Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DNAJC16	23341	broad.mit.edu	37	1	15888681	15888681	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15888681A>C	uc001aws.2	+	9	1319	c.1199A>C	c.(1198-1200)AAA>ACA	p.K400T	DNAJC16_uc001awr.1_Missense_Mutation_p.K400T|DNAJC16_uc001awt.2_Missense_Mutation_p.K88T|DNAJC16_uc001awu.2_RNA	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	400	Cytoplasmic (Potential).				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AAGTTGAGCAAACCCTTTGAG	0.483													13	329	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16890431	16890431	+	3'UTR	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16890431G>A	uc009vos.1	-	31					uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GGCTTAGTAAGGGCTGCTTAC	0.478													26	849	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976709	16976709	+	RNA	SNP	C	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976709C>G	uc010och.1	+	14		c.2430C>G			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						ACTGGATTCACAAGGTCATGA	0.483													4	87	---	---	---	---	PASS
RUNX3	864	broad.mit.edu	37	1	25256117	25256117	+	Silent	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25256117C>A	uc001bjq.2	-	1	654	c.243G>T	c.(241-243)TCG>TCT	p.S81S	RUNX3_uc010oen.1_Silent_p.S81S|RUNX3_uc009vrj.2_Silent_p.S95S|RUNX3_uc001bjr.2_Silent_p.S95S|RUNX3_uc009vrk.2_Silent_p.S95S|RUNX3_uc009vrl.1_Silent_p.S95S	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	81	Runt.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		AGCGCCAGTGCGAGGGCAGCA	0.692													4	13	---	---	---	---	PASS
C1orf52	148423	broad.mit.edu	37	1	85725279	85725279	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85725279G>A	uc001dkv.2	-	1	77	c.38C>T	c.(37-39)GCG>GTG	p.A13V	C1orf52_uc001dkw.2_RNA|C1orf52_uc001dkx.3_RNA|C1orf52_uc009wcn.2_Missense_Mutation_p.A13V	NM_198077	NP_932343	Q8N6N3	CA052_HUMAN	hypothetical protein LOC148423	13										ovary(1)	1				all cancers(265;0.0105)|Epithelial(280;0.0293)		CCCGTATGCCGCAAAATAGCT	0.652											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	12	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155256981	155256981	+	Silent	SNP	A	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155256981A>C	uc001fjz.1	+	7	1503	c.1495A>C	c.(1495-1497)AGG>CGG	p.R499R	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Silent_p.R194R	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	499	Cytoplasmic (Potential).|cAMP.					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCTGCTAACTAGGGGCCGGCG	0.567													13	44	---	---	---	---	PASS
PTGS2	5743	broad.mit.edu	37	1	186646956	186646956	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186646956T>G	uc001gsb.2	-	5	601	c.464A>C	c.(463-465)AAG>ACG	p.K155T	PTGS2_uc009wyo.2_Intron	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor	155					cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	AGGAAGCTGCTTTTTACCTGA	0.368													6	77	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196642129	196642129	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196642129G>T	uc001gtj.3	+	2	320	c.80G>T	c.(79-81)AGA>ATA	p.R27I	CFH_uc001gti.3_Missense_Mutation_p.R27I|CFH_uc009wyw.2_Missense_Mutation_p.R27I|CFH_uc009wyx.2_Missense_Mutation_p.R27I	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	27	Sushi 1.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						CTTCCTCCAAGAAGAAATACA	0.353													13	71	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196642130	196642130	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196642130A>T	uc001gtj.3	+	2	321	c.81A>T	c.(79-81)AGA>AGT	p.R27S	CFH_uc001gti.3_Missense_Mutation_p.R27S|CFH_uc009wyw.2_Missense_Mutation_p.R27S|CFH_uc009wyx.2_Missense_Mutation_p.R27S	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	27	Sushi 1.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						TTCCTCCAAGAAGAAATACAG	0.353													13	73	---	---	---	---	PASS
NCAPH	23397	broad.mit.edu	37	2	97024978	97024978	+	Intron	SNP	A	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97024978A>C	uc002svz.1	+						NCAPH_uc010fhu.1_3'UTR|NCAPH_uc010fhv.1_Intron|NCAPH_uc010yum.1_Intron|NCAPH_uc010fhw.1_Intron|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				AGTGTAGATGACCAGCCAGTC	0.498													10	26	---	---	---	---	PASS
PTPN18	26469	broad.mit.edu	37	2	131128788	131128788	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131128788A>G	uc002trc.2	+	12	1042	c.941A>G	c.(940-942)TAC>TGC	p.Y314C	PTPN18_uc002trd.2_Missense_Mutation_p.Y293C|PTPN18_uc002trb.2_Missense_Mutation_p.Y207C|PTPN18_uc002tre.2_5'Flank	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	314						cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					GCCCCACTCTACGACGATGCC	0.617													8	58	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138414712	138414712	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138414712G>T	uc002tva.1	+	23	4270	c.4270G>T	c.(4270-4272)GAT>TAT	p.D1424Y	THSD7B_uc010zbj.1_RNA	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCAGCGTTCAGATGGCGTTAA	0.403													10	65	---	---	---	---	PASS
ERMN	57471	broad.mit.edu	37	2	158184074	158184074	+	5'Flank	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158184074C>A	uc002tzh.2	-						ERMN_uc010zcj.1_5'Flank|ERMN_uc010zck.1_5'Flank|ERMN_uc002tzi.2_5'UTR	NM_020711	NP_065762	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein isoform b							cytoplasm|cytoskeleton				ovary(1)|skin(1)	2						aggagttcagctagtaaggtc	0.199											OREG0015023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	24	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170163814	170163814	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170163814T>C	uc002ues.2	-	4	617	c.404A>G	c.(403-405)GAT>GGT	p.D135G	LRP2_uc010zdf.1_Missense_Mutation_p.D135G	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	135	Extracellular (Potential).|LDL-receptor class A 3.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATCAGCTCCATCGGGGCAGTC	0.448													36	108	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188196	10188196	+	Splice_Site	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188196A>T	uc003bvc.2	+	2	554	c.341_splice	c.e2-2	p.G114_splice	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(8)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTGTCCCGATAGGTCACCTTT	0.333		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				53	155	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11340248	11340248	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11340248T>A	uc003bwc.2	+	2	196	c.79T>A	c.(79-81)TGG>AGG	p.W27R	ATG7_uc003bwd.2_Missense_Mutation_p.W27R|ATG7_uc011aum.1_Missense_Mutation_p.W27R	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	27					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TGTTGGGTTTTGGCATGAGTT	0.448													6	198	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47129722	47129722	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47129722C>A	uc003cqs.2	-	10	5211	c.5158G>T	c.(5158-5160)GAA>TAA	p.E1720*	SETD2_uc003cqv.2_Nonsense_Mutation_p.E1787*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1720					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCAGAGCTTCTAGCTCTCCA	0.343			N|F|S|Mis		clear cell renal carcinoma								21	109	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119135033	119135033	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119135033G>C	uc003ecj.3	+	12	4789	c.4257G>C	c.(4255-4257)GAG>GAC	p.E1419D		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1419					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						AGAGACTAGAGACCTCAACCA	0.473													6	94	---	---	---	---	PASS
HES1	3280	broad.mit.edu	37	3	193854202	193854202	+	Silent	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193854202G>A	uc003ftq.1	+	1	269	c.33G>A	c.(31-33)TCG>TCA	p.S11S	HES1_uc011bst.1_Silent_p.S11S	NM_005524	NP_005515	Q14469	HES1_HUMAN	hairy and enhancer of split 1	11					endocrine pancreas development|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway	nucleus	histone deacetylase binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)	2	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		AAAATTCCTCGTCCCCGGTGG	0.403													10	29	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													2	10	---	---	---	---	PASS
TM4SF19	116211	broad.mit.edu	37	3	196053866	196053866	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196053866C>T	uc003fwl.1	-	3	364	c.239G>A	c.(238-240)TGG>TAG	p.W80*	TM4SF19_uc003fwj.2_RNA|TM4SF19_uc010iad.1_Nonsense_Mutation_p.W80*|TM4SF19_uc011btv.1_Intron	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	80	Helical; (Potential).					integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		GCCGTATCTCCAGCCCATCAA	0.493													4	26	---	---	---	---	PASS
MUC7	4589	broad.mit.edu	37	4	71346715	71346715	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71346715C>T	uc011cat.1	+	4	542	c.254C>T	c.(253-255)CCA>CTA	p.P85L	MUC7_uc011cau.1_Missense_Mutation_p.P85L|MUC7_uc003hfj.2_Missense_Mutation_p.P85L|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	85						extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			CCCAAATTCCCAAATCCTCAC	0.458													29	119	---	---	---	---	PASS
PARM1	25849	broad.mit.edu	37	4	75971507	75971507	+	3'UTR	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75971507G>T	uc003hih.1	+	4						NM_015393	NP_056208	Q6UWI2	PARM1_HUMAN	prostatic androgen-repressed message-1						positive regulation of telomerase activity	early endosome|endosome membrane|Golgi membrane|integral to membrane|late endosome|plasma membrane				ovary(1)	1						ATTTATAAGTGCTTATCCAGT	0.418													8	21	---	---	---	---	PASS
FAM170A	340069	broad.mit.edu	37	5	118970217	118970217	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118970217C>A	uc003ksm.2	+	3	984	c.774C>A	c.(772-774)CAC>CAA	p.H258Q	FAM170A_uc003ksl.2_Intron|FAM170A_uc003ksn.2_Missense_Mutation_p.H258Q|FAM170A_uc003kso.2_Missense_Mutation_p.H211Q	NM_182761	NP_877438	A1A519	F170A_HUMAN	family with sequence similarity 170, member A	258						intracellular	zinc ion binding			skin(1)	1						TCAGCTGCCACGTCTTTCATC	0.448													54	229	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140236864	140236864	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236864G>T	uc003lhx.2	+	1	1231	c.1231G>T	c.(1231-1233)GCT>TCT	p.A411S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.A411S|PCDHA10_uc011dad.1_Missense_Mutation_p.A411S	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	411	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGACAGCGCTCTGGACCG	0.632													53	278	---	---	---	---	PASS
DPYSL3	1809	broad.mit.edu	37	5	146793183	146793183	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146793183A>T	uc003lon.1	-	5	626	c.516T>A	c.(514-516)GAT>GAA	p.D172E	DPYSL3_uc003loo.2_Missense_Mutation_p.D286E	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	172					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGATACAAATCCTTATAAG	0.413													4	50	---	---	---	---	PASS
CDSN	1041	broad.mit.edu	37	6	31088189	31088189	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31088189G>A	uc003nsm.1	-	1	35	c.8C>T	c.(7-9)TCG>TTG	p.S3L	PSORS1C1_uc003nsl.1_Intron|PSORS1C1_uc010jsj.1_Intron	NM_001264	NP_001255	Q15517	CDSN_HUMAN	corneodesmosin precursor	3					cell-cell adhesion|keratinocyte differentiation|skin morphogenesis	cornified envelope|desmosome|extracellular region	protein homodimerization activity			ovary(1)|pancreas(1)	2						TGCCCGAGACGAGCCCATCTC	0.657													5	10	---	---	---	---	PASS
SLC35F1	222553	broad.mit.edu	37	6	118475727	118475727	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118475727T>C	uc003pxx.3	+	2	494	c.293T>C	c.(292-294)TTC>TCC	p.F98S		NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	98	Helical; (Potential).				transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		TTCCAGAGTTTCCTCAATTAC	0.443													14	299	---	---	---	---	PASS
NPSR1	387129	broad.mit.edu	37	7	34889021	34889021	+	Intron	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34889021C>T	uc003teg.1	+						AAA1_uc010kwq.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Missense_Mutation_p.S371L|NPSR1_uc010kwt.1_Intron|NPSR1_uc010kwu.1_Intron|NPSR1_uc010kwv.1_Intron|NPSR1_uc003tei.1_Intron|NPSR1_uc010kww.1_Intron|NPSR1_uc011kar.1_Intron	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma							cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	AGCTGTGAGTCATGGAGAAGG	0.368													3	16	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44874056	44874056	+	3'UTR	SNP	A	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44874056A>C	uc003tma.2	-	5					H2AFV_uc003tlz.2_Intron|H2AFV_uc011kca.1_5'Flank|H2AFV_uc003tmb.2_3'UTR|H2AFV_uc003tmc.2_3'UTR|H2AFV_uc003tmd.2_3'UTR	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1						nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGTCCCAGTTACAGTACAATG	0.388													6	43	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48311657	48311657	+	Silent	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48311657C>T	uc003toq.2	+	17	2419	c.2394C>T	c.(2392-2394)AAC>AAT	p.N798N	ABCA13_uc010kyr.2_Silent_p.N301N	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	798					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AATTTGGCAACGAAGTGATTT	0.343													5	70	---	---	---	---	PASS
C7orf45	136263	broad.mit.edu	37	7	129856239	129856239	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129856239C>G	uc003vpp.2	+	3	711	c.664C>G	c.(664-666)CCG>GCG	p.P222A		NM_145268	NP_660311	Q8WWF3	CG045_HUMAN	hypothetical protein LOC136263	222						integral to membrane					0	Melanoma(18;0.0435)					TTCAGTAACACCGCCAATGAA	0.428													6	231	---	---	---	---	PASS
TAS2R60	338398	broad.mit.edu	37	7	143140757	143140757	+	Nonsense_Mutation	SNP	C	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143140757C>G	uc011ktg.1	+	1	212	c.212C>G	c.(211-213)TCA>TGA	p.S71*	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	71	Extracellular (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)					TGTCTGCAGTCAGTGGTAATG	0.493													40	156	---	---	---	---	PASS
XKR6	286046	broad.mit.edu	37	8	11058309	11058309	+	Silent	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11058309G>A	uc003wtk.1	-	1	567	c.540C>T	c.(538-540)AGC>AGT	p.S180S		NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related	180						integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		ACCAGCGGAAGCTCAGGCTCT	0.692													33	44	---	---	---	---	PASS
COMMD5	28991	broad.mit.edu	37	8	146076470	146076470	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146076470A>T	uc003zem.2	-	2	385	c.254T>A	c.(253-255)CTG>CAG	p.L85Q	COMMD5_uc003zel.1_RNA|COMMD5_uc003zen.2_Missense_Mutation_p.L85Q|COMMD5_uc003zeo.3_Missense_Mutation_p.L85Q|COMMD5_uc010mgf.2_Missense_Mutation_p.L85Q	NM_001081004	NP_001074473	Q9GZQ3	COMD5_HUMAN	COMM domain containing 5	85						nucleus	protein binding			ovary(1)	1	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GCCTGCCAGCAGGGCACCCAG	0.662													7	23	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63999439	63999439	+	Silent	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63999439G>T	uc001jlw.2	-	5	553	c.456C>A	c.(454-456)ATC>ATA	p.I152I	RTKN2_uc001jlx.2_Silent_p.I152I	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	152					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					ATATATCTGTGATTGTTTTAT	0.269													5	21	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63999440	63999440	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63999440A>T	uc001jlw.2	-	5	552	c.455T>A	c.(454-456)ATC>AAC	p.I152N	RTKN2_uc001jlx.2_Missense_Mutation_p.I152N	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	152					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					TATATCTGTGATTGTTTTATC	0.274													5	22	---	---	---	---	PASS
DDX50	79009	broad.mit.edu	37	10	70706192	70706192	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70706192T>C	uc001jou.2	+	15	2127	c.2020T>C	c.(2020-2022)TCT>CCT	p.S674P	DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2	674						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						AAACACATCTTCTAATTCCAG	0.507													25	68	---	---	---	---	PASS
H2AFY2	55506	broad.mit.edu	37	10	71835428	71835428	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71835428G>C	uc001jqm.2	+	2	473	c.14G>C	c.(13-15)AGT>ACT	p.S5T	H2AFY2_uc001jqn.2_RNA	NM_018649	NP_061119	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	5	Histone H2A.				chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1						TCGGGCCGGAGTGGGAAGAAG	0.517													15	62	---	---	---	---	PASS
C10orf96	374355	broad.mit.edu	37	10	118101645	118101645	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118101645T>G	uc001lck.2	+	5	631	c.380T>G	c.(379-381)CTT>CGT	p.L127R		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	127	Potential.									ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		AAAAGAGAGCTTTTGATGAAA	0.294													7	140	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123810032	123810032	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123810032C>T	uc001lfv.2	+	3	473	c.113C>T	c.(112-114)ACG>ATG	p.T38M	TACC2_uc001lfw.2_Missense_Mutation_p.T38M|TACC2_uc009xzx.2_Missense_Mutation_p.T38M|TACC2_uc010qtv.1_Missense_Mutation_p.T38M	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	38						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CAGCAGGACACGCCCGGAAGC	0.577													12	58	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427885	3427885	+	RNA	SNP	A	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427885A>G	uc010qxs.1	+	9		c.878A>G			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						AGCTTCACAGATCCACCGCTG	0.587													3	30	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47828640	47828640	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47828640A>T	uc001ngm.2	-	19	2513	c.2428T>A	c.(2428-2430)TTA>ATA	p.L810I	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	810					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						TTTGCCATTAAAGCACCAGAG	0.373													12	108	---	---	---	---	PASS
SERPING1	710	broad.mit.edu	37	11	57367686	57367686	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57367686T>C	uc001nkp.1	+	3	577	c.386T>C	c.(385-387)CTC>CCC	p.L129P	SERPING1_uc001nkq.1_Missense_Mutation_p.L129P|SERPING1_uc010rju.1_Missense_Mutation_p.L77P|SERPING1_uc010rjv.1_Missense_Mutation_p.L134P|SERPING1_uc001nkr.1_Missense_Mutation_p.L129P|SERPING1_uc009ymi.1_Missense_Mutation_p.L129P|SERPING1_uc009ymj.1_Missense_Mutation_p.L129P|SERPING1_uc001nks.1_Intron	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	129			Missing (in HAE; type 2).		blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						CCTGTTACTCTCTGCTCTGAC	0.343									Hereditary_Angioedema				90	212	---	---	---	---	PASS
TMPRSS13	84000	broad.mit.edu	37	11	117785150	117785150	+	Silent	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117785150G>A	uc001prs.1	-	4	729	c.636C>T	c.(634-636)GAC>GAT	p.D212D	TMPRSS13_uc009yzr.1_Translation_Start_Site|TMPRSS13_uc001prt.1_Translation_Start_Site|TMPRSS13_uc001pru.1_Silent_p.D212D	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	207	Extracellular (Potential).|SRCR.|LDL-receptor class A.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		CCACCACCCCGTCACAGCGAA	0.517													19	413	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49415510	49415510	+	3'UTR	SNP	A	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49415510A>G	uc001rta.3	-	54						NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CATCCCTTTCAGGGAAGAGGT	0.622			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	34	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56487323	56487323	+	Missense_Mutation	SNP	G	A	A	rs149951770		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56487323G>A	uc001sjh.2	+	12	1662	c.1469G>A	c.(1468-1470)CGC>CAC	p.R490H	ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.R431H|ERBB3_uc009zok.2_5'Flank|ERBB3_uc001sjk.2_5'Flank|ERBB3_uc001sjj.1_Missense_Mutation_p.R58H	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	490	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AATCGGCCGCGCAGAGACTGC	0.567													10	80	---	---	---	---	PASS
ACOT6	641372	broad.mit.edu	37	14	74083716	74083716	+	5'UTR	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74083716C>T	uc001xop.2	+	1						NM_001037162	NP_001032239	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6							cytosol	carboxylesterase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TTCCTGGGATCATTGATCTGT	0.498													16	66	---	---	---	---	PASS
BCL11B	64919	broad.mit.edu	37	14	99640783	99640783	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99640783G>A	uc001yga.2	-	4	2657	c.2390C>T	c.(2389-2391)ACG>ATG	p.T797M	BCL11B_uc001ygb.2_Missense_Mutation_p.T726M	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	797	C2H2-type 4.					nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GTACTCGCACGTGTCGCTGCG	0.597			T	TLX3	T-ALL								8	15	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68628034	68628034	+	Splice_Site	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68628034C>A	uc002ari.2	-	12	1512	c.1425_splice	c.e12+1	p.Q475_splice	ITGA11_uc010bib.2_Splice_Site_p.Q475_splice	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	CCCTCCATTACCTGCTGGCCC	0.637													8	24	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81598949	81598949	+	Intron	SNP	A	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81598949A>T	uc002bgh.3	+						IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron|IL16_uc002bgj.2_Intron|IL16_uc002bgk.2_Intron|IL16_uc010unq.1_Nonsense_Mutation_p.K588*	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						AGGCCCCCAAAAGGCTTCTGG	0.507													13	109	---	---	---	---	PASS
SULT1A2	6799	broad.mit.edu	37	16	28606779	28606779	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28606779T>C	uc002dqg.1	-	4	632	c.281A>G	c.(280-282)GAG>GGG	p.E94G	uc010vct.1_Intron|SULT1A2_uc002dqh.1_Missense_Mutation_p.E94G	NM_177528	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A,	94					3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0						TTTCAGAGTCTCCATCCCTGA	0.577													5	138	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55844874	55844874	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55844874C>A	uc002eim.2	-	10	1240	c.1132G>T	c.(1132-1134)GCC>TCC	p.A378S	CES1_uc010ccf.2_Missense_Mutation_p.A53S|CES1_uc002eil.2_Missense_Mutation_p.A379S|CES1_uc002ein.2_Missense_Mutation_p.A377S	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	378					response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	AGTGACATGGCTGTCTTCTGG	0.333													5	54	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3920721	3920721	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3920721T>G	uc002fxe.2	-	48	8009	c.7945A>C	c.(7945-7947)ATG>CTG	p.M2649L	ZZEF1_uc002fxg.1_5'UTR	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2649							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ATGTAGGTCATATGGGCAGGG	0.562													8	76	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10258026	10258026	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10258026C>T	uc002gmk.1	-	11	1066	c.976G>A	c.(976-978)GAT>AAT	p.D326N		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	326	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCACTGTCATCGATACTGGCT	0.453													20	84	---	---	---	---	PASS
RPL27	6155	broad.mit.edu	37	17	41154776	41154776	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41154776A>G	uc002icj.2	+	4	383	c.338A>G	c.(337-339)GAG>GGG	p.E113G	RPL27_uc002ick.2_Missense_Mutation_p.E113G	NM_000988	NP_000979	P61353	RL27_HUMAN	ribosomal protein L27	113					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	structural constituent of ribosome				0		Breast(137;0.000717)|Ovarian(249;0.0776)		BRCA - Breast invasive adenocarcinoma(366;0.157)		GCCCGACGGGAGGCCAAGGTC	0.468													44	176	---	---	---	---	PASS
ETV4	2118	broad.mit.edu	37	17	41610308	41610308	+	Splice_Site	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41610308C>T	uc002idw.2	-	8	674	c.546_splice	c.e8-1	p.S182_splice	ETV4_uc002idv.2_5'Flank|ETV4_uc010wih.1_Splice_Site_p.S128_splice|ETV4_uc010czh.2_Splice_Site_p.S181_splice|ETV4_uc010wii.1_Splice_Site_p.S143_splice|ETV4_uc002idx.2_Splice_Site_p.S182_splice|ETV4_uc010wij.1_Splice_Site_p.S143_splice	NM_001986	NP_001977	P43268	ETV4_HUMAN	ets variant gene 4 (E1A enhancer binding						positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		GAAGACGGAGCTGGATGTGGT	0.567			T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								25	87	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587730	43587730	+	Intron	SNP	A	C	C	rs142536398	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587730A>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						GTATTGATTCATTTTATTCAT	0.328													3	40	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630632	44630632	+	3'UTR	SNP	C	T	T	rs142505146	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630632C>T	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TGTTACACAGCATACAATTCC	0.234													4	27	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630635	44630635	+	3'UTR	SNP	A	G	G	rs150521815	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630635A>G	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TACACAGCATACAATTCCTGT	0.239													5	33	---	---	---	---	PASS
C17orf71	55181	broad.mit.edu	37	17	57292295	57292295	+	Missense_Mutation	SNP	C	G	G	rs141411025		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57292295C>G	uc002ixi.2	+	4	2950	c.2908C>G	c.(2908-2910)CCT>GCT	p.P970A		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	970					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					TTGTTTCCCCCCTAAGGAAAA	0.433													33	121	---	---	---	---	PASS
C17orf62	79415	broad.mit.edu	37	17	80401693	80401693	+	3'UTR	SNP	C	T	T	rs145920831	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80401693C>T	uc002kez.2	-	6					C17orf62_uc002kex.2_Silent_p.P102P|C17orf62_uc002key.2_Silent_p.P102P|C17orf62_uc002kfa.2_3'UTR|C17orf62_uc010dir.2_3'UTR|C17orf62_uc002kfb.3_3'UTR|C17orf62_uc002kfc.3_3'UTR|C17orf62_uc002kfd.3_Silent_p.P102P|C17orf62_uc002kfe.3_Silent_p.P102P	NM_001100407	NP_001093877	Q9BQA9	CQ062_HUMAN	hypothetical protein LOC79415 isoform a							integral to membrane	protein binding				0	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAATGTGCCACGGGTCCTGTG	0.682													5	84	---	---	---	---	PASS
PHLPP1	23239	broad.mit.edu	37	18	60497298	60497298	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60497298G>A	uc002lis.2	+	3	249	c.71G>A	c.(70-72)CGG>CAG	p.R24Q		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	536	PH.				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						AGCTCTGAACGGATTCAGCTC	0.448													7	47	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7677733	7677733	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7677733G>T	uc002mgv.3	+	11	2455	c.2354G>T	c.(2353-2355)CGG>CTG	p.R785L	KIAA1543_uc002mgu.3_Missense_Mutation_p.R812L|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	785	Pro-rich.				epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						AAACACACGCGGCCAGCGGAG	0.736													3	5	---	---	---	---	PASS
C19orf39	126074	broad.mit.edu	37	19	11485453	11485453	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11485453G>T	uc002mrg.1	+	1	71	c.34G>T	c.(34-36)GGT>TGT	p.G12C		NM_175871	NP_787067	Q6NVH7	CS039_HUMAN	hypothetical protein LOC126074	12											0						GCTGCTGCTCGGTACACCAGG	0.667													4	69	---	---	---	---	PASS
NDUFA13	51079	broad.mit.edu	37	19	19626874	19626874	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19626874G>T	uc010xqy.1	+	1	335	c.76G>T	c.(76-78)GCA>TCA	p.A26S	TSSK6_uc002nmq.2_5'Flank|TSSK6_uc002nmr.2_5'Flank|NDUFA13_uc002nms.2_Missense_Mutation_p.A26S|NDUFA13_uc010xqx.1_Missense_Mutation_p.A26S	NM_015965	NP_057049	Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	Error:Variant_position_missing_in_Q9P0J0_after_alignment					apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	GCCCGGCAGCGCATTCCTACC	0.617													26	58	---	---	---	---	PASS
AKT2	208	broad.mit.edu	37	19	40742002	40742002	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40742002C>G	uc002onf.2	-	11	1232	c.970G>C	c.(970-972)GAC>CAC	p.D324H	AKT2_uc010egs.2_Missense_Mutation_p.D281H|AKT2_uc010egt.2_Missense_Mutation_p.D262H|AKT2_uc010xvj.1_Missense_Mutation_p.D262H|AKT2_uc010egu.1_Missense_Mutation_p.D262H|AKT2_uc002one.2_Missense_Mutation_p.D220H	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase	324	Protein kinase.				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			TAGTCATTGTCCTCCAGCACC	0.632			A		ovarian|pancreatic 								18	56	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33328813	33328813	+	Silent	SNP	C	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33328813C>A	uc002xav.2	-	12	7818	c.5247G>T	c.(5245-5247)ACG>ACT	p.T1749T	NCOA6_uc002xaw.2_Silent_p.T1749T	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1749	EP300/CRSP3-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						CTGGAGAAGACGTACAAGGAG	0.532													24	79	---	---	---	---	PASS
BACH1	571	broad.mit.edu	37	21	30715189	30715189	+	3'UTR	SNP	C	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30715189C>T	uc002ynj.2	+	5					BACH1_uc002ynk.2_3'UTR|BACH1_uc002ynl.2_Intron	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor							nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						ATCTAATTTTCTCCTGAAGTT	0.383													6	31	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32834668	32834668	+	Silent	SNP	A	G	G			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32834668A>G	uc004dda.1	-	6	691	c.447T>C	c.(445-447)CGT>CGC	p.R149R	DMD_uc004dcz.2_Silent_p.R26R|DMD_uc004dcy.1_Silent_p.R145R|DMD_uc004ddb.1_Silent_p.R141R|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Silent_p.R141R|DMD_uc010ngp.1_Silent_p.R26R|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	149	CH 2.|Actin-binding.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTGGATAATTACGAGTTGATT	0.413													18	87	---	---	---	---	PASS
DCX	1641	broad.mit.edu	37	X	110644391	110644391	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110644391G>A	uc004epd.2	-	3	947	c.775C>T	c.(775-777)CGC>TGC	p.R259C	DCX_uc011msv.1_Missense_Mutation_p.R259C|DCX_uc004epe.2_Missense_Mutation_p.R178C|DCX_uc004epf.2_Missense_Mutation_p.R178C|DCX_uc004epg.2_Missense_Mutation_p.R178C	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	259			R -> L (in SBHX).|R -> C (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						AGCTTGGGGCGCACAAAGTCC	0.537													4	89	---	---	---	---	PASS
ZNF185	7739	broad.mit.edu	37	X	152085828	152085828	+	Splice_Site	SNP	G	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152085828G>C	uc010ntv.1	+	5	301	c.264_splice	c.e5-1	p.R88_splice	ZNF185_uc011myg.1_Splice_Site_p.R88_splice|ZNF185_uc011myh.1_Splice_Site_p.R88_splice|ZNF185_uc011myi.1_Splice_Site_p.R88_splice|ZNF185_uc011myj.1_Splice_Site_p.R88_splice|ZNF185_uc011myk.1_Splice_Site_p.R88_splice|ZNF185_uc004fgw.3_5'Flank|ZNF185_uc004fgu.2_5'Flank	NM_007150	NP_009081	O15231	ZN185_HUMAN	zinc finger protein 185							cytoplasm|cytoskeleton|focal adhesion	zinc ion binding			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTCTTTCAGGGGAGTGTTC	0.612													23	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13031	13031	+	RNA	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13031G>A	uc004cox.3	+	1		c.695G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TCTCCACCCCTGACTCCCCTC	0.537													44	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15045	15045	+	Silent	SNP	G	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15045G>A	uc004coy.2	+	1	285	c.210G>A	c.(208-210)GCG>GCA	p.A70A	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		ACACATCGGGCGAGGCCTATA	0.473													5	67	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17185383	17185384	+	Intron	INS	-	C	C	rs143082557	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17185383_17185384insC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACTAAATTTTTAGTGCAATAAT	0.203													3	3	---	---	---	---	
ST3GAL3	6487	broad.mit.edu	37	1	44360317	44360318	+	Intron	INS	-	T	T	rs112814003		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44360317_44360318insT	uc001ckc.2	+						ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270	Q11203	SIAT6_HUMAN	sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				ttgtttgtttgttttttttttt	0.193													6	3	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67287866	67287867	+	Intron	INS	-	A	A	rs112641512		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67287866_67287867insA	uc001dcx.2	-						WDR78_uc009waw.2_Intron|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						agacgaggctgaaaaaaaaaaa	0.134													4	2	---	---	---	---	
PPP1R12B	4660	broad.mit.edu	37	1	202457853	202457854	+	Intron	DEL	AC	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202457853_202457854delAC	uc001gya.1	+						PPP1R12B_uc001gxz.1_Intron|PPP1R12B_uc001gyb.1_Intron|PPP1R12B_uc001gyc.1_Intron	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCTGATTTAAacacacacacac	0.173													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																		actccatctcaaaaaaaaaaa	0.179													2	4	---	---	---	---	
CAD	790	broad.mit.edu	37	2	27459886	27459886	+	Intron	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27459886delT	uc002rji.2	+						CAD_uc010eyw.2_Intron	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate						'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GTCTGAGGAAttttttttttt	0.239													4	2	---	---	---	---	
PPM1G	5496	broad.mit.edu	37	2	27605696	27605697	+	Intron	INS	-	T	T	rs111310967		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27605696_27605697insT	uc002rkl.2	-						ZNF513_uc002rkj.2_5'Flank|ZNF513_uc002rkk.2_5'Flank|PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698	O15355	PPM1G_HUMAN	protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					agtcttttttgttttttttttt	0.025													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	44293377	44293377	+	IGR	DEL	G	-	-	rs61062797		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44293377delG								LRPPRC (70233 upstream) : PPM1B (102623 downstream)																							TTTTTGTTTTGTTTTTTTTTT	0.313													6	7	---	---	---	---	
SMYD1	150572	broad.mit.edu	37	2	88383630	88383630	+	Intron	DEL	A	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88383630delA	uc002ssr.2	+						SMYD1_uc002ssq.1_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						actctgtctcaaaaaaaaaaa	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90475362	90475362	+	IGR	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90475362delT								None (None upstream) : None (None downstream)																							tcctccttccttccttccttc	0.050													4	2	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69245689	69245690	+	Intron	INS	-	AAAAC	AAAAC	rs144990660	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69245689_69245690insAAAAC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTTCAGACCAAAAAACAAAACA	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122242444	122242444	+	IGR	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122242444delT								KPNA1 (8658 upstream) : PARP9 (4318 downstream)																							cttttctttcttttttttttt	0.000													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191888074	191888074	+	Intron	DEL	A	-	-	rs11293703		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888074delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gcctcaaaagaaaaaaaaaaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84026501	84026502	+	IGR	INS	-	GTGT	GTGT	rs144583437	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84026501_84026502insGTGT								EDIL3 (345890 upstream) : None (None downstream)																							TCCCCTGCCTCgtgtgtgtgtg	0.277													4	2	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109228680	109228681	+	Intron	INS	-	A	A	rs4945823		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109228680_109228681insA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		tttttttttttACCAGTCATCT	0.307													3	4	---	---	---	---	
KATNA1	11104	broad.mit.edu	37	6	149954237	149954237	+	Intron	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149954237delT	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_Intron	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TCAATTGCAAttttttttttt	0.119													6	3	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8192427	8192429	+	Intron	DEL	CCA	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8192427_8192429delCCA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		accatcacctccaccaccaccac	0.000													6	4	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116590678	116590678	+	5'Flank	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116590678delT	uc003vin.2	+						ST7_uc011knl.1_5'Flank|ST7_uc003vio.2_5'Flank	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ccttccttccttccttcctcc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128210235	128210235	+	IGR	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128210235delT								METTL2B (67258 upstream) : FLJ45340 (71060 downstream)																							gttttagttcttTTTTTTTTT	0.194													6	3	---	---	---	---	
TNPO3	23534	broad.mit.edu	37	7	128645359	128645359	+	Intron	DEL	T	-	-	rs142831893		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128645359delT	uc003vol.1	-						TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5						AGTGTCACTGttttttttttt	0.204													9	4	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100301260	100301261	+	Intron	INS	-	ATGAATGA	ATGAATGA	rs147774364	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100301260_100301261insATGAATGA	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			cccctgcctctatgaatgaatg	0.045													3	4	---	---	---	---	
TRPS1	7227	broad.mit.edu	37	8	116600061	116600062	+	Intron	DEL	AC	-	-	rs34198799		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116600061_116600062delAC	uc003ynz.2	-						TRPS1_uc011lhy.1_Intron|TRPS1_uc003yny.2_Intron|TRPS1_uc010mcy.2_Intron	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1						negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TATAacacagacacacacacac	0.272									Langer-Giedion_syndrome				5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	83211589	83211590	+	IGR	DEL	AT	-	-	rs72445869		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83211589_83211590delAT								TLE4 (869932 upstream) : TLE1 (987010 downstream)																							ATacatacacatacacacacac	0.322													5	3	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16996123	16996124	+	Intron	INS	-	A	A	rs144569825	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16996123_16996124insA	uc001ioo.2	-							NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAATTTGGATAAAACTTTTTT	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42530677	42530678	+	IGR	INS	-	T	T			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42530677_42530678insT								None (None upstream) : LOC441666 (296637 downstream)																							tctaaagaacgttcaactctgt	0.000													16	8	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105924158	105924158	+	Intron	DEL	T	-	-	rs140844875		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105924158delT	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		ATTCCACAAAttttttttttt	0.149													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	21747095	21747104	+	IGR	DEL	TTTGTGTGTT	-	-	rs71034542		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21747095_21747104delTTTGTGTGTT								NELL1 (149868 upstream) : ANO5 (467618 downstream)																							tgtgtgtgtgtttgtgtgtttgtgtgtgtg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	21747103	21747104	+	IGR	DEL	TT	-	-	rs11026175		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21747103_21747104delTT								NELL1 (149876 upstream) : ANO5 (467618 downstream)																							tgtttgtgtgtttgtgtgtgtg	0.000													7	4	---	---	---	---	
FIBP	9158	broad.mit.edu	37	11	65653641	65653641	+	Intron	DEL	A	-	-	rs5792375		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65653641delA	uc001ogd.2	-						FIBP_uc009yqu.2_Intron|FIBP_uc001oge.2_Intron	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a						fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		ccgtctcattaaaaaaaaaaa	0.209													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89771845	89771845	+	Intron	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89771845delT	uc010rua.1	+							NM_020358	NP_065091			ring finger protein 18																		ATCTTTCTTCTTTTTTTTTTT	0.348													4	2	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	120994904	120994905	+	Intron	DEL	AG	-	-	rs57304098		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120994904_120994905delAG	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					aaaaaaaaaaagaaaaaaaTGA	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	40850814	40850815	+	IGR	DEL	AT	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40850814_40850815delAT								COG6 (485012 upstream) : LOC646982 (70458 downstream)																							acacacacacatacacacacaA	0.376													4	2	---	---	---	---	
FAM179B	23116	broad.mit.edu	37	14	45480988	45480989	+	Intron	INS	-	TGTG	TGTG	rs145724708	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45480988_45480989insTGTG	uc001wvv.2	+						FAM179B_uc001wvw.2_Intron|FAM179B_uc010anc.2_Intron	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116								binding			skin(2)|upper_aerodigestive_tract(1)	3						CAAAATATATAtgtgtgtgtgt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	58467206	58467207	+	IGR	INS	-	TG	TG	rs71450345		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58467206_58467207insTG								SLC35F4 (403591 upstream) : C14orf37 (3602 downstream)																							CTTGTCTCTTTtgtgtgtgtgt	0.228													3	3	---	---	---	---	
POTEB	339010	broad.mit.edu	37	15	21051000	21051001	+	Intron	INS	-	A	A			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21051000_21051001insA	uc010tzg.1	-						POTEB_uc010tzf.1_Intron	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,												0						ttaatgactggaaaaaacggta	0.054													8	4	---	---	---	---	
SPTBN5	51332	broad.mit.edu	37	15	42160138	42160138	+	Intron	DEL	G	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42160138delG	uc001zos.2	-						hsa-mir-4310|MI0015840_5'Flank	NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCACCTGGAAGGACTTGTGCA	0.582													5	3	---	---	---	---	
KLHL25	64410	broad.mit.edu	37	15	86314432	86314433	+	Intron	INS	-	A	A	rs55642980		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86314432_86314433insA	uc002bly.2	-						MIR1276_hsa-mir-1276|MI0006416_5'Flank	NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein							cytoplasm				ovary(2)	2						AATTAAGCCTGaaaaaaaaaaa	0.406													4	4	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90617221	90617222	+	Intron	INS	-	A	A	rs35145118		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617221_90617222insA	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			gagtctgtctcaaaaaaaaaac	0.223													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16696737	16696738	+	IGR	INS	-	CTTC	CTTC			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16696737_16696738insCTTC								LOC339047 (252300 upstream) : XYLT1 (499445 downstream)																							tccctccctttcttccttcctt	0.000													3	6	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69602280	69602289	+	Intron	DEL	TATATATATA	-	-	rs62052822		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69602280_69602289delTATATATATA	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron|MIR1538_hsa-mir-1538|MI0007259_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						tgtgtgtgtgtATATATATATATATATACA	0.152													3	3	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16649585	16649586	+	Intron	INS	-	TT	TT			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16649585_16649586insTT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						ctctctctctcttttttttttt	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	17286668	17286669	+	IGR	DEL	TA	-	-	rs59767075		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17286668_17286669delTA								NT5M (35693 upstream) : MED9 (93631 downstream)																							tttttttttttATTCCAAGTCC	0.267													4	3	---	---	---	---	
CPD	1362	broad.mit.edu	37	17	28773196	28773196	+	Intron	DEL	T	-	-	rs141561458		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28773196delT	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						CTTGGAGATCtttttttttta	0.159													4	2	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65905565	65905565	+	Intron	DEL	T	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65905565delT	uc002jgf.2	+						BPTF_uc002jge.2_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GACCTTTGTCTTTTTTTTTTT	0.299													5	3	---	---	---	---	
NARF	26502	broad.mit.edu	37	17	80417742	80417742	+	Intron	DEL	A	-	-	rs72353556		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80417742delA	uc002kfg.3	+						NARF_uc002kff.3_Intron|NARF_uc010wvo.1_Intron|NARF_uc010wvp.1_Intron|NARF_uc010dit.2_Intron|NARF_uc002kfj.3_Intron|NARF_uc002kfi.3_Intron|NARF_uc002kfh.3_Intron	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a							lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			gactccgtctaaaaaaataaa	0.129													5	5	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8786109	8786109	+	Intron	DEL	C	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8786109delC	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc010dkw.1_Frame_Shift_Del_p.S474fs	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						GGCAAGCAATCCCCCCCCCCC	0.692													5	3	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2418276	2418276	+	Intron	DEL	T	-	-	rs112073170		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418276delT	uc010xgx.1	+							NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ccttccctccttttcctttcc	0.124													4	2	---	---	---	---	
LILRB3	11025	broad.mit.edu	37	19	54733630	54733631	+	Intron	INS	-	T	T	rs141238984	by1000genomes	TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54733630_54733631insT	uc010erh.1	-						LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		atttttttgtattttcagtaga	0.005													4	2	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55777911	55777912	+	Intron	INS	-	C	C			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777911_55777912insC	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		catcaccatgacatcaccaaca	0.030													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10475943	10475943	+	Intron	DEL	A	-	-			TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10475943delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		GTCCAATGCCAAAATGTCCTG	0.468													4	2	---	---	---	---	
CXADR	1525	broad.mit.edu	37	21	18931675	18931675	+	Intron	DEL	A	-	-	rs147134822		TCGA-B2-4101-01A-02D-1458-08	TCGA-B2-4101-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18931675delA	uc002yki.2	+						CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron|CXADR_uc002ykj.1_Intron	NM_001338	NP_001329	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		ttttttttttaaaaaatgtgt	0.000													5	3	---	---	---	---	
