Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CAMK2N1	55450	broad.mit.edu	37	1	20810079	20810079	+	3'UTR	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20810079T>C	uc001bdh.2	-	2					CAMK2N1_uc001bdg.2_RNA	NM_018584	NP_061054	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II							cell junction|postsynaptic density|postsynaptic membrane|synaptosome					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		CTTTTCATGCTTTTTGCCAAT	0.438													38	142	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44154664	44154664	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44154664G>C	uc001cjx.2	+	13	2101	c.1935G>C	c.(1933-1935)CAG>CAC	p.Q645H	KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	645					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						AACTGTGGCAGAACCGACCTC	0.537													20	58	---	---	---	---	PASS
BCAS2	10286	broad.mit.edu	37	1	115123970	115123970	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115123970T>G	uc001efa.2	-	2	189	c.136A>C	c.(136-138)ACT>CCT	p.T46P	DENND2C_uc001eez.2_RNA	NM_005872	NP_005863	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	46					mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGTTCTTAGTAGGTCGGTAT	0.468													106	303	---	---	---	---	PASS
PDIA3P	171423	broad.mit.edu	37	1	146649788	146649788	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146649788C>G	uc001epg.1	+	1	359	c.96C>G	c.(94-96)GAC>GAG	p.D32E		NR_002305				SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);												0						GACTCAGGGACGACAACTTGG	0.687													6	18	---	---	---	---	PASS
MRPL9	65005	broad.mit.edu	37	1	151732588	151732588	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151732588A>T	uc001eyv.2	-	7	827	c.742T>A	c.(742-744)TAT>AAT	p.Y248N	MRPL9_uc009wmz.2_RNA	NM_031420	NP_113608	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9 precursor	248					translation	mitochondrial ribosome	structural constituent of ribosome			ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGTACTTATATCTTTTGGTC	0.493													56	158	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158670246	158670246	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158670246A>G	uc001fsu.1	-	1	197	c.197T>C	c.(196-198)CTT>CCT	p.L66P		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					CAGGAAAGAAAGAGCACTGAT	0.443													5	131	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197021948	197021948	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197021948A>G	uc001gtt.1	-	9	1415	c.1371T>C	c.(1369-1371)AAT>AAC	p.N457N		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	457	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TGTAATCCACATTAACAGTAC	0.269													6	322	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197060067	197060067	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197060067C>G	uc001gtu.2	-	23	9806	c.9549G>C	c.(9547-9549)AGG>AGC	p.R3183S	ASPM_uc001gtv.2_Missense_Mutation_p.R1598S|ASPM_uc001gtw.3_Missense_Mutation_p.R1031S	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3183	IQ 38.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTGATGCAGCCCTATTTCGCT	0.368													95	295	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200572414	200572414	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200572414A>G	uc010ppk.1	-	10	2358	c.1919T>C	c.(1918-1920)CTT>CCT	p.L640P	KIF14_uc010ppj.1_Missense_Mutation_p.L149P	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	640					microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						TTGTTCCGAAAGTGCAGATAT	0.303													6	346	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201844292	201844292	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201844292A>G	uc001gwz.2	+	23	3001	c.2951A>G	c.(2950-2952)TAC>TGC	p.Y984C		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	984					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						GAGGATTACTACGAGGATGAT	0.502													6	282	---	---	---	---	PASS
SLC41A1	254428	broad.mit.edu	37	1	205764141	205764141	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205764141T>C	uc001hdh.1	-	10	2085	c.1213A>G	c.(1213-1215)AAT>GAT	p.N405D	SLC41A1_uc001hdg.1_Missense_Mutation_p.N26D	NM_173854	NP_776253	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 member 1	405						integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			skin(2)	2	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GAGCGAGAATTCACATCTGGA	0.587													5	170	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978916	247978916	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978916C>T	uc001idm.1	-	1	116	c.116G>A	c.(115-117)GGG>GAG	p.G39E		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAGGACATTCCCCATCAGGGC	0.378													4	233	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20153652	20153652	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20153652T>C	uc002rdi.2	-	13	1484	c.1376A>G	c.(1375-1377)AAG>AGG	p.K459R	WDR35_uc002rdj.2_Missense_Mutation_p.K448R|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Missense_Mutation_p.K24R|WDR35_uc002rdk.3_Missense_Mutation_p.K24R	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	459										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTGTGAGCTTCTTTGCCAC	0.373													117	396	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													9	28	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103061787	103061787	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103061787A>G	uc002tbx.2	+	9	1543	c.1059A>G	c.(1057-1059)AAA>AAG	p.K353K	IL18RAP_uc010fiz.2_Silent_p.K211K	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	353	Ig-like C2-type 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						TCCAACTGAAAGAAAAGAGAG	0.443													5	173	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107021431	107021431	+	3'UTR	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021431C>T	uc010ywi.1	-	23						NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						CTGGTATCAACACTTCAAGCT	0.378													4	48	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114356198	114356198	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114356198G>A	uc002tkh.2	+	6	734	c.676G>A	c.(676-678)GGA>AGA	p.G226R	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CTCTGGGAAAGGACCTGGGGC	0.622													3	10	---	---	---	---	PASS
MARCH7	64844	broad.mit.edu	37	2	160623882	160623882	+	3'UTR	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160623882G>A	uc002uax.2	+	10					MARCH7_uc010foq.2_3'UTR|MARCH7_uc010zcn.1_3'UTR|MARCH7_uc010for.2_3'UTR|MARCH7_uc002uay.2_RNA	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin								ligase activity|zinc ion binding				0						GATGATCTGTGAACATAAGTG	0.294													68	237	---	---	---	---	PASS
TMEM111	55831	broad.mit.edu	37	3	10005822	10005822	+	Silent	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10005822T>C	uc003bun.2	-	8	896	c.717A>G	c.(715-717)GAA>GAG	p.E239E	CIDEC_uc003bto.2_Intron	NM_018447	NP_060917	Q9P0I2	TM111_HUMAN	transmembrane protein 111	239						integral to membrane					0						CCATGAGCTCTTCTTCGACAT	0.483													52	173	---	---	---	---	PASS
TEX264	51368	broad.mit.edu	37	3	51708346	51708346	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51708346T>A	uc010hls.2	+	3	195	c.26T>A	c.(25-27)CTG>CAG	p.L9Q	TEX264_uc003dbk.3_Missense_Mutation_p.L9Q|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Missense_Mutation_p.L9Q|TEX264_uc003dbm.3_Missense_Mutation_p.L48Q	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor	9						extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		CTACTGGGCCTGATTGGGGGC	0.607													18	43	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52439876	52439876	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52439876G>T	uc003ddx.2	-	10	951	c.836C>A	c.(835-837)TCA>TAA	p.S279*	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	279					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.S279L(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGCAGCTGTGACTCTTGAGA	0.557			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								15	33	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130720227	130720227	+	3'UTR	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130720227A>G	uc003enl.2	+	28					ATP2C1_uc011blg.1_3'UTR|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_3'UTR|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_3'UTR|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_3'UTR|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron|ATP2C1_uc003enu.2_3'UTR	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	GCAAACTAGGAATTGCAGTCT	0.323									Hailey-Hailey_disease				6	364	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133362056	133362056	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133362056A>T	uc003eps.2	-	12	2141	c.2009T>A	c.(2008-2010)CTC>CAC	p.L670H		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	670	BRCT 5.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						TGCTCCAAGGAGGTTTGCTAG	0.353								Other_conserved_DNA_damage_response_genes					76	111	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219839	160219839	+	3'UTR	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219839T>C	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			cacacacacatatatatatat	0.313													4	26	---	---	---	---	PASS
OTOL1	131149	broad.mit.edu	37	3	161221212	161221212	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161221212C>A	uc011bpb.1	+	4	916	c.916C>A	c.(916-918)CCT>ACT	p.P306T		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	306	Collagen-like 3.					collagen					0						TCTCCTGGGACCTACTGGGCC	0.567													8	39	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193120483	193120483	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193120483A>G	uc003ftd.2	-	30	3657	c.3549T>C	c.(3547-3549)TCT>TCC	p.S1183S	ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	1183	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GATTGCTGTAAGACACTCCTC	0.463													27	243	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505855	195505855	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505855G>T	uc011bto.1	-	3	12672	c.12212C>A	c.(12211-12213)TCC>TAC	p.S4071Y	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.597													17	62	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2952002	2952002	+	Intron	SNP	A	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952002A>C	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_RNA|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						GGACCATCTCACAGCCACATC	0.552													9	48	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104061981	104061981	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104061981G>A	uc003hxb.1	-	36	5834	c.5744C>T	c.(5743-5745)ACC>ATC	p.T1915I	CENPE_uc003hxc.1_Missense_Mutation_p.T1890I|CENPE_uc003hxd.1_5'Flank	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	1915	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TCTAGCTTTGGTTTCTTGCAG	0.254													101	396	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37022178	37022178	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37022178C>G	uc003jkl.3	+	28	5853	c.5354C>G	c.(5353-5355)GCA>GGA	p.A1785G	NIPBL_uc003jkk.3_Missense_Mutation_p.A1785G	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1785	HEAT 1.				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GGTGAAAATGCAATTGCTGTT	0.328													141	429	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37226660	37226660	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37226660C>G	uc011cpa.1	-	12	2268	c.2037G>C	c.(2035-2037)CAG>CAC	p.Q679H		NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	679										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTGAGAATAACTGACCCTTTT	0.333													31	86	---	---	---	---	PASS
PKD2L2	27039	broad.mit.edu	37	5	137228267	137228267	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137228267T>G	uc003lby.2	+	3	288	c.232T>G	c.(232-234)TTT>GTT	p.F78V	PKD2L2_uc010jep.1_Missense_Mutation_p.F18V|PKD2L2_uc003lbw.1_Missense_Mutation_p.F78V|PKD2L2_uc003lbx.2_Missense_Mutation_p.F78V	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	78	Extracellular (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGAACCAACTTTAAGTCCAT	0.353													95	330	---	---	---	---	PASS
ZNF879	345462	broad.mit.edu	37	5	178459395	178459395	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178459395A>G	uc003mjt.3	+	5	611	c.446A>G	c.(445-447)TAC>TGC	p.Y149C		NM_001136116	NP_001129588	B4DU55	ZN879_HUMAN	zinc finger protein 879	149					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						AAAAAAGTCTACATGAAGGAG	0.353													193	221	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75893315	75893315	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75893315A>G	uc003phs.2	-	10	1508	c.1342T>C	c.(1342-1344)TCC>CCC	p.S448P	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Missense_Mutation_p.S106P	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	448	VWFA 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ATGCTATAGGAGCCATCAACC	0.328													5	139	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133065463	133065463	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133065463A>G	uc003qdt.2	-	7	1550	c.1539T>C	c.(1537-1539)GCT>GCC	p.A513A	VNN2_uc003qds.2_Silent_p.A222A|VNN2_uc010kgb.2_Silent_p.A292A|VNN2_uc003qdv.2_Silent_p.A460A	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	513					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TATTTTGCAAAGCTATGATCA	0.383													6	299	---	---	---	---	PASS
MAP7	9053	broad.mit.edu	37	6	136698982	136698982	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136698982C>T	uc003qgz.2	-	7	908	c.662G>A	c.(661-663)TGG>TAG	p.W221*	MAP7_uc011edf.1_Nonsense_Mutation_p.W206*|MAP7_uc011edg.1_Nonsense_Mutation_p.W243*|MAP7_uc010kgu.2_Nonsense_Mutation_p.W243*|MAP7_uc011edh.1_Nonsense_Mutation_p.W206*|MAP7_uc010kgv.2_Nonsense_Mutation_p.W243*|MAP7_uc010kgs.2_Nonsense_Mutation_p.W75*|MAP7_uc011edi.1_Nonsense_Mutation_p.W75*|MAP7_uc010kgq.1_Nonsense_Mutation_p.W127*|MAP7_uc003qha.1_Nonsense_Mutation_p.W184*|MAP7_uc010kgr.2_Nonsense_Mutation_p.W75*|MAP7_uc010kgt.2_Nonsense_Mutation_p.W243*	NM_003980	NP_003971	Q14244	MAP7_HUMAN	microtubule-associated protein 7	221					establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GCTGCTCTCCCATGGGCTGAG	0.493													4	122	---	---	---	---	PASS
SYTL3	94120	broad.mit.edu	37	6	159184435	159184435	+	Silent	SNP	C	A	A	rs140709967	byFrequency	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159184435C>A	uc003qrp.2	+	16	1861	c.1617C>A	c.(1615-1617)GGC>GGA	p.G539G	SYTL3_uc011efp.1_Silent_p.G539G|SYTL3_uc003qro.2_Silent_p.G471G|SYTL3_uc003qrq.2_Silent_p.G471G|SYTL3_uc003qrr.2_Silent_p.G539G|SYTL3_uc003qrs.2_Silent_p.G471G|SYTL3_uc011efq.1_Silent_p.G265G	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	539	C2 2.				intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TCTTCAGTGGCGTAACCCCAG	0.537													21	71	---	---	---	---	PASS
STEAP1	26872	broad.mit.edu	37	7	89790291	89790291	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89790291T>C	uc003ujx.2	+	3	457	c.257T>C	c.(256-258)TTT>TCT	p.F86S	STEAP1_uc010lem.2_Missense_Mutation_p.F86S	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	86	Helical; (Potential).				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)					TCTCTGACTTTTCTTTACACT	0.388													101	306	---	---	---	---	PASS
GTPBP10	85865	broad.mit.edu	37	7	90007490	90007490	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90007490A>G	uc003ukm.1	+	8	808	c.742A>G	c.(742-744)AGG>GGG	p.R248G	GTPBP10_uc003ukn.1_Missense_Mutation_p.R169G|GTPBP10_uc003uko.1_Missense_Mutation_p.R58G	NM_033107	NP_149098	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 isoform 2	248					ribosome biogenesis	chromosome|nucleolus	GTP binding|GTPase activity|magnesium ion binding				0						CACTCAATACAGGACAGCTTT	0.323													9	622	---	---	---	---	PASS
TSC22D4	81628	broad.mit.edu	37	7	100065183	100065183	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100065183G>T	uc003uva.2	-	4	1725	c.970C>A	c.(970-972)CAA>AAA	p.Q324K	TSC22D4_uc003uvb.2_Missense_Mutation_p.Q85K|TSC22D4_uc011kjv.1_Missense_Mutation_p.Q85K|TSC22D4_uc010lgx.2_Missense_Mutation_p.Q324K	NM_030935	NP_112197	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	324					negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			breast(2)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCATGGCTTGCTCGATTTTG	0.577													21	59	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107717486	107717486	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107717486A>T	uc010ljo.1	-	17	2111	c.2027T>A	c.(2026-2028)ATC>AAC	p.I676N	LAMB4_uc003vey.2_Missense_Mutation_p.I676N	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	676	Laminin IV type B.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TTCTAAACAGATGGGTGTGGG	0.383													91	237	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121652726	121652726	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121652726T>C	uc003vjy.2	+	12	4021	c.3626T>C	c.(3625-3627)GTT>GCT	p.V1209A	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1209	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						CCAATATTGGTTGAAACCCCC	0.388													6	313	---	---	---	---	PASS
SHARPIN	81858	broad.mit.edu	37	8	145154959	145154959	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145154959G>C	uc003zba.2	-	3	874	c.390C>G	c.(388-390)AAC>AAG	p.N130K	SHARPIN_uc003zbb.2_RNA	NM_030974	NP_112236	Q9H0F6	SHRPN_HUMAN	shank-interacting protein-like 1	130	Self-association (By similarity).				negative regulation of inflammatory response|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein linear polyubiquitination|regulation of CD40 signaling pathway|regulation of tumor necrosis factor-mediated signaling pathway	cytosol|LUBAC complex	polyubiquitin binding|zinc ion binding			ovary(1)	1	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTGGTGGTGAGTTGCTCTTGC	0.602													87	330	---	---	---	---	PASS
C9orf72	203228	broad.mit.edu	37	9	27565553	27565553	+	Silent	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27565553T>C	uc003zqq.2	-	3	577	c.480A>G	c.(478-480)GAA>GAG	p.E160E	C9orf72_uc003zqr.1_Silent_p.E160E	NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	160										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TCTCTGTGCCTTCTAAGATAA	0.328													8	550	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43625354	43625354	+	Silent	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43625354C>T	uc011lrb.1	-	4	3362	c.3333G>A	c.(3331-3333)AAG>AAA	p.K1111K		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	1111						integral to membrane					0						CTAAGTTGGGCTTCCTAGACT	0.483													5	125	---	---	---	---	PASS
TMEM38B	55151	broad.mit.edu	37	9	108472692	108472692	+	Intron	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108472692C>T	uc004bcu.1	+						TMEM38B_uc010mtn.1_Intron|uc004bcv.2_RNA	NM_018112	NP_060582	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B							integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2						TCTTTCATAACTTCGGCTTCT	0.403													105	351	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114176208	114176208	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114176208A>G	uc004bfe.1	-	21	2580	c.2580T>C	c.(2578-2580)GCT>GCC	p.A860A	KIAA0368_uc010muc.1_Silent_p.A682A	NM_001080398	NP_001073867			KIAA0368 protein												0						CAAATTTGGTAGCCAGCTTTT	0.318													5	334	---	---	---	---	PASS
LRRC20	55222	broad.mit.edu	37	10	72136294	72136294	+	5'UTR	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72136294A>G	uc001jqx.1	-	2					LRRC20_uc001jqy.1_5'UTR|LRRC20_uc001jqz.1_5'UTR	NM_207119	NP_997002	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20 isoform 1												0						CAGCATGCAGACACAGGTGTC	0.627													4	31	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95095749	95095749	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95095749A>G	uc001kin.2	-	41	4615	c.4492T>C	c.(4492-4494)TCA>CCA	p.S1498P	MYOF_uc001kio.2_Missense_Mutation_p.S1485P|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1498	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						AACGTATCTGAGAAGTCTGTC	0.393													7	458	---	---	---	---	PASS
HBG1	3047	broad.mit.edu	37	11	5269511	5269511	+	3'UTR	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5269511C>T	uc001mah.1	-	3					HBG2_uc001mai.1_3'UTR	NM_000559	NP_000550	P69891	HBG1_HUMAN	A-gamma globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity|protein binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGATCTCTCAGCAGAATAG	0.368													8	35	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023936	6023936	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023936C>G	uc010qzv.1	-	1	443	c.443G>C	c.(442-444)AGC>ACC	p.S148T		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTGGGAAGCTGATCGACCT	0.542													28	93	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9192364	9192364	+	Intron	SNP	C	T	T	rs59591821		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9192364C>T	uc001mhl.2	-						DENND5A_uc001mhk.2_Translation_Start_Site|DENND5A_uc010rbw.1_Intron|DENND5A_uc010rbx.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						cacacacacacataaatacac	0.199													6	92	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	10019811	10019811	+	Splice_Site	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10019811A>G	uc001mib.2	-	9	1113	c.975_splice	c.e9+1	p.L325_splice	SBF2_uc001mif.3_Splice_Site_p.L81_splice	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		AATATGTCATACCAAAGAAAG	0.328													6	442	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32996944	32996944	+	Intron	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32996944C>T	uc001mty.2	+						QSER1_uc001mtz.1_Intron|QSER1_uc001mua.2_Silent_p.L1213L	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1											ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					TAAGGAGACTCTAGCCATAGT	0.284													13	93	---	---	---	---	PASS
SLC25A45	283130	broad.mit.edu	37	11	65144051	65144051	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65144051C>T	uc001odp.1	-	6	1116	c.694G>A	c.(694-696)GAT>AAT	p.D232N	SLC25A45_uc009yqi.1_Missense_Mutation_p.D170N|SLC25A45_uc001odq.1_Missense_Mutation_p.D208N|SLC25A45_uc001odr.1_Missense_Mutation_p.D232N|SLC25A45_uc001ods.1_Missense_Mutation_p.D190N|SLC25A45_uc001odt.1_Missense_Mutation_p.D190N	NM_001077241	NP_001070709	Q8N413	S2545_HUMAN	solute carrier family 25, member 45 isoform b	232	Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CTCAGTCCATCCATCTGCATC	0.612													9	38	---	---	---	---	PASS
INTS4	92105	broad.mit.edu	37	11	77702320	77702320	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77702320T>C	uc001oys.2	-	2	108	c.80A>G	c.(79-81)AAA>AGA	p.K27R	INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.K27R|INTS4_uc001oyv.1_RNA	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	27					snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TAGTCGGAGTTTCTTAGTAGC	0.423													8	726	---	---	---	---	PASS
NARS2	79731	broad.mit.edu	37	11	78147613	78147613	+	3'UTR	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78147613T>C	uc001ozi.2	-	14					NARS2_uc010rsq.1_3'UTR	NM_024678	NP_078954	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial						asparaginyl-tRNA aminoacylation	mitochondrial matrix	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding			ovary(2)	2	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	CAATTACATATTGAAATCTGC	0.383													14	35	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92577387	92577387	+	Silent	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92577387G>T	uc001pdj.3	+	18	10871	c.10854G>T	c.(10852-10854)CTG>CTT	p.L3618L	FAT3_uc001pdi.3_Silent_p.L58L	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3618	Cadherin 33.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTATGTCCTGAATGTGTCTG	0.507										TCGA Ovarian(4;0.039)			18	53	---	---	---	---	PASS
CCDC84	338657	broad.mit.edu	37	11	118886008	118886008	+	Intron	SNP	A	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118886008A>C	uc001pul.2	+						CCDC84_uc010ryk.1_RNA|CCDC84_uc010ryl.1_Intron|CCDC84_uc010rym.1_Intron	NM_198489	NP_940891	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84											ovary(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TTTCCCTATCATTGTACAGAG	0.289													17	59	---	---	---	---	PASS
NFRKB	4798	broad.mit.edu	37	11	129754640	129754640	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129754640C>T	uc001qfi.2	-	7	943	c.742G>A	c.(742-744)GAT>AAT	p.D248N	NFRKB_uc001qfg.2_Missense_Mutation_p.D273N|NFRKB_uc001qfh.2_Missense_Mutation_p.D271N|NFRKB_uc010sbw.1_Missense_Mutation_p.D260N	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	248					DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		TGGTTCTCACCTGCAGTTTTC	0.572													8	81	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53448982	53448982	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53448982T>G	uc001sbp.2	+	8	670	c.535T>G	c.(535-537)TCA>GCA	p.S179A	uc001sbk.1_5'Flank|TENC1_uc001sbl.2_Missense_Mutation_p.S55A|TENC1_uc001sbm.2_Missense_Mutation_p.S189A|TENC1_uc001sbn.2_Missense_Mutation_p.S189A|TENC1_uc001sbo.1_Missense_Mutation_p.S179A	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	179	Phosphatase tensin-type.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CTTCAACCTTTCAGAGAAAAG	0.512													130	165	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102811734	102811734	+	Silent	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102811734T>C	uc001tjp.3	-	4	669	c.450A>G	c.(448-450)AAA>AAG	p.K150K	IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Silent_p.K150K|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3	150					anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TTGGCCAACCTTTCCTTCTCT	0.468													8	658	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23909980	23909980	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23909980A>G	uc001uon.2	-	10	8624	c.8035T>C	c.(8035-8037)TCA>CCA	p.S2679P	SACS_uc001uoo.2_Missense_Mutation_p.S2532P|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	2679					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGAACATCTGAGAACTGTGTC	0.418													5	153	---	---	---	---	PASS
UBAC2	337867	broad.mit.edu	37	13	99853778	99853778	+	Intron	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99853778G>T	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_5'UTR|UBAC2_uc001voc.2_Missense_Mutation_p.C38F|UBAC2_uc010tiw.1_RNA|uc001vnx.1_5'Flank|uc001vny.1_5'Flank	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGCTGTGCTGCTGGATGTTG	0.507											OREG0022482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	362	---	---	---	---	PASS
PSMA3	5684	broad.mit.edu	37	14	58737146	58737146	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58737146G>A	uc001xdj.1	+	9	647	c.601G>A	c.(601-603)GTA>ATA	p.V201I	C14orf37_uc010tro.1_Intron|PSMA3_uc001xdk.1_Missense_Mutation_p.V194I|uc001xdl.2_Intron	NM_002788	NP_002779	P25788	PSA3_HUMAN	proteasome alpha 3 subunit isoform 1	201					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity				0						AATTTACATAGTACATGACGA	0.343													129	293	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71571970	71571970	+	Silent	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71571970A>T	uc001xmo.2	+	33	6560	c.6114A>T	c.(6112-6114)GGA>GGT	p.G2038G	PCNX_uc010are.1_Silent_p.G1927G|PCNX_uc010arf.1_Silent_p.G826G|PCNX_uc001xmp.2_Silent_p.G122G	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	2038						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AAGGTTGCGGAGCTGGATGTA	0.428													55	149	---	---	---	---	PASS
SERPINA12	145264	broad.mit.edu	37	14	94962788	94962788	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94962788T>C	uc001ydj.2	-	4	1623	c.827A>G	c.(826-828)GAT>GGT	p.D276G		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	276					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		CTTGCCCTCATCAGGAAGGAT	0.483													5	196	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102470899	102470899	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102470899A>G	uc001yks.2	+	24	5092	c.4928A>G	c.(4927-4929)AAC>AGC	p.N1643S		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1643	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ATCATTGGAAACAGCAAGAAT	0.333													6	294	---	---	---	---	PASS
IVD	3712	broad.mit.edu	37	15	40707145	40707145	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40707145A>T	uc001zls.3	+	8	1185	c.851A>T	c.(850-852)GAC>GTC	p.D284V	IVD_uc001zlq.2_Missense_Mutation_p.D254V|IVD_uc001zlr.2_5'Flank	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1	281	Substrate binding.				leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		AGTGGGCTGGACCTGGAGCGG	0.622													21	68	---	---	---	---	PASS
DNAJC17	55192	broad.mit.edu	37	15	41065992	41065992	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41065992A>T	uc001zms.1	-	10	736	c.725T>A	c.(724-726)CTG>CAG	p.L242Q	DNAJC17_uc010bbz.1_RNA	NM_018163	NP_060633	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	242	RRM.				protein folding		heat shock protein binding|nucleotide binding|RNA binding|unfolded protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGAAATCTTCAGAGGGTTATC	0.592													19	47	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43818938	43818938	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43818938A>G	uc001zrt.2	+	4	5734	c.5267A>G	c.(5266-5268)AAG>AGG	p.K1756R		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1756						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCAGACTTCAAGGATTTCCAG	0.572													3	12	---	---	---	---	PASS
RAB8B	51762	broad.mit.edu	37	15	63555808	63555808	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63555808C>T	uc002alz.2	+	8	710	c.614C>T	c.(613-615)TCG>TTG	p.S205L	RAB8B_uc010uih.1_Missense_Mutation_p.S188L	NM_016530	NP_057614	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	205					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)|kidney(1)	2						TTTCGTTGCTCGCTACTTTGA	0.458													47	131	---	---	---	---	PASS
MAP2K1	5604	broad.mit.edu	37	15	66774209	66774209	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66774209T>C	uc010bhq.2	+	6	1160	c.685T>C	c.(685-687)TAC>CAC	p.Y229H	MAP2K1_uc010ujp.1_Missense_Mutation_p.Y207H	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	229	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						CACAAGGTCCTACATGTCGGT	0.557									Cardiofaciocutaneous_syndrome				4	183	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101601457	101601457	+	Silent	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101601457G>A	uc002bwr.2	+	30	5080	c.4761G>A	c.(4759-4761)CAG>CAA	p.Q1587Q	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1587					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGAGCTGCCAGCTCCAGGTCC	0.617													21	45	---	---	---	---	PASS
MPV17L	255027	broad.mit.edu	37	16	15501819	15501819	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15501819A>G	uc002ddn.2	+	4	585	c.441A>G	c.(439-441)CAA>CAG	p.Q147Q	MPV17L_uc002ddm.2_Missense_Mutation_p.M124V	NM_001128423	NP_001121895	Q2QL34	MP17L_HUMAN	MPV17 mitochondrial membrane protein-like	147	Lumenal.					integral to membrane|peroxisomal membrane					0						TTCCTGTTCAATGGAGAACAG	0.498													154	285	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20554163	20554163	+	Intron	SNP	G	A	A	rs28460075	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20554163G>A	uc002dhj.3	-						ACSM2B_uc002dhk.3_Intron|ACSM2B_uc010bwf.1_3'UTR	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						cacagtccctgttcttaaacc	0.219													4	77	---	---	---	---	PASS
HEATR3	55027	broad.mit.edu	37	16	50120249	50120249	+	Silent	SNP	T	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50120249T>G	uc002efw.2	+	11	1659	c.1497T>G	c.(1495-1497)CTT>CTG	p.L499L	HEATR3_uc002efx.2_Silent_p.L413L	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	499							binding			ovary(1)|skin(1)	2						CACAGCTGCTTTTTTCTCAAC	0.473													24	104	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70030117	70030117	+	Intron	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70030117C>G	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						AGGGGCTCATCATGAGTGCCA	0.423													4	214	---	---	---	---	PASS
MON1B	22879	broad.mit.edu	37	16	77232057	77232057	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77232057C>A	uc002fez.2	+	6	1826	c.1496C>A	c.(1495-1497)GCA>GAA	p.A499E	MON1B_uc010vnf.1_Missense_Mutation_p.A390E|MON1B_uc010vng.1_Missense_Mutation_p.A353E|MON1B_uc002ffa.2_Missense_Mutation_p.A379E|SYCE1L_uc010vnh.1_5'Flank	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B	499							protein binding				0						GTGACCAAGGCAGGTGCAATC	0.567													8	186	---	---	---	---	PASS
MAP1LC3B	81631	broad.mit.edu	37	16	87436734	87436734	+	3'UTR	SNP	G	T	T	rs115646842	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87436734G>T	uc002fjx.2	+	4					MAP1LC3B_uc010chs.2_RNA	NM_022818	NP_073729	Q9GZQ8	MLP3B_HUMAN	microtubule-associated proteins 1A/1B light						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0249)		TTCTAGAATTGTTTAAACCCT	0.413													4	222	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161618	90161618	+	Missense_Mutation	SNP	C	T	T	rs13338202	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161618C>T	uc002fqp.2	+	3	971	c.493C>T	c.(493-495)CGT>TGT	p.R165C	uc002fqq.2_Missense_Mutation_p.R182C					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CAGTGATGGACGTTGTCAGAA	0.607													5	107	---	---	---	---	PASS
OR1D4	8385	broad.mit.edu	37	17	2966855	2966855	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2966855C>T	uc010vra.1	-	1	101	c.101G>A	c.(100-102)GGG>GAG	p.G34E		NM_003552	NP_003543			olfactory receptor, family 1, subfamily D,												0						CTCTGAGATCCCCAGGAGAAG	0.483													4	35	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18647627	18647627	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18647627C>T	uc002guk.2	+	1	302	c.70C>T	c.(70-72)CCT>TCT	p.P24S	FBXW10_uc002guj.2_Missense_Mutation_p.P24S|FBXW10_uc002gul.2_Missense_Mutation_p.P24S|FBXW10_uc010cqh.1_Missense_Mutation_p.P24S	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	24										ovary(1)	1						CGATTCCATCCCTCTATGCCG	0.463													5	405	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21730916	21730916	+	Missense_Mutation	SNP	G	T	T	rs111245273	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21730916G>T	uc002gyy.3	+	2	343	c.218G>T	c.(217-219)CGG>CTG	p.R73L						SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GTCCTGCGTCGGAGAGGTGGT	0.552													4	76	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38508302	38508302	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38508302C>A	uc002huk.1	+	5	1065	c.610C>A	c.(610-612)CAG>AAG	p.Q204K	RARA_uc002hul.3_Missense_Mutation_p.Q204K|RARA_uc010wfe.1_Missense_Mutation_p.Q107K|RARA_uc002hun.1_Missense_Mutation_p.Q199K	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	204	Ligand-binding.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TGCCCTCTGCCAGCTGGGCAA	0.642			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								7	41	---	---	---	---	PASS
KRT15	3866	broad.mit.edu	37	17	39673185	39673185	+	Missense_Mutation	SNP	C	T	T	rs138271368		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39673185C>T	uc002hwy.2	-	3	804	c.613G>A	c.(613-615)GTT>ATT	p.V205I	KRT15_uc002hwz.2_Missense_Mutation_p.V107I|KRT15_uc002hxa.2_Missense_Mutation_p.V40I|KRT15_uc002hxb.1_Missense_Mutation_p.V40I	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	205	Rod.|Coil 1B.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)				TCAGCCTCAACGCCCTGGCGC	0.612													8	33	---	---	---	---	PASS
MLX	6945	broad.mit.edu	37	17	40721610	40721610	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40721610A>G	uc002iag.2	+	6	689	c.624A>G	c.(622-624)CTA>CTG	p.L208L	MLX_uc002iaf.2_Silent_p.L154L|MLX_uc002iah.2_Silent_p.L124L	NM_170607	NP_733752	Q9UH92	MLX_HUMAN	transcription factor-like protein 4 isoform	208					energy reserve metabolic process|negative regulation of transcription, DNA-dependent|positive regulation of cellular metabolic process	cytoplasm|nucleus	DNA binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding				0		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TCACCGCCCTAAAGATCATGA	0.498													76	244	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51902272	51902272	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51902272A>G	uc002iua.2	+	1	2034	c.1878A>G	c.(1876-1878)AGA>AGG	p.R626R	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	626					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TCCAGGAGAGAGCTGGTGGAG	0.438													8	427	---	---	---	---	PASS
CCDC47	57003	broad.mit.edu	37	17	61829787	61829787	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61829787G>A	uc002jbs.3	-	11	1432	c.1096C>T	c.(1096-1098)CCT>TCT	p.P366S	CCDC47_uc010ddx.2_Missense_Mutation_p.P366S|CCDC47_uc002jbt.2_Missense_Mutation_p.P366S	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor	366						integral to membrane	protein binding				0						CCTGAGCCAGGCACTGGAAAA	0.378													42	121	---	---	---	---	PASS
MRPS7	51081	broad.mit.edu	37	17	73258639	73258639	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73258639G>C	uc002jnm.3	+	2	378	c.145G>C	c.(145-147)GAA>CAA	p.E49Q	GGA3_uc002jni.1_5'Flank|GGA3_uc002jnj.1_5'Flank|GGA3_uc010wrw.1_5'Flank|GGA3_uc002jnk.1_5'Flank|GGA3_uc010wrx.1_5'Flank|GGA3_uc010wry.1_5'Flank|GGA3_uc010wrz.1_5'Flank|MRPS7_uc002jnl.2_Missense_Mutation_p.E49Q|MRPS7_uc002jnn.3_Missense_Mutation_p.E78Q	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7 precursor	49					translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome			central_nervous_system(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			GATTGACAAGGAATATTATCG	0.512													22	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76496393	76496393	+	RNA	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76496393G>A	uc002jvt.1	+	2		c.1852G>A								Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		GTACCTTGTAGTCCATCTGCT	0.617													7	17	---	---	---	---	PASS
CHMP1B	57132	broad.mit.edu	37	18	11852138	11852138	+	3'UTR	SNP	G	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11852138G>T	uc002kqe.2	+	1					GNAL_uc002kqc.2_Intron|GNAL_uc010dkz.2_Intron|GNAL_uc002kqd.2_Intron	NM_020412	NP_065145	Q7LBR1	CHM1B_HUMAN	chromatin modifying protein 1B						cell cycle|cell division|protein transport	cytosol|late endosome membrane	protein domain specific binding				0						AGGTTTCCTGGCCATAGCCAC	0.547													3	9	---	---	---	---	PASS
IFI30	10437	broad.mit.edu	37	19	18286140	18286140	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18286140G>C	uc002nic.1	+	3	408	c.335G>C	c.(334-336)AGG>ACG	p.R112T	PIK3R2_uc002nib.1_RNA	NM_006332	NP_006323	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	112					antigen processing and presentation of exogenous peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway	cell junction|extracellular region|lysosome	oxidoreductase activity, acting on a sulfur group of donors				0						GTCAGTGGCAGGTGGGAGTTC	0.622													30	48	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44564919	44564919	+	Silent	SNP	C	A	A	rs138294962		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44564919C>A	uc002oyf.1	+	4	413	c.160C>A	c.(160-162)CGA>AGA	p.R54R	ZNF284_uc010ejd.2_RNA	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223	54	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				ACCATTCCACCGAGATACTTT	0.413													5	381	---	---	---	---	PASS
SULT2B1	6820	broad.mit.edu	37	19	49096055	49096055	+	Silent	SNP	C	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49096055C>G	uc002pjl.2	+	5	708	c.627C>G	c.(625-627)ACC>ACG	p.T209T	SULT2B1_uc002pjm.2_Silent_p.T194T	NM_177973	NP_814444	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	209					3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	alcohol sulfotransferase activity|protein binding|steroid sulfotransferase activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		TATTTATCACCTACGAGGAGC	0.597													11	83	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58101848	58101848	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101848A>C	uc002qpg.2	+	4	766	c.669A>C	c.(667-669)AAA>AAC	p.K223N	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.K168N|ZIK1_uc002qpi.2_Missense_Mutation_p.K210N|ZIK1_uc002qpj.2_Missense_Mutation_p.K120N	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	223					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCAGGCACAAACACACTCCTG	0.463													15	45	---	---	---	---	PASS
C22orf30	253143	broad.mit.edu	37	22	32108234	32108234	+	Missense_Mutation	SNP	C	T	T	rs143043548	byFrequency	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32108234C>T	uc003alp.3	-	4	5784	c.5591G>A	c.(5590-5592)CGG>CAG	p.R1864Q	C22orf30_uc003alo.1_Missense_Mutation_p.R1663Q|C22orf30_uc010gwj.1_Missense_Mutation_p.R1663Q	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143	1864											0						GGCTGGAGACCGTAACCCTTT	0.532													26	72	---	---	---	---	PASS
RBBP7	5931	broad.mit.edu	37	X	16870672	16870672	+	Splice_Site	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16870672A>G	uc004cxt.2	-	8	1321	c.963_splice	c.e8+1	p.Q321_splice	RBBP7_uc004cxs.1_Splice_Site_p.Q365_splice|RBBP7_uc004cxu.2_Splice_Site_p.Q312_splice	NM_002893	NP_002884	Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7						cell proliferation|cellular heat acclimation|CenH3-containing nucleosome assembly at centromere|DNA replication|multicellular organismal development|negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex|NuRD complex	protein binding			upper_aerodigestive_tract(1)|ovary(1)	2	Hepatocellular(33;0.0997)					ACTGTCACATACCTGGAAAAT	0.363													4	113	---	---	---	---	PASS
NYX	60506	broad.mit.edu	37	X	41307115	41307115	+	5'UTR	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41307115G>A	uc004dfh.2	+	1					NYX_uc011mku.1_5'UTR	NM_022567	NP_072089	Q9GZU5	NYX_HUMAN	nyctalopin precursor						response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix				lung(2)	2						GGGGTCCCACGGCTGGGTGGT	0.612													4	93	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71933736	71933736	+	Translation_Start_Site	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71933736C>T	uc004eax.3	-	1	294	c.-7G>A	c.(-9--5)ACGTG>ACATG		PHKA1_uc004eay.3_Translation_Start_Site|PHKA1_uc011mqi.1_Translation_Start_Site	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					CATGGCGACACGTTACTAATT	0.607													3	33	---	---	---	---	PASS
PLS3	5358	broad.mit.edu	37	X	114856594	114856594	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114856594T>C	uc004eqd.2	+	3	500	c.110T>C	c.(109-111)CTT>CCT	p.L37P	PLS3_uc010nqf.2_RNA|PLS3_uc010nqg.2_Missense_Mutation_p.L37P|PLS3_uc011mtf.1_Missense_Mutation_p.L15P|PLS3_uc004eqe.2_Missense_Mutation_p.L37P|PLS3_uc011mtg.1_Missense_Mutation_p.L37P|PLS3_uc011mth.1_5'UTR	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3	37	EF-hand 1.					cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						GACTATGAACTTCATGAGCTC	0.353													7	328	---	---	---	---	PASS
PLS3	5358	broad.mit.edu	37	X	114864223	114864223	+	Silent	SNP	A	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114864223A>G	uc004eqd.2	+	5	834	c.444A>G	c.(442-444)CCA>CCG	p.P148P	PLS3_uc010nqf.2_RNA|PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Silent_p.P126P|PLS3_uc004eqe.2_Silent_p.P148P|PLS3_uc011mtg.1_Silent_p.P121P|PLS3_uc011mth.1_Silent_p.P103P	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3	148	Actin-binding 1.|CH 1.					cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						ATGTTATACCAATGAACCCTA	0.333													131	278	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11900	11900	+	RNA	SNP	G	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11900G>A	uc004cov.3	+	1		c.1323G>A			uc004cow.1_5'Flank|uc004cox.3_5'Flank|uc004coy.2_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		GAGAACTCTCTGTGCTAGTAA	0.443													50	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14235	14235	+	RNA	SNP	C	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14235C>T	uc004cox.3	+	1		c.1899C>T			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		ACGCCCATAATCATACAAAGC	0.413													4	153	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5657676	5657677	+	Intron	INS	-	C	C	rs143432256	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5657676_5657677insC	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																		GGAGAGAGAGGCGCTGACAAGA	0.530													0	6	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15319966	15319966	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15319966delA	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron|KAZ_uc001avo.2_Intron|KAZ_uc001avp.2_Intron|KAZ_uc001avq.2_Intron|KAZ_uc001avr.2_Intron	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						actccatctcaaaaaaaaaaa	0.224													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30028400	30028400	+	IGR	DEL	C	-	-	rs113711260		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30028400delC								PTPRU (375085 upstream) : None (None downstream)																							TTCCGGGGCACTTTTTGTCTG	0.473													15	7	---	---	---	---	
MIER1	57708	broad.mit.edu	37	1	67436877	67436877	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67436877delT	uc001dde.2	+						MIER1_uc010opf.1_Intron|MIER1_uc009way.2_Intron|MIER1_uc001ddc.2_Intron|MIER1_uc001ddh.2_Intron|MIER1_uc001ddf.2_Intron|MIER1_uc001ddg.2_Intron|MIER1_uc010opg.1_Intron|MIER1_uc001ddj.1_Intron|MIER1_uc001ddi.2_Intron	NM_001077700	NP_001071168	Q8N108	MIER1_HUMAN	mesoderm induction early response 1 isoform b						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)	1						ttcattaggctttttaaaatT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84709900	84709900	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84709900delA								PRKACB (5721 upstream) : SAMD13 (54149 downstream)																							actctgtctcaaaaaaaaaaa	0.204													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88189507	88189507	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88189507delA								LMO4 (374904 upstream) : PKN2 (960415 downstream)																							ATGATCTCAGAAAAAAAAAAT	0.373													13	6	---	---	---	---	
CCBL2	56267	broad.mit.edu	37	1	89435339	89435339	+	Intron	DEL	T	-	-	rs76474607		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89435339delT	uc001dmp.2	-						CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1						biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AAGGAATGCCttttttttttt	0.184													4	2	---	---	---	---	
HFM1	164045	broad.mit.edu	37	1	91861409	91861409	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91861409delT	uc001doa.3	-						HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Intron	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AGTTTATTACttttttttttt	0.114													7	4	---	---	---	---	
INTS3	65123	broad.mit.edu	37	1	153744497	153744499	+	Intron	DEL	GGT	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153744497_153744499delGGT	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron|INTS3_uc010peb.1_Intron|INTS3_uc001fcw.2_Intron|INTS3_uc010pec.1_Intron|INTS3_uc001fcy.2_Intron|INTS3_uc001fcx.2_Intron	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GATTGCTGTCggtggtggtggtg	0.483											OREG0013827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194022243	194022244	+	IGR	DEL	TG	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194022243_194022244delTG								CDC73 (798303 upstream) : None (None downstream)																							TGTGGGGATATGTGTGTGTGTG	0.446													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217038068	217038069	+	Intron	INS	-	TT	TT	rs141584307	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217038068_217038069insTT	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CGTGGAGTAACAGACCAACTTA	0.495													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221249336	221249337	+	IGR	INS	-	CT	CT			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221249336_221249337insCT								HLX (190938 upstream) : LOC400804 (253933 downstream)																							ACTACAGCACCCTCTCTCCCTA	0.450													4	2	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236751520	236751520	+	Intron	DEL	A	-	-	rs34200005		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236751520delA	uc001hyd.1	-							NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGGCCTTTTGAGATTAATAAT	0.343													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248016213	248016236	+	IGR	DEL	ACACACACAGAGAGAGAGAGAGAG	-	-	rs71950488	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248016213_248016236delACACACACAGAGAGAGAGAGAGAG								OR11L1 (11015 upstream) : TRIM58 (4265 downstream)																							acacacacacacacacacagagagagagagagagagagagagag	0.147													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2631276	2631277	+	IGR	INS	-	G	G	rs140220490	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2631276_2631277insG								MYT1L (296231 upstream) : TSSC1 (561464 downstream)																							gcacctctggaggggtctgcca	0.069													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35836478	35836479	+	IGR	INS	-	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35836478_35836479insT								None (None upstream) : CRIM1 (746918 downstream)																							CCATTTAGGGATTTTTTTTTCT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91765298	91765299	+	IGR	INS	-	A	A	rs142746952		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91765298_91765299insA								None (None upstream) : LOC654342 (39893 downstream)																							gctcactgaggaaaaaaaatct	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176944473	176944473	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176944473delA								KIAA1715 (76959 upstream) : EVX2 (364 downstream)																							TCAGCCAAGCAACCCGGACCT	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	179377763	179377763	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179377763delT								PLEKHA3 (7983 upstream) : TTN (12957 downstream)																							ACAGTGGCACttttttttttt	0.184													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	190452700	190452701	+	IGR	INS	-	C	C	rs145625088	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190452700_190452701insC								SLC40A1 (4216 upstream) : ASNSD1 (73424 downstream)																							GCTGCGAGCTTCCCCTTGTCTG	0.450													4	8	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866695	224866695	+	Intron	DEL	T	-	-	rs10706128		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866695delT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ACTTTACTACttttttttttt	0.184													18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238039306	238039307	+	IGR	DEL	TG	-	-	rs148541514		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238039306_238039307delTG								COPS8 (31819 upstream) : COL6A3 (193348 downstream)																							gtgcatgtgatgtgtcagtgat	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239934154	239934155	+	IGR	INS	-	T	T	rs141725160	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239934154_239934155insT								TWIST2 (101917 upstream) : HDAC4 (35710 downstream)																							CCATGGGCGCCAGGCCTCCCAC	0.639													2	7	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	242021011	242021012	+	Intron	INS	-	TCG	TCG	rs73010045	byFrequency	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242021011_242021012insTCG	uc002wah.1	+						SNED1_uc002wai.1_Intron|SNED1_uc002waj.1_Intron	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TCAGGTCATCAAGGAAGGGACA	0.599													8	4	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242343091	242343091	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242343091delT	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TGCTTCAGACTTTTTTTTTTA	0.284													12	6	---	---	---	---	
XYLB	9942	broad.mit.edu	37	3	38404189	38404190	+	Intron	INS	-	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38404189_38404190insC	uc003cic.2	+						XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_Intron	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase						D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TTTGAGGATTGGTGGTTTATGA	0.168													10	6	---	---	---	---	
ZBTB47	92999	broad.mit.edu	37	3	42704330	42704331	+	Intron	INS	-	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42704330_42704331insA	uc003clu.1	+							NM_145166	NP_660149	Q9UFB7	ZBT47_HUMAN	zinc finger protein 651						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.216)		GAGACCCAGCCATGGAGGCAGG	0.624													4	2	---	---	---	---	
MYH15	22989	broad.mit.edu	37	3	108129282	108129282	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108129282delA	uc003dxa.1	-							NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15							myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CATCTAAAGTAAAAAAAAAAT	0.333													9	4	---	---	---	---	
MORC1	27136	broad.mit.edu	37	3	108703391	108703392	+	Intron	INS	-	GG	GG	rs145625526	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108703391_108703392insGG	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TGAAAAGGTTTGGGGGTAAGGT	0.337													22	14	---	---	---	---	
WDR52	55779	broad.mit.edu	37	3	113048793	113048793	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113048793delA	uc003ead.1	-						WDR52_uc010hqk.1_5'Flank			Q96MT7	WDR52_HUMAN	RecName: Full=WD repeat protein 52.; Flags: Fragment;											central_nervous_system(1)	1						TTTCCAAAACAAAAAAAAAAG	0.443													4	4	---	---	---	---	
H1FOO	132243	broad.mit.edu	37	3	129262692	129262693	+	Intron	INS	-	G	G			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129262692_129262693insG	uc003emu.2	+							NM_153833	NP_722575	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific						meiosis|nucleosome assembly	cytoplasm|nucleosome	DNA binding			skin(1)	1						gcttcagtggcggtaatccaga	0.000													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140285644	140285645	+	3'UTR	INS	-	TCTC	TCTC	rs141617411	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140285644_140285645insTCTC	uc003etn.2	+	17						NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGTACACACATtctctctctct	0.371										HNSCC(16;0.037)			6	3	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142772377	142772378	+	Intron	INS	-	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142772377_142772378insT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron|SR140_uc003evl.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						GAAGGGGTAGATTTTTTTTTTT	0.213													6	5	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158970337	158970337	+	Intron	DEL	T	-	-	rs79500886		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158970337delT	uc003fcq.1	+						SCHIP1_uc003fcr.1_Intron|IQCJ_uc003fco.2_Intron|IQCJ_uc010hvy.1_Intron|IQCJ_uc003fcp.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CAAAGCCACATTTTTTTTTTC	0.279													10	7	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173502536	173502537	+	Intron	INS	-	GAA	GAA	rs142837391	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173502536_173502537insGAA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AAAGACATTCTGAAGAAGAGAG	0.381													1	7	---	---	---	---	
AASDH	132949	broad.mit.edu	37	4	57250084	57250085	+	Intron	INS	-	A	A	rs137894855	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57250084_57250085insA	uc003hbn.2	-						AASDH_uc010ihb.2_5'Flank|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_Intron|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Intron|AASDH_uc003hbp.2_Intron|AASDH_uc003hbq.1_Intron	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase						fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				aaaataataCTGGGGAAATGCA	0.267													10	7	---	---	---	---	
EPHA5	2044	broad.mit.edu	37	4	66218505	66218506	+	Intron	INS	-	T	T	rs147005599	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66218505_66218506insT	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						acttctctgcattttttttttC	0.168										TSP Lung(17;0.13)			9	8	---	---	---	---	
CENPC1	1060	broad.mit.edu	37	4	68338163	68338164	+	3'UTR	DEL	TG	-	-	rs140237565		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68338163_68338164delTG	uc003hdd.1	-	19					CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1						mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						AGAAAAAACATGTGAGTTAGAA	0.233													2	6	---	---	---	---	
USO1	8615	broad.mit.edu	37	4	76712065	76712065	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76712065delA	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTTAGGAGAGAAAAAAAAAAA	0.204													13	6	---	---	---	---	
TLL1	7092	broad.mit.edu	37	4	167012137	167012138	+	Intron	INS	-	AT	AT	rs150647201	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167012137_167012138insAT	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ATTGATTTCACCTTTCTTAATT	0.257													6	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188964579	188964579	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188964579delA								ZFP42 (38380 upstream) : TRIML2 (47848 downstream)																							gagcctcaccaaaaatagcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	63313583	63313583	+	IGR	DEL	G	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63313583delG								HTR1A (56037 upstream) : RNF180 (148088 downstream)																							cctaaacttaggagactaaaa	0.104													4	2	---	---	---	---	
PPWD1	23398	broad.mit.edu	37	5	64875058	64875059	+	Intron	INS	-	A	A	rs138975983	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64875058_64875059insA	uc003jtv.3	+						PPWD1_uc011cqv.1_Intron|PPWD1_uc011cqw.1_Intron	NM_015342	NP_056157	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		TTCTGTTTTTTAACCTGAAAAT	0.168													12	8	---	---	---	---	
SNX2	6643	broad.mit.edu	37	5	122153222	122153222	+	Intron	DEL	T	-	-	rs144714905		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122153222delT	uc003kte.2	+						SNX2_uc011cwn.1_Intron	NM_003100	NP_003091	O60749	SNX2_HUMAN	sorting nexin 2						cell communication|endocytosis|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding|protein transporter activity			kidney(1)	1		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		ATTATGTAAATTTTTTTTGTT	0.219													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124478764	124478764	+	IGR	DEL	A	-	-	rs113213307		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124478764delA								ZNF608 (394264 upstream) : None (None downstream)																							tccacaggctaaatacacaga	0.000													6	7	---	---	---	---	
PFDN1	5201	broad.mit.edu	37	5	139660843	139660843	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139660843delT	uc003lff.1	-						C5orf32_uc010jfi.2_Intron|PFDN1_uc003lfe.1_Intron|PFDN1_uc003lfg.1_Intron	NM_002622	NP_002613	O60925	PFD1_HUMAN	prefoldin subunit 1						'de novo' posttranslational protein folding|cell cycle	prefoldin complex	sequence-specific DNA binding transcription factor activity|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGACTATTCTTTTTTTTTTG	0.289													14	7	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156755278	156755278	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156755278delA	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			gacatcgactaaaagccgatg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	4304269	4304269	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4304269delA								PECI (168438 upstream) : CDYL (402124 downstream)																							GGTCACCAGGAAAAAAAAATG	0.398													16	7	---	---	---	---	
MBOAT1	154141	broad.mit.edu	37	6	20122892	20122892	+	Intron	DEL	G	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20122892delG	uc003ncx.1	-						MBOAT1_uc011dji.1_Intron	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			aggaaggaatggggagttatt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20295294	20295294	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20295294delT								MBOAT1 (82624 upstream) : E2F3 (106843 downstream)																							cattgatctgtttttttgtac	0.000													6	3	---	---	---	---	
SYNGAP1	8831	broad.mit.edu	37	6	33389530	33389531	+	Intron	DEL	TG	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33389530_33389531delTG	uc011dri.1	+						SYNGAP1_uc003oeo.1_Intron|SYNGAP1_uc010juy.2_Intron	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						CCAGACAGTATGTGTGTGTGTG	0.500													4	2	---	---	---	---	
PEX6	5190	broad.mit.edu	37	6	42932348	42932348	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42932348delT	uc003otf.2	-						uc003ote.1_5'Flank|PEX6_uc010jya.2_Intron	NM_000287	NP_000278	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6						protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)	1			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CTCCCACTAGttttttttttc	0.279													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	70117799	70117799	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70117799delT								BAI3 (18397 upstream) : LMBRD1 (267952 downstream)																							AAGTTGGAACTTACATATTCA	0.318													4	2	---	---	---	---	
TXLNB	167838	broad.mit.edu	37	6	139610176	139610177	+	Intron	DEL	GC	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139610176_139610177delGC	uc011eds.1	-							NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta							cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GTAGAGAAAGGCAATGTCCTTT	0.238													4	2	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169618136	169618139	+	Intron	DEL	GATG	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169618136_169618139delGATG	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		gggtggatgagatggatggatgga	0.010													7	5	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34027288	34027288	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34027288delT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						ATCCTACTACTTTTTTTTTTT	0.418													4	2	---	---	---	---	
LOC285954	285954	broad.mit.edu	37	7	41797976	41797976	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41797976delT	uc003tht.3	+							NR_027118				Homo sapiens cDNA FLJ38947 fis, clone NT2NE2017792.												0						taaacactgattttttttttc	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125474578	125474578	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125474578delA								POT1 (904541 upstream) : GRM8 (604074 downstream)																							taaagctaggagttgaaaaga	0.000													4	2	---	---	---	---	
SGCZ	137868	broad.mit.edu	37	8	14338102	14338103	+	Intron	INS	-	A	A	rs74439882		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14338102_14338103insA	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TAATCATTCTCATCATGCTGAC	0.243													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77159836	77159836	+	IGR	DEL	T	-	-	rs74726863		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77159836delT								HNF4G (680777 upstream) : LOC100192378 (363279 downstream)																							acttccagaattttttttttt	0.000													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	79980015	79980016	+	IGR	INS	-	A	A	rs143028382	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79980015_79980016insA								IL7 (262257 upstream) : STMN2 (543364 downstream)																							atgcagatgacaaaaaaaagca	0.000													7	8	---	---	---	---	
RUNX1T1	862	broad.mit.edu	37	8	93099131	93099131	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93099131delT	uc011lgi.1	-						RUNX1T1_uc003yfe.1_Intron|RUNX1T1_uc010mao.2_Intron|RUNX1T1_uc003yfh.1_Intron	NM_175636	NP_783554	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1						generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGCAACAAGCTTCTCGCCTGG	0.498													4	2	---	---	---	---	
C9orf82	79886	broad.mit.edu	37	9	26852798	26852798	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26852798delA	uc003zqc.2	-						C9orf82_uc003zqb.2_Intron	NM_024828	NP_079104	Q9H8G2	CI082_HUMAN	hypothetical protein LOC79886												0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(42;1.39e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		cgagctctggaaaaaaaaaaa	0.040													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29529958	29529959	+	IGR	INS	-	TGTTAA	TGTTAA	rs142660131	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29529958_29529959insTGTTAA								MIR873 (641005 upstream) : None (None downstream)																							aaaaaattggttgttagtgaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	35136925	35136925	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35136925delT								KIAA1539 (21032 upstream) : UNC13B (25064 downstream)																							ccaccccccatttttttttta	0.000													4	2	---	---	---	---	
GBA2	57704	broad.mit.edu	37	9	35749945	35749946	+	5'Flank	INS	-	CC	CC			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35749945_35749946insCC	uc003zxw.2	-						GBA2_uc011lpb.1_5'Flank|GBA2_uc011lpc.1_5'Flank|GBA2_uc011lpd.1_5'UTR|RGP1_uc011lpe.1_Intron|RGP1_uc011lpf.1_Intron	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase						bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCAGAGCTCAGGTTGTCCTGTA	0.554													23	10	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77418972	77418973	+	Intron	INS	-	A	A	rs138585311	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77418972_77418973insA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_5'Flank	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CTCTGTTTCTCTCCATGATTAG	0.337													12	7	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78587997	78587998	+	Intron	INS	-	A	A	rs149376639	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78587997_78587998insA	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						gtctccctggtaaaaaaaatgg	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	121065081	121065081	+	IGR	DEL	G	-	-	rs34964017		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121065081delG								TLR4 (585317 upstream) : DBC1 (863827 downstream)																							TTTGTCCCCAGTCTGAATCTG	0.284													9	5	---	---	---	---	
DNM1	1759	broad.mit.edu	37	9	130994069	130994069	+	Intron	DEL	C	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130994069delC	uc011mau.1	+						DNM1_uc010mxr.2_Intron|DNM1_uc011mat.1_Intron	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1						receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						gtcattactaccccattttcc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	17362669	17362670	+	IGR	INS	-	ATC	ATC	rs150271971		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17362669_17362670insATC								VIM (83077 upstream) : ST8SIA6 (7 downstream)																							ATGAGTCAGATATGGTGTCCAT	0.332													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34153682	34153682	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34153682delA								NRP1 (529676 upstream) : PARD3 (246416 downstream)																							TGTAAAAAAGAAAAAAAAAAC	0.388													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42356395	42356395	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42356395delA								None (None upstream) : LOC441666 (470920 downstream)																							cttccattccattccattcca	0.000													4	4	---	---	---	---	
ASCC1	51008	broad.mit.edu	37	10	73874603	73874603	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73874603delT	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						gtcagcaaactttttttttta	0.104													3	3	---	---	---	---	
PNLIPRP1	5407	broad.mit.edu	37	10	118351098	118351099	+	Intron	INS	-	TAC	TAC	rs148419179	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118351098_118351099insTAC	uc001lco.1	+						PNLIPRP1_uc001lcp.2_Intron|PNLIPRP1_uc001lcn.2_Intron|PNLIPRP1_uc009xys.1_Intron	NM_006229	NP_006220	P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1 precursor						lipid metabolic process		calcium ion binding|triglyceride lipase activity			ovary(1)|breast(1)	2				all cancers(201;0.0161)		AATGGGACTGATACTACTACCG	0.485													9	6	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9518155	9518155	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9518155delT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		tttctttttctttttttttga	0.204													4	2	---	---	---	---	
LDHAL6A	160287	broad.mit.edu	37	11	18500107	18500107	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18500107delA	uc001mop.1	+						LDHAL6A_uc001moq.2_Intron	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	agtccgtctcaaaaaaaaaag	0.174													5	4	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70719847	70719847	+	Intron	DEL	T	-	-	rs113810067		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70719847delT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCATTTACCATTTTTTTTTTT	0.448													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89485912	89485912	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89485912delA								TRIM77 (34874 upstream) : TRIM49 (44912 downstream)																							acaaacaaacaaaaaaaaaaa	0.373													5	3	---	---	---	---	
HDAC7	51564	broad.mit.edu	37	12	48176656	48176657	+	3'UTR	DEL	CA	-	-	rs67892211		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48176656_48176657delCA	uc010slo.1	-	26					HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_3'UTR|HDAC7_uc001rqj.3_3'UTR|HDAC7_uc001rqk.3_3'UTR	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		acgcctcactcacacacatgct	0.322													11	10	---	---	---	---	
ANKRD52	283373	broad.mit.edu	37	12	56650764	56650764	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56650764delT	uc001skm.3	-						ANKRD52_uc001skn.1_Intron	NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						CAACTTATCCTTTTTGAAAGG	0.507													102	75	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59360450	59360450	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59360450delT								LRIG3 (46188 upstream) : SLC16A7 (629398 downstream)																							AAAAATAAAGTTTTTTTTTTT	0.353													9	4	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88530707	88530707	+	Intron	DEL	T	-	-	rs112841615		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88530707delT	uc001tar.2	-						CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GCTTAAGAACTTTTTTTTTTT	0.284													18	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22778118	22778118	+	Intron	DEL	A	-	-	rs34486609		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22778118delA	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																		GAGAAGAGTCAGGGGGTGAGC	0.473													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	41979774	41979777	+	IGR	DEL	TGAA	-	-	rs141781977		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41979774_41979777delTGAA								NAA16 (28608 upstream) : OR7E37P (25699 downstream)																							CCGAATAAACTGAATGAGCTTTTA	0.348													5	3	---	---	---	---	
CLYBL	171425	broad.mit.edu	37	13	100265950	100265951	+	Intron	DEL	TG	-	-	rs145015784		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100265950_100265951delTG	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TAAACATGACTGAGATGGAAAA	0.257													6	6	---	---	---	---	
MCF2L	23263	broad.mit.edu	37	13	113730586	113730586	+	Intron	DEL	T	-	-	rs111246282		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113730586delT	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron|MCF2L_uc001vss.3_Intron|MCF2L_uc010tjs.1_Intron|MCF2L_uc001vst.1_Intron	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				tttattattattttttttttg	0.179													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	61622532	61622532	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61622532delA								SLC38A6 (72082 upstream) : PRKCH (31755 downstream)																							ACTCCGTGGTAAAAAAAAATC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76980178	76980179	+	IGR	INS	-	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76980178_76980179insT								ESRRB (12000 upstream) : VASH1 (248056 downstream)																							CCTCAGCCATGTTTTTTTTTCC	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23140658	23140660	+	IGR	DEL	AGG	-	-	rs60632541		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23140658_23140660delAGG								NIPA1 (53815 upstream) : WHAMML1 (47071 downstream)																							AAAAAAAAAAAGGAAGAATACAT	0.266													2	4	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40894859	40894860	+	Intron	INS	-	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40894859_40894860insA	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		taattttgtattttggtagaga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61683798	61683798	+	IGR	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61683798delA								RORA (162296 upstream) : VPS13C (460794 downstream)																							tgaagtagataattttaaaag	0.040													4	2	---	---	---	---	
GOLGA6C	653641	broad.mit.edu	37	15	75552532	75552532	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75552532delT	uc002azs.1	+							NM_001145224	NP_001138696	A6NDK9	GOG6C_HUMAN	golgi autoantigen, golgin subfamily a, 6D											ovary(1)	1						CCCCCCACACTTTTTTTTTTA	0.443													9	5	---	---	---	---	
SGK269	79834	broad.mit.edu	37	15	77408903	77408903	+	Intron	DEL	A	-	-	rs74364657	byFrequency	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77408903delA	uc002bcm.2	-							NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		CAAATAGATTAAAAAAAAAAA	0.313													3	3	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81595688	81595688	+	Intron	DEL	T	-	-	rs113855862		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81595688delT	uc002bgh.3	+						IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron|IL16_uc002bgi.1_Intron|IL16_uc002bgj.2_Intron|IL16_uc002bgk.2_Intron|IL16_uc002bgl.1_Intron|IL16_uc010unq.1_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						tttacatacattttttttttc	0.194													12	7	---	---	---	---	
CPEB1	64506	broad.mit.edu	37	15	83214764	83214765	+	Intron	INS	-	T	T	rs72535639	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83214764_83214765insT	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_Intron|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron|CPEB1_uc002bip.2_Intron	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			ATGTCTGTCCCGGTCTGACCTT	0.411													6	11	---	---	---	---	
E4F1	1877	broad.mit.edu	37	16	2275227	2275228	+	Intron	INS	-	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2275227_2275228insT	uc002cpm.2	+						E4F1_uc010bsi.2_Intron|E4F1_uc010bsj.2_Intron	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F						cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						aagaaaaaagaTTGTGTGTCAT	0.277													7	4	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12640890	12640891	+	Intron	DEL	TC	-	-	rs71873816		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12640890_12640891delTC	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						AGATAAAGCATCTGTTTTCATG	0.436													3	6	---	---	---	---	
KIAA0556	23247	broad.mit.edu	37	16	27700731	27700731	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27700731delA	uc002dow.2	+						KIAA0556_uc002dox.1_Intron	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						gactccgtctaaaaaaaaaaa	0.189													3	5	---	---	---	---	
PSMB10	5699	broad.mit.edu	37	16	67969814	67969814	+	Intron	DEL	C	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67969814delC	uc002eux.1	-							NM_002801	NP_002792	P40306	PSB10_HUMAN	proteasome beta 10 subunit proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|humoral immune response|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)		CTTCCAATGGCCCCAACCCCG	0.672													4	2	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70192462	70192463	+	3'UTR	DEL	TA	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70192462_70192463delTA	uc002eyf.1	+	19					CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_3'UTR|PDPR_uc002eyg.1_3'UTR|PDPR_uc002eyh.2_3'UTR|PDPR_uc010vls.1_3'UTR	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CTTTAGTGCCTAAACCTTTTTG	0.436													5	7	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71061896	71061896	+	Intron	DEL	T	-	-	rs142337199		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71061896delT	uc002ezr.2	-						HYDIN_uc010cfz.1_Intron|HYDIN_uc002ezv.2_Intron	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				AATATAAGACTTTTTTTTTTT	0.408													6	3	---	---	---	---	
PHLPP2	23035	broad.mit.edu	37	16	71710659	71710659	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71710659delT	uc002fax.2	-						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Intron	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						CTCTGTTTACttttttttttt	0.144													11	5	---	---	---	---	
CRISPLD2	83716	broad.mit.edu	37	16	84928715	84928716	+	Intron	INS	-	A	A	rs138715390	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84928715_84928716insA	uc010voh.1	+						CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Intron	NM_031476	NP_113664	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain							extracellular region|transport vesicle					0						gctctgcacacgttagcacatc	0.248													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30424190	30424190	+	IGR	DEL	T	-	-	rs112375622		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30424190delT								LRRC37B (43673 upstream) : RHOT1 (45283 downstream)																							cttttctttcttttttttttt	0.119													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48284266	48284266	+	IGR	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48284266delT								COL1A1 (5266 upstream) : TMEM92 (67571 downstream)																							cttttcttagttttttttttc	0.189													2	4	---	---	---	---	
SPATA20	64847	broad.mit.edu	37	17	48625308	48625319	+	Intron	DEL	GGGGAGGGGCCT	-	-	rs3833151	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48625308_48625319delGGGGAGGGGCCT	uc002irf.2	+						SPATA20_uc002irc.2_Intron|SPATA20_uc002ire.2_Intron|SPATA20_uc002ird.2_Intron|SPATA20_uc010wmv.1_5'Flank|SPATA20_uc002irg.2_5'Flank	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20						cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GGAAGGGCCGGGGGAGGGGCCTGGGGAGGGGT	0.656													6	3	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60550365	60550365	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60550365delA	uc002izx.3	+									Q86UE8	TLK2_HUMAN	SubName: Full=Putative uncharacterized protein TLK1; Flags: Fragment;						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						ACTTACAAGCAAAAAAATAAC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15003198	15003199	+	IGR	INS	-	C	C	rs138604320	by1000genomes	TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15003198_15003199insC								ANKRD30B (150461 upstream) : LOC644669 (310356 downstream)																							AGGGAGAAGAACAGACATGCAG	0.634													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22124002	22124006	+	IGR	DEL	CTGTC	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22124002_22124006delCTGTC								HRH4 (64082 upstream) : ZNF521 (517882 downstream)																							TGAGCGAAGACTGTCTGCAGACATG	0.322													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22124007	22124008	+	IGR	INS	-	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22124007_22124008insA								HRH4 (64087 upstream) : ZNF521 (517880 downstream)																							GAAGACTGTCTGCAGACATGAA	0.317													9	5	---	---	---	---	
SERPINB5	5268	broad.mit.edu	37	18	61153240	61153240	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61153240delA	uc002liz.3	+						SERPINB5_uc002liy.2_Intron	NM_002639	NP_002630	P36952	SPB5_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1						TTGGAACAATAAAAAAAAAAA	0.333													15	10	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77737811	77737815	+	Intron	DEL	TTTTG	-	-	rs71338078		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77737811_77737815delTTTTG	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TCAGGGCAAtttttgttttgttttt	0.137													18	11	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14755138	14755138	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14755138delT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						tctttctttcttttttttttt	0.189													19	9	---	---	---	---	
C19orf42	79086	broad.mit.edu	37	19	16746962	16746962	+	Intron	DEL	G	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16746962delG	uc002neo.1	-						C19orf42_uc002nep.1_Intron			Q9BQ49	CS042_HUMAN	Homo sapiens cDNA: FLJ21949 fis, clone HEP04922.							integral to membrane					0						gtcagaattaggagacagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21749389	21749390	+	IGR	DEL	AA	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21749389_21749390delAA								ZNF429 (10321 upstream) : ZNF100 (157454 downstream)																							TTACTTTTTTAAAGGAAGAGCA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31345765	31345765	+	IGR	DEL	C	-	-	rs11478793		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31345765delC								ZNF536 (296800 upstream) : DKFZp566F0947 (295018 downstream)																							CCCAGGCAGACCCCCCAGTGC	0.567													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32564557	32564557	+	IGR	DEL	G	-	-	rs3834983		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32564557delG								TSHZ3 (724367 upstream) : ZNF507 (271957 downstream)																							agagggcagagaaagtggcaa	0.000													3	3	---	---	---	---	
CHST8	64377	broad.mit.edu	37	19	34185239	34185239	+	Intron	DEL	T	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34185239delT	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_Intron	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					TTCAGAGCCCTTTGCCTTTTC	0.512													4	2	---	---	---	---	
DNMT3B	1789	broad.mit.edu	37	20	31387738	31387741	+	Intron	DEL	TAGT	-	-	rs145092112		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31387738_31387741delTAGT	uc002wyc.2	+						DNMT3B_uc010zty.1_Intron|DNMT3B_uc002wyd.2_Intron|DNMT3B_uc002wye.2_Intron|DNMT3B_uc010gee.2_Intron|DNMT3B_uc010gef.2_Intron|DNMT3B_uc010ztz.1_Intron|DNMT3B_uc010zua.1_Intron|DNMT3B_uc002wyf.2_Intron|DNMT3B_uc002wyg.2_Intron|DNMT3B_uc010geg.2_5'Flank|DNMT3B_uc010geh.2_5'Flank	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						GGAGATAAACTAGTTAACAACTAC	0.363													4	3	---	---	---	---	
NFS1	9054	broad.mit.edu	37	20	34284029	34284029	+	Intron	DEL	A	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34284029delA	uc002xdw.1	-						NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron|NFS1_uc002xdx.2_Intron	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	ACTGCCAGACAAAAAAAAAAC	0.328													8	5	---	---	---	---	
CASS4	57091	broad.mit.edu	37	20	55026563	55026563	+	Intron	DEL	C	-	-	rs11475314		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55026563delC	uc002xxp.2	+						CASS4_uc002xxq.3_Intron|CASS4_uc002xxr.2_Intron|CASS4_uc010zze.1_Intron|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a						cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						GAAAGGGTTGCCAAGGGCATT	0.473													6	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62154313	62154313	+	IGR	DEL	G	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62154313delG								PPDPF (790 upstream) : PTK6 (5465 downstream)																							GGGCCTCCGTGGGGTGGGAAA	0.607													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11058603	11058603	+	Intron	DEL	G	-	-	rs57429001		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058603delG	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAAACCTAAAGATTTTTTTTT	0.269													18	12	---	---	---	---	
ZNRF3	84133	broad.mit.edu	37	22	29278752	29278753	+	5'Flank	INS	-	C	C			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29278752_29278753insC	uc003aeg.2	+							NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1						TTTCCAGACTTCTTTTGGGGGC	0.510													4	2	---	---	---	---	
INPP5J	27124	broad.mit.edu	37	22	31509420	31509421	+	Intron	INS	-	A	A			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31509420_31509421insA	uc010gwf.2	+						SELM_uc011alj.1_Intron			Q15735	PI5PA_HUMAN	RecName: Full=Phosphatidylinositol 4,5-bisphosphate 5-phosphatase A;          EC=3.1.3.56; AltName: Full=Inositol polyphosphate 5-phosphatase J;							cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						TGCCTACaattaaaaaaaaaaa	0.376													4	4	---	---	---	---	
CSF2RB	1439	broad.mit.edu	37	22	37322982	37322982	+	Intron	DEL	G	-	-	rs5845307		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37322982delG	uc003aqa.3	+						CSF2RB_uc003aqc.3_Intron	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta						respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GGCTGTCATTGGGAGTctcag	0.249													3	3	---	---	---	---	
SMC1B	27127	broad.mit.edu	37	22	45788589	45788590	+	Intron	INS	-	T	T			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45788589_45788590insT	uc003bgc.2	-						SMC1B_uc003bgd.2_Intron|SMC1B_uc003bge.1_Intron	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes						chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		tagatgtttccttttttttgga	0.000													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													13	6	---	---	---	---	
GLRA2	2742	broad.mit.edu	37	X	14622666	14622673	+	Intron	DEL	GTGTGTGT	-	-	rs10538084		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14622666_14622673delGTGTGTGT	uc010nep.2	+						GLRA2_uc010neq.2_Intron|GLRA2_uc004cwe.3_Intron|GLRA2_uc011mio.1_Intron|GLRA2_uc011mip.1_Intron	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A						neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	ACAAACCAAAgtgtgtgtgtgtgtgtgt	0.274													7	4	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16697102	16697102	+	Intron	DEL	C	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16697102delC	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					GTTCAAGAAGCCAGCCGAGAG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	31131394	31131394	+	IGR	DEL	G	-	-			TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31131394delG								FTHL17 (41224 upstream) : DMD (5951 downstream)																							ctatggttgtgggtgcaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960883	9960883	+	IGR	DEL	A	-	-	rs146746526		TCGA-BP-4163-01A-02D-1386-10	TCGA-BP-4163-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960883delA								TTTY22 (310029 upstream) : None (None downstream)																							TTGGCTAAACAAGATGTTTGC	0.473													4	4	---	---	---	---	
