Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF2	65122	broad.mit.edu	37	1	12919829	12919829	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12919829C>T	uc001aum.1	+	3	656	c.569C>T	c.(568-570)ACG>ATG	p.T190M		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	190											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AATTATCTAACGCCAATTAAA	0.398													113	402	---	---	---	---	PASS
ESPNP	284729	broad.mit.edu	37	1	17034423	17034423	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17034423C>T	uc001azn.1	-	2	345	c.231G>A	c.(229-231)GCG>GCA	p.A77A	ESPNP_uc010ocj.1_Silent_p.A7A	NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						CCATCTGCGCCGCGGCGTGCA	0.517													4	21	---	---	---	---	PASS
AIM1L	55057	broad.mit.edu	37	1	26664087	26664087	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26664087C>A	uc001bmd.3	-	8	881	c.451G>T	c.(451-453)GAG>TAG	p.E151*	AIM1L_uc001bmf.3_Nonsense_Mutation_p.E42*	NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	151	Beta/gamma crystallin 'Greek key' 3.						sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		TGGCTGTCCTCTGGCTGCTGA	0.612													9	44	---	---	---	---	PASS
ZNF362	149076	broad.mit.edu	37	1	33736126	33736126	+	5'UTR	SNP	T	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33736126T>G	uc001bxc.1	+	2						NM_152493	NP_689706	Q5T0B9	ZN362_HUMAN	zinc finger protein 362						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				tggctgggggttcagggaaag	0.065													15	59	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151496775	151496775	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151496775C>T	uc009wmw.2	+	7	1486	c.1342C>T	c.(1342-1344)CTG>TTG	p.L448L		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	442	Glu-rich.|Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGTGATGGAGCTGCAGAACAA	0.478													18	67	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161512660	161512660	+	3'UTR	SNP	C	T	T	rs114559215	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161512660C>T	uc001gat.3	-	6					FCGR3A_uc001gar.2_3'UTR|FCGR3A_uc001gas.2_3'UTR|FCGR3A_uc009wuh.2_3'UTR|FCGR3A_uc009wui.2_3'UTR	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor						immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AAGGAAAAGTCGAGAGTTGGA	0.478													9	13	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202566077	202566077	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202566077C>T	uc001gye.2	-	9	1261	c.1068G>A	c.(1066-1068)GTG>GTA	p.V356V	SYT2_uc010pqb.1_Silent_p.V356V|SYT2_uc009xaf.2_Silent_p.V186V	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	356	Phospholipid binding (By similarity).|C2 2.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GCACGGTGACCACTACCTGGA	0.552													29	67	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27892203	27892203	+	Silent	SNP	T	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27892203T>C	uc002rlk.3	+	5	1576	c.1294T>C	c.(1294-1296)TTG>CTG	p.L432L		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	432						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					CCAGTGCTCATTGGAAGCTTG	0.413													9	271	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84804488	84804488	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84804488C>A	uc010fgb.2	+	13	2169	c.2032C>A	c.(2032-2034)CTT>ATT	p.L678I	DNAH6_uc002soo.2_Missense_Mutation_p.L257I|DNAH6_uc002sop.2_Missense_Mutation_p.L257I	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	678	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						TGATACTAGGCTTCTAAGAGA	0.338													5	115	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86361451	86361451	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86361451T>A	uc002sqw.2	+	20	1646	c.1580T>A	c.(1579-1581)CTG>CAG	p.L527Q	PTCD3_uc002sqx.1_Missense_Mutation_p.L117Q|SNORD94_uc010fgr.1_5'Flank	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor	527						mitochondrion	protein binding			ovary(1)	1						CGCAGTGACCTGAGAGAAGAG	0.438													25	82	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													4	27	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157442	145157442	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157442G>A	uc002tvu.2	-	8	1792	c.1312C>T	c.(1312-1314)CAC>TAC	p.H438Y	ZEB2_uc002tvv.2_Missense_Mutation_p.H432Y|ZEB2_uc010zbm.1_Missense_Mutation_p.H409Y|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.H467Y	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	438	SMAD-MH2 binding domain (By similarity).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		ACACCTAAGTGCTGCATTGGA	0.473													37	102	---	---	---	---	PASS
MYO1B	4430	broad.mit.edu	37	2	192214900	192214900	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192214900G>T	uc010fsg.2	+	7	766	c.511G>T	c.(511-513)GAT>TAT	p.D171Y	MYO1B_uc002usq.2_Missense_Mutation_p.D171Y|MYO1B_uc002usr.2_Missense_Mutation_p.D171Y|MYO1B_uc002uss.1_Missense_Mutation_p.D171Y	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	171	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CAAATATATGGATATTGAATT	0.343													30	125	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201721535	201721535	+	Splice_Site	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201721535C>A	uc002uwe.2	-	9	1109	c.928_splice	c.e9-1	p.K310_splice	CLK1_uc002uwd.2_Splice_Site_p.K133_splice|CLK1_uc010zhi.1_Splice_Site_p.K352_splice|CLK1_uc002uwf.2_Splice_Site_p.K84_splice|CLK1_uc002uwg.2_Splice_Site_p.K159_splice|CLK1_uc010fsv.2_Splice_Site	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1						cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						CATCACGTTTCTGAAAATCAT	0.328													88	151	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235951396	235951396	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235951396G>T	uc002vvp.2	+	4	2376	c.1983G>T	c.(1981-1983)TTG>TTT	p.L661F	SH3BP4_uc010fym.2_Missense_Mutation_p.L661F|SH3BP4_uc002vvq.2_Missense_Mutation_p.L661F	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	661					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TTGGTAAGTTGCTCAAGACTG	0.582													33	104	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188309	10188309	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188309T>C	uc003bvc.2	+	2	665	c.452T>C	c.(451-453)ATC>ACC	p.I151T	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	151	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.I151S(6)|p.I151T(3)|p.I151M(2)|p.I151N(2)|p.I151F(1)|p.?(1)|p.N150fs*7(1)|p.I151_T152del(1)|p.I151fs*8(1)|p.G144fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTTGCCAATATCACACTGCCA	0.398		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				86	146	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108572578	108572578	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108572578C>A	uc003dxi.1	+	6	559	c.415C>A	c.(415-417)CAA>AAA	p.Q139K	TRAT1_uc010hpx.1_Missense_Mutation_p.Q102K	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	139	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						TGGAGATGAGCAACTACATGC	0.458													34	85	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94316836	94316836	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94316836G>C	uc011cdt.1	+	9	1582	c.1324G>C	c.(1324-1326)GTT>CTT	p.V442L	GRID2_uc011cdu.1_Missense_Mutation_p.V347L	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	442	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	GCGTGGAGTGGTTCTACGTGT	0.398													51	129	---	---	---	---	PASS
FAM173B	134145	broad.mit.edu	37	5	10227514	10227514	+	3'UTR	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10227514G>A	uc003jeo.2	-	5					FAM173B_uc003jep.2_RNA|FAM173B_uc010itr.2_3'UTR	NM_199133	NP_954584	Q6P4H8	F173B_HUMAN	hypothetical protein LOC134145							integral to membrane				kidney(1)|central_nervous_system(1)	2						CAAGATCAGGGAAGACTACAA	0.408													20	52	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21751731	21751731	+	3'UTR	SNP	G	T	T	rs145035915		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21751731G>T	uc010iuc.2	-	12					CDH12_uc011cno.1_3'UTR|CDH12_uc003jgk.2_3'UTR|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						gtgtgtgtgtgtgtgtgtgtt	0.239										HNSCC(59;0.17)			3	30	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32052785	32052785	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32052785C>T	uc003jhl.2	+	9	2122	c.1734C>T	c.(1732-1734)CTC>CTT	p.L578L	PDZD2_uc003jhm.2_Silent_p.L578L|PDZD2_uc011cnx.1_Silent_p.L404L	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	578					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CTTGGAGGCTCATTCGGCCAT	0.483													74	178	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36108639	36108639	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36108639G>T	uc003jkb.1	-	16	2309	c.1894C>A	c.(1894-1896)CGT>AGT	p.R632S		NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	632	Cytoplasmic (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TACTTACAACGGTTGGTATTA	0.353													3	90	---	---	---	---	PASS
RGNEF	64283	broad.mit.edu	37	5	73148375	73148375	+	Intron	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73148375G>T	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_3'UTR|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		AGCTGGTAGTGTGTATAATGA	0.323													23	53	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127609608	127609608	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127609608A>T	uc003kuu.2	-	61	8203	c.7764T>A	c.(7762-7764)TGT>TGA	p.C2588*		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2588	EGF-like 44; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GAGTGTTTTGACAGATTCCCT	0.448													24	70	---	---	---	---	PASS
RAPGEF6	51735	broad.mit.edu	37	5	130897689	130897689	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130897689C>T	uc003kvn.1	-	5	539	c.333G>A	c.(331-333)GAG>GAA	p.E111E	RAPGEF6_uc003kvp.1_Silent_p.E161E|RAPGEF6_uc003kvo.1_Silent_p.E111E|RAPGEF6_uc010jdi.1_Silent_p.E111E|RAPGEF6_uc010jdj.1_Silent_p.E111E|RAPGEF6_uc003kvr.2_Silent_p.E111E|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Silent_p.E111E	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide	111					Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTTCTGAAGGCTCTAATACAA	0.289													41	161	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774176	140774176	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774176G>T	uc003lkd.1	+	1	2694	c.1796G>T	c.(1795-1797)GGC>GTC	p.G599V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.G599V	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	599	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706													6	63	---	---	---	---	PASS
WRNIP1	56897	broad.mit.edu	37	6	2784577	2784577	+	Silent	SNP	G	A	A	rs150885902		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2784577G>A	uc003mtz.2	+	6	1853	c.1662G>A	c.(1660-1662)GCG>GCA	p.A554A	WRNIP1_uc003mua.2_Silent_p.A529A	NM_020135	NP_064520	Q96S55	WRIP1_HUMAN	Werner helicase interacting protein isoform 1	554					DNA replication|DNA synthesis involved in DNA repair|regulation of DNA-dependent DNA replication initiation	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|DNA binding|metal ion binding|protein binding			ovary(1)|pancreas(1)	2	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				ACCCGTCTGCGTTAACACAAG	0.493													15	39	---	---	---	---	PASS
TMEM30A	55754	broad.mit.edu	37	6	75968691	75968691	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75968691G>C	uc003phw.2	-	6	975	c.697C>G	c.(697-699)CCT>GCT	p.P233A	TMEM30A_uc003phx.2_Missense_Mutation_p.P197A	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1	233						integral to membrane					0						CAGTTCACAGGCTTTGTTGTA	0.363													21	85	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79708068	79708068	+	Silent	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79708068G>A	uc003pir.2	-	18	2146	c.1920C>T	c.(1918-1920)ATC>ATT	p.I640I	PHIP_uc011dyp.1_Silent_p.I640I	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	640					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CCAGTGGGCTGATCTCCTGGT	0.393													56	154	---	---	---	---	PASS
TWISTNB	221830	broad.mit.edu	37	7	19737956	19737956	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19737956T>G	uc003sup.1	-	4	1021	c.1000A>C	c.(1000-1002)AAA>CAA	p.K334Q		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	334	Lys-rich.					microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1						AAATTACTTTTCCCTTTTCTT	0.303													39	122	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28206650	28206650	+	Silent	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28206650A>G	uc003xgq.2	-	9	1510	c.1422T>C	c.(1420-1422)AGT>AGC	p.S474S	ZNF395_uc003xgt.2_Silent_p.S474S|ZNF395_uc003xgr.2_Silent_p.S474S|ZNF395_uc003xgs.2_Silent_p.S474S	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	474					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		ACCTGGCACCACTCTGGGCCC	0.632													46	104	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77776069	77776069	+	Silent	SNP	T	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77776069T>C	uc003yav.2	+	11	10371	c.9984T>C	c.(9982-9984)GCT>GCC	p.A3328A		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3324						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAAGTACTGCTACAGAAAGCA	0.388										HNSCC(33;0.089)			3	5	---	---	---	---	PASS
HEY1	23462	broad.mit.edu	37	8	80678002	80678002	+	Silent	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80678002G>A	uc003ybm.2	-	5	536	c.336C>T	c.(334-336)TAC>TAT	p.Y112Y	HEY1_uc010lzq.2_5'UTR|HEY1_uc003ybl.2_Silent_p.Y116Y	NM_012258	NP_036390	Q9Y5J3	HEY1_HUMAN	hairy/enhancer-of-split related with YRPW motif	112	Transcriptional repression and interaction with NCOR1 and SIN3A (By similarity).				angiogenesis|negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|transcription, DNA-dependent	nucleus	DNA binding|protein binding			lung(3)	3	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			GCGCGTCAAAGTAACCTAAGC	0.488											OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	69	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37746200	37746200	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37746200G>A	uc004aag.1	+	16	4215	c.4171G>A	c.(4171-4173)GCA>ACA	p.A1391T	FRMPD1_uc004aah.1_Missense_Mutation_p.A1391T	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1391						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		CTGCACCACCGCACCCCTGTC	0.662													4	107	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72617449	72617449	+	Splice_Site	SNP	T	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72617449T>C	uc001jrm.2	+	6	708	c.486_splice	c.e6+2	p.K162_splice		NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1						apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	CTTGTGAAGGTGAGTGTCCAG	0.473													16	86	---	---	---	---	PASS
MMS19	64210	broad.mit.edu	37	10	99223688	99223688	+	Silent	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99223688A>G	uc001kns.3	-	19	2064	c.1839T>C	c.(1837-1839)CCT>CCC	p.P613P	MMS19_uc001knq.2_5'Flank|MMS19_uc009xvs.2_Silent_p.P198P|MMS19_uc009xvt.2_Silent_p.P357P|MMS19_uc001knr.2_Silent_p.P454P|MMS19_uc010qox.1_Silent_p.P591P|MMS19_uc001knt.2_Silent_p.P613P|MMS19_uc001knu.1_RNA	NM_022362	NP_071757	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog	613					chromosome segregation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent|two-component signal transduction system (phosphorelay)	cytoplasm|holo TFIIH complex|MMXD complex	estrogen receptor binding|protein binding, bridging|receptor signaling complex scaffold activity|transcription coactivator activity				0		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		AGCAACTCTCAGGGTCCTGCT	0.507								Direct_reversal_of_damage|NER			OREG0020414	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	18	---	---	---	---	PASS
PI4K2A	55361	broad.mit.edu	37	10	99400914	99400914	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99400914T>G	uc001kog.1	+	1	472	c.415T>G	c.(415-417)TTC>GTC	p.F139V	PI4K2A_uc010qoy.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	139	PI3K/PI4K.				phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		CGGAAGCTACTTCGTCAAGGA	0.706													10	34	---	---	---	---	PASS
C10orf81	79949	broad.mit.edu	37	10	115534737	115534737	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115534737C>A	uc001lat.1	+	9	1476	c.914C>A	c.(913-915)ACA>AAA	p.T305K	C10orf81_uc001lar.1_Missense_Mutation_p.T311K|C10orf81_uc009xyc.1_Missense_Mutation_p.T223K|C10orf81_uc001las.1_Missense_Mutation_p.T223K|C10orf81_uc001lau.1_Missense_Mutation_p.T125K	NM_024889	NP_079165	Q5SXH7	CJ081_HUMAN	hypothetical protein LOC79949	305										central_nervous_system(1)	1		Colorectal(252;0.175)		Epithelial(162;0.0181)|all cancers(201;0.0204)		GCACAGACCACAAATGACCAA	0.478													8	71	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129913557	129913557	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129913557C>G	uc001lke.2	-	7	1310	c.1115G>C	c.(1114-1116)AGA>ACA	p.R372T	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	372					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CACAGATTCTCTTCTACCAGT	0.398													39	275	---	---	---	---	PASS
IRF7	3665	broad.mit.edu	37	11	614301	614301	+	Silent	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:614301G>A	uc001lqh.2	-	6	922	c.552C>T	c.(550-552)CTC>CTT	p.L184L	IRF7_uc009ycb.2_Silent_p.L78L|IRF7_uc010qwf.1_Silent_p.L183L|IRF7_uc001lqf.2_Intron|IRF7_uc010qwg.1_Intron|IRF7_uc001lqg.2_Silent_p.L197L|IRF7_uc001lqi.2_Silent_p.L184L|IRF7_uc010qwh.1_Intron	NM_001572	NP_001563	Q92985	IRF7_HUMAN	interferon regulatory factor 7 isoform a	184					interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of interferon-alpha production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCACTGCCTGGAGCAGGAGGT	0.657													5	22	---	---	---	---	PASS
OR4C16	219428	broad.mit.edu	37	11	55339950	55339950	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55339950C>T	uc010rih.1	+	1	347	c.347C>T	c.(346-348)ACG>ATG	p.T116M		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				CTCATCCTCACGGCTGTTGAC	0.512													96	239	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85409119	85409119	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85409119T>A	uc010rth.1	-	16	2632	c.2356A>T	c.(2356-2358)AAA>TAA	p.K786*	SYTL2_uc010rtg.1_Nonsense_Mutation_p.K787*|SYTL2_uc010rti.1_Nonsense_Mutation_p.K762*|SYTL2_uc010rtj.1_Nonsense_Mutation_p.K754*|SYTL2_uc001pav.2_Nonsense_Mutation_p.K228*|SYTL2_uc010rte.1_Nonsense_Mutation_p.K188*|SYTL2_uc001pax.2_Nonsense_Mutation_p.K228*|SYTL2_uc001paz.2_Nonsense_Mutation_p.K107*|SYTL2_uc001pba.2_Nonsense_Mutation_p.K171*|SYTL2_uc001pay.2_Nonsense_Mutation_p.K217*|SYTL2_uc001paw.2_Nonsense_Mutation_p.K188*|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Nonsense_Mutation_p.K1084*|SYTL2_uc001pbb.2_Nonsense_Mutation_p.K1124*|SYTL2_uc001pbc.2_Nonsense_Mutation_p.K1108*|SYTL2_uc010rtf.1_Nonsense_Mutation_p.K604*	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	786	C2 2.				intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGAAGCTTTTTACCTACAATA	0.403													28	73	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113860606	113860606	+	3'UTR	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113860606C>A	uc010rxb.1	+	8					HTR3A_uc010rxa.1_Intron|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_3'UTR	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A						digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	AGACAAAGTCCCGTGCCCTGT	0.532													3	12	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059127	119059127	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059127A>G	uc001pwb.2	+	6	1648	c.1124A>G	c.(1123-1125)GAC>GGC	p.D375G	PDZD3_uc001pvy.2_Missense_Mutation_p.D295G|PDZD3_uc001pvz.2_Missense_Mutation_p.D309G|PDZD3_uc010rzd.1_Missense_Mutation_p.D296G|PDZD3_uc001pwa.2_Missense_Mutation_p.D5G			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	375	PDZ 3.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CAGGCTGGGGACCGGCTGGTG	0.652													4	50	---	---	---	---	PASS
B3GAT1	27087	broad.mit.edu	37	11	134253723	134253723	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134253723C>T	uc001qhq.2	-	4	733	c.472G>A	c.(472-474)GCC>ACC	p.A158T	B3GAT1_uc001qhr.2_Missense_Mutation_p.A158T|B3GAT1_uc010scv.1_Missense_Mutation_p.A171T	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	158	Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GGGTCGCGGGCGTCTCCGCGC	0.731													3	12	---	---	---	---	PASS
LAG3	3902	broad.mit.edu	37	12	6882234	6882234	+	Intron	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6882234G>A	uc001qqt.3	+						LAG3_uc001qqs.2_Intron|LAG3_uc001qqu.2_5'UTR	NM_002286	NP_002277	P18627	LAG3_HUMAN	lymphocyte-activation protein 3 precursor							integral to membrane	antigen binding|MHC class II protein binding				0						TCTGGGCAGAGAAGAAACAGA	0.562													21	49	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30784892	30784892	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30784892C>A	uc001rjd.2	-	24	3123	c.2953G>T	c.(2953-2955)GAG>TAG	p.E985*	IPO8_uc001rje.1_Nonsense_Mutation_p.E474*|IPO8_uc010sjt.1_Nonsense_Mutation_p.E780*	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	985					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CTCTGATCCTCGCTGAGTGGT	0.562													3	78	---	---	---	---	PASS
C12orf40	283461	broad.mit.edu	37	12	40114940	40114940	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40114940C>A	uc001rmc.2	+	13	2013	c.1846C>A	c.(1846-1848)CTA>ATA	p.L616I	C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	616										ovary(6)	6						ACAGTGTGATCTAATTTCAAA	0.413													55	118	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85438507	85438507	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85438507G>A	uc001tac.2	+	4	367	c.256G>A	c.(256-258)GGA>AGA	p.G86R	LRRIQ1_uc001tab.1_Missense_Mutation_p.G86R|LRRIQ1_uc001taa.1_Missense_Mutation_p.G86R|LRRIQ1_uc001tad.2_5'UTR	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	86										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		CTGTAGTTATGGAGCAGTTTC	0.279													33	137	---	---	---	---	PASS
SCYL2	55681	broad.mit.edu	37	12	100733089	100733089	+	3'UTR	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100733089G>A	uc001thn.2	+	18						NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein						endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						CTCTGTCCATGCCAGCATAGT	0.393													3	14	---	---	---	---	PASS
PGAM5	192111	broad.mit.edu	37	12	133295376	133295376	+	Intron	SNP	T	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133295376T>G	uc009zyv.2	+						PGAM5_uc010tbr.1_Intron|PGAM5_uc001uku.2_Missense_Mutation_p.F250V	NM_138575	NP_612642	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5							integral to membrane|mitochondrial outer membrane	phosphoprotein phosphatase activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		CGCTGGGGATTTTGTGCTTCT	0.617													36	106	---	---	---	---	PASS
FAM123A	219287	broad.mit.edu	37	13	25744209	25744209	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25744209C>T	uc001uqb.2	-	1	1649	c.1549G>A	c.(1549-1551)GTC>ATC	p.V517I	FAM123A_uc001uqa.2_Missense_Mutation_p.V398I|FAM123A_uc001uqc.2_Missense_Mutation_p.V398I	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	517										ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CTGTTGGGGACGCCTTCCTGC	0.657													19	98	---	---	---	---	PASS
KBTBD6	89890	broad.mit.edu	37	13	41706394	41706394	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41706394T>C	uc001uxu.1	-	1	543	c.254A>G	c.(253-255)AAC>AGC	p.N85S	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Intron|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	85	BTB.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CACATTGCGGTTGCAGGGGAA	0.622													4	55	---	---	---	---	PASS
OLFM4	10562	broad.mit.edu	37	13	53624774	53624774	+	Silent	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53624774A>G	uc001vhl.2	+	5	1401	c.1401A>G	c.(1399-1401)CTA>CTG	p.L467L	OLFM4_uc001vhk.1_3'UTR	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	467	Olfactomedin-like.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AGGGCAAACTAGACATTGTAA	0.383													29	146	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92054360	92054360	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92054360C>A	uc001xzs.1	-	25	3159	c.3019G>T	c.(3019-3021)GCA>TCA	p.A1007S	CATSPERB_uc010aub.1_Missense_Mutation_p.A529S	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	1007					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TTATACACTGCAGCACCAAGA	0.299													21	49	---	---	---	---	PASS
MPI	4351	broad.mit.edu	37	15	75182890	75182890	+	Silent	SNP	G	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75182890G>T	uc002azc.1	+	2	44	c.39G>T	c.(37-39)GTG>GTT	p.V13V	MPI_uc010ulv.1_Silent_p.V13V|MPI_uc010ulw.1_Intron|MPI_uc002azd.1_Silent_p.V13V|MPI_uc010ulx.1_Intron|MPI_uc002aze.1_Silent_p.V13V	NM_002435	NP_002426	P34949	MPI_HUMAN	mannose-6- phosphate isomerase	13					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding			ovary(2)	2						CCTGTGCGGTGCAGCAGTATG	0.607													4	114	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	76994175	76994175	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76994175A>G	uc002bby.2	-	19	2491	c.2432T>C	c.(2431-2433)GTT>GCT	p.V811A	SCAPER_uc010bkr.2_Missense_Mutation_p.V119A|SCAPER_uc002bbx.2_Missense_Mutation_p.V565A|SCAPER_uc002bbz.1_Missense_Mutation_p.V682A|SCAPER_uc002bca.1_Missense_Mutation_p.V676A	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	810	C2H2-type.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TCTCCCTTTAACATGGCTAAA	0.353													21	71	---	---	---	---	PASS
CPEB1	64506	broad.mit.edu	37	15	83224911	83224911	+	Intron	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83224911G>A	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_Intron|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron|CPEB1_uc002bip.2_5'UTR	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			TTAAAGGCTAGTTTTGTTATA	0.378													4	12	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													3	16	---	---	---	---	PASS
DOK4	55715	broad.mit.edu	37	16	57509863	57509863	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57509863G>C	uc010cdb.2	-	2	371	c.73C>G	c.(73-75)CGG>GGG	p.R25G	DOK4_uc002elu.1_Missense_Mutation_p.R25G|DOK4_uc002elv.3_Missense_Mutation_p.R25G	NM_018110	NP_060580	Q8TEW6	DOK4_HUMAN	docking protein 4	25	PH.						insulin receptor binding			skin(1)	1						CAGCACCTCCGGTAGATCTGT	0.667													8	29	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11738174	11738174	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11738174G>C	uc002gne.2	+	49	9534	c.9466G>C	c.(9466-9468)GCA>CCA	p.A3156P	DNAH9_uc010coo.2_Missense_Mutation_p.A2450P	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3156	Stalk (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGCTGAGCCAGCACTCACAGC	0.572													5	37	---	---	---	---	PASS
RIOK3	8780	broad.mit.edu	37	18	21056977	21056977	+	Missense_Mutation	SNP	G	A	A	rs111330062	byFrequency	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21056977G>A	uc002kui.3	+	10	1798	c.1181G>A	c.(1180-1182)CGG>CAG	p.R394Q	RIOK3_uc010dls.2_Missense_Mutation_p.R394Q|RIOK3_uc010xas.1_Missense_Mutation_p.R378Q|RIOK3_uc010xat.1_Missense_Mutation_p.R138Q	NM_003831	NP_003822	O14730	RIOK3_HUMAN	sudD suppressor of bimD6 homolog	394	Protein kinase.				chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CAGTTGATGCGGCAGTTATAT	0.373													6	55	---	---	---	---	PASS
ATCAY	85300	broad.mit.edu	37	19	3907733	3907733	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3907733C>T	uc002lyy.3	+	5	790	c.360C>T	c.(358-360)GAC>GAT	p.D120D	ATCAY_uc010xhz.1_Silent_p.D126D|ATCAY_uc010dts.2_5'Flank	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	120					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		TGCTTCTAGACGACACCCCCG	0.642													10	37	---	---	---	---	PASS
ZNF155	7711	broad.mit.edu	37	19	44501334	44501334	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44501334A>G	uc002oxy.1	+	5	1530	c.1325A>G	c.(1324-1326)AAT>AGT	p.N442S	ZNF155_uc002oxz.1_Missense_Mutation_p.N442S|ZNF155_uc010xwt.1_Missense_Mutation_p.N453S|uc010ejc.1_RNA	NM_003445	NP_003436	Q12901	ZN155_HUMAN	zinc finger protein 155	442	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2		Prostate(69;0.0352)				ACTAAGTTTAATCTTGACTTG	0.418													23	129	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25187227	25187227	+	Splice_Site	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25187227G>A	uc002wuj.2	+	2	234	c.54_splice	c.e2+1	p.Q18_splice	ENTPD6_uc010zsy.1_Splice_Site_p.Q18_splice|ENTPD6_uc010gdj.1_Intron|ENTPD6_uc010zsz.1_Intron|ENTPD6_uc002wum.2_Intron|ENTPD6_uc010zta.1_Splice_Site_p.Q18_splice|ENTPD6_uc002wun.2_Splice_Site_p.Q18_splice|ENTPD6_uc002wuk.2_Splice_Site_p.Q18_splice|ENTPD6_uc002wul.2_Splice_Site_p.Q18_splice|ENTPD6_uc010ztb.1_Intron|ENTPD6_uc010ztc.1_Intron|ENTPD6_uc002wuo.2_Intron	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6							Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						CATTTTTCAGGTTTGTCTGGG	0.393													5	157	---	---	---	---	PASS
ADRM1	11047	broad.mit.edu	37	20	60881317	60881317	+	Missense_Mutation	SNP	C	A	A	rs145275540		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60881317C>A	uc002ycn.2	+	4	475	c.395C>A	c.(394-396)CCG>CAG	p.P132Q	ADRM1_uc011aai.1_Missense_Mutation_p.P132Q|ADRM1_uc002yco.2_Missense_Mutation_p.P132Q|ADRM1_uc002ycp.1_RNA	NM_007002	NP_008933	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1 precursor	132	Interaction with PSMD1.				proteasome assembly|transcription elongation from RNA polymerase II promoter	cytoplasm|integral to plasma membrane|membrane fraction|nucleus|proteasome complex	endopeptidase activator activity|protease binding|proteasome binding				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			AACAACCCCCCGATGCCTGGG	0.607													5	182	---	---	---	---	PASS
PRPF6	24148	broad.mit.edu	37	20	62642793	62642793	+	Silent	SNP	C	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62642793C>T	uc002yho.2	+	11	1629	c.1461C>T	c.(1459-1461)ATC>ATT	p.I487I	PRPF6_uc002yhp.2_Silent_p.I487I	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	487					assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					AGAAGATCATCGACCGAGCCA	0.587													16	43	---	---	---	---	PASS
MCART6	401612	broad.mit.edu	37	X	103349894	103349894	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103349894G>A	uc004elu.2	-	2	228	c.47C>T	c.(46-48)ACG>ATG	p.T16M		NM_001012755	NP_001012773	Q5H9E4	MCAR6_HUMAN	mitochondrial carrier triple repeat 6	16					transport	integral to membrane|mitochondrial inner membrane					0						CTCTGCTCGCGTCCTGTGCTG	0.522													25	46	---	---	---	---	PASS
PLEKHG5	57449	broad.mit.edu	37	1	6526203	6526210	+	3'UTR	DEL	CGTGCTCT	-	-	rs45616733		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6526203_6526210delCGTGCTCT	uc001ano.1	-	22					PLEKHG5_uc001ann.1_3'UTR|PLEKHG5_uc001anq.1_3'UTR|PLEKHG5_uc001anp.1_3'UTR|TNFRSF25_uc001ana.2_5'UTR|TNFRSF25_uc001anb.2_RNA|TNFRSF25_uc001anc.2_RNA|TNFRSF25_uc001and.2_5'UTR|TNFRSF25_uc009vlz.2_RNA|TNFRSF25_uc001ane.2_5'UTR|TNFRSF25_uc001anf.2_5'UTR|TNFRSF25_uc001ang.2_5'UTR|TNFRSF25_uc001anh.2_5'UTR|TNFRSF25_uc001ani.1_5'UTR|PLEKHG5_uc001anj.1_3'UTR|PLEKHG5_uc009vma.1_3'UTR|PLEKHG5_uc010nzr.1_3'UTR|PLEKHG5_uc001ank.1_3'UTR|PLEKHG5_uc009vmb.1_3'UTR|PLEKHG5_uc001anl.1_3'UTR|PLEKHG5_uc001anm.1_3'UTR	NM_001042663	NP_001036128	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		TTCCCGGCTCCGTGCTCTCTGCCCGTCG	0.471													5	5	---	---	---	---	
CELA3A	10136	broad.mit.edu	37	1	22333210	22333215	+	Intron	DEL	AATAAT	-	-	rs34545472		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22333210_22333215delAATAAT	uc001bfl.2	+							NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein						cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						actctgtctcaataataataataata	0.180													2	4	---	---	---	---	
EYA3	2140	broad.mit.edu	37	1	28316444	28316445	+	Intron	DEL	TA	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28316444_28316445delTA	uc001bpi.1	-						EYA3_uc010ofs.1_Intron|EYA3_uc010oft.1_Intron|EYA3_uc001bpj.2_Intron|EYA3_uc001bpk.1_Intron|EYA3_uc010ofu.1_Intron	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3						anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGTATGTTtatatatatata	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128407	31128409	+	IGR	DEL	GAC	-	-	rs72287507	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128407_31128409delGAC								None (None upstream) : MATN1 (55717 downstream)																							tggtggtggtgacggtggtggtg	0.000													4	2	---	---	---	---	
ROR1	4919	broad.mit.edu	37	1	64602853	64602853	+	Intron	DEL	G	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64602853delG	uc001dbj.2	+						ROR1_uc001dbi.3_Intron|uc001dbl.2_Intron	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						ATGACTTTCTGGGGGTGTAGG	0.418											OREG0013542	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790791	153790791	+	Intron	DEL	T	-	-	rs144812255		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790791delT	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAAGGttttcttttttttttt	0.189													4	2	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173819744	173819744	+	Intron	DEL	T	-	-	rs66665709		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819744delT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	TGCATAAATCttttttttttt	0.184													4	2	---	---	---	---	
C1orf21	81563	broad.mit.edu	37	1	184528723	184528724	+	Intron	INS	-	CCTT	CCTT	rs141160537	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184528723_184528724insCCTT	uc001gqv.1	+							NM_030806	NP_110433	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21												0		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ctctcttcctcccttccttcct	0.010													5	3	---	---	---	---	
ASPM	259266	broad.mit.edu	37	1	197093847	197093848	+	Intron	DEL	AT	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197093847_197093848delAT	uc001gtu.2	-						ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly						mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						atatatatacatatatatatat	0.035													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215814186	215814186	+	Intron	DEL	C	-	-	rs78797010		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215814186delC	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAATCCaaacaaaaaaaaaa	0.318										HNSCC(13;0.011)			6	3	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215955732	215955733	+	Intron	INS	-	AA	AA	rs138855979	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215955732_215955733insAA	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACATAAATGATAAGAGTCATTT	0.282										HNSCC(13;0.011)			4	2	---	---	---	---	
ITGA4	3676	broad.mit.edu	37	2	182344708	182344708	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182344708delT	uc002unu.2	+						ITGA4_uc010zfl.1_Intron	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	CTTCTCTGGCTTTTTTTTTTT	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	28069378	28069381	+	IGR	DEL	CTTT	-	-	rs113702029		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28069378_28069381delCTTT								EOMES (305172 upstream) : CMC1 (213743 downstream)																							ttctcttctcctttctttctttct	0.049													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137009707	137009708	+	IGR	INS	-	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137009707_137009708insT								IL20RB (279787 upstream) : SOX14 (473871 downstream)																							tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180605395	180605395	+	IGR	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180605395delT								CCDC39 (149733 upstream) : FXR1 (25057 downstream)																							TTGACTAAGGTTTTTTTTTTT	0.274													5	3	---	---	---	---	
GAK	2580	broad.mit.edu	37	4	906329	906330	+	Intron	INS	-	A	A	rs111864334		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:906329_906330insA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbo.2_Intron|GAK_uc003gbl.3_5'Flank	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		ACCCTGGCAGTAAAAAAAAAAC	0.446													4	2	---	---	---	---	
GRK4	2868	broad.mit.edu	37	4	3029536	3029537	+	Intron	DEL	TT	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3029536_3029537delTT	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron	NM_182982	NP_892027	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AATGCTATTATTTCCAGCCATG	0.356													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050665	154050665	+	IGR	DEL	A	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050665delA								FHDC1 (149817 upstream) : TRIM2 (23605 downstream)																							caccatcaccaccaccaccac	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4912875	4912882	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4912875_4912882delGAAGGAAG								None (None upstream) : LOC340094 (121590 downstream)																							ggaaagaaatgaaggaaggaaggaagga	0.111													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124187225	124187228	+	IGR	DEL	CTTT	-	-	rs111256114		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124187225_124187228delCTTT								ZNF608 (102725 upstream) : None (None downstream)																							tccttccttcctttcttccttcct	0.029													6	5	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170692965	170692966	+	Intron	INS	-	AT	AT			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170692965_170692966insAT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACTGGtaaaaaatatatatata	0.426			T	TRD@	ALL								4	3	---	---	---	---	
FTSJD2	23070	broad.mit.edu	37	6	37420622	37420622	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37420622delT	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCTGTTTACATTTTTTTTTTT	0.244													4	3	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123812250	123812250	+	Intron	DEL	A	-	-	rs5879684		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123812250delA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		actacatctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38385227	38385227	+	Intron	DEL	A	-	-	rs79129934	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38385227delA	uc003tgp.1	+											Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AGGAGCTGGTATTCCTGAGAC	0.527													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659470	57659471	+	IGR	DEL	TA	-	-	rs79867563	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659470_57659471delTA								ZNF716 (126205 upstream) : None (None downstream)																							GCGTTGATCTTACAGTCTGGTG	0.371													11	5	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	108060484	108060485	+	Intron	DEL	GT	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108060484_108060485delGT	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						TAGTTCCATCgtgtgtgtgtgt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15300846	15300855	+	IGR	DEL	TGTGTGTGTG	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15300846_15300855delTGTGTGTGTG								SGCZ (205054 upstream) : TUSC3 (96875 downstream)																							cccACCTAATtgtgtgtgtgtgtgtgtgtg	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67022159	67022160	+	IGR	DEL	GT	-	-	rs35658987		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67022159_67022160delGT								DNAJC5B (9404 upstream) : TRIM55 (17118 downstream)																							cttttttttggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
C8orf46	254778	broad.mit.edu	37	8	67417593	67417593	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67417593delT	uc003xwg.2	+						C8orf46_uc003xwh.2_Intron|C8orf46_uc011let.1_Intron	NM_152765	NP_689978	Q8TAG6	CH046_HUMAN	hypothetical protein LOC254778											skin(2)	2			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GCTAACCGCGTTTCCCCCGCC	0.672													4	2	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125034095	125034096	+	Intron	INS	-	T	T	rs138450142	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125034095_125034096insT	uc003yqw.2	+						uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGCTTTATTCATTTTTTTTTCA	0.386													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128574529	128574530	+	IGR	DEL	CA	-	-	rs113761762		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128574529_128574530delCA								LOC727677 (80145 upstream) : MYC (173235 downstream)																							GGATacacaccacacacacaca	0.252													4	2	---	---	---	---	
EXOSC2	23404	broad.mit.edu	37	9	133573185	133573186	+	Intron	INS	-	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133573185_133573186insT	uc004bzu.2	+						EXOSC2_uc011mbz.1_Intron|EXOSC2_uc011mca.1_Intron	NM_014285	NP_055100	Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|positive regulation of cell growth|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|7S RNA binding|protein binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		ACTGGTTCATGttttttttttt	0.198													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298339	57298342	+	Intron	DEL	TTCC	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298339_57298342delTTCC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ccttcctcctttccttccttcctt	0.000										HNSCC(58;0.16)			9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72397905	72397906	+	IGR	INS	-	TCCT	TCCT	rs143397937	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72397905_72397906insTCCT								PRF1 (35374 upstream) : ADAMTS14 (34653 downstream)																							ACAGCTTATGAtccttccttcc	0.020													8	4	---	---	---	---	
XPNPEP1	7511	broad.mit.edu	37	10	111651337	111651337	+	Intron	DEL	T	-	-	rs112429910		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111651337delT	uc001kyp.1	-						XPNPEP1_uc009xxt.1_Intron|XPNPEP1_uc001kyq.1_Intron|XPNPEP1_uc010qrb.1_Intron	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,						bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		aggcatgccattttttttttt	0.159													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24207166	24207167	+	IGR	INS	-	GGAA	GGAA	rs138351629	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24207166_24207167insGGAA								None (None upstream) : LUZP2 (311389 downstream)																							agggaaggaagggaagggaagg	0.000													10	6	---	---	---	---	
HTR3B	9177	broad.mit.edu	37	11	113803374	113803375	+	Intron	INS	-	AC	AC	rs143933468	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113803374_113803375insAC	uc001pok.2	+						HTR3B_uc001pol.2_Intron	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B						synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		TTGTTTTGGAAACAGTGTTAGG	0.406													3	3	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116906807	116906807	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116906807delT	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						GAAAGGTTAATTTTttttttt	0.249													11	5	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117613718	117613719	+	Intron	INS	-	CATCCATC	CATCCATC	rs143696830	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117613718_117613719insCATCCATC	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CACTCCACTTTcatccatccat	0.292													5	3	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126391451	126391451	+	Intron	DEL	C	-	-	rs35886498		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126391451delC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CAAGCAGGGGCCATTCTACAA	0.572													1	5	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178448	134178450	+	Intron	DEL	CAT	-	-	rs140914654	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178448_134178450delCAT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		tcaccatcaccatcaccaccacc	0.000													6	5	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5922220	5922223	+	Intron	DEL	AGGA	-	-	rs147780677		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5922220_5922223delAGGA	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						agaaagaaagaggaaggaaggaag	0.137													2	4	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42692996	42692998	+	Intron	DEL	AAA	-	-	rs71808992		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42692996_42692998delAAA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		agactctgtcaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80632597	80632598	+	IGR	DEL	TG	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80632597_80632598delTG								PPP1R12A (303362 upstream) : PTPRQ (205528 downstream)																							TACACCTATTtgtgtgtgtgtg	0.302													4	2	---	---	---	---	
ZCCHC8	55596	broad.mit.edu	37	12	122962860	122962860	+	Intron	DEL	A	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122962860delA	uc001ucn.2	-						ZCCHC8_uc001ucl.2_5'UTR|ZCCHC8_uc001ucm.2_Intron|ZCCHC8_uc009zxp.2_Intron|ZCCHC8_uc009zxq.2_Intron	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AAAGAGAAGGAAAAAAAAAAC	0.353													4	2	---	---	---	---	
FAM48A	55578	broad.mit.edu	37	13	37607341	37607341	+	Intron	DEL	A	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37607341delA	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc010tes.1_Intron|FAM48A_uc001uwl.1_Intron	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		TTTCAAAAAGAAAAAAAAAAA	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112849952	112849953	+	IGR	INS	-	CCTT	CCTT	rs111430260		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112849952_112849953insCCTT								SOX1 (123932 upstream) : C13orf28 (180716 downstream)																							GTACCAATTGCccttccttcct	0.252													4	5	---	---	---	---	
SAMD4A	23034	broad.mit.edu	37	14	55241532	55241533	+	Intron	DEL	AA	-	-	rs35827295		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55241532_55241533delAA	uc001xbb.2	+						SAMD4A_uc001xbc.2_Intron|SAMD4A_uc001xbg.2_Intron	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						accctgactcaaaaaaaaaaaa	0.193													4	4	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176041	92176041	+	Intron	DEL	C	-	-	rs12882622		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176041delC	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ctcaaaaaaacaaaaaaaaag	0.144													6	3	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123117	100123118	+	Intron	DEL	AG	-	-	rs35577018		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123117_100123118delAG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				gtctgcaaaaagaaaagaaaag	0.000													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106452461	106452462	+	Intron	INS	-	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106452461_106452462insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						acaaacaaaccaaaaaaaaaaa	0.084													4	3	---	---	---	---	
HAUS2	55142	broad.mit.edu	37	15	42856126	42856126	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42856126delT	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	NM_018097	NP_060567	Q9NVX0	HAUS2_HUMAN	centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0						CCAGTTTAGCTTTTTAATAGC	0.224													49	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70601616	70601617	+	IGR	INS	-	GAAG	GAAG	rs11629518	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70601616_70601617insGAAG								TLE3 (211360 upstream) : UACA (345278 downstream)																							GGAgaaggaaagaaggaaggaa	0.248													4	3	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23354834	23354835	+	Intron	INS	-	A	A			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23354834_23354835insA	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	gaaggaaaaggaaggaaggaag	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25276656	25276657	+	IGR	INS	-	T	T	rs146823283	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25276656_25276657insT								ZKSCAN2 (7801 upstream) : HS3ST4 (426690 downstream)																							TTTCTCATTTCTTTTATTTTCT	0.020													2	6	---	---	---	---	
SEZ6L2	26470	broad.mit.edu	37	16	29910431	29910431	+	5'UTR	DEL	G	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29910431delG	uc002duq.3	-	1					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_5'UTR|SEZ6L2_uc002dur.3_5'UTR|SEZ6L2_uc002dus.3_5'UTR|SEZ6L2_uc010vec.1_5'UTR|SEZ6L2_uc010ved.1_5'UTR|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CCCTTTAATTGtttttttttt	0.483													9	4	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919481	57919484	+	Intron	DEL	TCTT	-	-	rs5817124	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919481_57919484delTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tctctctctctctttctttctttc	0.000													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	72038787	72038787	+	IGR	DEL	T	-	-	rs3063174		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72038787delT								PKD1L3 (4910 upstream) : DHODH (3856 downstream)																							AACTCTCCTCTTTTTTTTTTT	0.418													2	4	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83356887	83356888	+	Intron	INS	-	T	T	rs151162771	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83356887_83356888insT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ttctttttttcttttttttttA	0.000													5	3	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7669103	7669104	+	Intron	INS	-	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7669103_7669104insT	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				tttcttttttcttttttttttt	0.243													4	2	---	---	---	---	
PCTP	58488	broad.mit.edu	37	17	53848256	53848257	+	Intron	INS	-	T	T	rs71363819		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53848256_53848257insT	uc002iul.3	+						PCTP_uc002ium.3_Intron|PCTP_uc010dcg.2_Intron|PCTP_uc010dch.2_Intron	NM_021213	NP_067036	Q9UKL6	PPCT_HUMAN	phosphatidylcholine transfer protein isoform 1							cytosol	phosphatidylcholine binding|phosphatidylcholine transmembrane transporter activity			lung(1)	1			BRCA - Breast invasive adenocarcinoma(1;0.00207)			gatttttttgcttttttttttt	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	30362345	30362347	+	IGR	DEL	CTT	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30362345_30362347delCTT								KLHL14 (9371 upstream) : C18orf34 (155019 downstream)																							tctttctttccttctttctttct	0.000													9	5	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2585102	2585125	+	Intron	DEL	GAAGGAAGGAAAGAAGGTAGGAAT	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2585102_2585125delGAAGGAAGGAAAGAAGGTAGGAAT	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aagaaggaaggaaggaaggaaagaaggtaggaatgaaggaagga	0.000													4	3	---	---	---	---	
ZNF626	199777	broad.mit.edu	37	19	20806648	20806649	+	3'UTR	DEL	CA	-	-	rs71893877		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20806648_20806649delCA	uc002npb.1	-	4					ZNF626_uc002npc.1_3'UTR	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TATGCTTTGCCACATTCTTCAC	0.203													6	4	---	---	---	---	
CBLC	23624	broad.mit.edu	37	19	45297243	45297243	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45297243delT	uc002ozs.2	+						CBLC_uc010ejt.2_Intron	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				gataacaagattctcaggtcc	0.224			M		AML								4	2	---	---	---	---	
ZNF814	730051	broad.mit.edu	37	19	58385927	58385927	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385927delG	uc002qqo.2	-	3	1103	c.831delC	c.(829-831)TCCfs	p.S277fs	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	277	C2H2-type 3.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ATTTGCTAAAGGATTTCCCAC	0.363													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	22360910	22360913	+	IGR	DEL	GAAG	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22360910_22360913delGAAG								C21orf131 (185484 upstream) : NCAM2 (9720 downstream)																							agggagggaagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	35712555	35712556	+	IGR	INS	-	AGGAGG	AGGAGG	rs145061950	by1000genomes	TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35712555_35712556insAGGAGG								C21orf82 (150335 upstream) : KCNE2 (23767 downstream)																							GGACGTGGCCCaggaggaggag	0.505													4	2	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43257865	43257882	+	Intron	DEL	TCCTGAGCTCCAGAACAT	-	-	rs71969131		TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43257865_43257882delTCCTGAGCTCCAGAACAT	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCATTAAACTCCTGAGCTCCAGAACATTCCTGAGCTC	0.381													5	3	---	---	---	---	
LZTR1	8216	broad.mit.edu	37	22	21344659	21344659	+	Intron	DEL	T	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21344659delT	uc002zto.2	+						LZTR1_uc002ztn.2_Intron|LZTR1_uc011ahy.1_Intron|LZTR1_uc010gsr.1_Intron	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GGCTGAGCTGTCCTCTCCCCC	0.493													163	78	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1585603	1585604	+	Intron	INS	-	CCTC	CCTC			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585603_1585604insCCTC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCTGCTGTCtcctccctccct	0.356			T	CRLF2	B-ALL|Downs associated ALL								4	4	---	---	---	---	
GAGE2A	729447	broad.mit.edu	37	X	49208295	49208296	+	Intron	INS	-	TAT	TAT			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49208295_49208296insTAT	uc004dnr.3	+						GAGE12J_uc004dnl.3_Intron|GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_In_Frame_Ins_p.9_10insY|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Intron|GAGE2D_uc004dnp.3_Intron|GAGE2C_uc004dno.3_Intron|GAGE8_uc011mnh.1_Intron|GAGE2C_uc004dnu.3_In_Frame_Ins_p.9_10insY|GAGE2D_uc010njc.2_In_Frame_Ins_p.9_10insY|GAGE2D_uc004dnt.3_In_Frame_Ins_p.9_10insY|GAGE8_uc011mni.1_In_Frame_Ins_p.9_10insY	NM_001127212	NP_001120684	Q6NT46	GAG2A_HUMAN	G antigen 2A												0	Ovarian(276;0.236)					GAAGATCGACCTATCGGCCTAG	0.465													7	4	---	---	---	---	
PFKFB1	5207	broad.mit.edu	37	X	54959758	54959759	+	3'UTR	INS	-	AGC	AGC			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54959758_54959759insAGC	uc004dty.1	-	14					PFKFB1_uc010nkd.1_3'UTR|PFKFB1_uc011mol.1_3'UTR	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,						energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						CAAGGCAGAGTAGGAGAAGAGC	0.535													13	6	---	---	---	---	
P2RY4	5030	broad.mit.edu	37	X	69479530	69479530	+	5'UTR	DEL	C	-	-			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69479530delC	uc004dxz.1	-	1						NM_002565	NP_002556	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y4						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1						TCCCTGCCCACCCCCATCCCT	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	74964415	74964416	+	IGR	INS	-	T	T			TCGA-BP-5196-01A-01D-1429-08	TCGA-BP-5196-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74964415_74964416insT								ZDHHC15 (221078 upstream) : MAGEE2 (38407 downstream)																							TTTTTTGCTTCTTTTTTTTGGA	0.351													23	12	---	---	---	---	
