Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11188177	11188177	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11188177T>A	uc001asd.2	-	43	6038	c.5917A>T	c.(5917-5919)ATC>TTC	p.I1973F	MTOR_uc001asc.2_Missense_Mutation_p.I178F	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1973	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						AGTGGGTAGATGAGGGCCTGA	0.463													21	100	---	---	---	---	PASS
SFRS11	9295	broad.mit.edu	37	1	70712550	70712550	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70712550A>G	uc001des.2	+	10	1106	c.982A>G	c.(982-984)AAA>GAA	p.K328E	SFRS11_uc001det.2_Missense_Mutation_p.K328E|SFRS11_uc001deu.2_Missense_Mutation_p.K328E|SFRS11_uc001dev.2_Missense_Mutation_p.K138E|SFRS11_uc001dew.2_Missense_Mutation_p.K268E	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	328	10 X 8 AA approximate repeats of R-R-S-R- S-R-S-R.|8.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						AACACCACCAAAAAGTTACAG	0.358													47	80	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713152	142713152	+	Intron	SNP	T	G	G	rs142135372	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713152T>G	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TGCTGTTCAATGCACGGATTT	0.368													3	109	---	---	---	---	PASS
APCS	325	broad.mit.edu	37	1	159557958	159557958	+	Silent	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159557958G>A	uc001ftv.2	+	2	228	c.132G>A	c.(130-132)CCG>CCA	p.P44P		NM_001639	NP_001630	P02743	SAMP_HUMAN	serum amyloid P component precursor	44	Pentaxin.				acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding			ovary(1)|breast(1)	2	all_hematologic(112;0.0429)					TGATCACACCGCTGGAGAAGC	0.443													57	119	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947421	237947421	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947421G>A	uc001hyl.1	+	90	12529	c.12409G>A	c.(12409-12411)GAA>AAA	p.E4137K	RYR2_uc010pya.1_Missense_Mutation_p.E552K	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4137					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGCCGCATCGAAATCATGGG	0.512													44	55	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247586613	247586613	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247586613A>G	uc001icr.2	+	4	503	c.365A>G	c.(364-366)GAG>GGG	p.E122G	NLRP3_uc001ics.2_Missense_Mutation_p.E122G|NLRP3_uc001icu.2_Missense_Mutation_p.E122G|NLRP3_uc001icw.2_Missense_Mutation_p.E122G|NLRP3_uc001icv.2_Missense_Mutation_p.E122G|NLRP3_uc010pyw.1_Missense_Mutation_p.E120G|NLRP3_uc001ict.1_Missense_Mutation_p.E120G	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	122					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGTTTACTGGAGTACCTTTCG	0.438													87	180	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179397153	179397153	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179397153G>A	uc010zfg.1	-	307	96709	c.96485C>T	c.(96484-96486)ACC>ATC	p.T32162I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T25857I|TTN_uc010zfi.1_Missense_Mutation_p.T25790I|TTN_uc010zfj.1_Missense_Mutation_p.T25665I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33089							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGTGATAGGTTGAATACCT	0.488													63	179	---	---	---	---	PASS
ZNF385B	151126	broad.mit.edu	37	2	180308134	180308134	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180308134G>C	uc002unn.3	-	10	1863	c.1259C>G	c.(1258-1260)CCT>CGT	p.P420R	ZNF385B_uc002unj.2_Missense_Mutation_p.P318R|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Missense_Mutation_p.P317R|ZNF385B_uc002unm.2_Missense_Mutation_p.P344R	NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	420						nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CGCTGCGAGAGGTGAGGACAG	0.597													4	9	---	---	---	---	PASS
CXCR2	3579	broad.mit.edu	37	2	218999602	218999602	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218999602C>A	uc002vgz.1	+	4	303	c.78C>A	c.(76-78)AGC>AGA	p.S26R	CXCR2_uc002vha.1_Missense_Mutation_p.S26R|CXCR2_uc002vhb.1_Missense_Mutation_p.S26R	NM_001557	NP_001548	P25025	CXCR2_HUMAN	interleukin 8 receptor beta	26	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity			lung(1)|breast(1)	2						ACAGTTACAGCTCTACCCTGC	0.408													5	214	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228173652	228173652	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228173652G>A	uc002vom.1	+	49	4662	c.4500G>A	c.(4498-4500)ATG>ATA	p.M1500I	COL4A3_uc002von.1_Missense_Mutation_p.M1500I|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron|uc002voq.1_Intron|uc002vor.1_Intron|COL4A3_uc010fxf.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	1500	Required for the anti-angiogenic activity of tumstatin.|Collagen IV NC1.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TTACCACAATGCCATTCTTAT	0.388													47	165	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51198060	51198060	+	Silent	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51198060C>T	uc011bds.1	+	12	987	c.964C>T	c.(964-966)CTA>TTA	p.L322L		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	322						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CTGTGCGGTCCTAAGCATCTT	0.468													11	32	---	---	---	---	PASS
CD200	4345	broad.mit.edu	37	3	112054820	112054820	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112054820C>T	uc003dyw.2	+	2	187	c.43C>T	c.(43-45)CTT>TTT	p.L15F	CD200_uc010hqd.1_Intron|CD200_uc003dyx.2_Intron|CD200_uc003dyy.2_Intron|CD200_uc003dyz.2_Intron	NM_001004196	NP_001004196	P41217	OX2G_HUMAN	CD200 antigen isoform b	Error:Variant_position_missing_in_P41217_after_alignment					regulation of immune response	integral to plasma membrane					0		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				GGGCCCTCTCCTTACAGCTAC	0.308													41	120	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186947662	186947662	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186947662G>A	uc003frh.1	-	11	1659	c.1327C>T	c.(1327-1329)CGG>TGG	p.R443W		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	443					complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ATCAGCTTCCGGGAGAACTTG	0.607													17	47	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7626320	7626320	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7626320C>T	uc003jdz.1	+	4	678	c.611C>T	c.(610-612)GCG>GTG	p.A204V		NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	204	Helical; (Potential).			VWQILANVIIFICGNLAGAY -> GLADPGQCDHFHLWEPG XTN (in Ref. 1; AAP97285).	activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GGGAACCTGGCGGGAGCCTAC	0.438													100	198	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131892948	131892948	+	5'UTR	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131892948C>A	uc003kxi.2	+	1					RAD50_uc003kxg.1_Intron|RAD50_uc003kxh.2_5'UTR	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCCGTGCACGCCTTGCTTCGG	0.592								Homologous_recombination					3	49	---	---	---	---	PASS
CDKN2AIPNL	91368	broad.mit.edu	37	5	133747411	133747411	+	Silent	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133747411C>A	uc011cxs.1	-	1	179	c.135G>T	c.(133-135)CTG>CTT	p.L45L	CDKN2AIPNL_uc003kzi.1_Silent_p.L45L	NM_080656	NP_542387	Q96HQ2	C2AIL_HUMAN	CDKN2A interacting protein N-terminal like	45											0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGGTGGCGCAGGATGAATT	0.657											OREG0016789	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	16	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140563511	140563511	+	Silent	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140563511C>T	uc003liv.2	+	1	2532	c.1377C>T	c.(1375-1377)TTC>TTT	p.F459F	PCDHB16_uc010jfw.1_Silent_p.F131F	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	459	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACACCCTGTTCGTCCGCGAGA	0.582													72	96	---	---	---	---	PASS
MRPS18B	28973	broad.mit.edu	37	6	30593435	30593435	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30593435T>C	uc003nqo.2	+	7	795	c.638T>C	c.(637-639)CTG>CCG	p.L213P	MRPS18B_uc011dml.1_3'UTR|MRPS18B_uc010jsd.1_Missense_Mutation_p.L170P|C6orf134_uc003nqr.3_5'Flank|C6orf134_uc003rdc.2_5'Flank|C6orf134_uc003nqs.3_5'Flank|C6orf134_uc003rdd.2_5'Flank|C6orf134_uc003nqu.2_5'Flank|C6orf134_uc003nqt.2_5'Flank|C6orf134_uc011dmm.1_5'Flank|C6orf134_uc003nqv.2_5'Flank	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor	213					translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						GAGAGAGAACTGTCTCGCCTT	0.607													56	118	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161530934	161530934	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161530934C>T	uc003qtn.2	+	23	4526	c.4384C>T	c.(4384-4386)CGT>TGT	p.R1462C	MAP3K4_uc010kkc.1_Missense_Mutation_p.R1458C|MAP3K4_uc003qto.2_Missense_Mutation_p.R1412C|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.R915C|MAP3K4_uc003qtp.2_Missense_Mutation_p.R398C|MAP3K4_uc003qtq.2_Missense_Mutation_p.R151C	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1462	Protein kinase.				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CATAGTCCACCGTGACATTAA	0.552													46	101	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17907964	17907964	+	Intron	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17907964C>T	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron|SNX13_uc003stx.1_3'UTR			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					ACCCTATCTCCCAACTATATT	0.249													7	14	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413896	72413896	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413896A>G	uc003twk.2	+	11	3364	c.3364A>G	c.(3364-3366)ACC>GCC	p.T1122A	POM121_uc003twj.2_Missense_Mutation_p.T857A|POM121_uc010lam.1_Missense_Mutation_p.T857A	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1122	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				AGGCTCCAGCACCACCACCGG	0.637													3	54	---	---	---	---	PASS
SMURF1	57154	broad.mit.edu	37	7	98639741	98639741	+	Silent	SNP	G	C	C	rs138664041		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98639741G>C	uc003upu.1	-	13	1769	c.1449C>G	c.(1447-1449)CCC>CCG	p.P483P	SMURF1_uc003upv.1_Silent_p.P457P|SMURF1_uc003upt.2_Silent_p.P457P	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform	483	HECT.				BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TCATACTTACGGGGTTGATTG	0.383													37	67	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678325	100678325	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678325C>T	uc003uxp.1	+	3	3681	c.3628C>T	c.(3628-3630)CCA>TCA	p.P1210S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1210	Extracellular (Potential).|Ser-rich.|18.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.512													6	465	---	---	---	---	PASS
ZNHIT1	10467	broad.mit.edu	37	7	100867049	100867049	+	Silent	SNP	A	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100867049A>T	uc003uye.2	+	4	861	c.369A>T	c.(367-369)CCA>CCT	p.P123P	ZNHIT1_uc003uyf.2_RNA	NM_006349	NP_006340	O43257	ZNHI1_HUMAN	zinc finger, HIT domain containing 1	123	HIT-type.						metal ion binding|protein binding			large_intestine(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					GTGGCTTCCCATCCCCCTACA	0.652													14	47	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150698930	150698930	+	Silent	SNP	G	A	A	rs61734203	byFrequency	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150698930G>A	uc003wif.2	+	13	1820	c.1524G>A	c.(1522-1524)TCG>TCA	p.S508S	NOS3_uc011kuy.1_Silent_p.S302S|NOS3_uc011kuz.1_Silent_p.S508S|NOS3_uc011kva.1_Silent_p.S508S|NOS3_uc011kvb.1_Silent_p.S508S	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	508	Calmodulin-binding (Potential).				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	TCTCCGCCTCGCTCATGGGCA	0.657													25	52	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35631934	35631934	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35631934G>A	uc003xjr.1	+	16	2924	c.2596G>A	c.(2596-2598)GAT>AAT	p.D866N	UNC5D_uc003xjs.1_Missense_Mutation_p.D861N|UNC5D_uc003xju.1_Missense_Mutation_p.D442N	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	866	Death.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGCTACATTTGATACCCCCAA	0.478													36	48	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145626349	145626349	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145626349C>A	uc003zcj.2	-	6	583	c.508G>T	c.(508-510)GCT>TCT	p.A170S	CPSF1_uc003zck.1_Missense_Mutation_p.A92S|CPSF1_uc011lle.1_Missense_Mutation_p.A170S|MIR1234_hsa-mir-1234|MI0006324_5'Flank|CPSF1_uc011llf.1_Missense_Mutation_p.A170S	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	170					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TGCTCCTCAGCCAGGCTCTCC	0.721													3	22	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138714184	138714184	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138714184C>A	uc004cgr.3	-	11	2323	c.2323G>T	c.(2323-2325)GAG>TAG	p.E775*	CAMSAP1_uc004cgq.3_Nonsense_Mutation_p.E665*|CAMSAP1_uc010nbg.2_Nonsense_Mutation_p.E497*	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	775						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TTCATGTCCTCCTGCAGTTTG	0.562													4	135	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12071445	12071445	+	Silent	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12071445G>A	uc001ila.2	-	2	918	c.444C>T	c.(442-444)AAC>AAT	p.N148N	UPF2_uc001ilb.2_Silent_p.N148N|UPF2_uc001ilc.2_Silent_p.N148N|UPF2_uc009xiz.1_Silent_p.N148N	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	148					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				GAGCATTTTGGTTTTTGCTAC	0.368													55	376	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96291127	96291127	+	Silent	SNP	A	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96291127A>G	uc001kjr.2	+	12	2354	c.2169A>G	c.(2167-2169)CTA>CTG	p.L723L		NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12	723						intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CACAGTTTCTAACTAAATTGC	0.383													82	167	---	---	---	---	PASS
SLK	9748	broad.mit.edu	37	10	105768006	105768006	+	Silent	SNP	G	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105768006G>T	uc001kxo.1	+	12	2710	c.2676G>T	c.(2674-2676)CTG>CTT	p.L892L	SLK_uc001kxp.1_Silent_p.L892L	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	892	Potential.|UVR.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCGAACGCCTGGAACAAGAGC	0.388													4	238	---	---	---	---	PASS
DHX32	55760	broad.mit.edu	37	10	127526903	127526903	+	Silent	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127526903C>T	uc001ljf.1	-	10	2426	c.1935G>A	c.(1933-1935)CAG>CAA	p.Q645Q	BCCIP_uc001ljd.3_Intron|DHX32_uc001lje.1_Silent_p.Q269Q|DHX32_uc001ljg.1_Silent_p.Q645Q|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	645						mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCTGAGCAACCTGCTTATGTG	0.403													15	221	---	---	---	---	PASS
UBQLNL	143630	broad.mit.edu	37	11	5537739	5537739	+	5'UTR	SNP	T	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5537739T>C	uc001maz.3	-	1					HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like											large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GGCAGACAAATGTTTCTGCTG	0.537													12	24	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82878246	82878246	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82878246T>C	uc001ozx.3	+	6	2242	c.1897T>C	c.(1897-1899)TCA>CCA	p.S633P	PCF11_uc010rsu.1_Missense_Mutation_p.S633P	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	633					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						AGGAATTTTATCACCTCGAGC	0.408													67	143	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													5	29	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47629507	47629507	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47629507G>A	uc001rpn.2	+	4	1392	c.661G>A	c.(661-663)GCG>ACG	p.A221T	FAM113B_uc010slj.1_Missense_Mutation_p.A101T|FAM113B_uc001rpq.2_Missense_Mutation_p.A221T	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	221							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					CTTCCGCCACGCGAGGGAGAA	0.597													10	12	---	---	---	---	PASS
CNOT2	4848	broad.mit.edu	37	12	70723321	70723321	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70723321G>T	uc001svv.2	+	5	936	c.357G>T	c.(355-357)ATG>ATT	p.M119I	CNOT2_uc009zro.2_Missense_Mutation_p.M119I|CNOT2_uc009zrp.2_Missense_Mutation_p.M99I|CNOT2_uc009zrq.2_Missense_Mutation_p.M119I	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	119					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TACCAACAATGTCACTTCACA	0.423													20	127	---	---	---	---	PASS
VPS29	51699	broad.mit.edu	37	12	110933957	110933957	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110933957G>A	uc001tqy.2	-	2	115	c.55C>T	c.(55-57)CCA>TCA	p.P19S	VPS29_uc001tqw.2_RNA|VPS29_uc001tqx.2_Missense_Mutation_p.P23S|VPS29_uc001tqz.2_RNA	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1	19					protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						AATTTAGCTGGCAAACTGTTG	0.403													4	164	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19409767	19409767	+	RNA	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19409767G>A	uc010tcj.1	-	1		c.36343C>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ACTTTCCAGTGGATTTACTGA	0.393													7	204	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61986058	61986058	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61986058G>A	uc001vid.3	-	2	2538	c.2174C>T	c.(2173-2175)ACA>ATA	p.T725I	PCDH20_uc010thj.1_Missense_Mutation_p.T725I	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	698	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GATTTTTGCTGTAGAGGAGAG	0.443													94	166	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24524822	24524822	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24524822C>T	uc001wlj.2	+	9	833	c.676C>T	c.(676-678)CGG>TGG	p.R226W		NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	226										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		CAAGGACTTGCGGCTGGTAGG	0.592													4	96	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47342716	47342716	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47342716A>C	uc001wwj.3	-	14	2661	c.2465T>G	c.(2464-2466)ATA>AGA	p.I822R	MDGA2_uc001wwh.3_Missense_Mutation_p.I24R|MDGA2_uc001wwi.3_Missense_Mutation_p.I593R|MDGA2_uc010ani.2_Missense_Mutation_p.I382R	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	822	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TTTGGGAGCTATGCTGAAAAC	0.383													7	293	---	---	---	---	PASS
FERMT2	10979	broad.mit.edu	37	14	53339598	53339598	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53339598T>A	uc001xad.2	-	10	1247	c.1192A>T	c.(1192-1194)ACC>TCC	p.T398S	FERMT2_uc001xac.2_Missense_Mutation_p.T398S|FERMT2_uc001xae.2_Missense_Mutation_p.T398S|FERMT2_uc001xaf.2_Missense_Mutation_p.T398S	NM_006832	NP_006823	Q96AC1	FERM2_HUMAN	fermitin family homolog 2 isoform 1	398	FERM.|PH.				actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding				0	Breast(41;0.0342)					TCTTTGAAGGTGCACCAATAT	0.408													48	127	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76964809	76964809	+	3'UTR	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76964809G>A	uc001xsq.1	+	7					ESRRB_uc001xsr.2_Intron|ESRRB_uc001xso.2_Intron	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TGATGGCCCCGCACACGGACC	0.587													3	33	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105409862	105409862	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105409862G>A	uc010axc.1	-	7	12046	c.11926C>T	c.(11926-11928)CCG>TCG	p.P3976S	AHNAK2_uc001ypx.2_Missense_Mutation_p.P3876S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3976						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGAACGACGGCATCTTGAAC	0.617													6	445	---	---	---	---	PASS
CYP11A1	1583	broad.mit.edu	37	15	74636237	74636237	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74636237A>G	uc002axt.2	-	4	877	c.722T>C	c.(721-723)TTC>TCC	p.F241S	CYP11A1_uc002axs.2_Missense_Mutation_p.F83S|CYP11A1_uc010bjm.1_Missense_Mutation_p.F83S|CYP11A1_uc010bjn.1_Intron|CYP11A1_uc010bjo.1_Missense_Mutation_p.F241S|CYP11A1_uc010bjp.1_RNA|CYP11A1_uc010ulj.1_Missense_Mutation_p.F21S	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	241					C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	GCTGGTGTGGAACATCTGGTA	0.562													54	98	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4405287	4405287	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4405287C>A	uc002cwh.3	-	27	2892	c.2772G>T	c.(2770-2772)TGG>TGT	p.W924C	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.W924C|CORO7_uc002cwg.3_Missense_Mutation_p.W704C|CORO7_uc010uxh.1_Missense_Mutation_p.W906C|CORO7_uc010uxi.1_Missense_Mutation_p.W839C	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	924						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CACTACTCACCCACTCGTCCT	0.657													22	31	---	---	---	---	PASS
KRTAP4-2	85291	broad.mit.edu	37	17	39334330	39334330	+	Silent	SNP	G	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39334330G>T	uc002hwd.2	-	1	131	c.87C>A	c.(85-87)ACC>ACA	p.T29T		NM_033062	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	29	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].|3.					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TCCTGCAGCAGGTGGTCTGGC	0.647													33	53	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38949888	38949888	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38949888G>A	uc002oit.2	+	19	2400	c.2270G>A	c.(2269-2271)CGC>CAC	p.R757H	RYR1_uc002oiu.2_Missense_Mutation_p.R757H	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	757	Cytoplasmic.|B30.2/SPRY 1.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ATCTCCTTCCGCATCAACGGC	0.612													8	43	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42260723	42260723	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42260723G>A	uc002orm.2	+	2	429	c.280G>A	c.(280-282)GCA>ACA	p.A94T		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	94	Ig-like V-type.				cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		CCCAGGGCCCGCATACAGTGG	0.463													5	409	---	---	---	---	PASS
ZNF628	89887	broad.mit.edu	37	19	55994427	55994427	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55994427A>C	uc002qld.2	+	3	2420	c.1855A>C	c.(1855-1857)ACC>CCC	p.T619P	NAT14_uc002qle.1_5'Flank	NM_033113	NP_149104	Q5EBL2	ZN628_HUMAN	zinc finger protein 628	619	C2H2-type 16.					nucleus	DNA binding|zinc ion binding				0	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GCGCCCCTTCACCTGCCCCAT	0.711													7	16	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	G	G			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385762C>G	uc002qqo.2	-	3	1268	c.996G>C	c.(994-996)TCG>TCC	p.S332S	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ATTTGCTAAACGATTTCCCAC	0.358													6	17	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17462428	17462428	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17462428G>A	uc002wpm.2	+	12	1950	c.1630G>A	c.(1630-1632)GAC>AAC	p.D544N	PCSK2_uc002wpl.2_Missense_Mutation_p.D525N|PCSK2_uc010zrm.1_Missense_Mutation_p.D509N|PCSK2_uc002wpn.2_Missense_Mutation_p.D198N	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	544					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAGGGATGACGACTCCAAGGT	0.577													26	50	---	---	---	---	PASS
C20orf4	25980	broad.mit.edu	37	20	34828315	34828315	+	Silent	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34828315G>A	uc002xfc.1	+	2	618	c.525G>A	c.(523-525)GGG>GGA	p.G175G	C20orf4_uc002xfd.1_Silent_p.G175G|C20orf4_uc002xfe.1_Silent_p.G175G	NM_015511	NP_056326	Q9Y312	CT004_HUMAN	hypothetical protein LOC25980	175											0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)				ACCGCGTGGGGCAGAATCTAC	0.577													4	151	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32445972	32445972	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32445972C>A	uc003amc.2	+	2	410	c.178C>A	c.(178-180)CTG>ATG	p.L60M		NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	60	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						AGGCTTCTTCCTGGCAGGCCG	0.453													7	442	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56310908	56310908	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56310908G>A	uc004dur.2	+	6	2007	c.1061G>A	c.(1060-1062)CGT>CAT	p.R354H	KLF8_uc011mop.1_3'UTR|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	354	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGCATCGCCGTCGCCATGAC	0.547													5	18	---	---	---	---	PASS
DFFA	1676	broad.mit.edu	37	1	10527571	10527572	+	Intron	INS	-	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10527571_10527572insT	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		CTCttctttcattttttttttt	0.188													8	5	---	---	---	---	
ARHGEF19	128272	broad.mit.edu	37	1	16528470	16528483	+	Intron	DEL	CCTACCCTAGGGAC	-	-	rs58225172		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16528470_16528483delCCTACCCTAGGGAC	uc001ayc.1	-						ARHGEF19_uc009voo.1_Intron|ARHGEF19_uc001ayb.1_Intron	NM_153213	NP_694945	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AGGACCCAGGCCTACCCTAGGGACCCATGTCTGC	0.621													4	5	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17299014	17299014	+	3'UTR	DEL	A	-	-	rs6661019	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17299014delA	uc001azt.2	+	37					CROCC_uc001azu.2_3'UTR|CROCC_uc001azv.2_3'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGCCCCCCCACCCAGAGCCC	0.672													4	5	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186959	26186960	+	5'Flank	INS	-	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186959_26186960insT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AAATTTTGTAATTTTTTTTTTT	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128160	31128161	+	IGR	INS	-	GGTGAC	GGTGAC			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128160_31128161insGGTGAC								None (None upstream) : MATN1 (55965 downstream)																							gtggtggtggtggtggtggtgg	0.000													5	3	---	---	---	---	
NEGR1	257194	broad.mit.edu	37	1	72342269	72342272	+	Intron	DEL	AAGG	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72342269_72342272delAAGG	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		ggagggaggcaaggaaggaaggaa	0.142													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222641941	222641942	+	IGR	INS	-	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222641941_222641942insC								DUSP10 (726480 upstream) : HHIPL2 (53660 downstream)																							GTCCCTCAGTGCCTGCGCAAGG	0.545													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242995203	242995204	+	IGR	INS	-	GAAA	GAAA	rs10926878	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242995203_242995204insGAAA								PLD5 (307205 upstream) : CEP170 (292527 downstream)																							aaggaaggaaggaaggaaggag	0.000													3	4	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86682418	86682418	+	Intron	DEL	T	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86682418delT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						TTCTTttttcttttttttttt	0.179													6	4	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113596301	113596304	+	5'Flank	DEL	TTTC	-	-	rs10560590		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113596301_113596304delTTTC	uc002tii.1	-							NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	tttcttttcttttctttctttctt	0.103													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134405166	134405167	+	IGR	DEL	GA	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134405166_134405167delGA								NCKAP5 (79135 upstream) : MGAT5 (606663 downstream)																							tatagagagggagagagagaga	0.000													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124066218	124066219	+	Intron	INS	-	TG	TG	rs148085083	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124066218_124066219insTG	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AGGTGAGAAGCtgtgtgtgtgt	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156978684	156978688	+	IGR	DEL	TTTTA	-	-	rs71740874		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156978684_156978688delTTTTA								CCNL1 (100202 upstream) : VEPH1 (10 downstream)																							CTGTAGCTCCTTTTATTTTATTTTA	0.361													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163031433	163031436	+	IGR	DEL	CTTC	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163031433_163031436delCTTC								None (None upstream) : MIR1263 (857823 downstream)																							tccctcccatcttccttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164525334	164525337	+	IGR	DEL	AGGG	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164525334_164525337delAGGG								MIR720 (466096 upstream) : SI (171350 downstream)																							aagaaaaggaagggagggagggag	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099753	49099757	+	IGR	DEL	GTCCA	-	-	rs62293900		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099753_49099757delGTCCA								CWH43 (35660 upstream) : None (None downstream)																							ttccgttccggtccattccattcca	0.000													1	9	---	---	---	---	
ACCN5	51802	broad.mit.edu	37	4	156758139	156758150	+	Intron	DEL	ACTCTGAAACAA	-	-	rs35429748		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156758139_156758150delACTCTGAAACAA	uc003ipe.1	-							NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,							integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		AATGGTGTTTACTCTGAAACAAATATGTTACT	0.316													5	4	---	---	---	---	
RWDD4A	201965	broad.mit.edu	37	4	184576826	184576828	+	Intron	DEL	AAC	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184576826_184576828delAAC	uc003ivt.1	-						RWDD4A_uc003ivu.1_Intron|RWDD4A_uc003ivv.1_Intron|RWDD4A_uc011ckl.1_Intron	NM_152682	NP_689895	Q6NW29	RWDD4_HUMAN	RWD domain containing 4A												0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;7.35e-27)|Epithelial(43;1.49e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.76e-10)|GBM - Glioblastoma multiforme(59;5.54e-06)|Colorectal(24;7.92e-06)|STAD - Stomach adenocarcinoma(60;2.35e-05)|COAD - Colon adenocarcinoma(29;6.26e-05)|LUSC - Lung squamous cell carcinoma(40;0.00935)|READ - Rectum adenocarcinoma(43;0.166)		GTACAATAAAAACAAGTTTATCT	0.187													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	106085763	106085766	+	IGR	DEL	GAAG	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106085763_106085766delGAAG								None (None upstream) : EFNA5 (626825 downstream)																							taaaaagacagaaggaaggaagga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124187225	124187228	+	IGR	DEL	CTTT	-	-	rs111256114		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124187225_124187228delCTTT								ZNF608 (102725 upstream) : None (None downstream)																							tccttccttcctttcttccttcct	0.029													5	4	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130781980	130781981	+	Intron	INS	-	T	T	rs138678438	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130781980_130781981insT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc003kvm.1_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTATCCCTCTATTTTTTGGATA	0.337													3	4	---	---	---	---	
SH3RF2	153769	broad.mit.edu	37	5	145343835	145343836	+	Intron	INS	-	TTCC	TTCC			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145343835_145343836insTTCC	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			tttcccttcttttccttccttc	0.000													3	3	---	---	---	---	
CAMK2A	815	broad.mit.edu	37	5	149624902	149624922	+	Intron	DEL	CCTCCTCCTCCTCCTCCTCCT	-	-	rs3834260		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149624902_149624922delCCTCCTCCTCCTCCTCCTCCT	uc003lru.2	-						CAMK2A_uc003lrs.2_5'Flank|CAMK2A_uc003lrt.2_Intron|CAMK2A_uc010jhe.2_Intron	NM_171825	NP_741960	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGGGGAGGcctcctcctcctcctcctcctcctcctcctc	0.543													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179513203	179513203	+	IGR	DEL	T	-	-	rs146020552		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179513203delT								RNF130 (14094 upstream) : RASGEF1C (14593 downstream)																							AAGAGATTAGttttttttttt	0.209													5	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38952247	38952248	+	Intron	DEL	CA	-	-	rs34819199		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38952247_38952248delCA	uc003ooe.1	+						DNAH8_uc003oog.1_3'UTR	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						cacacacatgcacacacacaca	0.203													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	105890861	105890862	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105890861_105890862insTTCCTTCCTTCC								PREP (39892 upstream) : PRDM1 (643333 downstream)																							CAGTTGTCTTTttccttccttc	0.203													5	3	---	---	---	---	
TPD52L1	7164	broad.mit.edu	37	6	125493270	125493271	+	Intron	INS	-	T	T			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125493270_125493271insT	uc003pzu.1	+						TPD52L1_uc003pzv.1_Intron|TPD52L1_uc003pzw.1_Intron|TPD52L1_uc003pzx.1_Intron|TPD52L1_uc003pzy.1_Intron	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		ttctttctttctttctttcttt	0.020													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	131704862	131704862	+	IGR	DEL	G	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131704862delG								AKAP7 (100189 upstream) : ARG1 (189503 downstream)																							aaggaaggaaggaaggaagga	0.154													8	4	---	---	---	---	
TMEM130	222865	broad.mit.edu	37	7	98457692	98457692	+	Intron	DEL	A	-	-	rs67317732		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98457692delA	uc003upo.2	-						TMEM130_uc011kiq.1_Intron|TMEM130_uc011kir.1_Intron|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			actgcatctcaaaaaaaaaaa	0.249													2	4	---	---	---	---	
ZNF800	168850	broad.mit.edu	37	7	127026341	127026342	+	Intron	DEL	CG	-	-	rs6962137	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127026341_127026342delCG	uc003vlx.1	-						ZNF800_uc003vlw.1_5'Flank|ZNF800_uc003vly.1_Intron|ZNF800_uc010lla.2_Intron	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CACACACACACGCATATATAAT	0.287													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141479343	141479343	+	IGR	DEL	T	-	-	rs3840580		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141479343delT								TAS2R4 (155 upstream) : TAS2R5 (10674 downstream)																							CATTCTGTAATTTTTTTTTTT	0.338													4	3	---	---	---	---	
TRPV6	55503	broad.mit.edu	37	7	142571007	142571007	+	Intron	DEL	T	-	-	rs4987673		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142571007delT	uc003wbx.1	-						TRPV6_uc003wbw.1_Intron|TRPV6_uc010lou.1_Intron	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,						regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CTGTGAGGCATTCTTCTCAGC	0.368													6	5	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9732116	9732117	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs145244640	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9732116_9732117insGAAGGAAG								TNKS (92261 upstream) : LOC157627 (25457 downstream)																							aaaaaaaGTGAGaaggaaggaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	102061588	102061590	+	IGR	DEL	TTT	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102061588_102061590delTTT								YWHAZ (95965 upstream) : ZNF706 (147678 downstream)																							cctttctttctttttctttcttt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109140114	109140133	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGG	-	-	rs71947791	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109140114_109140133delAAGGAAGGAAGGAAGGAAGG								RSPO2 (44201 upstream) : EIF3E (73840 downstream)																							ggagggaagaaaggaaggaaggaaggaaggaaggaaggaa	0.014													4	4	---	---	---	---	
CPSF1	29894	broad.mit.edu	37	8	145623566	145623567	+	Intron	INS	-	C	C			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145623566_145623567insC	uc003zcj.2	-							NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,						mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GGGCCCAACCACCCCCCCACCT	0.703													6	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27367840	27367840	+	Intron	DEL	A	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27367840delA	uc001ith.2	-						ANKRD26_uc001itg.2_Intron|ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTACCAAAGTAAAAAAAAAAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	59940131	59940144	+	IGR	DEL	CTCCCTCTCTCTCT	-	-	rs140879198	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59940131_59940144delCTCCCTCTCTCTCT								None (None upstream) : IPMK (15474 downstream)																							tccttccttcctccctctctctctcttccttcct	0.121													4	2	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93695681	93695681	+	Intron	DEL	T	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695681delT	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				AGACTTAAACTTTTTTTTTTT	0.279													4	2	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112340975	112340975	+	Intron	DEL	T	-	-	rs67616631		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112340975delT	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCACACTGACttttttttttt	0.149													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133145257	133145260	+	IGR	DEL	TCCT	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133145257_133145260delTCCT								TCERG1L (35273 upstream) : PPP2R2D (602700 downstream)																							cttccttctctccttccttcctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68412080	68412081	+	IGR	INS	-	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412080_68412081insA								SAPS3 (29281 upstream) : GAL (39902 downstream)																							aggaaggaaagaaggaaggaag	0.000													4	2	---	---	---	---	
SDHD	6392	broad.mit.edu	37	11	111958933	111958933	+	Intron	DEL	T	-	-	rs113282959		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111958933delT	uc001pmz.2	+						TIMM8B_uc001pmx.2_5'Flank|TIMM8B_uc001pmy.2_5'Flank	NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	ttttgttttctttttttttga	0.159			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				4	3	---	---	---	---	
RAP1B	5908	broad.mit.edu	37	12	69050390	69050393	+	Intron	DEL	AAAC	-	-	rs143766063		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69050390_69050393delAAAC	uc001sub.2	+						RAP1B_uc010ste.1_Intron|RAP1B_uc001suc.2_Intron|RAP1B_uc010stf.1_Intron|RAP1B_uc010stg.1_Intron|RAP1B_uc010sth.1_Intron|RAP1B_uc010sti.1_Intron	NM_001089704	NP_001083173	P61224	RAP1B_HUMAN	SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;						blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		TGTAGTAAATAAACAATACTATTT	0.299													6	3	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94675906	94675910	+	Intron	DEL	AAAGT	-	-	rs2307570		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94675906_94675910delAAAGT	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_Intron	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						ACAAACAAACAAAGTAAAACAGAAC	0.376													6	5	---	---	---	---	
UHRF1BP1L	23074	broad.mit.edu	37	12	100464068	100464069	+	Intron	INS	-	TT	TT			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100464068_100464069insTT	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron|UHRF1BP1L_uc001tgp.2_Intron	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						taattaattaattttttttttt	0.124													4	2	---	---	---	---	
C12orf24	29902	broad.mit.edu	37	12	110910781	110910788	+	Intron	DEL	AAAAAAAA	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110910781_110910788delAAAAAAAA	uc001tqu.3	+						C12orf24_uc010sxz.1_Intron|C12orf24_uc009zvo.2_Intron|C12orf24_uc001tqt.2_Intron|C12orf24_uc001tqv.3_Intron	NM_013300	NP_037432	Q8WUB2	CL024_HUMAN	hypothetical protein LOC29902												0						accctgtctcaaaaaaaaaaaaaaaaaa	0.091													4	2	---	---	---	---	
MAPKAPK5	8550	broad.mit.edu	37	12	112321187	112321188	+	Intron	INS	-	A	A			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112321187_112321188insA	uc001tta.2	+						MAPKAPK5_uc001tsz.2_Intron|MAPKAPK5_uc001ttb.2_Intron	NM_139078	NP_620777	Q8IW41	MAPK5_HUMAN	MAP kinase-activated protein kinase 5 isoform 2						signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)	3						ctgtctcaaagaaaaaaaaaga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64499762	64499762	+	IGR	DEL	C	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64499762delC								OR7E156P (183061 upstream) : None (None downstream)																							ttccttccttccttccttcct	0.075													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTTTTTTCTTAAAAAAAAAAAA	0.485													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850459	112850460	+	IGR	INS	-	TTCC	TTCC	rs143336831	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850459_112850460insTTCC								SOX1 (124439 upstream) : C13orf28 (180209 downstream)																							tccttccttttttccttcctcc	0.000													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78781335	78781338	+	Intron	DEL	TCTT	-	-	rs10551573		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78781335_78781338delTCTT	uc001xum.1	+									Q9Y4C0	NRX3A_HUMAN	Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ccttcctttctctttctttctttc	0.000													4	2	---	---	---	---	
SLC24A1	9187	broad.mit.edu	37	15	65931908	65931909	+	Intron	INS	-	CTGAGGC	CTGAGGC	rs148083690	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65931908_65931909insCTGAGGC	uc010ujf.1	+						SLC24A1_uc010ujd.1_Intron|SLC24A1_uc010uje.1_Intron|SLC24A1_uc010ujg.1_Intron|SLC24A1_uc010ujh.1_Intron	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24						response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						ACAGGGGCCCACTGTGCGGCTC	0.584													4	2	---	---	---	---	
KLHL25	64410	broad.mit.edu	37	15	86314432	86314433	+	Intron	INS	-	A	A	rs55642980		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86314432_86314433insA	uc002bly.2	-						MIR1276_hsa-mir-1276|MI0006416_5'Flank	NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein							cytoplasm				ovary(2)	2						AATTAAGCCTGaaaaaaaaaaa	0.406													4	4	---	---	---	---	
TTLL13	440307	broad.mit.edu	37	15	90799859	90799874	+	Intron	DEL	TTCCTTCCTTCCTTCT	-	-	rs66679154		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90799859_90799874delTTCCTTCCTTCCTTCT	uc002bpd.1	+						TTLL13_uc002bpe.1_Intron	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			ccttccttccttccttccttccttctttctttctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1136181	1136182	+	IGR	DEL	TG	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1136181_1136182delTG								SSTR5 (6039 upstream) : C1QTNF8 (2044 downstream)																							TGGTGGTGGTTGTGTGTGTGTG	0.124													5	3	---	---	---	---	
E4F1	1877	broad.mit.edu	37	16	2279365	2279366	+	Intron	INS	-	G	G	rs148612482	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2279365_2279366insG	uc002cpm.2	+						E4F1_uc010bsi.2_Intron|E4F1_uc010bsj.2_Intron	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F						cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						GACCCTGGCCCGGGGGTGAAGG	0.683													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15251603	15251608	+	IGR	DEL	CACTCT	-	-	rs111269757		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15251603_15251608delCACTCT								PDXDC1 (18408 upstream) : MPV17L (238003 downstream)																							CGCGcacacacactctcacacacaca	0.393													3	3	---	---	---	---	
MT1X	4501	broad.mit.edu	37	16	56717624	56717624	+	Intron	DEL	G	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56717624delG	uc002ejy.2	+						MT1X_uc002ejz.2_Intron	NM_005952	NP_005943	P80297	MT1X_HUMAN	metallothionein 1X						response to metal ion		metal ion binding				0						GCCTCCTTTTGTTCCTGTACC	0.522													4	2	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82837917	82837918	+	Intron	INS	-	ACAT	ACAT	rs2318183	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82837917_82837918insACAT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		cacacacacacgcacacacata	0.000													4	2	---	---	---	---	
NCRNA00188	125144	broad.mit.edu	37	17	16344166	16344167	+	Intron	INS	-	A	A	rs79350206		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16344166_16344167insA	uc002gqc.2	+						NCRNA00188_uc010vwf.1_Intron|NCRNA00188_uc010vwg.1_Intron|NCRNA00188_uc010vwh.1_Intron|NCRNA00188_uc010cpd.2_Intron|NCRNA00188_uc002gqb.3_Intron|NCRNA00188_uc010vwi.1_Intron|NCRNA00188_uc010vwj.1_Intron|NCRNA00188_uc002gqa.3_Intron|NCRNA00188_uc010vwk.1_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|SNORD65_uc002gqf.1_5'Flank	NR_027667				RecName: Full=Putative uncharacterized protein C17orf45, mitochondrial; Flags: Precursor;												0						gactccatctcaaaaaaaaaaa	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													3	3	---	---	---	---	
DHRS13	147015	broad.mit.edu	37	17	27230748	27230749	+	5'Flank	INS	-	CCTT	CCTT	rs145493498	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27230748_27230749insCCTT	uc002hde.3	-						DHRS13_uc002hdd.3_5'Flank|DHRS13_uc010wba.1_5'Flank	NM_144683	NP_653284	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13							extracellular region	binding|oxidoreductase activity				0	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			cttccttccttccttccttccc	0.045													3	3	---	---	---	---	
EFCAB5	374786	broad.mit.edu	37	17	28320516	28320516	+	Intron	DEL	A	-	-	rs78216599		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28320516delA	uc002het.2	+						EFCAB5_uc010wbi.1_Intron|EFCAB5_uc010wbj.1_Intron|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_Intron|EFCAB5_uc010cse.2_Intron|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a								calcium ion binding			ovary(1)|skin(1)	2						GAGCATTACCAAAAAAAAAAA	0.343													4	2	---	---	---	---	
SMARCD2	6603	broad.mit.edu	37	17	61913095	61913095	+	Intron	DEL	T	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61913095delT	uc010deb.1	-						SMARCD2_uc010wpt.1_Intron|SMARCD2_uc010dea.1_Intron|SMARCD2_uc010dec.1_Intron	NM_001098426	NP_001091896	Q92925	SMRD2_HUMAN	SWI/SNF-related matrix-associated						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity				0						agtcccagccttttttttttt	0.020													6	3	---	---	---	---	
ZADH2	284273	broad.mit.edu	37	18	72913186	72913186	+	3'UTR	DEL	T	-	-	rs67264905		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72913186delT	uc002llx.2	-	2					ZADH2_uc010dqv.2_3'UTR	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain							peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		TATTAGCACATTTTTTTTTTT	0.303													4	2	---	---	---	---	
RBCK1	10616	broad.mit.edu	37	20	409871	409871	+	Intron	DEL	T	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:409871delT	uc002wdp.3	+						RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_Intron|RBCK1_uc002wdr.3_Intron	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				gaggtaagaattttttttttt	0.075													10	5	---	---	---	---	
TASP1	55617	broad.mit.edu	37	20	13568964	13568965	+	Intron	INS	-	AAGG	AAGG	rs147823593	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13568964_13568965insAAGG	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron|TASP1_uc010zrj.1_Intron	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						aagagaaagaaaaggaaggaag	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52557957	52557958	+	IGR	DEL	GC	-	-	rs67132379		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52557957_52557958delGC								SUMO1P1 (65709 upstream) : BCAS1 (2121 downstream)																							gtgtgtgtgtgcgcgtgtgtgt	0.396													3	3	---	---	---	---	
PTK6	5753	broad.mit.edu	37	20	62164170	62164170	+	Intron	DEL	C	-	-	rs142590975		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62164170delC	uc002yfg.2	-						PTK6_uc011aay.1_Intron|PTK6_uc011aaz.1_5'UTR	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6							cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)			AGACCTCCTGCCCCCGACAGG	0.706													4	3	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26344452	26344453	+	Intron	INS	-	TT	TT	rs5752247		TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26344452_26344453insTT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ttctttctttctctttctttct	0.010													4	3	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30073959	30073960	+	Intron	INS	-	TGAGGGA	TGAGGGA	rs150466339	by1000genomes	TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30073959_30073960insTGAGGGA	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron|NF2_uc011akq.1_Intron	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GGTTAGAGATTTGAGGGATGAT	0.361			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				5	5	---	---	---	---	
HPRT1	3251	broad.mit.edu	37	X	133609078	133609078	+	Intron	DEL	T	-	-			TCGA-B0-5100-01A-01D-1421-08	TCGA-B0-5100-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133609078delT	uc004exl.3	+						HPRT1_uc010nrs.2_Intron	NM_000194	NP_000185	P00492	HPRT_HUMAN	hypoxanthine phosphoribosyltransferase 1						adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP catabolic process|GMP salvage|grooming behavior|guanine salvage|hypoxanthine salvage|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|protein homotetramerization|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	guanine phosphoribosyltransferase activity|hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity				0	Acute lymphoblastic leukemia(192;0.000127)				Mercaptopurine(DB01033)|Thioguanine(DB00352)	gcctggctaattttttttttt	0.060													7	4	---	---	---	---	
