAT	0.458													4	2	---	---	---	---	
USP5	8078	broad.mit.edu	37	12	6974597	6974597	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6974597delT	uc001qri.3	+						USP5_uc001qrh.3_Intron|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4						ggccaccagctttttttttaa	0.184													4	2	---	---	---	---	
CLEC6A	93978	broad.mit.edu	37	12	8608460	8608461	+	5'Flank	INS	-	AT	AT	rs36184247		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8608460_8608461insAT	uc001qum.1	+							NM_001007033	NP_001007034	Q6EIG7	CLC6A_HUMAN	dectin-2						defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding			breast(1)	1	Lung SC(5;0.184)					AATGGTTTTCAATGTTTCTCAA	0.322													2	5	---	---	---	---	
DNM1L	10059	broad.mit.edu	37	12	32878997	32878997	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32878997delA	uc001rld.2	+						DNM1L_uc010skf.1_Intron|DNM1L_uc010skg.1_Intron|DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AAAAATTACGAAAAAAAAAAG	0.323													4	2	---	---	---	---	
KCNH3	23416	broad.mit.edu	37	12	49944275	49944275	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49944275delC	uc001ruh.1	+						KCNH3_uc010smj.1_Intron	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H						regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						CTCAGAGAAGCCCCAGTGACT	0.587													4	2	---	---	---	---	
ZNF740	283337	broad.mit.edu	37	12	53580480	53580482	+	Intron	DEL	TAA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53580480_53580482delTAA	uc001scb.3	+							NM_001004304	NP_001004304	Q8NDX6	ZN740_HUMAN	zinc finger protein 740						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|protein binding|zinc ion binding				0						TAGAACATTGTAATaataataat	0.241													4	2	---	---	---	---	
RBMS2	5939	broad.mit.edu	37	12	56980357	56980359	+	Intron	DEL	TAA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56980357_56980359delTAA	uc001sln.2	+						RBMS2_uc010sqp.1_Intron|RBMS2_uc010sqq.1_Intron|RBMS2_uc009zou.2_Intron	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting						RNA processing	nucleus	nucleotide binding|RNA binding				0						ttttttttactaatttttttagt	0.025													6	4	---	---	---	---	
SRGAP1	57522	broad.mit.edu	37	12	64265417	64265418	+	Intron	INS	-	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64265417_64265418insT	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TTTCTTTTTTCTTTTTTTTTTG	0.327													5	3	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78392511	78392511	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78392511delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAACAGGTCCTTCCAAATGCA	0.264										HNSCC(70;0.22)			2	5	---	---	---	---	
LTA4H	4048	broad.mit.edu	37	12	96397372	96397372	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96397372delT	uc001ten.1	-						LTA4H_uc010suy.1_Intron|LTA4H_uc010suz.1_Intron|LTA4H_uc010sva.1_Intron	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase						hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						TTCATTCTAATTTTTTTTTTT	0.284													3	4	---	---	---	---	
GATC	283459	broad.mit.edu	37	12	120894329	120894329	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120894329delC	uc010szi.1	+							NM_176818	NP_789788	O43716	GATCL_HUMAN	glutamyl-tRNA(Gln) amidotransferase, subunit C						regulation of translational fidelity						0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gcagaccacaccccagcctgc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19773149	19773151	+	IGR	DEL	AGA	-	-	rs138525012		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19773149_19773151delAGA								TUBA3C (17213 upstream) : LOC100101938 (63790 downstream)																							gcctgaaagcagaaggctactgc	0.005													4	2	---	---	---	---	
NEK3	4752	broad.mit.edu	37	13	52714964	52714964	+	Intron	DEL	C	-	-	rs3742296	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52714964delC	uc001vgi.2	-						NEK3_uc001vgg.2_Intron|NEK3_uc001vgh.2_Intron|NEK3_uc010tgx.1_Intron|NEK3_uc010tgy.1_Intron	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a						cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TAttttttttcttttgagatg	0.194													4	2	---	---	---	---	
C13orf34	79866	broad.mit.edu	37	13	73305799	73305803	+	Intron	DEL	AAGAG	-	-	rs71704149		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73305799_73305803delAAGAG	uc001viv.1	+						C13orf34_uc010thq.1_Intron|C13orf34_uc010aen.1_Intron|C13orf34_uc010thr.1_Intron|C13orf34_uc001viw.1_Intron	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis						cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)		GCACTCAGTTAAGAGAAGAACATTT	0.395													5	4	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76423624	76423624	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76423624delT	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc010thw.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATTCTGGCTGttttttttttt	0.373													7	4	---	---	---	---	
STK24	8428	broad.mit.edu	37	13	99174845	99174845	+	5'Flank	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99174845delC	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			tctctttctacccagacatct	0.055													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99477981	99477982	+	Intron	INS	-	ACC	ACC	rs148842388	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99477981_99477982insACC	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc001vnq.2_Intron|DOCK9_uc001vnr.2_Intron|DOCK9_uc010tin.1_Intron|DOCK9_uc001vns.2_Intron|DOCK9_uc010tio.1_Intron|DOCK9_uc010tip.1_Intron|DOCK9_uc001vnu.1_Intron|DOCK9_uc010tiq.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CACAGGAATAGACCAGCCAACC	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	108613088	108613088	+	IGR	DEL	G	-	-	rs34048652		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108613088delG								FAM155A (93628 upstream) : LIG4 (246706 downstream)																							caatgctgaaggataaagaga	0.075													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112224605	112224605	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112224605delC								C13orf16 (228012 upstream) : SOX1 (497308 downstream)																							GTAGCTGCTTCCCCCAGGATT	0.577													4	2	---	---	---	---	
DCUN1D2	55208	broad.mit.edu	37	13	114134655	114134656	+	Intron	DEL	TT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114134655_114134656delTT	uc001vtr.1	-						DCUN1D2_uc001vts.1_Intron|DCUN1D2_uc010agw.1_Intron	NM_001014283	NP_001014305	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain												0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			agaaaatgagttacaaaaggga	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49311262	49311262	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49311262delC								None (None upstream) : SDCCAG1 (721765 downstream)																							GCACAGCCATCCATCCTTCTT	0.413													6	3	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70407511	70407511	+	Intron	DEL	C	-	-	rs35343549		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70407511delC	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ATATCTGGATCCCTGGGTCCT	0.438													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	72356142	72356142	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72356142delT								SIPA1L1 (150024 upstream) : RGS6 (43014 downstream)																							GGAGTGTGGATTTTTTTCCCT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	82441590	82441590	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82441590delT								SEL1L (441385 upstream) : None (None downstream)																							TACATGAATCTTTTTTTTTTG	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	88179214	88179215	+	IGR	DEL	GG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88179214_88179215delGG								None (None upstream) : GALC (124949 downstream)																							GTGTCCTGCTGGGCAGATAGGG	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20449089	20449090	+	IGR	INS	-	AAAC	AAAC	rs148789326	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20449089_20449090insAAAC								None (None upstream) : GOLGA6L6 (288004 downstream)																							cgacctctcaaaaacaaacaaa	0.153													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20472844	20472844	+	IGR	DEL	G	-	-	rs71399656		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20472844delG								None (None upstream) : GOLGA6L6 (264250 downstream)																							CCAGACACGTGGATTGTTTTG	0.318													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																							GATGTGGAATATGATGAAGGAGA	0.369													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23685749	23685751	+	IGR	DEL	CTC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23685749_23685751delCTC								GOLGA8E (237326 upstream) : MKRN3 (124703 downstream)																							ctcgcatcttctcctcctggtcc	0.000													8	4	---	---	---	---	
WHAMML2	440253	broad.mit.edu	37	15	29009478	29009478	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29009478delA	uc001zci.1	+											Homo sapiens cDNA FLJ33935 fis, clone CTONG2017910.												0						TTTGTGCTTTAAAAAAAAAAG	0.279													4	2	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40894859	40894860	+	Intron	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40894859_40894860insA	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		taattttgtattttggtagaga	0.000													6	6	---	---	---	---	
SPG11	80208	broad.mit.edu	37	15	44863098	44863098	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44863098delC	uc001ztx.2	-						SPG11_uc010bdw.2_Intron|SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GTGACTGTTTCCCCAAAAGGC	0.458													4	2	---	---	---	---	
MTFMT	123263	broad.mit.edu	37	15	65319541	65319541	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65319541delT	uc002aof.3	-							NM_139242	NP_640335	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase							mitochondrion	methionyl-tRNA formyltransferase activity|methyltransferase activity			ovary(2)	2					Tetrahydrofolic acid(DB00116)	tttctttttcttttttttttt	0.139													4	3	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94926983	94926984	+	Intron	DEL	AC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94926983_94926984delAC	uc002btj.2	+						MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			tatgggagctacaattcaagat	0.129													4	2	---	---	---	---	
MPG	4350	broad.mit.edu	37	16	129955	129956	+	Intron	INS	-	TT	TT			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:129955_129956insTT	uc002cfn.2	+						MPG_uc002cfm.2_Intron|MPG_uc010bqp.2_Intron|MPG_uc002cfo.2_Intron	NM_002434	NP_002425	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase isoform a						depurination|DNA dealkylation involved in DNA repair	nucleoplasm	alkylbase DNA N-glycosylase activity|damaged DNA binding|identical protein binding			ovary(1)|skin(1)	2		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				GGCTCTGGGCATCTAGGGCAGG	0.599								BER_DNA_glycosylases					4	2	---	---	---	---	
DNAJA3	9093	broad.mit.edu	37	16	4499007	4499007	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4499007delT	uc002cwk.2	+						DNAJA3_uc002cwl.2_Intron|DNAJA3_uc010uxk.1_Intron	NM_005147	NP_005138	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3						activation of caspase activity|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of cell proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|neuromuscular junction development|positive regulation of apoptosis|positive regulation of protein ubiquitination|protein folding|protein folding|protein stabilization|response to heat|response to interferon-gamma	cytosol|mitochondrial matrix|mitochondrial nucleoid|nucleus	ATP binding|heat shock protein binding|interferon-gamma receptor binding|metal ion binding|NF-kappaB binding|protein kinase binding			ovary(2)|breast(2)	4						ggtcaacttctttttttttga	0.000													4	2	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	25949230	25949230	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25949230delG	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		TCCCAGCTCTGCAGTGTTGAG	0.488													4	2	---	---	---	---	
BOLA2	552900	broad.mit.edu	37	16	29911989	29911991	+	Intron	DEL	GTG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29911989_29911991delGTG	uc010bzb.1	-						uc002dtf.2_Intron|SEZ6L2_uc002dup.3_5'Flank|SEZ6L2_uc002dur.3_5'Flank|SEZ6L2_uc002duq.3_5'Flank|SEZ6L2_uc002dus.3_5'Flank|SEZ6L2_uc010vec.1_5'Flank|SEZ6L2_uc010ved.1_5'Flank|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank			Q9H3K6	BOLA2_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0						GGAGAGAGCAGTGAGGCCGGAGA	0.655													3	3	---	---	---	---	
BOLA2	552900	broad.mit.edu	37	16	29911995	29911996	+	Intron	DEL	CC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29911995_29911996delCC	uc010bzb.1	-						uc002dtf.2_Intron|SEZ6L2_uc002dup.3_5'Flank|SEZ6L2_uc002dur.3_5'Flank|SEZ6L2_uc002duq.3_5'Flank|SEZ6L2_uc002dus.3_5'Flank|SEZ6L2_uc010vec.1_5'Flank|SEZ6L2_uc010ved.1_5'Flank|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank			Q9H3K6	BOLA2_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0						AGCAGTGAGGCCGGAGAGAAAG	0.644													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32833853	32833853	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32833853delC								TP53TG3B (144975 upstream) : SLC6A10P (54944 downstream)																							ttccttccttctttttctttc	0.055													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33372394	33372395	+	IGR	INS	-	A	A	rs148572973	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33372394_33372395insA								SLC6A10P (475931 upstream) : MIR1826 (593113 downstream)																							ccctaaccctcaaaaacctttt	0.064													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	72353731	72353732	+	IGR	DEL	TG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72353731_72353732delTG								PMFBP1 (147382 upstream) : ZFHX3 (463056 downstream)																							gtggggactctgtgtgtgtgtg	0.000													4	3	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77359570	77359570	+	Intron	DEL	A	-	-	rs112943550		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77359570delA	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						GGTATCTTATAGGGGGAAAAA	0.373													8	6	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2886715	2886715	+	Intron	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2886715delG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						CAGTTGGGTTGATTCTCAGGA	0.388													4	2	---	---	---	---	
PITPNM3	83394	broad.mit.edu	37	17	6399116	6399116	+	Intron	DEL	A	-	-	rs145292163		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6399116delA	uc002gdd.3	-						PITPNM3_uc010cln.2_Intron	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1						phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCACAGCTGCAAGGGAATGTA	0.507													2	5	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16038907	16038907	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16038907delC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		cgtgtttctgccccctcacta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21333424	21333424	+	IGR	DEL	C	-	-	rs111937714		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21333424delC								KCNJ12 (10245 upstream) : C17orf51 (98148 downstream)																							taaccacagaccttttcacca	0.000													4	2	---	---	---	---	
LRRC37B	114659	broad.mit.edu	37	17	30362358	30362358	+	Intron	DEL	A	-	-	rs76777694		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30362358delA	uc002hgu.2	+						LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Intron	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AGATAATGGTAAAAAAAAAAG	0.264													11	7	---	---	---	---	
RHBDL3	162494	broad.mit.edu	37	17	30649142	30649143	+	3'UTR	DEL	GT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30649142_30649143delGT	uc002hhe.1	+	9					RHBDL3_uc010csw.1_3'UTR|RHBDL3_uc010csx.1_3'UTR|RHBDL3_uc010csy.1_3'UTR|RHBDL3_uc002hhf.1_3'UTR	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				ACATTCAtgcgtgtgtgtgtgt	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39215669	39215669	+	3'UTR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39215669delT	uc002hvx.2	-	1						NM_033184	NP_149440			keratin associated protein 2-4																		TATTTACTCGTTTTTTTTTTC	0.368													4	3	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41257255	41257255	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41257255delT	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_5'Flank|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Intron|BRCA1_uc002ide.1_5'Flank|BRCA1_uc010cyy.1_Intron|BRCA1_uc010whs.1_Intron|BRCA1_uc010cyz.2_Intron|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ACTAGAGTACttttttttttg	0.164			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			3	3	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59045928	59045928	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59045928delT	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyx.1_Intron|BCAS3_uc002iyy.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			agttgttgccttttttttttg	0.000													4	2	---	---	---	---	
ICAM2	3384	broad.mit.edu	37	17	62100492	62100492	+	5'Flank	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62100492delG	uc002jdw.3	-						ICAM2_uc010ded.2_5'Flank|ICAM2_uc002jdx.3_5'Flank|ICAM2_uc002jdv.3_5'Flank|ICAM2_uc010wpx.1_5'Flank	NM_001099788	NP_001093258	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor						cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						GTGGGAAGGAGGCAGCAGGGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12130201	12130202	+	IGR	INS	-	A	A	rs145398881	by1000genomes	TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12130201_12130202insA								IMPA2 (99325 upstream) : CIDEA (124116 downstream)																							AAAACAAAGGTAAAAAAATAAC	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35424264	35424264	+	IGR	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35424264delT								CELF4 (278264 upstream) : None (None downstream)																							GTCACCTGTCTTTTCTCAGAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44789420	44789420	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44789420delG								IER3IP1 (86675 upstream) : SMAD2 (570047 downstream)																							GAGCGGGGCTGGGGTTAAGGC	0.502													4	2	---	---	---	---	
DOT1L	84444	broad.mit.edu	37	19	2209229	2209230	+	Intron	DEL	TC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2209229_2209230delTC	uc002lvb.3	+						DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase							nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		caccATTCAAtctctctctctc	0.084													4	2	---	---	---	---	
ZNF556	80032	broad.mit.edu	37	19	2873789	2873789	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2873789delA	uc002lwp.1	+						ZNF556_uc002lwq.2_Intron	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttgtctctacaaaaaaaaaat	0.000													5	3	---	---	---	---	
GCDH	2639	broad.mit.edu	37	19	13004060	13004060	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13004060delA	uc002mvq.2	+						GCDH_uc010xms.1_Intron|GCDH_uc002mvp.2_Intron|GCDH_uc010xmt.1_Intron|GCDH_uc010xmu.1_Intron	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a						lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						ttctcaagtgatcctcttgcc	0.020													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15010823	15010823	+	IGR	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15010823delC								OR7A17 (18656 upstream) : OR7C2 (41478 downstream)																							AGACCTCCTTCCAGGGCCCTG	0.473													4	2	---	---	---	---	
GMIP	51291	broad.mit.edu	37	19	19744707	19744708	+	Frame_Shift_Ins	INS	-	A	A			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19744707_19744708insA	uc002nnd.2	-	19	2493_2494	c.2376_2377insT	c.(2374-2379)GACCCAfs	p.D792fs	GMIP_uc010xrb.1_Frame_Shift_Ins_p.D766fs|GMIP_uc010xrc.1_Frame_Shift_Ins_p.D763fs	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	792_793	Pro-rich.				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						tgggagtctgggtcaaggtgcg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28331726	28331726	+	IGR	DEL	T	-	-	rs36066596		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28331726delT								LOC148189 (46878 upstream) : None (None downstream)																							ttctttttccttttttttttt	0.318													4	2	---	---	---	---	
ZNF781	163115	broad.mit.edu	37	19	38161187	38161188	+	5'UTR	INS	-	GA	GA			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38161187_38161188insGA	uc002ogy.2	-	4					ZNF781_uc002ogz.2_5'UTR	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATAGAGTTTCTTTCCAGTATGA	0.332													4	3	---	---	---	---	
ZNF781	163115	broad.mit.edu	37	19	38161190	38161191	+	5'UTR	DEL	CC	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38161190_38161191delCC	uc002ogy.2	-	4					ZNF781_uc002ogz.2_5'UTR	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGTTTCTTTCCAGTATGAATT	0.332													4	3	---	---	---	---	
PIH1D1	55011	broad.mit.edu	37	19	49952403	49952403	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49952403delA	uc002pns.2	-						PIH1D1_uc010yap.1_Intron|PIH1D1_uc010yaq.1_3'UTR	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17						box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CCATCACaagaaaaaaaaaaa	0.264													3	3	---	---	---	---	
SIGLEC11	114132	broad.mit.edu	37	19	50462494	50462494	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50462494delA	uc010ybh.1	-						SIGLEC11_uc010ybi.1_Intron	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1						cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		GGGTCTACACAGGTAAGAAGG	0.597													9	5	---	---	---	---	
SUV420H2	84787	broad.mit.edu	37	19	55854809	55854809	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55854809delT	uc002qkj.3	+						SUV420H2_uc002qkl.2_Intron	NM_032701	NP_116090	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding				0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GTATCTGCTGTGTGCGTGCTG	0.632													4	2	---	---	---	---	
SUV420H2	84787	broad.mit.edu	37	19	55854813	55854813	+	Intron	DEL	C	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55854813delC	uc002qkj.3	+						SUV420H2_uc002qkl.2_Intron	NM_032701	NP_116090	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding				0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTGCTGTGTGCGTGCTGCCCT	0.622													4	2	---	---	---	---	
KIF16B	55614	broad.mit.edu	37	20	16254307	16254310	+	Intron	DEL	TCAA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16254307_16254310delTCAA	uc002wpg.1	-						KIF16B_uc002wpe.1_Intron|KIF16B_uc002wpf.1_Intron|KIF16B_uc010gch.1_Intron	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						agaccctgtctcaatcaatcaatc	0.127													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37698056	37698057	+	IGR	DEL	TG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37698056_37698057delTG								DHX35 (29693 upstream) : LOC339568 (144367 downstream)																							AATGCGCAGCtgtgtgtgtgtg	0.475													4	2	---	---	---	---	
C20orf108	116151	broad.mit.edu	37	20	54940559	54940562	+	Intron	DEL	TTTG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54940559_54940562delTTTG	uc002xxc.2	+							NM_080821	NP_543011	Q96KR6	CT108_HUMAN	hypothetical protein LOC116151							integral to membrane					0			Colorectal(105;0.202)			acccagctgatttgtttgtttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828415	9828417	+	IGR	DEL	ATG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828415_9828417delATG								None (None upstream) : None (None downstream)																							ctctagaggcatgatgggttaaa	0.123													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10130988	10130989	+	IGR	DEL	AT	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10130988_10130989delAT								None (None upstream) : TPTE (775754 downstream)																							AGTTAAAAACATAAAATCCAGT	0.386													2	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11073970	11073974	+	Intron	DEL	TGAAA	-	-	rs55860507		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11073970_11073974delTGAAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		atttataaactgaaataactgcttt	0.000													4	2	---	---	---	---	
URB1	9875	broad.mit.edu	37	21	33734519	33734520	+	Intron	INS	-	TT	TT	rs112343819		TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33734519_33734520insTT	uc002ypn.2	-							NM_014825	NP_055640	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog							nucleolus	protein binding				0						CTGCAGTATAAttttttttttt	0.257													4	2	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42198384	42198404	+	Intron	DEL	GGAGTCTCCAGTTGGAGACTG	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42198384_42198404delGGAGTCTCCAGTTGGAGACTG	uc011ape.1	+						LOC339674_uc003bba.1_Intron|CCDC134_uc003bbh.1_Intron|CCDC134_uc011apg.1_Intron	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						ttggagactaggagtctccagttggagactggtgactagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1369964	1369965	+	IGR	INS	-	GATA	GATA			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1369964_1369965insGATA								CRLF2 (38434 upstream) : CSF2RA (17728 downstream)																							aggtgatagatgataaacatat	0.020													4	2	---	---	---	---	
SYTL4	94121	broad.mit.edu	37	X	99934109	99934110	+	Intron	INS	-	T	T			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99934109_99934110insT	uc004egd.3	-						SYTL4_uc004egc.2_5'Flank|SYTL4_uc010nnb.2_Intron|SYTL4_uc010nnc.2_Intron|SYTL4_uc004ege.3_Intron|SYTL4_uc004egf.3_Intron	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCTGTCTGCAGCCCTCCTCTTT	0.436													9	4	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107455019	107455019	+	Intron	DEL	T	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107455019delT	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						ACTTACAGTCTTTTTAATTGC	0.408									Alport_syndrome_with_Diffuse_Leiomyomatosis				35	21	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133547284	133547284	+	Intron	DEL	A	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133547284delA	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AACCTATGGTAAAAAAAAATA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13445669	13445670	+	IGR	DEL	AA	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13445669_13445670delAA								None (None upstream) : None (None downstream)																							GATTCAAATGAAAAAAAAATCA	0.317													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28815671	28815671	+	IGR	DEL	G	-	-			TCGA-B0-4816-01A-01D-1501-10	TCGA-B0-4816-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28815671delG								None (None upstream) : None (None downstream)																							ggaatggaatggtatggaacg	0.000													5	3	---	---	---	---	
