Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC45A1	50651	broad.mit.edu	37	1	8390936	8390936	+	Silent	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8390936C>T	uc001apb.2	+	4	1383	c.1383C>T	c.(1381-1383)GAC>GAT	p.D461D	SLC45A1_uc001apc.2_Silent_p.D159D	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	461					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCATCCCGGACGCAGCCGGAG	0.607													25	131	---	---	---	---	PASS
NCDN	23154	broad.mit.edu	37	1	36026446	36026446	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36026446G>C	uc001bza.2	+	4	821	c.694G>C	c.(694-696)GCT>CCT	p.A232P	KIAA0319L_uc010ohw.1_5'Flank|NCDN_uc001bzb.2_Missense_Mutation_p.A232P|NCDN_uc001bzc.2_Missense_Mutation_p.A215P	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	232					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTTCCAGAAAGCTGAGGATGC	0.647													26	83	---	---	---	---	PASS
LCE1A	353131	broad.mit.edu	37	1	152800036	152800036	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152800036C>T	uc010pdw.1	+	1	88	c.88C>T	c.(88-90)CCC>TCC	p.P30S		NM_178348	NP_848125	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	30	Cys-rich.				keratinization					ovary(1)|skin(1)	2	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			tcctaagtgccccccaaagtg	0.428													7	106	---	---	---	---	PASS
IER5	51278	broad.mit.edu	37	1	181059036	181059036	+	3'UTR	SNP	C	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181059036C>G	uc001got.3	+	1						NM_016545	NP_057629	Q5VY09	IER5_HUMAN	immediate early response 5											pancreas(1)	1						CTTGGCCCCCCTGCGGGGAGG	0.711													3	18	---	---	---	---	PASS
SLC3A1	6519	broad.mit.edu	37	2	44547760	44547760	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44547760A>G	uc002ruc.3	+	10	2118	c.2040A>G	c.(2038-2040)ATA>ATG	p.I680M	PREPL_uc002ruf.2_3'UTR|PREPL_uc002rug.2_3'UTR|PREPL_uc002ruh.2_3'UTR|PREPL_uc010fax.2_3'UTR|PREPL_uc002rui.3_3'UTR|PREPL_uc002ruj.1_3'UTR|PREPL_uc002ruk.1_3'UTR|SLC3A1_uc002rud.3_Missense_Mutation_p.I402M|SLC3A1_uc002rue.3_Missense_Mutation_p.I300M	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	680	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TACTGAACATACTGTATACCT	0.413													7	126	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122273322	122273322	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122273322A>G	uc002tnc.2	-	7	953	c.563T>C	c.(562-564)ATA>ACA	p.I188T	CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.I188T|CLASP1_uc010yza.1_Missense_Mutation_p.I188T|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Missense_Mutation_p.I188T	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	188	HEAT 2.				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					TAAGCTGTTTATTGCTGCATC	0.463													17	53	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160035470	160035470	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160035470C>G	uc002uag.2	+	14	2580	c.2306C>G	c.(2305-2307)ACA>AGA	p.T769R	TANC1_uc010fol.1_Missense_Mutation_p.T663R|TANC1_uc010zcm.1_Missense_Mutation_p.T761R|TANC1_uc010fom.1_Missense_Mutation_p.T575R|TANC1_uc002uai.1_RNA	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	769						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						CACCCCATGACAGACGAGCAG	0.552													71	330	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179452123	179452123	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179452123T>C	uc010zfg.1	-	256	56335	c.56111A>G	c.(56110-56112)GAT>GGT	p.D18704G	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D12399G|TTN_uc010zfi.1_Missense_Mutation_p.D12332G|TTN_uc010zfj.1_Missense_Mutation_p.D12207G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19631							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACTTTTAAATCAGACACAGG	0.428													11	22	---	---	---	---	PASS
OR6B2	389090	broad.mit.edu	37	2	240968847	240968847	+	3'UTR	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240968847A>G	uc002vyr.2	-	2						NM_001005853	NP_001005853	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		taaaGAGCACAAAGTGCCACA	0.249													13	63	---	---	---	---	PASS
CAMK1	8536	broad.mit.edu	37	3	9799318	9799318	+	Intron	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9799318A>G	uc003bst.2	-						OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_Intron|CAMK1_uc003bss.2_Silent_p.C149C	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I						cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		GCATGGGAAGACAGAACAGAG	0.682													3	34	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52443892	52443892	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52443892C>T	uc003ddx.2	-	1	118	c.3G>A	c.(1-3)ATG>ATA	p.M1I	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	1					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGCCCTTATTCATCTTCCCGC	0.766			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								6	29	---	---	---	---	PASS
FAM86D	692099	broad.mit.edu	37	3	75475719	75475719	+	Silent	SNP	C	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75475719C>G	uc003dpp.3	-	7	878	c.519G>C	c.(517-519)TCG>TCC	p.S173S	FAM86D_uc003dpo.3_RNA|FAM86D_uc003dps.3_RNA|FAM86D_uc003dpq.3_Silent_p.S81S|FAM86D_uc003dpr.3_RNA	NR_024241				RecName: Full=Protein FAM86B1;												0						TCCCGACCAGCGACACGATGG	0.572													4	27	---	---	---	---	PASS
NR1I2	8856	broad.mit.edu	37	3	119535982	119535982	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119535982C>T	uc003edj.2	+	9	3067	c.1228C>T	c.(1228-1230)CGG>TGG	p.R410W	NR1I2_uc003edi.2_Missense_Mutation_p.R373W|NR1I2_uc003edk.2_Missense_Mutation_p.R449W|NR1I2_uc003edl.2_Missense_Mutation_p.R298W	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	410	Ligand-binding.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	GCACACCCAGCGGCTGCTGCG	0.577													5	69	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184103856	184103856	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184103856T>G	uc003fov.2	+	15	2087	c.1841T>G	c.(1840-1842)CTG>CGG	p.L614R	CHRD_uc003fow.2_Missense_Mutation_p.L244R|CHRD_uc003fox.2_Missense_Mutation_p.L614R|CHRD_uc003foy.2_Missense_Mutation_p.L244R|CHRD_uc010hyc.2_Missense_Mutation_p.L204R|CHRD_uc011brr.1_Missense_Mutation_p.L244R	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	614	CHRD 4.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTGAAGGACCTGGAGCCGGAA	0.488													32	153	---	---	---	---	PASS
MFI2	4241	broad.mit.edu	37	3	196733606	196733606	+	Silent	SNP	G	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196733606G>T	uc003fxk.3	-	14	1865	c.1752C>A	c.(1750-1752)GGC>GGA	p.G584G		NM_005929	NP_005920	P08582	TRFM_HUMAN	melanoma-associated antigen p97 isoform 1	584	Transferrin-like 2.				cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding				0	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CGGAATTGTGGCCTGAGGGGG	0.612													3	30	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23891669	23891669	+	5'UTR	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23891669C>T	uc003gqs.2	-	1					PPARGC1A_uc003gqt.2_RNA|PPARGC1A_uc010ier.1_RNA|PPARGC1A_uc003gqu.3_5'UTR	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				CAGCCCCTTACTGAGAGTGAA	0.527													13	34	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6611190	6611190	+	Silent	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6611190C>T	uc003jdu.2	-	11	1169	c.1104G>A	c.(1102-1104)ACG>ACA	p.T368T	NSUN2_uc003jdt.2_Silent_p.T132T|NSUN2_uc011cmk.1_Silent_p.T333T|NSUN2_uc003jdv.2_Silent_p.T132T	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	368						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						GCCCATCTTTCGTCATTACCT	0.498													13	262	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35771808	35771808	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35771808A>C	uc003jjo.2	+	27	4010	c.3899A>C	c.(3898-3900)AAA>ACA	p.K1300T	SPEF2_uc003jjp.1_Missense_Mutation_p.K786T|SPEF2_uc003jjr.2_5'Flank	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1300					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCAAATAAAAAAGTCAAAAAG	0.423													28	52	---	---	---	---	PASS
HMGCR	3156	broad.mit.edu	37	5	74643063	74643063	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74643063C>G	uc003kdp.2	+	6	641	c.485C>G	c.(484-486)GCA>GGA	p.A162G	HMGCR_uc011cst.1_Missense_Mutation_p.A182G|HMGCR_uc003kdq.2_Missense_Mutation_p.A162G|HMGCR_uc010izn.1_Missense_Mutation_p.A2G	NM_000859	NP_000850	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	162	Helical; (Potential).				cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CGTGGAATGGCAATTTTAGGT	0.368													13	397	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147481422	147481422	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147481422C>A	uc003lox.2	+	15	1454	c.1381C>A	c.(1381-1383)CCA>ACA	p.P461T	SPINK5_uc010jgs.1_Missense_Mutation_p.P433T|SPINK5_uc010jgr.2_Missense_Mutation_p.P442T|SPINK5_uc003low.2_Missense_Mutation_p.P461T|SPINK5_uc003loy.2_Missense_Mutation_p.P461T	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	461	Kazal-like 7.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCCAGGGCCCAGATGGAAA	0.498													19	128	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147481423	147481423	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147481423C>A	uc003lox.2	+	15	1455	c.1382C>A	c.(1381-1383)CCA>CAA	p.P461Q	SPINK5_uc010jgs.1_Missense_Mutation_p.P433Q|SPINK5_uc010jgr.2_Missense_Mutation_p.P442Q|SPINK5_uc003low.2_Missense_Mutation_p.P461Q|SPINK5_uc003loy.2_Missense_Mutation_p.P461Q	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	461	Kazal-like 7.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCAGGGCCCAGATGGAAAA	0.502													18	128	---	---	---	---	PASS
NIPAL4	348938	broad.mit.edu	37	5	156899742	156899742	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156899742C>T	uc003lwx.3	+	6	1291	c.1175C>T	c.(1174-1176)TCG>TTG	p.S392L	ADAM19_uc003lww.1_Intron|NIPAL4_uc011ddq.1_Missense_Mutation_p.S373L	NM_001099287	NP_001092757	Q0D2K0	NIPA4_HUMAN	ichthyin protein	392	Helical; (Potential).					integral to membrane	receptor activity				0						GGCACCCTCTCGGGCTTTGTC	0.537													23	73	---	---	---	---	PASS
HFE	3077	broad.mit.edu	37	6	26094575	26094575	+	3'UTR	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26094575G>A	uc003nfx.1	+	6					HFE_uc003nfy.1_3'UTR|HFE_uc010jqe.1_3'UTR|HFE_uc003nfz.1_3'UTR|HFE_uc003ngd.1_3'UTR|HFE_uc003nga.1_3'UTR|HFE_uc003ngb.1_3'UTR|HFE_uc003ngc.1_3'UTR|HFE_uc003nge.1_3'UTR|HFE_uc003ngf.1_3'UTR|uc010jqf.1_5'Flank	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor						antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						ATTGCCTGACGAACTCCTTGA	0.433									Hemochromatosis				3	3	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180449	20180449	+	3'UTR	SNP	G	C	C	rs113534252		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180449G>C	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacacagacacacacac	0.164													6	67	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42012033	42012033	+	Missense_Mutation	SNP	G	C	C	rs139108417	byFrequency	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42012033G>C	uc011kbh.1	-	13	2097	c.2006C>G	c.(2005-2007)ACT>AGT	p.T669S	GLI3_uc011kbg.1_Missense_Mutation_p.T610S	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	669					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GGCTCCCTGAGTCGGTCGGCC	0.602									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				6	262	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48411895	48411895	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48411895G>A	uc003toq.2	+	33	10959	c.10934G>A	c.(10933-10935)AGC>AAC	p.S3645N	ABCA13_uc010kys.1_Missense_Mutation_p.S719N|ABCA13_uc003tos.1_Missense_Mutation_p.S471N	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3645					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTTGCACACAGCAATACCTTT	0.458													74	298	---	---	---	---	PASS
SEMA3A	10371	broad.mit.edu	37	7	83590955	83590955	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83590955C>T	uc003uhz.2	-	17	2363	c.2048G>A	c.(2047-2049)GGA>GAA	p.G683E		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	683					axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						AGAGCCATCTCCATCATCATC	0.443													71	214	---	---	---	---	PASS
TFR2	7036	broad.mit.edu	37	7	100226966	100226966	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100226966C>A	uc003uvv.1	-	10	1341	c.1300G>T	c.(1300-1302)GAT>TAT	p.D434Y	TFR2_uc010lhc.1_5'UTR|TFR2_uc003uvu.1_Missense_Mutation_p.D263Y	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2	434	Extracellular (Potential).				cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCCATGCATCCCTCTGGGCC	0.607													7	125	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131896814	131896814	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131896814T>C	uc003ytd.3	-	8	2361	c.2105A>G	c.(2104-2106)CAC>CGC	p.H702R	ADCY8_uc010mds.2_Missense_Mutation_p.H702R	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	702	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CTCTACCTTGTGCTCCAGGCT	0.468										HNSCC(32;0.087)			13	204	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2056787	2056787	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2056787A>T	uc003zhc.2	+	7	1388	c.1289A>T	c.(1288-1290)GAG>GTG	p.E430V	SMARCA2_uc003zhd.2_Missense_Mutation_p.E430V|SMARCA2_uc010mha.2_Missense_Mutation_p.E421V	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	430					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CGCATGACCGAGAAGCTGGAG	0.567													9	53	---	---	---	---	PASS
DBH	1621	broad.mit.edu	37	9	136505100	136505100	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136505100G>A	uc004cel.2	+	2	481	c.472G>A	c.(472-474)GAT>AAT	p.D158N		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	158	DOMON.|Intragranular (Potential).				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	CGACCCCAAGGATTACCTCAT	0.592													11	48	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97174217	97174217	+	Intron	SNP	A	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97174217A>C	uc001kkp.2	-						SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Missense_Mutation_p.S250A	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGACATTCAGAAAAGCCGTGA	0.602													22	87	---	---	---	---	PASS
RIC8A	60626	broad.mit.edu	37	11	212621	212621	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:212621C>A	uc001log.2	+	7	1397	c.1072C>A	c.(1072-1074)CCC>ACC	p.P358T	RIC8A_uc001lof.2_Missense_Mutation_p.P364T|RIC8A_uc001loh.2_Missense_Mutation_p.P351T	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8	358						cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCAGGTGCTGCCCCCTCTGCG	0.612													3	36	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64108611	64108611	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64108611C>T	uc001nzy.2	+	4	393	c.349C>T	c.(349-351)CCC>TCC	p.P117S	CCDC88B_uc009ypo.1_Missense_Mutation_p.P114S|CCDC88B_uc001nzz.1_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	117					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						CCTGTCGCCACCCCCAGACCT	0.647													13	69	---	---	---	---	PASS
FAM55B	120406	broad.mit.edu	37	11	114569272	114569272	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114569272G>A	uc009yyy.2	+	3	736	c.638G>A	c.(637-639)AGG>AAG	p.R213K		NM_182495	NP_872301	Q96DL1	FA55B_HUMAN	hypothetical protein LOC120406	213						integral to membrane				ovary(1)	1						GGATGTGATAGGATCATCTTC	0.517													5	36	---	---	---	---	PASS
FAM55B	120406	broad.mit.edu	37	11	114569274	114569274	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114569274A>G	uc009yyy.2	+	3	738	c.640A>G	c.(640-642)ATC>GTC	p.I214V		NM_182495	NP_872301	Q96DL1	FA55B_HUMAN	hypothetical protein LOC120406	214						integral to membrane				ovary(1)	1						ATGTGATAGGATCATCTTCAC	0.517													5	36	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117052642	117052642	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117052642C>A	uc001pqh.1	+	3	466	c.425C>A	c.(424-426)ACC>AAC	p.T142N	SIDT2_uc010rxe.1_Missense_Mutation_p.T142N|SIDT2_uc001pqg.2_Missense_Mutation_p.T142N|SIDT2_uc001pqi.1_Missense_Mutation_p.T142N	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	142	Extracellular (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CCAGTCAACACCACATACCAG	0.577													6	55	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23818384	23818384	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23818384C>T	uc001rfw.2	-	7	1027	c.925G>A	c.(925-927)GGA>AGA	p.G309R	SOX5_uc001rfx.2_Missense_Mutation_p.G296R|SOX5_uc001rfy.2_Missense_Mutation_p.G296R|SOX5_uc010siv.1_Missense_Mutation_p.G296R|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.G261R	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	309					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						TTACTACATCCAGCCTTATAG	0.478													58	225	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131438960	131438960	+	5'UTR	SNP	C	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131438960C>A	uc001uit.3	+	1					GPR133_uc010tbm.1_5'UTR	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCGTTCTCACAGACCCTCAG	0.498													15	75	---	---	---	---	PASS
STARD13	90627	broad.mit.edu	37	13	33686964	33686964	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33686964C>T	uc001uuw.2	-	9	2512	c.2386G>A	c.(2386-2388)GTC>ATC	p.V796I	STARD13_uc001uuu.2_Missense_Mutation_p.V788I|STARD13_uc001uuv.2_Missense_Mutation_p.V678I|STARD13_uc001uux.2_Missense_Mutation_p.V761I|STARD13_uc010tec.1_RNA	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	796	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		AAGTTGACGACGTCGTTCAGG	0.542													5	178	---	---	---	---	PASS
ARL11	115761	broad.mit.edu	37	13	50204841	50204841	+	Silent	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50204841C>T	uc001vdf.1	+	2	404	c.258C>T	c.(256-258)TAC>TAT	p.Y86Y		NM_138450	NP_612459	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	86					small GTPase mediated signal transduction	intracellular	GTP binding|protein binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		TCCTCGTGTACGTGCTGGACA	0.617													27	87	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89386810	89386810	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89386810G>A	uc010upo.1	+	6	1356	c.982G>A	c.(982-984)GTC>ATC	p.V328I	ACAN_uc002bmx.2_Missense_Mutation_p.V328I|ACAN_uc010upp.1_Missense_Mutation_p.V328I|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	328					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CGTGAGGACCGTCTACGTGCA	0.682													15	42	---	---	---	---	PASS
CMIP	80790	broad.mit.edu	37	16	81712128	81712128	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81712128T>C	uc002fgp.2	+	10	1355	c.1283T>C	c.(1282-1284)CTC>CCC	p.L428P	CMIP_uc002fgq.1_Missense_Mutation_p.L334P|CMIP_uc010vnq.1_Missense_Mutation_p.L241P|CMIP_uc002fgr.1_Missense_Mutation_p.L275P	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip	394						cytoplasm|nucleus					0						GAGCCCAACCTCATCGACTGC	0.667													2	6	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2606746	2606746	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2606746A>T	uc002fuy.1	-	3	313	c.227T>A	c.(226-228)GTG>GAG	p.V76E	KIAA0664_uc002fux.1_Missense_Mutation_p.V8E	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	76							binding			breast(2)	2						GTCCATGAGCACCTGGTGAAT	0.657													8	31	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904139	21904139	+	RNA	SNP	T	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904139T>G	uc002gza.2	+	1		c.78T>G				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ccgagcaggatgaggaaacca	0.000													3	57	---	---	---	---	PASS
SLC26A11	284129	broad.mit.edu	37	17	78199688	78199688	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78199688A>G	uc002jyb.1	+	6	835	c.566A>G	c.(565-567)CAC>CGC	p.H189R	SLC26A11_uc002jyc.1_Missense_Mutation_p.H189R|SLC26A11_uc002jyd.1_Missense_Mutation_p.H189R|SLC26A11_uc010dhv.1_Missense_Mutation_p.H189R	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11	189	Cytoplasmic (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CAGGTGTACCACACCTTCCTC	0.567													25	133	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6955495	6955495	+	Intron	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6955495C>T	uc002knm.2	-						LAMA1_uc002knk.2_Nonsense_Mutation_p.W18*|LAMA1_uc002knl.2_Intron|LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CACTCAGCCGCCACCCGCAGC	0.567													3	16	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8253332	8253332	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8253332G>A	uc002knn.3	+	17	3138	c.2635G>A	c.(2635-2637)GCC>ACC	p.A879T	PTPRM_uc010dkv.2_Missense_Mutation_p.A892T|PTPRM_uc010wzl.1_Missense_Mutation_p.A666T	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	879	Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GCTCCACCCCGCCATCCGGGT	0.602													3	34	---	---	---	---	PASS
FECH	2235	broad.mit.edu	37	18	55221616	55221616	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55221616G>T	uc002lgq.3	-	9	1070	c.953C>A	c.(952-954)TCT>TAT	p.S318Y	FECH_uc002lgp.3_Missense_Mutation_p.S324Y|FECH_uc002lgr.3_Missense_Mutation_p.S176Y	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	318					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				CCCTTTGATAGATTCGTCTGT	0.488													23	249	---	---	---	---	PASS
ECSIT	51295	broad.mit.edu	37	19	11618611	11618611	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11618611G>T	uc002msb.2	-	6	985	c.851C>A	c.(850-852)CCT>CAT	p.P284H	ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_RNA|ECSIT_uc010dyc.1_Intron|ECSIT_uc010dyd.2_Intron|ECSIT_uc010xma.1_Missense_Mutation_p.P70H	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate	284					innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						AACAAAGACAGGCCGGGCTGG	0.627													8	44	---	---	---	---	PASS
ERCC1	2067	broad.mit.edu	37	19	45923622	45923622	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45923622C>T	uc002pbs.1	-	4	531	c.385G>A	c.(385-387)GAC>AAC	p.D129N	ERCC1_uc002pbt.1_Missense_Mutation_p.D129N|ERCC1_uc002pbu.1_Missense_Mutation_p.D57N|ERCC1_uc002pbv.2_Missense_Mutation_p.D129N	NM_001983	NP_001974	P07992	ERCC1_HUMAN	excision repair cross-complementing 1 isofrom 2	129					mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		AGCACATAGTCGGGAATTACG	0.617								NER					6	43	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	31023608	31023608	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31023608A>T	uc002yno.1	-	6	1248	c.784T>A	c.(784-786)TTA>ATA	p.L262I	GRIK1_uc002ynn.2_Missense_Mutation_p.L262I|GRIK1_uc011acs.1_Missense_Mutation_p.L262I|GRIK1_uc011act.1_Missense_Mutation_p.L206I|GRIK1_uc010glq.1_Missense_Mutation_p.L120I|GRIK1_uc002ynr.2_Missense_Mutation_p.L262I	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	262	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	AAAGCAAATAAGTCCTGCATA	0.353													13	49	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34011316	34011316	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34011316G>A	uc002yqh.2	-	31	3934	c.3934C>T	c.(3934-3936)CAG>TAG	p.Q1312*	SYNJ1_uc011ads.1_Nonsense_Mutation_p.Q1226*|SYNJ1_uc002yqf.2_Nonsense_Mutation_p.Q1257*|SYNJ1_uc002yqg.2_Nonsense_Mutation_p.Q1226*|SYNJ1_uc002yqi.2_Nonsense_Mutation_p.Q1312*|SYNJ1_uc002yqe.3_5'UTR	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	1273	Pro-rich.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						GGGCCAGACTGAGGCATAGGT	0.567													42	255	---	---	---	---	PASS
NONO	4841	broad.mit.edu	37	X	70511743	70511743	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70511743T>G	uc004dzo.2	+	5	979	c.269T>G	c.(268-270)ATG>AGG	p.M90R	BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Missense_Mutation_p.M90R|NONO_uc004dzp.2_Missense_Mutation_p.M90R|NONO_uc011mpv.1_Missense_Mutation_p.M1R|NONO_uc004dzq.2_5'Flank	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	90	DBHS.|RRM 1.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					GAGGAAGAAATGAGGAAACTA	0.423			T	TFE3	papillary renal cancer								10	62	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73040547	73040547	+	RNA	SNP	A	G	G			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73040547A>G	uc004ebn.2	+	1		c.28508A>G			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						GTTTGTTTCAATTGTGACATC	0.348													11	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14921	14921	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14921G>A	uc004coy.2	+	1	161	c.86G>A	c.(85-87)CGC>CAC	p.R29H	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		ACTCACCAGACGCCTCAACCG	0.502													3	4	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203593358	203593365	+	5'Flank	DEL	GAAGGAAG	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203593358_203593365delGAAGGAAG	uc001gzw.2	+						ATP2B4_uc001gzv.2_5'Flank	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			aagaaagaaagaaggaaggaaggaagga	0.000													3	5	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9597277	9597280	+	Intron	DEL	TGTG	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9597277_9597280delTGTG	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		GGAAAgtatatgtgtgtgtgtgtg	0.211													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17035642	17035642	+	IGR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17035642delT								FAM49A (188546 upstream) : RAD51AP2 (656344 downstream)																							TTTGTCTATGTTTTTTTTATG	0.269													4	2	---	---	---	---	
PRKD3	23683	broad.mit.edu	37	2	37507198	37507198	+	Intron	DEL	T	-	-	rs112877376		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37507198delT	uc002rqd.2	-						PRKD3_uc002rqe.1_5'Flank|PRKD3_uc002rqf.1_Intron	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				agtatttctcttttttttttt	0.040													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156126552	156126552	+	IGR	DEL	A	-	-	rs77418096		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156126552delA								KCNJ3 (413538 upstream) : None (None downstream)																							ccataatggcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TTC21B	79809	broad.mit.edu	37	2	166802307	166802310	+	Intron	DEL	CTGT	-	-	rs5836067		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166802307_166802310delCTGT	uc002udk.2	-						TTC21B_uc002udl.2_Intron|uc002udm.1_Intron	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TATAGTGgtactgtctaatagaaa	0.123													4	12	---	---	---	---	
PMS1	5378	broad.mit.edu	37	2	190656341	190656342	+	Intron	INS	-	A	A			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190656341_190656342insA	uc002urh.3	+						PMS1_uc010zga.1_Intron|PMS1_uc010zgb.1_Intron|PMS1_uc002urk.3_Intron|PMS1_uc002uri.3_Intron|PMS1_uc010zgc.1_Intron|PMS1_uc010zgd.1_Intron|PMS1_uc002urj.2_Intron|PMS1_uc010fry.1_5'Flank|PMS1_uc010frz.2_5'Flank|PMS1_uc010zfz.1_Intron	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a						mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			atttcatctccaaaaaaaaaaa	0.030			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					4	2	---	---	---	---	
SLC16A14	151473	broad.mit.edu	37	2	230902403	230902403	+	Intron	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230902403delT	uc002vqd.1	-						FBXO36_uc010fxi.1_Intron	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid							integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		tttcttttccttttttttttt	0.318													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14310064	14310067	+	IGR	DEL	TGTG	-	-	rs150596489		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14310064_14310067delTGTG								LSM3 (70228 upstream) : SLC6A6 (134039 downstream)																							CCCCATTAATtgtgtgtgtgtgtg	0.402													3	3	---	---	---	---	
ROBO1	6091	broad.mit.edu	37	3	78760498	78760499	+	Intron	INS	-	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78760498_78760499insT	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron|ROBO1_uc003dqf.1_Intron	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		tccttccttcctccttccttcc	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	121673418	121673419	+	IGR	INS	-	CTTCCTTT	CTTCCTTT	rs137874716	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121673418_121673419insCTTCCTTT								SLC15A2 (10384 upstream) : ILDR1 (32752 downstream)																							ttccttccttcctttctttctC	0.005													5	3	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131268667	131268668	+	Intron	INS	-	T	T			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131268667_131268668insT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						aggttaagtcatttgtccaaat	0.163													22	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194712007	194712008	+	IGR	INS	-	TCC	TCC	rs111948714	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194712007_194712008insTCC								FAM43A (302243 upstream) : C3orf21 (77007 downstream)																							cctcctcctcttcctcctcctc	0.000													4	2	---	---	---	---	
WHSC1	7468	broad.mit.edu	37	4	1940129	1940129	+	Intron	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1940129delT	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gei.3_5'Flank|WHSC1_uc003gdy.1_Intron|WHSC1_uc010icd.1_Intron|WHSC1_uc003gea.1_Intron|WHSC1_uc010ice.1_Intron|WHSC1_uc003geh.1_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ttttcttttcttttttttttc	0.209			T	IGH@	MM								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88802898	88802898	+	IGR	DEL	A	-	-	rs67908579		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88802898delA								MEPE (34956 upstream) : SPP1 (93904 downstream)																							agaaagagagagggggaagga	0.055													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	134593370	134593371	+	IGR	INS	-	TTG	TTG	rs145889567	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134593370_134593371insTTG								PCDH10 (480639 upstream) : PABPC4L (524120 downstream)																							tccatcttgcattgttgttgtt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51951709	51951709	+	IGR	DEL	G	-	-	rs113844542		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51951709delG								None (None upstream) : ITGA1 (132065 downstream)																							gaagaaagaaggaaggaagga	0.000													4	2	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55462026	55462027	+	Intron	INS	-	TC	TC	rs71602943		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55462026_55462027insTC	uc003jqu.2	-							NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				ccttccttccttctctctctct	0.000													3	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59284181	59284181	+	3'UTR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59284181delT	uc003jse.1	-	5					PDE4D_uc003jsb.2_Intron|PDE4D_uc010iwj.1_3'UTR			Q08499	PDE4D_HUMAN	Homo sapiens cAMP-specific phosphodiesterase PDE4D7 (PDE4D) mRNA, complete cds; alternatively spliced.						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	AAATTCATCCTTTTTTTTTTG	0.348													6	3	---	---	---	---	
CENPK	64105	broad.mit.edu	37	5	64838465	64838465	+	Intron	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64838465delA	uc003jts.2	-						CENPK_uc003jtt.2_Intron|CENPK_uc003jtu.2_Intron	NM_022145	NP_071428	Q9BS16	CENPK_HUMAN	SoxLZ/Sox6 leucine zipper binding protein						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		ctccgtttccaaaaaaaaaaa	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	110159876	110159879	+	IGR	DEL	CTTT	-	-	rs1814576	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110159876_110159879delCTTT								SLC25A46 (61394 upstream) : TSLP (245899 downstream)																							tccttccttcctttctttctctct	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173545156	173545157	+	IGR	INS	-	GA	GA			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173545156_173545157insGA								HMP19 (8975 upstream) : MSX2 (606418 downstream)																							cctccctccctccttccttcct	0.000													4	2	---	---	---	---	
ABCF1	23	broad.mit.edu	37	6	30548124	30548124	+	Intron	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30548124delA	uc003nql.2	+						ABCF1_uc003nqk.2_Intron|ABCF1_uc003nqm.2_Intron|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1						inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						actccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810504	35810504	+	Intron	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810504delA	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TAGATCATTTAAAAAAAAAAA	0.308													4	2	---	---	---	---	
HCRTR2	3062	broad.mit.edu	37	6	55147362	55147362	+	3'UTR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55147362delT	uc003pcl.2	+	7					HCRTR2_uc010jzv.2_RNA	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CTTGTGGATCTTTTTTTTTTT	0.254													3	3	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142168221	142168222	+	Intron	INS	-	TGG	TGG			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142168221_142168222insTGG	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGGGCTCTGTTTGGGAGAGCT	0.530													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143816457	143816457	+	IGR	DEL	T	-	-	rs67586979		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143816457delT								OR2A2 (8827 upstream) : OR2A14 (9749 downstream)																							ATCCCATTTCTTTTTTTTTTt	0.244													4	2	---	---	---	---	
ADAM32	203102	broad.mit.edu	37	8	39009194	39009195	+	Intron	INS	-	T	T	rs67270213		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39009194_39009195insT	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			AACATCTTATCttttttttttt	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144138674	144138674	+	IGR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144138674delT								C8orf31 (2954 upstream) : LY6H (100658 downstream)																							attatttttattttttttttt	0.159													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	31644563	31644563	+	IGR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31644563delT								None (None upstream) : ACO1 (740038 downstream)																							ACAAGGAGAGTTTTTTTTTTT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460010	90460011	+	IGR	DEL	TG	-	-	rs36046714		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460010_90460011delTG								CTSL3 (58211 upstream) : C9orf79 (37730 downstream)																							AGTCTTGCTCtgtgtgtgtgtg	0.292													4	2	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286637	92286645	+	Intron	DEL	ATGGTGGTT	-	-	rs138909303	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286637_92286645delATGGTGGTT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						ggtggtggtgatggtggttatggtggtga	0.033													4	2	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131586559	131586560	+	Intron	DEL	GT	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131586559_131586560delGT	uc004bwd.2	-						C9orf114_uc004bwe.2_Intron|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						GAGCtgtgtggtgtgtgtgtgt	0.500													3	3	---	---	---	---	
C9orf173	441476	broad.mit.edu	37	9	140147094	140147095	+	Intron	INS	-	CT	CT	rs146633703	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140147094_140147095insCT	uc004cmk.1	+						C9orf173_uc004cmj.1_Intron|C9orf173_uc011meu.1_Intron|C9orf173_uc010ncd.1_Intron|C9orf173_uc011mev.1_Intron|C9orf173_uc004cml.1_Intron|COBRA1_uc004cmm.3_5'Flank			Q8N7X2	CI173_HUMAN	SubName: Full=LOC441476 protein;											pancreas(1)	1						CCCTGCAGCCCGTCTCCTACCC	0.723													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71193238	71193239	+	IGR	INS	-	AC	AC	rs139709581	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71193238_71193239insAC								TACR2 (16564 upstream) : TSPAN15 (17987 downstream)																							TATCTATATCTACACACACACA	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81788176	81788176	+	IGR	DEL	A	-	-	rs35380147		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81788176delA								MBL1P (77393 upstream) : LOC219347 (17815 downstream)																							AGCTGTGCATATCTGGACTCC	0.443													3	6	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99402621	99402622	+	Intron	DEL	TT	-	-	rs72182783		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99402621_99402622delTT	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		tctttctttctttttctttctt	0.089													6	3	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105186867	105186868	+	Intron	INS	-	A	A	rs75558099		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105186867_105186868insA	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ccttgtcccagaaaaaaaaaaa	0.208													4	2	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42010455	42010462	+	IGR	DEL	AAAAGAAA	-	-	rs72331687		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010455_42010462delAAAAGAAA								LRRC4C (529132 upstream) : None (None downstream)																							agaaagaaagaaaagaaagaaagaaaga	0.130													4	3	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47772241	47772246	+	Intron	DEL	AAAAAA	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47772241_47772246delAAAAAA	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						actctgtctcaaaaaaaaaaaaaaaa	0.097													4	2	---	---	---	---	
FADS1	3992	broad.mit.edu	37	11	61580507	61580508	+	Intron	INS	-	G	G	rs143226787	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61580507_61580508insG	uc010rlm.1	-						FADS1_uc001nsh.2_Intron|FADS1_uc010rln.1_Intron	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1						cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGGTAGTGGCAGCCTTGGGGGA	0.401													6	4	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	271387	271387	+	Intron	DEL	T	-	-	rs66703624		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:271387delT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		actgCATCTCTTTTTTTTTTT	0.189													6	4	---	---	---	---	
DEPDC4	120863	broad.mit.edu	37	12	100646135	100646135	+	3'UTR	DEL	A	-	-	rs66721214		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100646135delA	uc001thi.2	-	5					DEPDC4_uc001thh.1_Intron	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4						intracellular signal transduction						0						AAAAAATAGCAAAAAAAAATG	0.333													3	6	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28388214	28388214	+	Intron	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28388214delA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAAAAAAACTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23180560	23180563	+	IGR	DEL	AAGG	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23180560_23180563delAAGG								USP31 (19969 upstream) : SCNN1G (13477 downstream)																							ggagggaagaaaggaaggaaggaa	0.078													4	5	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	24990136	24990137	+	Intron	INS	-	A	A	rs77415652	by1000genomes	TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24990136_24990137insA	uc002dnb.2	-						ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dng.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		cAACAAAACTGTTTTCTTTCCT	0.158													4	2	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													8	5	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307103	7307103	+	Intron	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307103delA	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				GAGAAAGGGCACCCCCCCCCC	0.627													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	65772734	65772734	+	IGR	DEL	A	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65772734delA								NOL11 (32468 upstream) : BPTF (49046 downstream)																							actccatctcaaaaaaaaaaa	0.229													6	4	---	---	---	---	
MYL12B	103910	broad.mit.edu	37	18	3277640	3277643	+	Intron	DEL	ACTT	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3277640_3277643delACTT	uc010dkl.2	+						MYL12B_uc002klt.3_Intron|MYL12B_uc010wyv.1_Intron	NM_001144944	NP_001138416	O14950	ML12B_HUMAN	myosin regulatory light chain MRCL2 isoform A						axon guidance|muscle contraction	cytosol|myosin complex	calcium ion binding				0						TAGTTCACTAACTTACTTTGTTTA	0.294													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393630	77393638	+	IGR	DEL	CAGTGGTGA	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393630_77393638delCAGTGGTGA								NFATC1 (104308 upstream) : CTDP1 (46163 downstream)																							gtggtgatggcagtggtgatggtggttgt	0.000													4	2	---	---	---	---	
LMNB2	84823	broad.mit.edu	37	19	2433561	2433561	+	Intron	DEL	C	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2433561delC	uc002lvy.2	-						LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126	Q03252	LMNB2_HUMAN	lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCTGGTCACCCCCATCAGC	0.682													4	3	---	---	---	---	
ZNF253	56242	broad.mit.edu	37	19	19991101	19991102	+	Intron	INS	-	G	G	rs142319547		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19991101_19991102insG	uc002noj.2	+						ZNF253_uc002nok.2_Intron|ZNF253_uc002nol.2_Intron	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTTTTTTTTTTCTCCCACAAAG	0.391													5	4	---	---	---	---	
CCDC123	84902	broad.mit.edu	37	19	33418019	33418020	+	Intron	INS	-	ACCCACCT	ACCCACCT	rs11280765		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33418019_33418020insACCCACCT	uc002nty.2	-						CCDC123_uc002ntx.2_Intron|CCDC123_uc010edg.2_Intron|CCDC123_uc002ntz.1_Intron	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)					tctgcctacccacccacctacc	0.114													5	3	---	---	---	---	
ACTN4	81	broad.mit.edu	37	19	39218707	39218708	+	Intron	DEL	CT	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39218707_39218708delCT	uc002oja.1	+						ACTN4_uc002ojb.1_Intron	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCATTAACTGctctctctctct	0.545													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9676854	9676855	+	IGR	DEL	GT	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9676854_9676855delGT								None (None upstream) : None (None downstream)																							aatatataccgtgtgtgtgtgt	0.010													6	4	---	---	---	---	
PFKL	5211	broad.mit.edu	37	21	45745230	45745239	+	Intron	DEL	CACGGGCACC	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45745230_45745239delCACGGGCACC	uc002zel.2	+						PFKL_uc002zek.2_Intron|PFKL_uc002zem.2_Intron|PFKL_uc002zen.2_Intron	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase						fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		TCCCAGCCCTCACGGGCACCCACGGGCACT	0.652													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16419352	16419352	+	IGR	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16419352delT								POTEH (131415 upstream) : OR11H1 (29474 downstream)																							GAATCGACGATTTTTTTTTTG	0.398													4	3	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26761678	26761678	+	Intron	DEL	A	-	-	rs675083		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26761678delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						catctctaccaaaaaaaaaaa	0.114													8	4	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32269504	32269504	+	Intron	DEL	T	-	-			TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32269504delT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ttgttttttgttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507744	36507745	+	IGR	INS	-	TTT	TTT	rs66602609		TCGA-BP-4962-01A-01D-1462-08	TCGA-BP-4962-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507744_36507745insTTT								CXorf30 (104311 upstream) : FAM47C (518725 downstream)																							tttcttTCGGGttttttttttt	0.020													3	3	---	---	---	---	
