Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WDR8	49856	broad.mit.edu	37	1	3564112	3564112	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3564112G>A	uc001ako.2	-	2	190	c.82C>T	c.(82-84)CAG>TAG	p.Q28*	WDR8_uc001akn.3_Nonsense_Mutation_p.Q28*|WDR8_uc010nzi.1_Nonsense_Mutation_p.Q28*	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8	28						centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		AACCGGTACTGGACACAGGAA	0.537													18	56	---	---	---	---	PASS
DNAJC11	55735	broad.mit.edu	37	1	6704634	6704634	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6704634C>T	uc001aof.2	-	10	1187	c.1081G>A	c.(1081-1083)GTT>ATT	p.V361I	DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Missense_Mutation_p.V361I|DNAJC11_uc010nzu.1_Missense_Mutation_p.V271I	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	361					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TTGAGAGAAACACCCTGTGGA	0.512													16	56	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16975626	16975626	+	Intron	SNP	G	C	C	rs12031642		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975626G>C	uc010och.1	+						MST1P2_uc001azl.3_Intron|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						TCTAGCATCTGTCCCAGGAGT	0.582													8	25	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17084510	17084510	+	Silent	SNP	G	A	A	rs61769731	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17084510G>A	uc010ock.1	-	12	1588	c.1588C>T	c.(1588-1590)CTA>TTA	p.L530L	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Silent_p.L130L	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						ACCCGCTGTAGGCCTGGCTCT	0.577													3	20	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112308358	112308358	+	Splice_Site	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112308358G>A	uc001ebs.2	+	11	1670	c.1313_splice	c.e11-1	p.D438_splice	DDX20_uc010owf.1_Splice_Site_p.D200_splice|DDX20_uc001ebt.2_Splice_Site_p.D46_splice	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20						assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTTTATGTAGATCCCATTCC	0.348													54	173	---	---	---	---	PASS
CELF3	11189	broad.mit.edu	37	1	151688472	151688472	+	Silent	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151688472G>A	uc001eys.1	-	1	819	c.25C>T	c.(25-27)CTG>TTG	p.L9L	CELF3_uc001eyr.2_Silent_p.L9L|CELF3_uc009wmy.2_Silent_p.L9L|CELF3_uc009wmx.1_Silent_p.L9L|CELF3_uc001eyt.2_Intron|CELF3_uc010pdi.1_Silent_p.L9L|C1orf230_uc001eyu.2_Intron	NM_007185	NP_009116	Q5SZQ8	CELF3_HUMAN	trinucleotide repeat containing 4	9	RRM 1.				nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2						CCCACAAACAGCTTGATGGCA	0.597													14	58	---	---	---	---	PASS
C1orf77	26097	broad.mit.edu	37	1	153614785	153614785	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153614785C>T	uc001fcm.1	+	4	595	c.283C>T	c.(283-285)CTG>TTG	p.L95L	C1orf77_uc001fcn.1_Silent_p.L96L|C1orf77_uc001fco.1_Silent_p.L70L|C1orf77_uc001fcp.2_5'Flank|C1orf77_uc009woj.1_Silent_p.L95L	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine	95	Arg/Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATAGGGGCCCTGGCCAGGGG	0.567													3	36	---	---	---	---	PASS
ILDR2	387597	broad.mit.edu	37	1	166944470	166944470	+	Silent	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166944470G>A	uc001gdx.1	-	1	92	c.36C>T	c.(34-36)TTC>TTT	p.F12F		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	12	Extracellular (Potential).					integral to membrane				ovary(1)	1						CTGTTAGCCAGAAGAGAGAAA	0.498													36	107	---	---	---	---	PASS
DPT	1805	broad.mit.edu	37	1	168698362	168698362	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168698362C>T	uc001gfp.2	-	1	67	c.51G>A	c.(49-51)TGG>TGA	p.W17*		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	17					cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					CATACTGGCCCCAGGCCATGG	0.517													9	32	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200587322	200587322	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200587322G>C	uc010ppk.1	-	2	969	c.530C>G	c.(529-531)TCT>TGT	p.S177C	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	177	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						AGGTACAGAAGAGGCAACAAA	0.348													57	174	---	---	---	---	PASS
REN	5972	broad.mit.edu	37	1	204128614	204128614	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204128614T>A	uc001haq.2	-	5	646	c.602A>T	c.(601-603)CAG>CTG	p.Q201L		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	201					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GCCAATGGCCTGTTCAATGAA	0.537													30	94	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215955490	215955490	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215955490C>T	uc001hku.1	-	54	11021	c.10634G>A	c.(10633-10635)CGG>CAG	p.R3545Q		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3545	Extracellular (Potential).|Fibronectin type-III 20.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	p.R3545W(1)		ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGATGTTCCCCGAAAACGTTC	0.383										HNSCC(13;0.011)			36	166	---	---	---	---	PASS
PRKD3	23683	broad.mit.edu	37	2	37501595	37501595	+	Silent	SNP	A	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37501595A>C	uc002rqd.2	-	10	2175	c.1620T>G	c.(1618-1620)GTT>GTG	p.V540V	PRKD3_uc002rqe.1_Silent_p.V140V|PRKD3_uc002rqf.1_Silent_p.V540V	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	540					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				GAGAAGTGCAAACACTTGCTT	0.448													29	200	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107021431	107021431	+	3'UTR	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021431C>T	uc010ywi.1	-	23						NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						CTGGTATCAACACTTCAAGCT	0.378													5	54	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164468066	164468066	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164468066C>T	uc002uck.1	-	3	587	c.276G>A	c.(274-276)TCG>TCA	p.S92S		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	92						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						ATGGTGTGTCCGAATAGTTGC	0.468													36	158	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182542705	182542705	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182542705T>C	uc002uof.2	-	2	1119	c.883A>G	c.(883-885)AAA>GAA	p.K295E	CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1	295					amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GCATAATTTTTCTCAAACTCG	0.557													37	83	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207413075	207413075	+	Silent	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207413075G>T	uc002vbq.2	+	8	1087	c.864G>T	c.(862-864)GTG>GTT	p.V288V	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	288	Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AGAGAGCAGTGAATGTGAGTG	0.418													155	369	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212576841	212576841	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212576841A>T	uc002veg.1	-	9	1156	c.1058T>A	c.(1057-1059)ATT>AAT	p.I353N	ERBB4_uc002veh.1_Missense_Mutation_p.I353N|ERBB4_uc010zji.1_Missense_Mutation_p.I353N|ERBB4_uc010zjj.1_Missense_Mutation_p.I353N|ERBB4_uc010fut.1_Missense_Mutation_p.I353N	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	353	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		GAATTTGTCAATGTTACTGGA	0.373										TSP Lung(8;0.080)			87	208	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220333895	220333895	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220333895T>G	uc010fwg.2	+	13	3509	c.3509T>G	c.(3508-3510)ATG>AGG	p.M1170R		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1170					muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTGGAGAAGATGCCATCCATT	0.672													14	20	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225360600	225360600	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225360600G>T	uc002vny.2	-	13	2175	c.1791C>A	c.(1789-1791)TTC>TTA	p.F597L	CUL3_uc010zls.1_Missense_Mutation_p.F531L|CUL3_uc010fwy.1_Missense_Mutation_p.F603L|CUL3_uc002vnz.1_Missense_Mutation_p.F44L	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	597					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TGGTCATCTGGAAAGTGGAAA	0.343													67	505	---	---	---	---	PASS
USP40	55230	broad.mit.edu	37	2	234468567	234468567	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234468567G>A	uc010zmu.1	-	4	389	c.271C>T	c.(271-273)CGA>TGA	p.R91*	USP40_uc010zmr.1_Nonsense_Mutation_p.R103*			Q9NVE5	UBP40_HUMAN	SubName: Full=cDNA FLJ56772, highly similar to Ubiquitin carboxyl-terminal hydrolase 40 (EC 3.1.2.15);	91					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GGGATGATTCGAACCTGAATG	0.413													68	161	---	---	---	---	PASS
SPCS1	28972	broad.mit.edu	37	3	52741704	52741704	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52741704T>G	uc011bei.1	+	4	591	c.386T>G	c.(385-387)CTG>CGG	p.L129R	GLT8D1_uc003dfj.2_5'Flank|GLT8D1_uc003dfk.2_5'Flank|GLT8D1_uc003dfl.2_5'Flank|GLT8D1_uc003dfm.2_5'Flank|GLT8D1_uc003dfn.2_5'Flank|GLT8D1_uc003dfo.1_5'Flank|GLT8D1_uc010hmm.1_5'Flank	NM_014041	NP_054760	Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog	129	Helical; (Potential).				energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to endoplasmic reticulum membrane|microsome|signal peptidase complex	peptidase activity				0				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		CTGGCCCAGCTGACACTTCCT	0.423													83	107	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98518192	98518192	+	3'UTR	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98518192G>A	uc003dtd.2	-	16					DCBLD2_uc003dte.2_3'UTR	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2						cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						TTAAAACGATGCTTTGTAAAA	0.368													4	72	---	---	---	---	PASS
CCNL1	57018	broad.mit.edu	37	3	156867022	156867022	+	Intron	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156867022A>G	uc003fbf.2	-						CCNL1_uc003fbd.1_Intron|CCNL1_uc003fbe.2_Intron|CCNL1_uc003fbg.2_Intron|CCNL1_uc011bor.1_Intron|CCNL1_uc003fbi.1_3'UTR	NM_020307	NP_064703	Q9UK58	CCNL1_HUMAN	cyclin L1						regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nuclear speck	protein kinase binding			lung(3)|breast(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			AGAAAAAGCAATAACCTTTAA	0.313													61	190	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505801	195505801	+	Missense_Mutation	SNP	G	T	T	rs140673091	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505801G>T	uc011bto.1	-	3	12726	c.12266C>A	c.(12265-12267)GCA>GAA	p.A4089E	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	974	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.592													5	55	---	---	---	---	PASS
RPL9	6133	broad.mit.edu	37	4	39459978	39459978	+	Intron	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39459978A>G	uc003gub.2	-						RPL9_uc003guc.2_Intron|RPL9_uc011byk.1_Intron|RPL9_uc011byl.1_Intron|RPL9_uc003gud.1_Missense_Mutation_p.C28R|LIAS_uc003gue.3_5'Flank|LIAS_uc011bym.1_5'Flank|LIAS_uc003guf.2_5'Flank|LIAS_uc003gug.2_5'Flank|LIAS_uc003guh.2_5'Flank	NM_001024921	NP_001020092	P32969	RL9_HUMAN	ribosomal protein L9						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|nucleolus|ribosome	rRNA binding|structural constituent of ribosome			skin(1)	1						TGGAACGTGCAGTAAAGATGT	0.453													6	144	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55956163	55956163	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55956163C>T	uc003has.2	-	23	3454	c.3152G>A	c.(3151-3153)CGG>CAG	p.R1051Q	KDR_uc003hat.1_Missense_Mutation_p.R1051Q	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1051	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	ATAAATATCCCGGGCCAAGCC	0.408			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			49	140	---	---	---	---	PASS
ADH5	128	broad.mit.edu	37	4	99997942	99997942	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99997942T>A	uc003hui.2	-	5	557	c.477A>T	c.(475-477)AAA>AAT	p.K159N	ADH5_uc003huk.1_Missense_Mutation_p.K159N|ADH5_uc003huj.2_Missense_Mutation_p.K37N	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit	159					ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	AAGGATCTATTTTAGCAACAG	0.423													52	142	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164393649	164393649	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393649T>G	uc003iqp.3	-	1	1399	c.1238A>C	c.(1237-1239)AAT>ACT	p.N413T		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	413						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AAGGTTGATATTGGCTTGAGA	0.493													16	33	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14485224	14485224	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14485224A>T	uc003jff.2	+	47	6710	c.6704A>T	c.(6703-6705)AAA>ATA	p.K2235I	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.K1884I	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	2235	PH 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					GATCCCTGTAAATTTGCTCTG	0.338													71	182	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262062	45262062	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262062G>C	uc003jok.2	-	8	2659	c.2634C>G	c.(2632-2634)GAC>GAG	p.D878E		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	878	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CTGCGTCTGGGTCTGTGTTTA	0.493													12	122	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115327884	115327884	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115327884T>A	uc003kro.2	+	5	1334	c.1170T>A	c.(1168-1170)GAT>GAA	p.D390E	AQPEP_uc003krp.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	390	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						TGATATTTGATGAATCAGGAT	0.373													194	435	---	---	---	---	PASS
ARHGAP26	23092	broad.mit.edu	37	5	142150382	142150382	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142150382G>T	uc011dbj.1	+	1	91	c.56G>T	c.(55-57)CGA>CTA	p.R19L	ARHGAP26_uc003lmt.2_Missense_Mutation_p.R19L|ARHGAP26_uc003lmw.2_Missense_Mutation_p.R19L	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal	19					actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGCACTTCCGAGAGACGCTC	0.443													10	29	---	---	---	---	PASS
MFAP3	4238	broad.mit.edu	37	5	153429206	153429206	+	5'UTR	SNP	T	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153429206T>G	uc003lvf.2	+	2					MFAP3_uc010jib.2_5'UTR|MFAP3_uc011ddb.1_Intron	NM_001135037	NP_001128509	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3 isoform 2							integral to membrane|plasma membrane					0	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		AAGCAATAAATTACCCGCTGT	0.338													38	94	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169145692	169145692	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169145692G>C	uc003maf.2	+	22	2244	c.2164G>C	c.(2164-2166)GAT>CAT	p.D722H	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.D214H	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	722					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACTTACTTGGATACCTCCAG	0.378													82	222	---	---	---	---	PASS
HLA-DPB1	3115	broad.mit.edu	37	6	33096471	33096471	+	Intron	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33096471G>T	uc011dqp.1	+						HLA-DPB2_uc003ocw.1_RNA	NM_002121	NP_002112	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex				ovary(1)	1						TTCATGCTGGGGCTCATCATC	0.537													4	20	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43188337	43188337	+	Silent	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43188337G>A	uc003ouk.2	+	32	6498	c.6423G>A	c.(6421-6423)AAG>AAA	p.K2141K	CUL9_uc003oul.2_Silent_p.K2113K|CUL9_uc010jyk.2_Silent_p.K1293K|CUL9_uc003oun.2_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	2141	IBR-type.				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TCATCTCCAAGGTATCCCCTC	0.627													9	52	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157469827	157469827	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157469827T>A	uc003qqn.2	+	8	2560	c.2408T>A	c.(2407-2409)ATG>AAG	p.M803K	ARID1B_uc003qqo.2_Missense_Mutation_p.M816K|ARID1B_uc003qqp.2_Missense_Mutation_p.M803K|ARID1B_uc003qqq.1_Missense_Mutation_p.M245K|ARID1B_uc010kjl.2_Missense_Mutation_p.M1K	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	861					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GGGCCCGGTATGGGTATCAGT	0.557													15	53	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158924983	158924983	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158924983T>A	uc003qrf.2	+	13	5645	c.4288T>A	c.(4288-4290)TGG>AGG	p.W1430R	TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	1430					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CAGAAAGGGCTGGAAAAGCAA	0.642													5	25	---	---	---	---	PASS
TTYH3	80727	broad.mit.edu	37	7	2698601	2698601	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2698601C>T	uc003smp.2	+	13	1639	c.1452C>T	c.(1450-1452)CCC>CCT	p.P484P	TTYH3_uc010ksn.2_Silent_p.P204P|TTYH3_uc003smq.2_Silent_p.P313P	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN	tweety 3	484	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		TCCAGAACCCCCGCTGTGAGA	0.657													30	64	---	---	---	---	PASS
TPST1	8460	broad.mit.edu	37	7	65705728	65705728	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65705728C>T	uc003tuw.2	+	2	668	c.316C>T	c.(316-318)CGA>TGA	p.R106*	TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Nonsense_Mutation_p.R106*|TPST1_uc010laa.2_Nonsense_Mutation_p.R106*	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	106	Lumenal (Potential).				inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						GGTCATTCCCCGAATCCTGGC	0.537													26	160	---	---	---	---	PASS
OR13C2	392376	broad.mit.edu	37	9	107367525	107367525	+	Silent	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107367525G>A	uc011lvq.1	-	1	384	c.384C>T	c.(382-384)AAC>AAT	p.N128N		NM_001004481	NP_001004481	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATCTCAGAGGGTTGCAGATAG	0.522													46	101	---	---	---	---	PASS
GPR107	57720	broad.mit.edu	37	9	132891134	132891134	+	Intron	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132891134C>A	uc004bze.2	+						GPR107_uc004bzb.2_3'UTR|GPR107_uc004bzc.3_Intron|GPR107_uc011mbx.1_Intron|GPR107_uc004bzd.2_Intron|GPR107_uc004bzg.1_5'Flank	NM_001136557	NP_001130029	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107 isoform 1							integral to membrane				upper_aerodigestive_tract(1)	1		Ovarian(14;0.000531)				CTCAGCATTTCGTGGCTGCAG	0.512													13	67	---	---	---	---	PASS
EGFL7	51162	broad.mit.edu	37	9	139563044	139563044	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139563044C>G	uc004cid.2	+	4	1027	c.116C>G	c.(115-117)CCT>CGT	p.P39R	EGFL7_uc004cif.2_Missense_Mutation_p.P39R|EGFL7_uc004cig.2_RNA|EGFL7_uc010nbp.2_Missense_Mutation_p.P39R|EGFL7_uc004cie.2_Missense_Mutation_p.P39R|EGFL7_uc004cih.2_Missense_Mutation_p.P39R|MIR126_hsa-mir-126|MI0000471_5'Flank	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	39	EMI.				angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CACGGGGACCCTGTCTCCGAG	0.667													6	7	---	---	---	---	PASS
SAR1A	56681	broad.mit.edu	37	10	71912161	71912161	+	3'UTR	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71912161A>G	uc010qjh.1	-	8					SAR1A_uc010qji.1_3'UTR|SAR1A_uc010qjj.1_3'UTR	NM_001142648	NP_001136120	Q9NR31	SAR1A_HUMAN	SAR1a gene homolog 1						ER to Golgi vesicle-mediated transport|intracellular protein transport	Golgi apparatus	GTP binding|GTPase activity				0						TCTATTAGAAAAGTTCATGAG	0.443													13	30	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72518012	72518012	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72518012C>G	uc001jrh.2	+	21	3149	c.3149C>G	c.(3148-3150)CCC>CGC	p.P1050R	ADAMTS14_uc001jrg.2_Missense_Mutation_p.P1053R	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1050					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CAATCTGAACCCCTACATCCC	0.547													7	133	---	---	---	---	PASS
PLAU	5328	broad.mit.edu	37	10	75676303	75676303	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75676303G>C	uc001jwa.2	+	11	1422	c.1276G>C	c.(1276-1278)GAG>CAG	p.E426Q	C10orf55_uc001jvz.1_5'UTR|PLAU_uc010qkw.1_Missense_Mutation_p.E409Q|PLAU_uc010qkx.1_Missense_Mutation_p.E340Q|PLAU_uc001jwb.2_RNA|PLAU_uc001jwc.2_Missense_Mutation_p.E426Q|PLAU_uc009xrq.1_Missense_Mutation_p.E390Q	NM_002658	NP_002649	P00749	UROK_HUMAN	plasminogen activator, urokinase isoform 1	426					blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(2)|kidney(1)	3	Prostate(51;0.0112)				Amiloride(DB00594)|Urokinase(DB00013)	CACCAAGGAAGAGAATGGCCT	0.562													9	26	---	---	---	---	PASS
TNKS2	80351	broad.mit.edu	37	10	93604754	93604754	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93604754T>C	uc001khp.2	+	17	2435	c.2138T>C	c.(2137-2139)CTT>CCT	p.L713P		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	713	ANK 14.				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				AAAGGAGGACTTATTCCTTTA	0.343													72	240	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10820873	10820873	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820873A>G	uc001mjc.2	-	20	2840	c.2423T>C	c.(2422-2424)CTA>CCA	p.L808P	EIF4G2_uc001mjb.2_Missense_Mutation_p.L602P|EIF4G2_uc009ygf.2_Missense_Mutation_p.L602P|EIF4G2_uc001mjd.2_Missense_Mutation_p.L770P	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	808	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AGATAGTAGTAGTTGTTTTTC	0.428													107	223	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033589	30033589	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033589C>A	uc001msk.2	-	2	1789	c.637G>T	c.(637-639)GAC>TAC	p.D213Y		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	213						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CGCAAAGGGTCAAAGTACTGA	0.468													27	93	---	---	---	---	PASS
CST6	1474	broad.mit.edu	37	11	65780703	65780703	+	Intron	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65780703G>A	uc001ogr.2	+						CST6_uc001ogs.1_3'UTR	NM_001323	NP_001314	Q15828	CYTM_HUMAN	cystatin M precursor						anatomical structure morphogenesis	extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1						GCCTGGAGCAGCCTGGCAGGC	0.607													7	13	---	---	---	---	PASS
ZBTB16	7704	broad.mit.edu	37	11	114057770	114057770	+	Intron	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114057770C>T	uc001pop.2	+						ZBTB16_uc001poo.1_Missense_Mutation_p.T488I|ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997	Q05516	ZBT16_HUMAN	promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GGTGAGTTGACTTGGATTCCT	0.498													33	137	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2675675	2675675	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2675675C>G	uc009zdu.1	+	12	1909	c.1596C>G	c.(1594-1596)TTC>TTG	p.F532L	CACNA1C_uc009zdv.1_Missense_Mutation_p.F529L|CACNA1C_uc001qkb.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkc.2_Missense_Mutation_p.F532L|CACNA1C_uc001qke.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkf.2_Missense_Mutation_p.F532L|CACNA1C_uc001qjz.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkd.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkg.2_Missense_Mutation_p.F532L|CACNA1C_uc009zdw.1_Missense_Mutation_p.F532L|CACNA1C_uc001qkh.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkl.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkn.2_Missense_Mutation_p.F532L|CACNA1C_uc001qko.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkp.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkr.2_Missense_Mutation_p.F532L|CACNA1C_uc001qku.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkq.2_Missense_Mutation_p.F532L|CACNA1C_uc001qks.2_Missense_Mutation_p.F532L|CACNA1C_uc001qkt.2_Missense_Mutation_p.F532L|CACNA1C_uc001qka.1_Missense_Mutation_p.F67L|CACNA1C_uc001qki.1_Missense_Mutation_p.F268L|CACNA1C_uc001qkj.1_Missense_Mutation_p.F268L|CACNA1C_uc001qkk.1_Missense_Mutation_p.F268L|CACNA1C_uc001qkm.1_Missense_Mutation_p.F268L|CACNA1C_uc009zdy.1_Missense_Mutation_p.F197L|CACNA1C_uc001qkv.1_Missense_Mutation_p.F102L	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	532	II.|Helical; Name=S1 of repeat II; (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TGGTGATTTTCCTGGTGTTCC	0.587													9	36	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546747	11546747	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546747G>A	uc010shk.1	-	3	300	c.265C>T	c.(265-267)CCT>TCT	p.P89S		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGACCTTGAGGTTTGTTGCCT	0.607													7	97	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15087884	15087884	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15087884T>C	uc001rco.2	-	3	260	c.239A>G	c.(238-240)CAA>CGA	p.Q80R		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	80	Thioredoxin.					endoplasmic reticulum lumen				breast(1)	1						TGGGAATTTTTGCACCATGCT	0.438													33	98	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48388230	48388230	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48388230C>T	uc001rqu.2	-	12	974	c.793G>A	c.(793-795)GAA>AAA	p.E265K	COL2A1_uc001rqv.2_Missense_Mutation_p.E196K	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	265	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding	p.R265W(1)		ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GGACCCCTTTCACCAGCTTTT	0.577													26	108	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49436587	49436587	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49436587G>C	uc001rta.3	-	26	5719	c.5719C>G	c.(5719-5721)CTG>GTG	p.L1907V		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1907					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCACAACCCAGATGCTGTTCT	0.537			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			18	74	---	---	---	---	PASS
C12orf44	60673	broad.mit.edu	37	12	52470991	52470991	+	3'UTR	SNP	G	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52470991G>C	uc001rzu.3	+	4					C12orf44_uc009zmd.2_3'UTR|uc009zme.1_5'Flank	NM_021934	NP_068753	Q9BSB4	ATGA1_HUMAN	Atg13-interacting protein						autophagic vacuole assembly	pre-autophagosomal structure	identical protein binding|protein complex binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0978)		CTGGATCTCTGGGAGCTCCTT	0.567													4	22	---	---	---	---	PASS
PTPRQ	374462	broad.mit.edu	37	12	80982097	80982097	+	Missense_Mutation	SNP	A	G	G	rs61729263	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80982097A>G	uc001sze.2	+	23	4475	c.4475A>G	c.(4474-4476)TAT>TGT	p.Y1492C		NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						CAATACCTCTATGAAGCTCAC	0.358													6	184	---	---	---	---	PASS
DAO	1610	broad.mit.edu	37	12	109290797	109290797	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109290797A>G	uc001tnr.3	+	8	781	c.628A>G	c.(628-630)ATG>GTG	p.M210V	DAO_uc001tnq.3_Missense_Mutation_p.M144V|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_Intron	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	210					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						CGCCCCTTGGATGAAGCACTT	0.542													16	79	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121660766	121660766	+	Silent	SNP	G	A	A	rs140643624		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121660766G>A	uc001tzr.2	+	5	748	c.444G>A	c.(442-444)AGG>AGA	p.R148R	P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Splice_Site_p.R148_splice|P2RX4_uc001tzs.2_Silent_p.R164R|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Silent_p.R47R	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	148	Extracellular (Potential).			R -> W (in Ref. 7; AAB66834).	endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAACAGGCAGGTGCGTAGCTT	0.587													24	51	---	---	---	---	PASS
LTB4R	1241	broad.mit.edu	37	14	24785139	24785139	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24785139C>T	uc001wos.2	+	2	603	c.282C>T	c.(280-282)CAC>CAT	p.H94H	LTB4R_uc010alp.2_Silent_p.H94H|LTB4R_uc001wou.2_Silent_p.H94H	NM_001143919	NP_001137391	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	94	Helical; Name=3; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular component movement|immune response|inflammatory response|muscle contraction	integral to plasma membrane	nucleotide binding				0				GBM - Glioblastoma multiforme(265;0.018)		GCCTGTGTCACTATGTCTGCG	0.607													10	55	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77916095	77916095	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77916095C>T	uc001xtt.1	-	6	682	c.344G>A	c.(343-345)GGT>GAT	p.G115D	VIPAR_uc001xtu.1_Missense_Mutation_p.G115D|VIPAR_uc010tvj.1_Missense_Mutation_p.S66N|VIPAR_uc001xtv.1_Missense_Mutation_p.G115D	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	115					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						TCTAGTTCTACCTAAAGGTAA	0.428													76	122	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39881491	39881491	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39881491C>A	uc001zkh.2	+	12	2041	c.1862C>A	c.(1861-1863)CCC>CAC	p.P621H	THBS1_uc010bbi.2_Missense_Mutation_p.P93H	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	621	EGF-like 2; calcium-binding (Potential).				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	CTGCCCTGCCCCCCACGCTTC	0.577													10	35	---	---	---	---	PASS
TGM7	116179	broad.mit.edu	37	15	43577100	43577100	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43577100C>T	uc001zrf.1	-	7	921	c.916G>A	c.(916-918)GCG>ACG	p.A306T		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	306					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	ACGTTGTGCGCGGAACGGAAA	0.428													38	152	---	---	---	---	PASS
ZNF280D	54816	broad.mit.edu	37	15	56924221	56924221	+	Silent	SNP	A	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56924221A>C	uc002adu.2	-	22	2632	c.2415T>G	c.(2413-2415)GTT>GTG	p.V805V	uc002ads.2_5'Flank|ZNF280D_uc002adv.2_Silent_p.V792V|ZNF280D_uc010bfq.2_Silent_p.V805V|ZNF280D_uc002adt.2_Silent_p.V46V|ZNF280D_uc010bfp.2_RNA	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1	805					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		CCTTATCTGAAACTGTTATGC	0.343													58	244	---	---	---	---	PASS
BCL2A1	597	broad.mit.edu	37	15	80253460	80253460	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80253460T>A	uc002bfc.3	-	2	659	c.477A>T	c.(475-477)GAA>GAT	p.E159D	BCL2A1_uc002bfd.3_3'UTR	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1	159					anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						TTCCTGTAACTTCTAGAAAAG	0.348													81	286	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1616280	1616280	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1616280G>A	uc002cmb.2	-	16	2145	c.1783C>T	c.(1783-1785)CCT>TCT	p.P595S	IFT140_uc002clz.2_Missense_Mutation_p.P246S	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	595										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				TTGGAATCAGGGCTGTTGTCA	0.507													28	185	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14355166	14355166	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14355166C>G	uc010uza.1	+	17	3320	c.3165C>G	c.(3163-3165)AAC>AAG	p.N1055K	MKL2_uc002dcg.2_Missense_Mutation_p.N1005K|MKL2_uc002dcj.2_Missense_Mutation_p.N300K	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein	1044					cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						CAGACTCAAACTTGGACAACA	0.537													11	118	---	---	---	---	PASS
ERI2	112479	broad.mit.edu	37	16	20810063	20810063	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20810063C>T	uc010vbb.1	-	9	1102	c.1059G>A	c.(1057-1059)ATG>ATA	p.M353I	ERI2_uc002dht.3_Missense_Mutation_p.M260I|ERI2_uc002dhs.2_Intron|ERI2_uc010bwh.2_Missense_Mutation_p.M260I|ERI2_uc010vbc.1_Missense_Mutation_p.M125I|ERI2_uc002dhu.1_Intron	NM_001142725	NP_001136197	A8K979	ERI2_HUMAN	exoribonuclease 2 isoform 1	353						intracellular	exonuclease activity|nucleic acid binding|zinc ion binding			large_intestine(1)	1						CTTGCTTTTGCATATAGATAG	0.383													43	269	---	---	---	---	PASS
RRN3P3	100131998	broad.mit.edu	37	16	22444123	22444123	+	RNA	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22444123G>A	uc002dkp.2	-	4		c.1060C>T			RRN3P3_uc010vbu.1_RNA	NR_027460				Homo sapiens cDNA FLJ31180 fis, clone KIDNE2000266.												0						ATCACTATCCGCTCAAAATTC	0.333													4	49	---	---	---	---	PASS
CES2	8824	broad.mit.edu	37	16	66973125	66973125	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66973125T>C	uc002eqr.2	+	3	1479	c.479T>C	c.(478-480)CTA>CCA	p.L160P	CES2_uc002eqq.2_Missense_Mutation_p.L160P|CES2_uc002eqs.2_Missense_Mutation_p.L3P	NM_003869	NP_003860	O00748	EST2_HUMAN	carboxylesterase 2 isoform 1	96					catabolic process	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)		ACCAGGTGTCTACAGGACCTC	0.562													23	86	---	---	---	---	PASS
CDH3	1001	broad.mit.edu	37	16	68721619	68721619	+	Missense_Mutation	SNP	C	T	T	rs145851551		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68721619C>T	uc002ewf.2	+	12	2907	c.1775C>T	c.(1774-1776)ACG>ATG	p.T592M	CDH3_uc010vli.1_Missense_Mutation_p.T537M	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein	592	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		ATCTACTGGACGGCAGAGGTC	0.617													6	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													7	25	---	---	---	---	PASS
METT10D	79066	broad.mit.edu	37	17	2323880	2323880	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2323880T>G	uc002fut.2	-	10	1221	c.1073A>C	c.(1072-1074)AAA>ACA	p.K358T	METT10D_uc002fuu.3_RNA|METT10D_uc010cka.2_RNA|METT10D_uc002fuv.2_Intron|METT10D_uc010vqx.1_RNA|METT10D_uc010vqy.1_Missense_Mutation_p.K140T	NM_024086	NP_076991	Q86W50	MET16_HUMAN	methyltransferase 10 domain containing	358							methyltransferase activity				0						GGGAACTCGTTTATGCTGGAC	0.378													8	43	---	---	---	---	PASS
NUFIP2	57532	broad.mit.edu	37	17	27613674	27613674	+	Silent	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27613674G>T	uc002hdy.3	-	2	1427	c.1338C>A	c.(1336-1338)ATC>ATA	p.I446I	NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	446						nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TCCCAGAAGAGATGGGTGTTA	0.423													40	152	---	---	---	---	PASS
ARHGAP23	57636	broad.mit.edu	37	17	36654047	36654047	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36654047C>T	uc010wdp.1	+	21	3677	c.3015C>T	c.(3013-3015)GAC>GAT	p.D1005D	ARHGAP23_uc002hqc.2_Silent_p.D893D	NM_020876	NP_065927	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1099					signal transduction	intracellular	GTPase activator activity			lung(1)	1						TCTTCAGTGACGAAGAGGACA	0.587													6	93	---	---	---	---	PASS
DLX3	1747	broad.mit.edu	37	17	48069215	48069215	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48069215A>T	uc002ipy.2	-	3	756	c.530T>A	c.(529-531)TTC>TAC	p.F177Y		NM_005220	NP_005211	O60479	DLX3_HUMAN	distal-less homeobox 3	177	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCGGTTCTGGAACCAGATTTT	0.502													57	108	---	---	---	---	PASS
CD300LB	124599	broad.mit.edu	37	17	72522164	72522164	+	Silent	SNP	G	T	T	rs111972938		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72522164G>T	uc002jkx.2	-	2	217	c.204C>A	c.(202-204)TCC>TCA	p.S68S	CD300LB_uc010wqz.1_Silent_p.S68S	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	31	Ig-like V-type.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)	1						GAACCGTCAGGGACCCCTGCT	0.542													18	94	---	---	---	---	PASS
KCTD2	23510	broad.mit.edu	37	17	73058235	73058235	+	Silent	SNP	C	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73058235C>G	uc002jmp.2	+	5	724	c.657C>G	c.(655-657)TCC>TCG	p.S219S	KCTD2_uc010dfz.2_RNA|KCTD2_uc002jmq.2_RNA	NM_015353	NP_056168	Q14681	KCTD2_HUMAN	potassium channel tetramerisation domain	219						voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)					TCGGATCTTCCTATAACTACG	0.428													80	154	---	---	---	---	PASS
RHBDF2	79651	broad.mit.edu	37	17	74468019	74468019	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74468019A>T	uc002jrq.1	-	19	2560	c.2267T>A	c.(2266-2268)GTG>GAG	p.V756E	RHBDF2_uc002jrp.1_Missense_Mutation_p.V727E|RHBDF2_uc002jrr.1_3'UTR	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	756	Helical; (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						CAGGAAGAGCACGATGGCCGA	0.632													9	59	---	---	---	---	PASS
SFRS2	6427	broad.mit.edu	37	17	74732524	74732524	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732524G>A	uc002jsv.2	-	2	555	c.385C>T	c.(385-387)CGA>TGA	p.R129*	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Nonsense_Mutation_p.R129*|SFRS2_uc010wtg.1_Nonsense_Mutation_p.R117*|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	129	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						CTCCGGGATCGGCTGCGGCGA	0.547													3	15	---	---	---	---	PASS
HGS	9146	broad.mit.edu	37	17	79652641	79652641	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79652641C>T	uc002kbg.2	+	2	121	c.44C>T	c.(43-45)GCG>GTG	p.A15V	ARL16_uc002kbe.2_5'Flank|ARL16_uc002kbf.2_5'Flank|HGS_uc010wus.1_Missense_Mutation_p.A15V	NM_004712	NP_004703	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine	15	VHS.				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TCAGACAAGGCGACCAGCCAG	0.602													40	48	---	---	---	---	PASS
THOC4	10189	broad.mit.edu	37	17	79846407	79846407	+	Missense_Mutation	SNP	C	A	A	rs150564817		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79846407C>A	uc002kbu.2	-	4	597	c.591G>T	c.(589-591)AGG>AGT	p.R197S		NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4	190	Ala/Arg/Gly-rich.				intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TCTGTGCAGGCCTCCGCTGTG	0.587													9	50	---	---	---	---	PASS
PLEKHJ1	55111	broad.mit.edu	37	19	2234235	2234235	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2234235G>T	uc002lvf.1	-	4	315	c.234C>A	c.(232-234)TTC>TTA	p.F78L	MIR1227_hsa-mir-1227|MI0006316_5'Flank|SF3A2_uc002lvg.2_5'Flank	NM_018049	NP_060519	Q9NW61	PKHJ1_HUMAN	pleckstrin homology domain containing, family J	78	PH.						protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCCTCAATGAAGCCTGGGG	0.562													12	32	---	---	---	---	PASS
SLC25A23	79085	broad.mit.edu	37	19	6444201	6444201	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6444201A>T	uc002mex.1	-	9	1325	c.1183T>A	c.(1183-1185)TAC>AAC	p.Y395N	SLC25A23_uc010duu.1_RNA|SLC25A23_uc002meu.2_RNA|SLC25A23_uc002mev.2_RNA|SLC25A23_uc002mew.1_RNA|SLC25A23_uc010xjd.1_Missense_Mutation_p.Y156N	NM_024103	NP_077008	Q9BV35	SCMC3_HUMAN	solute carrier family 25, member 23	395	Helical; Name=5; (Potential).|Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2						GCCAGCGGGTAACTGGCTATC	0.667													8	7	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7805951	7805951	+	3'UTR	SNP	A	T	T	rs11465413	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7805951A>T	uc002mht.2	-	7					CD209_uc010xju.1_3'UTR|CD209_uc010dvp.2_3'UTR|CD209_uc002mhr.2_3'UTR|CD209_uc002mhs.2_3'UTR|CD209_uc002mhu.2_3'UTR|CD209_uc010dvq.2_3'UTR|CD209_uc002mhq.2_3'UTR|CD209_uc002mhv.2_3'UTR|CD209_uc002mhx.2_3'UTR|CD209_uc002mhw.2_3'UTR|CD209_uc010dvr.2_3'UTR	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1						cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						GTGTTTGGAAAGGAGCAGTGC	0.448													6	170	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8595162	8595162	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8595162C>T	uc002mkg.2	-	21	2360	c.2246G>A	c.(2245-2247)CGG>CAG	p.R749Q		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	749						unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						CAGCTCGGGCCGCTCCTCCAG	0.622													6	36	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10568555	10568555	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10568555A>G	uc002moj.2	+	8	986	c.878A>G	c.(877-879)GAC>GGC	p.D293G	PDE4A_uc002mok.2_Missense_Mutation_p.D267G|PDE4A_uc002mol.2_Missense_Mutation_p.D232G|PDE4A_uc002mom.2_Missense_Mutation_p.D54G|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_5'Flank	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	293					signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	TCTTCTGCAGACAAACAGAAT	0.582													5	73	---	---	---	---	PASS
JUNB	3726	broad.mit.edu	37	19	12903494	12903494	+	Silent	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12903494C>T	uc002mvc.2	+	1	1185	c.909C>T	c.(907-909)CTC>CTT	p.L303L	JUNB_uc002mvb.2_RNA	NM_002229	NP_002220	P17275	JUNB_HUMAN	jun B proto-oncogene	303	Leucine-zipper.					chromatin|nucleus	protein dimerization activity|transcription coactivator activity|transcription corepressor activity			lung(2)|central_nervous_system(1)	3						TGAAGACGCTCAAGGCCGAGA	0.672													6	6	---	---	---	---	PASS
CAPNS1	826	broad.mit.edu	37	19	36640752	36640752	+	3'UTR	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36640752C>T	uc002odj.2	+	11					CAPNS1_uc002odi.1_3'UTR|CAPNS1_uc002odk.2_3'UTR|CAPNS1_uc002odl.2_3'UTR	NM_001749	NP_001740	P04632	CPNS1_HUMAN	calpain, small subunit 1						positive regulation of cell proliferation	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ACTGGAGCCCCAGACCCGCCC	0.617													31	80	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39034251	39034251	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39034251C>A	uc002oit.2	+	86	11988	c.11858C>A	c.(11857-11859)GCC>GAC	p.A3953D	RYR1_uc002oiu.2_Missense_Mutation_p.A3948D|RYR1_uc002oiv.1_Missense_Mutation_p.A862D	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3953					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TTCTCCAAAGCCATGTCGGTG	0.602													20	125	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57325755	57325755	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57325755T>C	uc002qnu.2	-	7	4406	c.4055A>G	c.(4054-4056)GAG>GGG	p.E1352G	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.E1323G|PEG3_uc002qnv.2_Missense_Mutation_p.E1352G|PEG3_uc002qnw.2_Missense_Mutation_p.E1228G|PEG3_uc002qnx.2_Missense_Mutation_p.E1226G|PEG3_uc010etr.2_Missense_Mutation_p.E1352G	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1352	Glu-rich.|C2H2-type 10.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGATGAAGCTCCTTATGTTT	0.358													17	71	---	---	---	---	PASS
SAMHD1	25939	broad.mit.edu	37	20	35547877	35547877	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35547877T>C	uc002xgh.1	-	7	872	c.742A>G	c.(742-744)AAT>GAT	p.N248D		NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	248	HD.				defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				TTAATTCCATTAGAATTAATA	0.383													69	281	---	---	---	---	PASS
WFDC8	90199	broad.mit.edu	37	20	44207862	44207862	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44207862C>A	uc002xow.2	-	1	104	c.25G>T	c.(25-27)GGG>TGG	p.G9W	WFDC8_uc002xox.2_Missense_Mutation_p.G9W	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	9						extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				CCTCCTCACCCTCCTTCAGTT	0.577													15	325	---	---	---	---	PASS
NEURL2	140825	broad.mit.edu	37	20	44517360	44517360	+	3'UTR	SNP	T	C	C	rs1516580	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44517360T>C	uc002xqg.1	-	2					C20orf165_uc002xqf.2_5'Flank|CTSA_uc002xqh.2_5'Flank|CTSA_uc002xqj.3_5'Flank|CTSA_uc002xqi.2_5'Flank|CTSA_uc010zxi.1_5'Flank|CTSA_uc002xqk.3_5'Flank	NM_080749	NP_542787	Q9BR09	NEUL2_HUMAN	neuralized-like protein 2						intracellular signal transduction						0		Myeloproliferative disorder(115;0.0122)				GGTCTGGGGCTCCAGGATGCA	0.552													5	72	---	---	---	---	PASS
ZNF334	55713	broad.mit.edu	37	20	45140775	45140775	+	5'UTR	SNP	C	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45140775C>T	uc002xsc.2	-	2					ZNF334_uc002xsd.2_5'UTR|ZNF334_uc010ghl.2_5'UTR	NM_018102	NP_060572	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				GTGTTGAAAGCAGAGCTGGGT	0.398													58	253	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29121349	29121349	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29121349A>C	uc003adu.1	-	3	398	c.326T>G	c.(325-327)GTG>GGG	p.V109G	CHEK2_uc003ads.1_5'UTR|CHEK2_uc010gvh.1_Intron|CHEK2_uc010gvi.1_Missense_Mutation_p.V109G|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.V152G|CHEK2_uc003adv.1_Missense_Mutation_p.V109G|CHEK2_uc003adw.1_Missense_Mutation_p.V109G|CHEK2_uc003adx.1_5'UTR|CHEK2_uc003ady.1_Missense_Mutation_p.V109G|CHEK2_uc003adz.1_5'UTR	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	109					cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						GTTGTCATTCACACATTCTGT	0.353			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				68	188	---	---	---	---	PASS
RPS19BP1	91582	broad.mit.edu	37	22	39928457	39928457	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39928457T>C	uc003ayb.2	-	2	251	c.124A>G	c.(124-126)ATT>GTT	p.I42V		NM_194326	NP_919307	Q86WX3	AROS_HUMAN	S19 binding protein	42						nucleolus|nucleoplasm					0	Melanoma(58;0.04)					TGGGCCTGAATTGCCTTCGTC	0.642													10	45	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76875909	76875909	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76875909C>A	uc004ecp.3	-	20	5458	c.5226G>T	c.(5224-5226)AGG>AGT	p.R1742S	ATRX_uc004ecq.3_Missense_Mutation_p.R1704S|ATRX_uc004eco.3_Missense_Mutation_p.R1527S	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1742	Helicase ATP-binding.		R -> K (in ATRX; atypical; patients presents spastic paraplegia at birth).		DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	AAATAATCCTCCTCCTTGATC	0.328			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						73	107	---	---	---	---	PASS
CXorf1	9142	broad.mit.edu	37	X	144909435	144909435	+	Silent	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144909435G>A	uc004fch.2	+	1	508	c.240G>A	c.(238-240)ACG>ACA	p.T80T		NM_004709	NP_004700	O96002	CX001_HUMAN	hypothetical protein LOC9142	80											0	Acute lymphoblastic leukemia(192;6.56e-05)					GCTTTAAGACGTATGAGCATC	0.398													10	132	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3591	3591	+	RNA	SNP	G	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3591G>A	uc004cos.3	+	2		c.1884G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		CCCAACCCCCTGGTCAACCTC	0.532													52	8	---	---	---	---	PASS
KIAA1751	85452	broad.mit.edu	37	1	1893558	1893559	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1893558_1893559insC	uc001aim.1	-						KIAA1751_uc009vkz.1_Intron	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452											pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CTACAAACCTGTCCACAAAGAG	0.297													3	3	---	---	---	---	
SPSB1	80176	broad.mit.edu	37	1	9392763	9392763	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9392763delC	uc010oae.1	+							NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GATACTGTCACAAAACTAGGA	0.473													4	2	---	---	---	---	
UBE4B	10277	broad.mit.edu	37	1	10132494	10132494	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10132494delT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		AACTTCCATCTTTTTTTTTTT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12986614	12986614	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12986614delT								PRAMEF8 (6048 upstream) : PRAMEF5 (11688 downstream)																							CAGCACAGCCTTTTTTTGTTA	0.448													6	3	---	---	---	---	
DNAJC16	23341	broad.mit.edu	37	1	15874484	15874484	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15874484delA	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CGGTACAGGTAATCCCCAAAC	0.423													4	2	---	---	---	---	
DDI2	84301	broad.mit.edu	37	1	15962632	15962632	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15962632delT	uc001awx.1	+						DDI2_uc009voj.1_Intron	NM_032341	NP_115717	Q5TDH0	DDI2_HUMAN	DNA-damage inducible protein 2						proteolysis		aspartic-type endopeptidase activity				0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GTCAGCAGAGttttttttgtt	0.174													3	4	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18434888	18434889	+	Intron	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18434888_18434889delGT	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		TTGTGCCAGGgtgtgtgtgtgt	0.460													4	2	---	---	---	---	
IFFO2	126917	broad.mit.edu	37	1	19249825	19249826	+	Intron	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19249825_19249826delGG	uc001bbd.2	-							NM_001136265	NP_001129737	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2												0						catctcatgaggaaggcgaggc	0.257													4	2	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21328170	21328170	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21328170delC	uc001bec.2	-						EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		aatggttcctccaCCCACTGG	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25388660	25388661	+	IGR	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25388660_25388661delGT								RUNX3 (97048 upstream) : SYF2 (160106 downstream)																							GAGAGGACACgtgtgtgtgtgt	0.446													4	2	---	---	---	---	
UBXN11	91544	broad.mit.edu	37	1	26608890	26608891	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26608890_26608891delCC	uc001blw.2	-	16	1735_1736	c.1462_1463delGG	c.(1462-1464)GGTfs	p.G488fs	UBXN11_uc001blz.1_Frame_Shift_Del_p.G455fs|UBXN11_uc001blv.2_Frame_Shift_Del_p.G450fs|UBXN11_uc001bly.2_Frame_Shift_Del_p.G368fs|UBXN11_uc001blx.2_Frame_Shift_Del_p.G246fs|UBXN11_uc001bma.2_Frame_Shift_Del_p.G455fs|UBXN11_uc001bmb.1_Frame_Shift_Del_p.G488fs	NM_183008	NP_892120	Q5T124	UBX11_HUMAN	socius isoform 2	488	Pro-rich.|3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|1.		Missing.|Missing.			cytoplasm|cytoskeleton				ovary(1)	1						gggaccgggaccgggacaggga	0.267													7	4	---	---	---	---	
UBXN11	91544	broad.mit.edu	37	1	26608893	26608896	+	Frame_Shift_Del	DEL	GGAC	-	-	rs72872911	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26608893_26608896delGGAC	uc001blw.2	-	16	1730_1733	c.1457_1460delGTCC	c.(1456-1461)TGTCCCfs	p.C486fs	UBXN11_uc001blz.1_Frame_Shift_Del_p.C453fs|UBXN11_uc001blv.2_Frame_Shift_Del_p.C448fs|UBXN11_uc001bly.2_Frame_Shift_Del_p.C366fs|UBXN11_uc001blx.2_Frame_Shift_Del_p.C244fs|UBXN11_uc001bma.2_Frame_Shift_Del_p.C453fs|UBXN11_uc001bmb.1_Frame_Shift_Del_p.C486fs	NM_183008	NP_892120	Q5T124	UBX11_HUMAN	socius isoform 2	486_487	Pro-rich.|3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|1.		Missing.			cytoplasm|cytoskeleton				ovary(1)	1						accgggaccgggacagggaccagg	0.275													8	4	---	---	---	---	
SLC9A1	6548	broad.mit.edu	37	1	27433954	27433957	+	Intron	DEL	ACAC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27433954_27433957delACAC	uc001bnm.2	-						SLC9A1_uc010ofk.1_Intron|SLC9A1_uc001bnn.2_Intron	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1						regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	caatacgcatacacacacacacca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30210989	30210991	+	IGR	DEL	ACA	-	-	rs144686685		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30210989_30210991delACA								PTPRU (557674 upstream) : MATN1 (973135 downstream)																							aacaacaacgacaacaacaaaaa	0.360													1	6	---	---	---	---	
MATN1	4146	broad.mit.edu	37	1	31186225	31186226	+	3'UTR	DEL	CA	-	-	rs71794590		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31186225_31186226delCA	uc001brz.2	-	8						NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein precursor						protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GGCGCACGTGcacacacacaca	0.376													4	3	---	---	---	---	
HDAC1	3065	broad.mit.edu	37	1	32768067	32768067	+	Intron	DEL	C	-	-	rs74064094		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32768067delC	uc001bvb.1	+						HDAC1_uc010ohd.1_Intron|HDAC1_uc010ohe.1_Intron|HDAC1_uc010ohf.1_Intron	NM_004964	NP_004955	Q13547	HDAC1_HUMAN	histone deacetylase 1						anti-apoptosis|blood coagulation|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|histone H3 deacetylation|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of androgen receptor signaling pathway|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytosol|NuRD complex|Sin3 complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|identical protein binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|RNA polymerase II transcription corepressor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)	3		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	TTTTTTTTTTCTTTTGGAGTT	0.423													8	5	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34463888	34463888	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34463888delA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ccccaccagcaaaaaagccct	0.000													4	2	---	---	---	---	
PSMB2	5690	broad.mit.edu	37	1	36076589	36076590	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36076589_36076590insT	uc001bzf.1	-						PSMB2_uc001bzd.1_Intron|PSMB2_uc010ohz.1_Intron|PSMB2_uc001bzg.1_Intron	NM_002794	NP_002785	P49721	PSB2_HUMAN	proteasome beta 2 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)	CAAATGGATGATTTTTTTTTTC	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36953959	36953959	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36953959delA								CSF3R (5450 upstream) : GRIK3 (307169 downstream)																							ACTGGTCCTGAACACCTCCCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37507632	37507633	+	IGR	DEL	CA	-	-	rs5773570		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37507632_37507633delCA								GRIK3 (7788 upstream) : ZC3H12A (432486 downstream)																							TGCATGcacgcacacacacaca	0.450													4	2	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42439342	42439343	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42439342_42439343delCA	uc001chb.1	-									Q5T1R4	ZEP3_HUMAN	Homo sapiens kappa B and V(D)J recombination signal sequences binding protein (KRC) mRNA, complete cds.						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				gaaagcagttcactaggttcag	0.163													4	2	---	---	---	---	
EBNA1BP2	10969	broad.mit.edu	37	1	43632276	43632276	+	Intron	DEL	A	-	-	rs76862196		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43632276delA	uc001cin.2	-						EBNA1BP2_uc001cio.2_Intron|EBNA1BP2_uc001cim.2_Intron|EBNA1BP2_uc010ojx.1_Intron	NM_006824	NP_006815	Q99848	EBP2_HUMAN	EBNA1 binding protein 2 isoform 2						ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				gagactgtccaaaaaaaaaag	0.214													5	3	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	45114687	45114688	+	Intron	INS	-	G	G	rs140860973	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45114687_45114688insG	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010oky.1_Intron|RNF220_uc010okz.1_Intron|RNF220_uc001clx.1_Intron|RNF220_uc001cly.1_Intron|RNF220_uc001clz.1_Intron|RNF220_uc001cma.1_Intron|TMEM53_uc001cmb.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GAGTCAGGCGAGGGGGTGCAGA	0.554													2	6	---	---	---	---	
NSUN4	387338	broad.mit.edu	37	1	46811258	46811258	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46811258delC	uc001cpr.1	+						NSUN4_uc010omc.1_Intron|NSUN4_uc009vyf.1_Intron|NSUN4_uc009vyg.1_Intron|NSUN4_uc001cpt.1_Intron|NSUN4_uc001cps.1_Intron	NM_199044	NP_950245	Q96CB9	NSUN4_HUMAN	NOL1/NOP2/Sun domain family 4 protein								methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)					ctcacagccacccatcaaagt	0.214													4	2	---	---	---	---	
KIAA0494	9813	broad.mit.edu	37	1	47175041	47175043	+	Intron	DEL	TCT	-	-	rs149850053	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47175041_47175043delTCT	uc001cqk.3	-						KIAA0494_uc010omh.1_Intron|KIAA0494_uc010omj.1_5'Flank|KIAA0494_uc001cql.1_Intron	NM_014774	NP_055589	O75071	K0494_HUMAN	hypothetical protein LOC9813								calcium ion binding				0	Acute lymphoblastic leukemia(166;0.155)					ttggcttgtctcttctttatttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48950265	48950265	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48950265delC								SPATA6 (12420 upstream) : AGBL4 (48262 downstream)																							TGAGGTCTCGCCTGATTTGGA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	50507802	50507802	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50507802delA								AGBL4 (18176 upstream) : ELAVL4 (5884 downstream)																							GCCTATGTGGAAAAAAAAAAA	0.393													4	2	---	---	---	---	
ZYG11A	440590	broad.mit.edu	37	1	53358201	53358201	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53358201delA	uc001cuk.2	+						ZYG11A_uc001cul.2_Intron	NM_001004339	NP_001004339	Q6WRX3	ZY11A_HUMAN	zyg-11 homolog A								binding				0						actctgtctcaaaaaaaaaaa	0.154													5	3	---	---	---	---	
PCSK9	255738	broad.mit.edu	37	1	55524340	55524353	+	Intron	DEL	GTGTGTGTGTGTGT	-	-	rs5774209		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55524340_55524353delGTGTGTGTGTGTGT	uc001cyf.1	+						PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9						cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CCCCTCCTTCgtgtgtgtgtgtgtgtgtgtgtgt	0.505													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58685471	58685472	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58685471_58685472delCA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						TTGCACACATCACAATTGTAAT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64130191	64130192	+	IGR	INS	-	C	C	rs60777653		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64130191_64130192insC								PGM1 (4277 upstream) : ROR1 (109498 downstream)																							TTTTTTTTTTTTCTGTTCAACC	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	67744528	67744528	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67744528delT								IL23R (18880 upstream) : IL12RB2 (28519 downstream)																							TAACAGAAACTTTTTTTTTGT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68441917	68441917	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68441917delT	uc001deb.1	+						uc001dec.1_Intron					Homo sapiens cDNA FLJ38762 fis, clone KIDNE2013801.																		gtatgaaacctgcatgatttg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	75395974	75395974	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75395974delT								TYW3 (163616 upstream) : LHX8 (198145 downstream)																							actTCTTCCCTTTTGCCCCTT	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81342217	81342218	+	IGR	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81342217_81342218delTT								None (None upstream) : LPHN2 (429627 downstream)																							TCTTCTTGGCTTTTAAAGCATA	0.327													4	2	---	---	---	---	
HS2ST1	9653	broad.mit.edu	37	1	87502816	87502817	+	Intron	INS	-	T	T	rs142346544	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87502816_87502817insT	uc010osk.1	+						HS2ST1_uc001dmc.3_Intron|LOC339524_uc001dme.1_Intron	NM_012262	NP_036394	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1 isoform							Golgi membrane|integral to membrane				central_nervous_system(1)	1		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		CCAACTTTTGCTTTATCGTCAT	0.302													2	4	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94560128	94560128	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94560128delT	uc001dqh.2	-						ABCA4_uc010otn.1_Intron	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAACAAGCATTTAGGAGGGG	0.507													4	2	---	---	---	---	
CCDC76	54482	broad.mit.edu	37	1	100614877	100614877	+	3'UTR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100614877delC	uc001dsv.2	+	11					CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_3'UTR|LRRC39_uc001dsw.1_Intron|LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76						tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		GCAGACAATTCAGAGATATTC	0.333													6	3	---	---	---	---	
CCDC76	54482	broad.mit.edu	37	1	100614883	100614883	+	3'UTR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100614883delT	uc001dsv.2	+	11					CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_3'UTR|LRRC39_uc001dsw.1_Intron|LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76						tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		AATTCAGAGATATTCACAATT	0.328													6	3	---	---	---	---	
COL11A1	1301	broad.mit.edu	37	1	103464051	103464052	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103464051_103464052insT	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		atttaaataacttttaaatata	0.248													4	2	---	---	---	---	
SLC25A24	29957	broad.mit.edu	37	1	108686523	108686523	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108686523delT	uc001dvn.3	-						SLC25A24_uc001dvm.2_Intron	NM_013386	NP_037518	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 member 24 isoform 1						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		GAGAGACCCGTTTACTGCAAG	0.338													4	2	---	---	---	---	
GSTM2	2946	broad.mit.edu	37	1	110222100	110222100	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110222100delA	uc010ovt.1	+						GSTM2_uc009wfk.2_Intron	NM_001142368	NP_001135840	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 2						glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	attccatctcaaaaaaagaaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	114588427	114588427	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114588427delG								OLFML3 (63551 upstream) : SYT6 (43488 downstream)																							AAGTCTGAGAGCAAAGTGATG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144011450	144011450	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144011450delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		TTGTCCTCTCTTTTTTTGGCA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153773461	153773461	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153773461delT								SLC27A3 (20829 upstream) : GATAD2B (3743 downstream)																							CTCTAGGCCCTTTCCTCATCC	0.552													4	2	---	---	---	---	
TPM3	7170	broad.mit.edu	37	1	154164725	154164725	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154164725delA	uc001fec.1	-							NM_152263	NP_689476	P06753	TPM3_HUMAN	tropomyosin 3 isoform 1						cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					CATCACCAGCAAAAAAAATAT	0.483			T	NTRK1|ALK	papillary thyroid|ALCL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154171647	154171647	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154171647delT								MIR190B (5428 upstream) : C1orf189 (201 downstream)																							CCCTGCCCCCTTACATCAACA	0.428													4	2	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774046	157774047	+	Intron	INS	-	A	A	rs12133090		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774046_157774047insA	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACCCCCCCCCCAGTGGCCCATG	0.520													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	158845079	158845079	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158845079delT								MNDA (25809 upstream) : PYHIN1 (56263 downstream)																							cttgatgagcttccttacctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161451496	161451497	+	IGR	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161451496_161451497delAC								C1orf192 (113832 upstream) : FCGR2A (23708 downstream)																							tcacacacagacacacacacaa	0.297													4	2	---	---	---	---	
LRRC52	440699	broad.mit.edu	37	1	165530371	165530371	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165530371delA	uc001gde.2	+						LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor							integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CCCTCCCAACAAAGCCACCCA	0.517													4	2	---	---	---	---	
BLZF1	8548	broad.mit.edu	37	1	169353416	169353416	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169353416delA	uc001gfx.1	+						BLZF1_uc001gfy.2_Intron|BLZF1_uc009wvp.1_Intron	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1						cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding			skin(1)	1	all_hematologic(923;0.208)					agatttcgataaaaaacacat	0.204													4	2	---	---	---	---	
TNFSF18	8995	broad.mit.edu	37	1	173020270	173020270	+	5'Flank	DEL	A	-	-	rs72718913	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173020270delA	uc001giu.2	-							NM_005092	NP_005083	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily,						anti-apoptosis|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						CTCAGAACATAAAAAAAAAAG	0.388													3	3	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175462405	175462405	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175462405delC	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TAAGCTATAGCCCCAGAAAAG	0.408													4	2	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176645592	176645593	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176645592_176645593insA	uc001gkz.2	+						PAPPA2_uc001gky.1_Intron|PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						tatgctaagtgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CEP350	9857	broad.mit.edu	37	1	179938517	179938517	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179938517delG	uc001gnt.2	+						CEP350_uc001gnr.1_Intron	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4						ACTGGTCTGAGGGCGTGCGGG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181079065	181079065	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181079065delC								IER5 (19088 upstream) : CACNA1E (373651 downstream)																							TCTGGAGCTGCCCCCGGGTCC	0.547													4	2	---	---	---	---	
NMNAT2	23057	broad.mit.edu	37	1	183274704	183274704	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183274704delG	uc001gqc.1	-						NMNAT2_uc001gqb.1_5'Flank	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						TGTTTTTCCTGGGTAAAACAG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187867211	187867211	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187867211delG								PLA2G4A (909106 upstream) : None (None downstream)																							ACATGAAAATGGGGCATCAGA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195201947	195201947	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195201947delT								None (None upstream) : KCNT2 (992966 downstream)																							cattgtctgatttgttgtata	0.000													4	2	---	---	---	---	
CHIT1	1118	broad.mit.edu	37	1	203194457	203194457	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203194457delT	uc001gzn.2	-						FMOD_uc010pqi.1_Intron|CHIT1_uc001gzm.1_Intron|CHIT1_uc009xal.1_5'Flank|CHIT1_uc009xam.1_Intron|CHIT1_uc009xan.1_Intron|CHIT1_uc001gzo.2_Intron	NM_003465	NP_003456	Q13231	CHIT1_HUMAN	chitotriosidase precursor						chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity				0						GAAGCAAGGATTGGGGCAGAT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209096329	209096330	+	IGR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209096329_209096330delAG								PLXNA2 (678664 upstream) : LOC642587 (505838 downstream)																							tgttggccctagagaatcatga	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209446544	209446545	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209446544_209446545delAA								None (None upstream) : LOC642587 (155623 downstream)																							TTagacttctaagacagaaacc	0.020													4	2	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220323058	220323058	+	3'UTR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220323058delC	uc010puk.1	-	35					RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_3'UTR	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GACTCACAGGCCCCCATCCCA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226611024	226611025	+	IGR	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226611024_226611025delGG								PARP1 (15223 upstream) : C1orf95 (125476 downstream)																							ggcccacagaggaagctccata	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	233031271	233031271	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233031271delC								KIAA1383 (85179 upstream) : C1orf57 (55099 downstream)																							CAGAAAGGCACCCCACTGATA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1613014	1613014	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1613014delA								TPO (66516 upstream) : PXDN (22646 downstream)																							tagagtgtggaaaacctgcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7485413	7485413	+	IGR	DEL	T	-	-	rs113006533		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7485413delT								RNF144A (301106 upstream) : LOC339788 (577145 downstream)																							GACAATCACATTTTTTTTTtc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7950024	7950024	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7950024delT								RNF144A (765717 upstream) : LOC339788 (112534 downstream)																							cctctagtaattttattgtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8773342	8773342	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8773342delG								LOC339788 (656365 upstream) : ID2 (45998 downstream)																							ATCCTAGGGTGGGGCAGCATC	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11508847	11508848	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11508847_11508848insT								ROCK2 (24136 upstream) : E2F6 (75654 downstream)																							ttttatttttatttttttgaga	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11632206	11632206	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11632206delC								E2F6 (25909 upstream) : GREB1 (42036 downstream)																							TCCCTGGATTCCCCATGGCTC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13231955	13231956	+	IGR	INS	-	T	T	rs143245926	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13231955_13231956insT								TRIB2 (349099 upstream) : None (None downstream)																							AGTAGTTATGCTTTTTTTTTAA	0.203													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14813586	14813600	+	IGR	DEL	GGCTGAGCGCTGGAA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14813586_14813600delGGCTGAGCGCTGGAA								FAM84A (22653 upstream) : NBAS (493432 downstream)																							atggccctagggctgagcgctGGAAGGCTGCTTAT	0.270													4	2	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15608271	15608272	+	Intron	INS	-	AATA	AATA	rs139646833	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15608271_15608272insAATA	uc002rcc.1	-						NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						CTTCAAATGGTAGTGTCAGTCT	0.337													3	3	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15612767	15612768	+	Intron	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15612767_15612768delGG	uc002rcc.1	-						NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						tgccaaccttggcaaccgtgga	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15866528	15866528	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15866528delA								DDX1 (95304 upstream) : MYCNOS (213492 downstream)																							ACACTCCAAGAAAGGCCCCAG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17521675	17521676	+	IGR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17521675_17521676delAG								FAM49A (674579 upstream) : RAD51AP2 (170310 downstream)																							agagagacacagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18010659	18010660	+	IGR	INS	-	G	G	rs138881134	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18010659_18010660insG								MSGN1 (12293 upstream) : KCNS3 (48454 downstream)																							GAATGTTCTCAGGGATTGGAAG	0.426													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19542164	19542165	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19542164_19542165insA								NT5C1B (771326 upstream) : OSR1 (9082 downstream)																							gaaataatgactggaaaatttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19595640	19595640	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19595640delT								OSR1 (37268 upstream) : TTC32 (500878 downstream)																							AGCAATCACATTTTTTTCTAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19755781	19755782	+	IGR	INS	-	G	G	rs142066792	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19755781_19755782insG								OSR1 (197409 upstream) : TTC32 (340736 downstream)																							gagtcaccccaggaaagcagaa	0.000													2	5	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20153965	20153965	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20153965delA	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron|WDR35_uc002rdk.3_5'Flank	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctcaaatgctaaaaccataaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20881955	20881955	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20881955delC								GDF7 (10705 upstream) : C2orf43 (1848 downstream)																							CTGCCTGATGCATATTTTTGC	0.468											OREG0014483	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22842193	22842194	+	IGR	INS	-	A	A	rs140224976	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22842193_22842194insA								None (None upstream) : KLHL29 (913261 downstream)																							ACTCACTCAGCAAAAAAGACAC	0.396													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23611194	23611194	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23611194delT								None (None upstream) : KLHL29 (144261 downstream)																							GATAAAAACCTTTTTTTTGTT	0.368													4	2	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25767358	25767358	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25767358delT	uc002rgh.2	-						DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCCTGTCATTTTCACTTCC	0.468													4	2	---	---	---	---	
ZNF512	84450	broad.mit.edu	37	2	27839742	27839742	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27839742delA	uc002rla.2	+						ZNF512_uc010ylv.1_Intron|ZNF512_uc010ylw.1_Intron|ZNF512_uc002rlb.2_Intron|ZNF512_uc010ylx.1_Intron|ZNF512_uc002rlc.2_Intron|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Intron	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CTCCTCACACAAAATGAGCAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	29173403	29173403	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29173403delT								WDR43 (2323 upstream) : FAM179A (30761 downstream)																							gtggagtgggtttgtgaggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30874304	30874305	+	IGR	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30874304_30874305delGA								LCLAT1 (7214 upstream) : CAPN13 (71335 downstream)																							tggaccccctgaaaaggtcttg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	31521901	31521902	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31521901_31521902insT								EHD3 (30642 upstream) : XDH (35286 downstream)																							GTAGCACTTCATTTTTTTTTCC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	31651140	31651141	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31651140_31651141delTG								XDH (13529 upstream) : SRD5A2 (98515 downstream)																							gcctacggaatgtgaccattca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	36524307	36524308	+	IGR	INS	-	A	A	rs138141106	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36524307_36524308insA								None (None upstream) : CRIM1 (59089 downstream)																							CCTTCCAGAAGAAAAAACAGAC	0.441													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37970471	37970472	+	IGR	INS	-	TG	TG	rs142322916		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37970471_37970472insTG								CDC42EP3 (71145 upstream) : FAM82A1 (181990 downstream)																							ATAGTGGACATTCTCTTACTCT	0.381													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38477094	38477095	+	IGR	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38477094_38477095insG								C2orf58 (68103 upstream) : ATL2 (44936 downstream)																							gcacaggaaatggggcagagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39009295	39009295	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39009295delT								GEMIN6 (191 upstream) : DHX57 (15583 downstream)																							tctttttttcttttttttttg	0.164													4	2	---	---	---	---	
SOS1	6654	broad.mit.edu	37	2	39270203	39270204	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39270203_39270204insT	uc002rrk.3	-						SOS1_uc010ynr.1_Intron|SOS1_uc002rrl.2_Intron	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1						apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ggtgatagtggtattcttttct	0.000									Noonan_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42256448	42256449	+	IGR	INS	-	AG	AG	rs150256747	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42256448_42256449insAG								None (None upstream) : PKDCC (18712 downstream)																							TATATATATACagagagagaga	0.178													4	2	---	---	---	---	
SIX2	10736	broad.mit.edu	37	2	45239010	45239010	+	5'Flank	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45239010delC	uc002ruo.2	-						SIX2_uc002rup.2_5'Flank	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CCACAGCCTTCACCATGAATG	0.488													4	2	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46237815	46237815	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46237815delT	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			CAGCATCTTCTTTTTTAGGGC	0.403													4	2	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46252216	46252216	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46252216delA	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			ATTTGACTGTAAAAAAAAACA	0.358													4	2	---	---	---	---	
LOC100134259	100134259	broad.mit.edu	37	2	47067755	47067755	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47067755delT	uc002rvi.3	+							NR_024452				Homo sapiens cDNA FLJ35178 fis, clone PLACE6014043.												0						GGTAGAAAGGTTTTTTAGGAG	0.537													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47295595	47295595	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47295595delA	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|C2orf61_uc010fbd.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GCTTGGCAGGAAAGTTCAATA	0.507													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50194814	50194814	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50194814delA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc010yon.1_Intron|NRXN1_uc002rxa.3_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATTGCTAGGTAGAGTGAAATA	0.338													4	2	---	---	---	---	
TSPYL6	388951	broad.mit.edu	37	2	54481859	54481859	+	3'UTR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54481859delA	uc002rxr.2	-	1					ACYP2_uc002rxq.3_Intron	NM_001003937	NP_001003937	Q8N831	TSYL6_HUMAN	TSPY-like 6						nucleosome assembly	nucleus					0						GCAGAATAGCAAGACGACCAG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56090113	56090113	+	IGR	DEL	T	-	-	rs11125607	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56090113delT								PNPT1 (169102 upstream) : EFEMP1 (2990 downstream)																							AGATAAGGTATAATGACTTCC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62085792	62085792	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62085792delA								FAM161A (4514 upstream) : CCT4 (9471 downstream)																							acagaacaagaaaaaaaaaac	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65902998	65902998	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65902998delG	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		ctgtaaaaatgggcaactcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67196698	67196698	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67196698delC								MEIS1 (396808 upstream) : ETAA1 (427744 downstream)																							CATGCAGCTGCCCCAGGGAAG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67385179	67385179	+	Intron	DEL	A	-	-	rs67118306		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67385179delA	uc002sdx.2	+						uc002sdy.1_Intron					Homo sapiens, clone IMAGE:5541055, mRNA.																		AGTTCAGAAGAAAAAAAAAAG	0.333													2	4	---	---	---	---	
C2orf42	54980	broad.mit.edu	37	2	70381253	70381254	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70381253_70381254insA	uc002sgh.2	-							NM_017880	NP_060350	Q9NWW7	CB042_HUMAN	hypothetical protein LOC54980												0						atccacaaaagaaaaaaaataa	0.000													4	2	---	---	---	---	
SNRPG	6637	broad.mit.edu	37	2	70516393	70516393	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70516393delT	uc002sgp.2	-						SNRPG_uc002sgo.2_Intron	NM_003096	NP_003087	P62308	RUXG_HUMAN	small nuclear ribonucleoprotein polypeptide G						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|RNA binding				0						cTGCTTTAAATTTTTATAAAG	0.139													60	27	---	---	---	---	
CLEC4F	165530	broad.mit.edu	37	2	71048720	71048721	+	5'Flank	INS	-	C	C	rs58395865		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71048720_71048721insC	uc002shf.2	-						CLEC4F_uc010yqv.1_5'Flank	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN	C-type lectin, superfamily member 13						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(5)	5						gaccccactggccttgccctgt	0.000													4	2	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	73020723	73020723	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73020723delA	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						aggagtcaggaaaaaaaagag	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81455140	81455141	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81455140_81455141insT								CTNNA2 (579236 upstream) : None (None downstream)																							CATAAAGTTAGtgacataattt	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88716094	88716095	+	IGR	INS	-	CT	CT			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88716094_88716095insCT								THNSL2 (229949 upstream) : FOXI3 (31631 downstream)																							TGCTACATTCCCTCTCTCTCTG	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91672684	91672684	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91672684delT								None (None upstream) : LOC654342 (132508 downstream)																							TTTTTCTTTCTACCTATTAAA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91769732	91769733	+	IGR	INS	-	AATC	AATC	rs113868867		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91769732_91769733insAATC								None (None upstream) : LOC654342 (35459 downstream)																							AGGCAGTGATGAATCAGACAGT	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	97057448	97057449	+	IGR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97057448_97057449delAG								NCAPH (16174 upstream) : NEURL3 (105936 downstream)																							tcaggcagaaagagagagagag	0.000													4	2	---	---	---	---	
TMEM131	23505	broad.mit.edu	37	2	98380253	98380253	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98380253delG	uc002syh.3	-						TMEM131_uc002syg.2_5'Flank	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6						TCCTGTGGGTGGAATGTGTTT	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	99351577	99351577	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99351577delG								MGAT4A (3988 upstream) : C2orf55 (58732 downstream)																							ctgggggcaaggaagccttcc	0.164													4	2	---	---	---	---	
FHL2	2274	broad.mit.edu	37	2	106026648	106026649	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106026648_106026649insC	uc002tdd.2	-						FHL2_uc002tdc.2_Intron	NM_201557	NP_963851	Q14192	FHL2_HUMAN	four and a half LIM domains 2						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent	actin cytoskeleton|focal adhesion|nucleus	androgen receptor binding|identical protein binding|transcription coactivator activity|zinc ion binding			ovary(1)	1						GACAGCTTTGTCCCCCAAAAGG	0.545													4	2	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	109952379	109952379	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109952379delA	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						GCAGCTCAACAAAAAAAGACA	0.284													4	2	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113588379	113588379	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113588379delT	uc002tii.1	-						IL1B_uc002tih.1_Intron	NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	TAGGTGAGAATTTTTTTTTTT	0.383													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114110615	114110615	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114110615delT								PAX8 (74117 upstream) : CBWD2 (84653 downstream)																							TTCTTTTCTCTTTTTTTTTTC	0.244													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122466740	122466740	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122466740delT	uc002tnj.1	+											Homo sapiens cDNA FLJ40945 fis, clone UTERU2008747.																		ttttttgttgttttttttttg	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	123658188	123658188	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123658188delA								None (None upstream) : None (None downstream)																							TATAATCTGTAAAAAAAAAAC	0.328													5	3	---	---	---	---	
BIN1	274	broad.mit.edu	37	2	127805623	127805623	+	3'UTR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127805623delT	uc002tns.1	-	19					BIN1_uc010yzf.1_3'UTR|BIN1_uc010yzg.1_3'UTR|BIN1_uc002tnu.1_3'UTR|BIN1_uc002toa.1_3'UTR|BIN1_uc002tnt.1_3'UTR|BIN1_uc002tnv.1_3'UTR|BIN1_uc002tnw.1_3'UTR|BIN1_uc002tnx.1_3'UTR|BIN1_uc002tny.1_3'UTR|BIN1_uc002tnz.1_3'UTR|BIN1_uc002tob.1_3'UTR|BIN1_uc002toc.1_3'UTR	NM_139343	NP_647593	O00499	BIN1_HUMAN	bridging integrator 1 isoform 1						cell proliferation|endocytosis|interspecies interaction between organisms|multicellular organismal development	actin cytoskeleton|nucleus				ovary(2)|central_nervous_system(2)|skin(2)|lung(1)	7	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GTTTTTATCATTTTTTTTTTG	0.443													6	3	---	---	---	---	
BIN1	274	broad.mit.edu	37	2	127855622	127855622	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127855622delG	uc002tns.1	-						BIN1_uc010yzg.1_Intron|BIN1_uc002tnu.1_Intron|BIN1_uc002toa.1_Intron|BIN1_uc002tnt.1_Intron|BIN1_uc002tnv.1_Intron|BIN1_uc002tnw.1_Intron|BIN1_uc002tnx.1_Intron|BIN1_uc002tny.1_Intron|BIN1_uc002tnz.1_Intron|BIN1_uc002tob.1_Intron|BIN1_uc002toc.1_Intron	NM_139343	NP_647593	O00499	BIN1_HUMAN	bridging integrator 1 isoform 1						cell proliferation|endocytosis|interspecies interaction between organisms|multicellular organismal development	actin cytoskeleton|nucleus				ovary(2)|central_nervous_system(2)|skin(2)|lung(1)	7	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GTGCAAGGCTGGGAGCTCCTG	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129428110	129428110	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129428110delG								HS6ST1 (351939 upstream) : None (None downstream)																							ccccatccctggggtgtcagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130537779	130537780	+	IGR	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130537779_130537780delTC								None (None upstream) : LOC389033 (142655 downstream)																							TTCTGTCCGGTCTCACCCCCAT	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133046384	133046385	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133046384_133046385delTG								NCRNA00164 (30842 upstream) : GPR39 (127762 downstream)																							tgtgtgtttatgtgtgtgtgtg	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133081485	133081485	+	IGR	DEL	T	-	-	rs113299534		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133081485delT								NCRNA00164 (65943 upstream) : GPR39 (92662 downstream)																							ACTTCCCTTATTTTTTTTCTT	0.249													4	2	---	---	---	---	
GPR39	2863	broad.mit.edu	37	2	133389398	133389398	+	Intron	DEL	T	-	-	rs75675133		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133389398delT	uc002ttl.2	+							NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						cttcttcttcttttttttttt	0.179													4	2	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133882901	133882901	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133882901delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						ACTGATACACAAACACTTCAT	0.383													4	2	---	---	---	---	
ACMSD	130013	broad.mit.edu	37	2	135656097	135656098	+	Intron	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135656097_135656098delAA	uc002ttz.2	+						ACMSD_uc002tua.2_Intron|uc010zbe.1_Intron	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		ATATAAAAACAAAGAACAGAGG	0.322													129	65	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	140478826	140478826	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140478826delA								NXPH2 (941015 upstream) : LRP1B (510170 downstream)																							CAGTCAGAGGAAAAAAAAAAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	142904327	142904327	+	IGR	DEL	A	-	-	rs75170145		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142904327delA								LRP1B (15057 upstream) : KYNU (730868 downstream)																							cccaagaaagaaaaaaaaaaa	0.114													4	2	---	---	---	---	
KYNU	8942	broad.mit.edu	37	2	143651233	143651234	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143651233_143651234insA	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	GATGGTATGGGAAAAAAAAGAG	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147059064	147059064	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147059064delA								None (None upstream) : PABPC1P2 (285561 downstream)																							ggagctagagaaacaagaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156170395	156170397	+	IGR	DEL	GAG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156170395_156170397delGAG								KCNJ3 (457381 upstream) : None (None downstream)																							CCTCCACAAAGAGGAGAAGATTT	0.379													6	3	---	---	---	---	
BAZ2B	29994	broad.mit.edu	37	2	160530046	160530047	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160530046_160530047insA	uc002uau.1	-									Q9UIF8	BAZ2B_HUMAN	SubName: Full=Putative uncharacterized protein DKFZp686H10114;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						tctaaatgcataaaaatatgta	0.000													4	2	---	---	---	---	
ITGB6	3694	broad.mit.edu	37	2	161103197	161103198	+	Intron	INS	-	T	T	rs34720802		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161103197_161103198insT	uc010fow.1	-									P18564	ITB6_HUMAN	Synthetic construct DNA, clone: pF1KB8424, Homo sapiens ITGB6 gene for integrin, beta 6, without stop codon, in Flexi system.						cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						tttttttcttcttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162345285	162345285	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162345285delG								TBR1 (63712 upstream) : SLC4A10 (135560 downstream)																							tctaccacctggggtggtgat	0.000													4	2	---	---	---	---	
KCNH7	90134	broad.mit.edu	37	2	163639119	163639119	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163639119delA	uc002uch.1	-						KCNH7_uc002uci.2_Intron|uc002ucj.1_Intron	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	gggtcattgtaagaactttgg	0.060													4	2	---	---	---	---	
STK39	27347	broad.mit.edu	37	2	169034823	169034823	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169034823delT	uc002uea.2	-							NM_013233	NP_037365	Q9UEW8	STK39_HUMAN	serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2						AAGATCATTATACCTTCAGAG	0.318													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170143601	170143602	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170143601_170143602insC	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CTGCCTGAAATCCAGGCAGGGC	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173196262	173196262	+	IGR	DEL	T	-	-	rs66522574		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173196262delT								DLX2 (228784 upstream) : ITGA6 (95820 downstream)																							aaaattgtgatttttcataga	0.040													1	6	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	173954318	173954318	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173954318delT	uc002uhz.2	+						ZAK_uc002uhx.2_Intron|ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron|ZAK_uc002uia.1_5'Flank	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			cgtgtttcccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177441748	177441749	+	IGR	INS	-	A	A	rs151305845	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177441748_177441749insA								MTX2 (238997 upstream) : MIR1246 (23959 downstream)																							GAGTGAGGAGGAAAAAAATAAT	0.287													4	2	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178600129	178600130	+	Intron	INS	-	A	A	rs111870211		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178600129_178600130insA	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			ATGATTCGTGGAAAAAAAAAAC	0.401									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				6	3	---	---	---	---	
ZNF385B	151126	broad.mit.edu	37	2	180673216	180673216	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180673216delA	uc002unn.3	-							NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTGCTGGCCTAAAAAAAATAA	0.194													4	2	---	---	---	---	
ITGA4	3676	broad.mit.edu	37	2	182387958	182387959	+	Intron	INS	-	AT	AT	rs148652743	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182387958_182387959insAT	uc002unu.2	+						ITGA4_uc010frj.1_Intron|ITGA4_uc002unv.2_Intron	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	tatatacatacatatatataca	0.099													5	3	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183128774	183128775	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183128774_183128775insT	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			GGAAGAGGAGATTTTTTTTTCA	0.322													4	2	---	---	---	---	
GULP1	51454	broad.mit.edu	37	2	189216057	189216057	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189216057delT	uc010fru.2	+						GULP1_uc002uqc.3_Intron|GULP1_uc002uqd.2_Intron|GULP1_uc010zfw.1_Intron|GULP1_uc002uqe.2_Intron|GULP1_uc002uqf.2_Intron|GULP1_uc002uqg.2_Intron	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing						apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			agaggtcctatgacttgttca	0.119													4	2	---	---	---	---	
GULP1	51454	broad.mit.edu	37	2	189331461	189331462	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189331461_189331462delAC	uc010fru.2	+						GULP1_uc002uqc.3_Intron|GULP1_uc002uqd.2_Intron|GULP1_uc010zfw.1_Intron|GULP1_uc002uqe.2_Intron|GULP1_uc002uqf.2_Intron|GULP1_uc002uqg.2_Intron	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing						apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			ctctattcctaccctacctacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	195386475	195386476	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195386475_195386476delAA								None (None upstream) : None (None downstream)																							AAATTCTCCTAAATTGATTTTT	0.322													4	2	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197272711	197272711	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197272711delA	uc002utm.1	-							NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CTGAATATATAAAACCCTTAA	0.358													4	2	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197431865	197431865	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197431865delG	uc002utm.1	-							NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CTCACAGACTGGGGTACAAAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	209068438	209068438	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209068438delT								C2orf80 (13665 upstream) : IDH1 (32516 downstream)																							AAACTGTGGCTTTTCTCTGTA	0.318													5	4	---	---	---	---	
MAP2	4133	broad.mit.edu	37	2	210574397	210574397	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210574397delA	uc002vde.1	+						MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Intron	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	AACAAATCAGAAAAAAAAAAT	0.209													9	5	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218563003	218563003	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218563003delC	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						GTTCCTGCAGCCCAGCCACAG	0.368													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218731313	218731313	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218731313delC	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc010zjv.1_Intron|TNS1_uc010fvj.1_Intron|TNS1_uc010fvk.1_Intron|TNS1_uc002vgu.3_Intron|TNS1_uc010fvi.1_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GATTTATTTTCATCAGTGAAA	0.527													4	2	---	---	---	---	
CXCR1	3577	broad.mit.edu	37	2	219030129	219030129	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219030129delT	uc002vhc.2	-							NM_000634	NP_000625	P25024	CXCR1_HUMAN	interleukin 8 receptor alpha						dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity			lung(2)	2						TCTTCGGAGGTTGGCTTCCCA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224928356	224928356	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224928356delG								SERPINE2 (24320 upstream) : FAM124B (315060 downstream)																							GAGGAATACTGAACTAGAGAG	0.408													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225721012	225721012	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225721012delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTTGTAAGAGTTTTTTTTTTA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228718117	228718117	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228718117delG								CCL20 (35837 upstream) : WDR69 (18210 downstream)																							ATatctggctggggatgatgg	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229493503	229493503	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229493503delA								SPHKAP (447142 upstream) : PID1 (395187 downstream)																							agaagcaaacaaaaaaaGAGT	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	231528724	231528724	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231528724delA								SP100 (118407 upstream) : CAB39 (48833 downstream)																							aaaataaaacaaaaaaaaaag	0.000													4	4	---	---	---	---	
NMUR1	10316	broad.mit.edu	37	2	232391510	232391511	+	Intron	INS	-	T	T	rs144086480	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232391510_232391511insT	uc002vry.3	-							NM_006056	NP_006047	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|calcium ion transport|calcium-mediated signaling|chloride transport|smooth muscle contraction	integral to plasma membrane|membrane fraction	neuromedin U receptor activity			lung(3)|central_nervous_system(1)|pancreas(1)	5		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTGAGCTGGGATGCAGGTAGGT	0.579													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236092362	236092363	+	IGR	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236092362_236092363delTT								SH3BP4 (128006 upstream) : AGAP1 (310373 downstream)																							GACAAGGTAGTTAGGAAGAGGG	0.436													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236843468	236843469	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236843468_236843469insC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						AAGTGTGCCTTCCCATTGTTGT	0.485													4	2	---	---	---	---	
ASB18	401036	broad.mit.edu	37	2	237146644	237146646	+	Intron	DEL	GTG	-	-	rs72060634		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237146644_237146646delGTG	uc010znh.1	-						ASB18_uc010fyp.1_Intron	NM_212556	NP_997721	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box-containing 18						intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		GAGGTTAGTTGTGGTGGTGGTGG	0.537													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240624881	240624881	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240624881delG								HDAC4 (301535 upstream) : NDUFA10 (275277 downstream)																							ttatttttttgaataacagtt	0.000													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241665266	241665266	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241665266delC	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron|KIF1A_uc002vzw.2_5'Flank|KIF1A_uc002vzx.2_5'UTR	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GAACAGCTGGCCCCTTTGTCT	0.463													4	2	---	---	---	---	
HDLBP	3069	broad.mit.edu	37	2	242172349	242172350	+	Intron	INS	-	GT	GT			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242172349_242172350insGT	uc002waz.2	-						HDLBP_uc002wba.2_Intron|HDLBP_uc002wbb.2_Intron	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TGGCCTGGCTGGTGTGTGTGTG	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242946795	242946796	+	3'UTR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242946795_242946796delAG	uc002wct.1	+	1										Homo sapiens cDNA FLJ38379 fis, clone FEBRA2002986.																		tgtggtggttagctgtattcct	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8896717	8896718	+	IGR	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8896717_8896718insC								OXTR (85417 upstream) : RAD18 (24843 downstream)																							CCTCCTTACAGCCCCCCATCTC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	11954049	11954049	+	5'Flank	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11954049delC	uc003bwk.1	-											DQ587806																		TCAATATTCTCCCCCACAAAA	0.507													4	2	---	---	---	---	
NUP210	23225	broad.mit.edu	37	3	13388213	13388213	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13388213delG	uc003bxv.1	-							NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					GGTGGCGACTGCAGGGGATAA	0.567													4	2	---	---	---	---	
ZNF385D	79750	broad.mit.edu	37	3	21512983	21512984	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21512983_21512984insC	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						TCACTAAAGAGCCCAAAACAAA	0.327													4	2	---	---	---	---	
THRB	7068	broad.mit.edu	37	3	24188535	24188535	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24188535delT	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	AGTCAACACCTTTTTTTTTGG	0.338													4	2	---	---	---	---	
GADL1	339896	broad.mit.edu	37	3	30877590	30877590	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30877590delC	uc003cep.2	-						GADL1_uc003ceq.1_Intron	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	CTTCTCTTATCCCCCAACCTC	0.393													4	2	---	---	---	---	
CLASP2	23122	broad.mit.edu	37	3	33626582	33626582	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33626582delA	uc003cfu.2	-						CLASP2_uc003cft.2_Intron|CLASP2_uc010hgb.2_Intron|CLASP2_uc011axt.1_Intron	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						TATAACCTGGAAAAAAAAAGG	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	39029954	39029954	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39029954delC								SCN11A (37902 upstream) : WDR48 (63553 downstream)																							CTCATGCCTGCCCTCCACACA	0.562													4	2	---	---	---	---	
HIGD1A	25994	broad.mit.edu	37	3	42835470	42835470	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42835470delA	uc003cma.3	-						HIGD1A_uc010hid.2_Intron|HIGD1A_uc003cmb.3_Intron	NM_001099669	NP_001093139	Q9Y241	HIG1A_HUMAN	HIG1 domain family, member 1A isoform b						response to stress	integral to membrane|protein complex	protein binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.217)		ctccaaaaagaaaaaaaaaGT	0.124													4	2	---	---	---	---	
C3orf39	84892	broad.mit.edu	37	3	43143916	43143916	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43143916delG	uc003cmr.1	-							NM_032806	NP_116195	Q8NAT1	AGO61_HUMAN	glycosyltransferase precursor							extracellular region	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)		TGAAAGATCTGATTCTCTTAG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	53236026	53236027	+	IGR	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53236026_53236027delCC								PRKCD (9295 upstream) : TKT (22697 downstream)																							tctgataatacccagtgctggt	0.069													4	2	---	---	---	---	
SYNPR	132204	broad.mit.edu	37	3	63466852	63466852	+	Intron	DEL	A	-	-	rs11349566		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63466852delA	uc003dlq.2	+						SYNPR_uc003dlp.2_Intron|SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron|SYNPR_uc010hnt.2_Intron|SYNPR_uc011bfm.1_Intron	NM_144642	NP_653243	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 2							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		GACTCTCCTCAAAAAAAAAGA	0.413													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	68664796	68664796	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68664796delG								FAM19A1 (70027 upstream) : FAM19A4 (116121 downstream)																							CGCTGATGCTGGATCATTTGT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83604624	83604624	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83604624delT								None (None upstream) : None (None downstream)																							tgctttctgctttttctttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98026474	98026475	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98026474_98026475insA								OR5H2 (23798 upstream) : OR5K4 (46223 downstream)																							TTATCTTGCTTAAAAAAAATTG	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112774068	112774069	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112774068_112774069delCA	uc003dzv.2	-											full-length cDNA clone CS0DI042YP13 of Placenta Cot 25-normalized of Homo sapiens (human).																		acacaccactcacacacacaca	0.198													4	3	---	---	---	---	
GRAMD1C	54762	broad.mit.edu	37	3	113547779	113547780	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113547779_113547780insT	uc011bil.1	+									Q8IYS0	GRM1C_HUMAN	Homo sapiens cDNA FLJ35862 fis, clone TESTI2007346.							integral to membrane				ovary(2)|skin(1)	3						ctcatcacttctatcaccagca	0.000													4	2	---	---	---	---	
ZBTB20	26137	broad.mit.edu	37	3	114604284	114604285	+	Intron	INS	-	TC	TC	rs146632882	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114604284_114604285insTC	uc003ebm.2	-						ZBTB20_uc003ebn.2_Intron|ZBTB20_uc003ebp.2_Intron	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TTTGTTTAGTGTCTCTCTCTCG	0.312													7	5	---	---	---	---	
IGSF11	152404	broad.mit.edu	37	3	118622766	118622766	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118622766delA	uc003ebw.2	-						IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Intron|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						AGCATGGTCCAGGAAGAGAGC	0.463													4	2	---	---	---	---	
FSTL1	11167	broad.mit.edu	37	3	120153100	120153100	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120153100delA	uc003eds.2	-						FSTL1_uc011bjh.1_Intron|FSTL1_uc010hrb.2_Intron	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor						BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		agagaaagtgaaaaataaaag	0.209													4	2	---	---	---	---	
ROPN1	54763	broad.mit.edu	37	3	123701890	123701890	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123701890delT	uc003eha.2	-						ROPN1_uc003ehb.1_Intron|ROPN1_uc003ehc.1_Intron	NM_017578	NP_060048	Q9HAT0	ROP1A_HUMAN	ropporin						signal transduction		cAMP-dependent protein kinase regulator activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.148)		cagaatttccttttttttgga	0.000													4	2	---	---	---	---	
SLC41A3	54946	broad.mit.edu	37	3	125758441	125758441	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125758441delT	uc003eij.2	-						SLC41A3_uc003eii.2_Intron|SLC41A3_uc003eil.2_Intron|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_Intron|SLC41A3_uc010hsd.1_Intron	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		gcaaacactatttttttgctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127157666	127157666	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127157666delC								PLXNA1 (401438 upstream) : TPRA1 (134242 downstream)																							CCCAGAACAACCCCCAGCATT	0.448													4	2	---	---	---	---	
TF	7018	broad.mit.edu	37	3	133428156	133428156	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133428156delT	uc003epu.1	+							NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	attggaagtgtagtttccata	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137678758	137678759	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137678758_137678759delAA								SOX14 (194362 upstream) : CLDN18 (38899 downstream)																							agagaagagtaaaaaaaaaaaa	0.213													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	139744480	139744481	+	Intron	INS	-	GA	GA			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139744480_139744481insGA	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AGGAAGAAGAGGAGAGAGAGAG	0.446										HNSCC(16;0.037)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157257255	157257255	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157257255delT								VEPH1 (35840 upstream) : C3orf55 (3904 downstream)																							TCATCTTGTGTTTTCTATGTG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161299890	161299890	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161299890delG								OTOL1 (78162 upstream) : None (None downstream)																							TTTCTGCAGTGGTATATGCCC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162120851	162120851	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162120851delC								OTOL1 (899123 upstream) : None (None downstream)																							CAGTTTttttcttccattccc	0.129													4	2	---	---	---	---	
GOLIM4	27333	broad.mit.edu	37	3	167764595	167764595	+	Intron	DEL	A	-	-	rs66983386		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167764595delA	uc003ffe.2	-						GOLIM4_uc011bpe.1_Intron|GOLIM4_uc011bpf.1_Intron|GOLIM4_uc011bpg.1_Intron	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TTTGGCAGCCAAAAAAAAAAA	0.323													6	4	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185955456	185955456	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185955456delG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	cagagtgtctggtatacatca	0.005													4	2	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188948224	188948224	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188948224delA	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CATAAATTGCAAAAAAAAAAT	0.045													2	4	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147703	190147704	+	Intron	DEL	GA	-	-	rs78875004		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147703_190147704delGA	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		CCACAGGGGGGAAAAAAAAAAT	0.351													4	4	---	---	---	---	
UBXN7	26043	broad.mit.edu	37	3	196099147	196099147	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196099147delC	uc003fwm.3	-						UBXN7_uc003fwn.3_Intron|UBXN7_uc010iae.2_Intron	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7								protein binding			ovary(2)|pancreas(1)	3						TCTCTTTTATCCAGTTATTTG	0.184													4	2	---	---	---	---	
HTT	3064	broad.mit.edu	37	4	3144834	3144835	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3144834_3144835insA	uc011bvq.1	+							NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AATACACGCCCAAAATAAAAAA	0.228													6	3	---	---	---	---	
ACOX3	8310	broad.mit.edu	37	4	8433315	8433315	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8433315delA	uc003glc.3	-						ACOX3_uc003gld.3_Intron	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3 isoform a						bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1						aaatttggggaaaaaaataag	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13705870	13705870	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13705870delA	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																		TCTTGCAACCAGTCTTCATCT	0.423													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14100530	14100530	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14100530delT								BOD1L (471202 upstream) : CPEB2 (904992 downstream)																							AGACGTGGGATAGCAATGGCA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14547662	14547663	+	Intron	INS	-	A	A	rs142581799	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14547662_14547663insA	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																		actttgtctctaaaaaaaaaTG	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31950004	31950004	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31950004delC								PCDH7 (801583 upstream) : None (None downstream)																							atgattcagtcacctcccatg	0.000													4	2	---	---	---	---	
C4orf19	55286	broad.mit.edu	37	4	37561821	37561822	+	Intron	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37561821_37561822delCT	uc003gsw.3	+							NM_001104629	NP_001098099	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286												0						AATTCTCATGCTCAAGGATGCC	0.480													4	2	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41473480	41473480	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41473480delT	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						TCCAGAATTATTTTTGAACTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	44852406	44852406	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44852406delT								GNPDA2 (123794 upstream) : None (None downstream)																							ATTGGTATCATTTTTTTTCTT	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49219711	49219711	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49219711delA								CWH43 (155618 upstream) : None (None downstream)																							tctttgtCAcaggctggccat	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49246289	49246292	+	IGR	DEL	CTTC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49246289_49246292delCTTC								CWH43 (182196 upstream) : None (None downstream)																							TTTTGACTTACTTCGTTAATTTTT	0.324													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49246538	49246539	+	IGR	DEL	AA	-	-	rs57295322		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49246538_49246539delAA								CWH43 (182445 upstream) : None (None downstream)																							TTAAAACAATAACATAATTATT	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49534615	49534616	+	IGR	INS	-	C	C	rs68121402		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49534615_49534616insC								CWH43 (470522 upstream) : None (None downstream)																							TAAAAAAAAAACACTACTGCTT	0.129													4	2	---	---	---	---	
REST	5978	broad.mit.edu	37	4	57773491	57773491	+	5'Flank	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57773491delT	uc003hch.2	+						REST_uc003hci.2_5'Flank	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor						cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					GTCCATAACCTCCTTCCTGAA	0.463													4	2	---	---	---	---	
POLR2B	5431	broad.mit.edu	37	4	57854668	57854668	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57854668delT	uc003hcl.1	+						POLR2B_uc011cae.1_Intron|POLR2B_uc011caf.1_Intron	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					tgtctatctctttttttttta	0.134													4	3	---	---	---	---	
POLR2B	5431	broad.mit.edu	37	4	57889309	57889309	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57889309delT	uc003hcl.1	+						POLR2B_uc011cae.1_Intron|POLR2B_uc011caf.1_Intron|POLR2B_uc003hcm.1_Intron	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					CTTCATAGACTTTTTTTTTTG	0.368													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	60065601	60065601	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60065601delG								None (None upstream) : None (None downstream)																							CATACTCAATGGGTTCTGGGG	0.274													4	2	---	---	---	---	
AFM	173	broad.mit.edu	37	4	74366206	74366206	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74366206delA	uc003hhb.2	+							NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor						vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGCAGCCAGCAAAAAGGCTCA	0.388													4	3	---	---	---	---	
BTC	685	broad.mit.edu	37	4	75676091	75676091	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75676091delT	uc003hig.2	-							NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor						positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			GTAATTTCAATTTTTTTTTGC	0.269													9	4	---	---	---	---	
PARM1	25849	broad.mit.edu	37	4	75965219	75965219	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75965219delG	uc003hih.1	+							NM_015393	NP_056208	Q6UWI2	PARM1_HUMAN	prostatic androgen-repressed message-1						positive regulation of telomerase activity	early endosome|endosome membrane|Golgi membrane|integral to membrane|late endosome|plasma membrane				ovary(1)	1						tccctgtactgcaatcagtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84899575	84899575	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84899575delT	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		ACTTTTACTCTTTTTTTTACA	0.408													4	3	---	---	---	---	
HERC6	55008	broad.mit.edu	37	4	89352023	89352023	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89352023delT	uc011cdi.1	+						HERC6_uc011cdj.1_Intron|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		CAAAATTTGGTTTGAGATACT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97360139	97360139	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97360139delT								PDHA2 (597515 upstream) : None (None downstream)																							atcatgtatgttttttttttc	0.000													1	5	---	---	---	---	
NFKB1	4790	broad.mit.edu	37	4	103467447	103467447	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103467447delA	uc011ceq.1	+						NFKB1_uc011cep.1_Intron	NM_003998	NP_003989	P19838	NFKB1_HUMAN	nuclear factor kappa-B, subunit 1 isoform 1						anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)	GGACTGAAGGAAAAAAAAAAA	0.388													4	2	---	---	---	---	
MANBA	4126	broad.mit.edu	37	4	103656618	103656618	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103656618delA	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		ATGCATGCTGAAAAAAAAAAA	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105496314	105496314	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105496314delG	uc003hxh.1	+											Homo sapiens cDNA FLJ37242 fis, clone BRAMY2004335.																		GACATTTGGAGGGGTCAGCTA	0.393													4	2	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107172061	107172061	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107172061delT	uc010ilv.2	-						TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						TGTTTCTCCATTAAAAAAACT	0.388													4	2	---	---	---	---	
ELOVL6	79071	broad.mit.edu	37	4	111081270	111081273	+	Intron	DEL	ACAC	-	-	rs66799932		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111081270_111081273delACAC	uc003hzz.2	-						ELOVL6_uc003iaa.2_Intron	NM_001130721	NP_001124193	Q9H5J4	ELOV6_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, saturated fatty acid|long-chain fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process		fatty acid elongase activity|protein binding			haematopoietic_and_lymphoid_tissue(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		acacacacaaacacacacacacac	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112475171	112475172	+	IGR	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112475171_112475172insG								MIR297 (693368 upstream) : C4orf32 (591381 downstream)																							AAAGCTATACTGGGGGGAAAAA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	116550409	116550409	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116550409delA								NDST4 (515377 upstream) : MIR1973 (670472 downstream)																							ATTTTGTTGTAAAAGAAGACT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121545522	121545522	+	IGR	DEL	T	-	-	rs33958706		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121545522delT								MAD2L1 (557509 upstream) : PRDM5 (70408 downstream)																							ctttactgcctcattgttgga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	124986298	124986298	+	IGR	DEL	A	-	-	rs79803430		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124986298delA								LOC285419 (134780 upstream) : ANKRD50 (599170 downstream)																							tagagaatacaatattttcaa	0.109													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	126945618	126945618	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126945618delG								MIR2054 (517156 upstream) : None (None downstream)																							ttgggcctatggttgtggaga	0.065													4	2	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964675	139964675	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964675delT	uc003ihl.2	+						CCRN4L_uc003ihk.1_3'UTR	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					TGGTTTTCACTTTTTTTTTTT	0.378													4	2	---	---	---	---	
SCOC	60592	broad.mit.edu	37	4	141235284	141235284	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141235284delG	uc003iib.2	+						uc003iic.1_Intron	NM_032547	NP_115936	Q9UIL1	SCOC_HUMAN	short coiled-coil protein isoform 4							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)					aaaaaaaaaagaaTGCATATG	0.189													4	2	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148868108	148868109	+	Intron	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148868108_148868109delTT	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron|ARHGAP10_uc003ilh.2_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TGGATGTACATTTTAGGAATTA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160310379	160310379	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160310379delA								RAPGEF2 (29080 upstream) : None (None downstream)																							AAATTGATCTAAAGTTGTTGC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	168880105	168880105	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168880105delA								SPOCK3 (724364 upstream) : ANXA10 (133602 downstream)																							atcatagcagaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190675962	190675962	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190675962delG								None (None upstream) : FRG1 (186012 downstream)																							AAACGCTTAAGGAAAATGATT	0.308													4	2	---	---	---	---	
EXOC3	11336	broad.mit.edu	37	5	448662	448662	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:448662delC	uc003jba.2	+							NM_007277	NP_009208	O60645	EXOC3_HUMAN	Sec6 protein						exocytosis|protein transport						0		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TCTTCCTGTTCCTCTACCAGA	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	654448	654449	+	IGR	INS	-	TG	TG	rs144191300	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:654448_654449insTG								CEP72 (784 upstream) : TPPP (5529 downstream)																							tgtgtgtgcgctgtgtgtgcgc	0.040													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2283389	2283389	+	IGR	DEL	G	-	-	rs2652153		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2283389delG								IRX4 (400509 upstream) : IRX2 (462892 downstream)																							GACCCTCCCTGGGCCTACCTC	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3465094	3465094	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3465094delC	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																		TAATTTATCTCCATTTCTCTG	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4585240	4585241	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4585240_4585241insA								IRX1 (983724 upstream) : LOC340094 (449231 downstream)																							GAGAATCCTCTCCAAATTCCAG	0.475													4	2	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5305655	5305656	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5305655_5305656delAC	uc003jdl.2	+							NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						cccacaccatacacacacacac	0.213													3	4	---	---	---	---	
SRD5A1	6715	broad.mit.edu	37	5	6643149	6643149	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6643149delT	uc003jdw.2	+						SRD5A1_uc011cml.1_Intron|SRD5A1_uc011cmm.1_Intron	NM_001047	NP_001038	P18405	S5A1_HUMAN	steroid-5-alpha-reductase 1						androgen biosynthetic process|cell differentiation|sex determination|sex differentiation	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|electron carrier activity				0					Dutasteride(DB01126)|Finasteride(DB01216)	ttgtaatttgttttttttttg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8272205	8272205	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8272205delG								MTRR (370972 upstream) : SEMA5A (762933 downstream)																							CTGGACACAAGGCGGAGGACT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8606310	8606310	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8606310delC								MTRR (705077 upstream) : SEMA5A (428828 downstream)																							TAGAGGTATTCCATAGAGAAG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8606313	8606313	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8606313delT								MTRR (705080 upstream) : SEMA5A (428825 downstream)																							AGGTATTCCATAGAGAAGAGA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10962798	10962799	+	IGR	INS	-	AG	AG	rs144196101	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10962798_10962799insAG								DAP (201411 upstream) : CTNND2 (9153 downstream)																							ctctcatacccagagagagaga	0.000													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11274027	11274027	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11274027delT	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GATTTTAAAGTTTAGCACTGG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16639028	16639028	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16639028delG								FAM134B (21910 upstream) : MYO10 (22989 downstream)																							caccagggctggggatggaaa	0.000													4	2	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19661830	19661830	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19661830delT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TAATGCCATATTTTGGAGATG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20328507	20328507	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20328507delA								CDH18 (340200 upstream) : None (None downstream)																							tgttgagagtaaaagagagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	24258473	24258473	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24258473delA								PRDM9 (729769 upstream) : CDH10 (228737 downstream)																							GTGCCACAAGAAAAAAAAAGC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28695491	28695491	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28695491delT								None (None upstream) : None (None downstream)																							CCCCTATAACTTTTTTTTCCA	0.164													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35120217	35120217	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35120217delC	uc003jjm.2	-							NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TAGGGTTCTACCCACAGTGGG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40468248	40468249	+	IGR	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40468248_40468249delAC								None (None upstream) : PTGER4 (211783 downstream)																							tatgaagaaaacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50234845	50234845	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50234845delG								PARP8 (96676 upstream) : ISL1 (444113 downstream)																							accctgccccgacctagtggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51412610	51412610	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51412610delT								ISL1 (722053 upstream) : ITGA1 (671164 downstream)																							ATGAGCCAGCTTTTTTTTTTG	0.408													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61371167	61371167	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61371167delT								FLJ37543 (368805 upstream) : KIF2A (230822 downstream)																							AACCAAGTTCTTATTATCTCA	0.423													4	2	---	---	---	---	
CWC27	10283	broad.mit.edu	37	5	64140985	64140985	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64140985delT	uc003jtn.1	+						CWC27_uc003jtm.2_3'UTR|CWC27_uc010iwt.1_Intron	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						gcccagcaaattagagaactc	0.000													4	2	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64595644	64595644	+	Intron	DEL	A	-	-	rs3832321		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64595644delA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTATATGAAGAAAAAAAAATT	0.308													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	65218355	65218355	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65218355delC								NLN (98968 upstream) : ERBB2IP (4029 downstream)																							acaaacctatcataaaaagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	66661944	66661944	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66661944delT								CD180 (169327 upstream) : PIK3R1 (849660 downstream)																							CAGTGATTCCTGGCAGGCAAA	0.547													4	2	---	---	---	---	
MRPS27	23107	broad.mit.edu	37	5	71525401	71525402	+	Intron	INS	-	T	T	rs141844336	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71525401_71525402insT	uc003kbz.3	-						MRPS27_uc003kca.3_Intron|MRPS27_uc011cse.1_Intron|MRPS27_uc010iza.2_Intron|MRPS27_uc010iyz.1_Intron	NM_015084	NP_055899	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27							mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		CCTTACAAACATTTTTCCCCCT	0.371													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73574711	73574711	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73574711delT								RGNEF (337298 upstream) : ENC1 (348524 downstream)																							ttctcctctctttctgaaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73617213	73617214	+	5'Flank	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73617213_73617214insT	uc003kdb.2	+											Homo sapiens, clone IMAGE:5170127, mRNA.																		CTGCCCTATCCTTTCGCCGGGT	0.480													4	2	---	---	---	---	
FAM169A	26049	broad.mit.edu	37	5	74096090	74096090	+	Intron	DEL	T	-	-	rs113346993		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74096090delT	uc003kdm.2	-						FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Intron	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049												0						TTTTTGTTTGTTTTTTTTTTG	0.284													4	3	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75447992	75447992	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75447992delC	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CAGGCAGTGGCCATGAGAAAG	0.483													4	2	---	---	---	---	
IQGAP2	10788	broad.mit.edu	37	5	75746170	75746170	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75746170delT	uc003kek.2	+							NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CCTAAAAGAATAAAAATGTTT	0.403													4	2	---	---	---	---	
IQGAP2	10788	broad.mit.edu	37	5	75980332	75980333	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75980332_75980333delAC	uc003kek.2	+						IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron|IQGAP2_uc010izw.1_Intron	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TCCATCCTTTACACACAGagta	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77287295	77287296	+	IGR	DEL	AT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77287295_77287296delAT								TBCA (215110 upstream) : AP3B1 (10855 downstream)																							CCATCTGAACATAAAAGACATG	0.446													4	2	---	---	---	---	
SCAMP1	9522	broad.mit.edu	37	5	77656642	77656643	+	Intron	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77656642_77656643delCT	uc003kfl.2	+						SCAMP1_uc010jaa.2_Intron|SCAMP1_uc011ctc.1_Intron|SCAMP1_uc011ctd.1_Intron|uc003kfk.2_5'Flank	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		GCGTCTGCCCCTCGGCTCCCCT	0.673													29	13	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81374841	81374841	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81374841delT	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		TTGCTTCTTGTTTAGCCCTCT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	83130238	83130239	+	IGR	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83130238_83130239delGT								HAPLN1 (113342 upstream) : EDIL3 (107887 downstream)																							TTTGGTGTGCGTGTGTGTGTGt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	87588167	87588168	+	Intron	INS	-	A	A	rs145272066	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87588167_87588168insA	uc003kjd.2	+						uc003kje.2_Intron					Homo sapiens cDNA clone IMAGE:4814828.																		ataacattctcaaattgcaaaa	0.000													4	7	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90099646	90099646	+	Intron	DEL	A	-	-	rs67562849		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90099646delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTGTTGTTATAAAAAAAAAAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90764604	90764604	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90764604delG								LOC100129716 (48073 upstream) : None (None downstream)																							TGGAATTTCTGAGGGTGCAGA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	91916374	91916375	+	IGR	INS	-	T	T	rs140767484	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91916374_91916375insT								None (None upstream) : FLJ42709 (828690 downstream)																							TTGTTTCTTTCTTTCTTTTTTT	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92280533	92280533	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92280533delA								None (None upstream) : FLJ42709 (464532 downstream)																							TGCTATGCTGAAAAAGCCTAC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92373690	92373690	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92373690delG								None (None upstream) : FLJ42709 (371375 downstream)																							AGTGTCATCTGGCTGGGAGAA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95147869	95147869	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95147869delG								RHOBTB3 (15800 upstream) : GLRX (1685 downstream)																							AATTTTCCATGTTGAGGGTTC	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97074729	97074730	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97074729_97074730insT								RIOK2 (555724 upstream) : None (None downstream)																							ACTCTAAAAGCTTTTTTTTTTA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99467153	99467154	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99467153_99467154insT								None (None upstream) : LOC100133050 (248055 downstream)																							atatctacttcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	100949416	100949416	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100949416delT								ST8SIA4 (710429 upstream) : SLCO4C1 (620278 downstream)																							tatgtgcccctgcaacatcac	0.025													4	2	---	---	---	---	
SLCO6A1	133482	broad.mit.edu	37	5	101735091	101735091	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101735091delA	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TAAGTTAGCTAAAAGAGAAAT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	104066327	104066327	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104066327delC								None (None upstream) : RAB9BP1 (368848 downstream)																							GGACATGATACCATGGTATGA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	104236012	104236012	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104236012delT								None (None upstream) : RAB9BP1 (199163 downstream)																							tttacagaaatttttttacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	108933041	108933041	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108933041delA								PJA2 (187366 upstream) : MAN2A1 (92115 downstream)																							AGAACATGCTAAAAACAGGAG	0.443													4	2	---	---	---	---	
TMEM232	642987	broad.mit.edu	37	5	109805178	109805178	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109805178delG	uc011cvh.1	-						TMEM232_uc003kow.1_Intron|TMEM232_uc003kox.2_Intron|TMEM232_uc010jbs.2_Intron|TMEM232_uc003koy.3_Intron			C9JQI7	TM232_HUMAN	SubName: Full=cDNA FLJ54480;							integral to membrane					0						cattcctcctggggaaatggt	0.000													4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112431206	112431206	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112431206delT	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		attatCATAATTTAGGTTTTC	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113487499	113487499	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113487499delA								YTHDC2 (556520 upstream) : KCNN2 (210517 downstream)																							AACTGTCTAGAAAAAAAAAAT	0.363													3	5	---	---	---	---	
COMMD10	51397	broad.mit.edu	37	5	115556114	115556115	+	Intron	INS	-	T	T	rs150658149	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115556114_115556115insT	uc003krt.1	+							NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10								protein binding			ovary(1)	1		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		CCCTGTAATTCTTTCATTCCAT	0.381													2	4	---	---	---	---	
DMXL1	1657	broad.mit.edu	37	5	118510461	118510461	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118510461delT	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AGTTACTGCCTTTTATACCTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123513566	123513566	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123513566delC								CSNK1G3 (561104 upstream) : ZNF608 (459044 downstream)																							ACCACTTCTTCCTTTtgaagg	0.075													4	2	---	---	---	---	
MARCH3	115123	broad.mit.edu	37	5	126268620	126268620	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126268620delA	uc003kuf.2	-						MARCH3_uc011cxc.1_Intron	NM_178450	NP_848545	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		CCCCTTTCCTAACAACAAAGG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126523282	126523282	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126523282delA								FLJ44606 (114110 upstream) : MEGF10 (103174 downstream)																							ATCATAAAACAAAAAAAACCC	0.348													3	3	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127607500	127607500	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127607500delT	uc003kuu.2	-							NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AAAAACAAACTTTTTTTTTAA	0.303													4	2	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127866644	127866645	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127866644_127866645insC	uc003kuu.2	-						FBN2_uc003kuv.2_Intron|FBN2_uc003kuw.3_Intron|FBN2_uc003kux.1_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ccacactgttttccatagtggc	0.134													6	3	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127866649	127866649	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127866649delT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron|FBN2_uc003kuw.3_Intron|FBN2_uc003kux.1_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ctgttttccatagtggctgta	0.119													6	3	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130825550	130825550	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130825550delT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		tactataaacTTTTTTTTTTT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131139861	131139861	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131139861delG								RAPGEF6 (7105 upstream) : ACSL6 (2979 downstream)																							ggagccttaaggggaacaatg	0.000													4	2	---	---	---	---	
RAD50	10111	broad.mit.edu	37	5	131928108	131928108	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131928108delA	uc003kxi.2	+						RAD50_uc003kxh.2_Intron	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			aggaggagccaaatcaggact	0.000								Homologous_recombination					4	2	---	---	---	---	
FSTL4	23105	broad.mit.edu	37	5	132950911	132950912	+	5'Flank	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132950911_132950912delAG	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATACCCATTAGAAGCCAGACT	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133012798	133012798	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133012798delT								FSTL4 (64575 upstream) : C5orf15 (278401 downstream)																							ATAGTGCTTGTAAAACTGAAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134356491	134356492	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134356491_134356492insA								CATSPER3 (9106 upstream) : PITX1 (6933 downstream)																							TACCAACACTTAAAAAAAATTG	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134895433	134895433	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134895433delC								NEUROG1 (23794 upstream) : CXCL14 (10940 downstream)																							gtgcaggttacataaaacaat	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143000557	143000557	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143000557delC								NR3C1 (185480 upstream) : HMHB1 (191169 downstream)																							tctttctgttcccaggacctg	0.289													4	2	---	---	---	---	
SH3TC2	79628	broad.mit.edu	37	5	148110435	148110435	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148110435delT	uc003lpp.1	-							NM_024577		Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGGGGGATTGGCAAAAGT	0.473											OREG0016903	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ABLIM3	22885	broad.mit.edu	37	5	148613755	148613755	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148613755delA	uc003lpy.2	+						ABLIM3_uc003lpz.1_Intron|ABLIM3_uc003lqa.1_Intron|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Intron|ABLIM3_uc003lqd.1_Intron|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Intron	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3						axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tagttgggagaaggcatcccg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152523328	152523330	+	IGR	DEL	CCA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152523328_152523330delCCA								NMUR2 (738488 upstream) : GRIA1 (345845 downstream)																							acccaacttgccaccaccaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157580766	157580767	+	IGR	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157580766_157580767delTC								CLINT1 (294598 upstream) : EBF1 (542157 downstream)																							GGGAAGTGTGTCTGCACTTTTC	0.495													4	2	---	---	---	---	
GABRG2	2566	broad.mit.edu	37	5	161533317	161533318	+	Intron	DEL	AT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161533317_161533318delAT	uc003lyz.3	+						GABRG2_uc010jjc.2_Intron|GABRG2_uc003lyy.3_Intron|GABRG2_uc011dej.1_Intron	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		AATATTGTGAATAGCCTTCACA	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161614121	161614121	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161614121delA								GABRG2 (31577 upstream) : None (None downstream)																							aatgtctgctaaaaatctgct	0.000													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167447586	167447586	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167447586delT	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TTTCAGCAGCTTAGGTGGCAG	0.478													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168525918	168525919	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168525918_168525919delCA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTAGGAGGGTCACACACCTGGG	0.520													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168725774	168725775	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168725774_168725775delGA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			gcacgaccttgagtaaatgaca	0.119													4	2	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172583097	172583097	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172583097delC	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CACAGGGAGGCCAGTGTAAGC	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175475890	175475890	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175475890delG								THOC3 (80345 upstream) : FAM153B (11802 downstream)																							AGTATGTGTTGGGATCTGCAA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	176189679	176189679	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176189679delT								TSPAN17 (103621 upstream) : UNC5A (47881 downstream)																							agagtctatgTTTTTttttta	0.000													5	3	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178575507	178575508	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178575507_178575508delGA	uc003mjw.2	-							NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		gccctctgctgaggtcgcatcc	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16810816	16810817	+	IGR	DEL	GC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16810816_16810817delGC								ATXN1 (49095 upstream) : RBM24 (470992 downstream)																							tgtttatctggctgagagttat	0.000													4	2	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	25039336	25039336	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25039336delG	uc011dju.1	-							NM_015864	NP_056948	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						TATATAACTTGAGTCCCCAAG	0.328													4	2	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25604845	25604845	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25604845delA	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TCCTGACCGTAAACACAGAAT	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26357909	26357910	+	IGR	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26357909_26357910delTT								HIST1H4H (72147 upstream) : BTN3A2 (7488 downstream)																							tttttttttctttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27179720	27179720	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27179720delA								HIST1H2AH (64375 upstream) : PRSS16 (35788 downstream)																							CTTCCTGTCcaaaaaaaaaag	0.388													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27909901	27909902	+	IGR	DEL	AT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27909901_27909902delAT								OR2B2 (29804 upstream) : OR2B6 (15117 downstream)																							CCCAAATCTGATATATATATGT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28574225	28574226	+	IGR	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28574225_28574226insC								SCAND3 (19113 upstream) : TRIM27 (296554 downstream)																							CTCCATGGTTTCCTACAGATTG	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28651814	28651814	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28651814delA								SCAND3 (96702 upstream) : TRIM27 (218966 downstream)																							aaattagaagaaaagggtcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29653670	29653681	+	IGR	DEL	TTTGGGAAACAC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29653670_29653681delTTTGGGAAACAC								ZFP57 (4783 upstream) : HLA-F (37436 downstream)																							TCAGCGTGGATTTGGGAAACACTTCAGATTCC	0.542													4	2	---	---	---	---	
VARS	7407	broad.mit.edu	37	6	31752968	31752968	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31752968delC	uc003nxe.2	-						VARS_uc011doi.1_Intron	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase						translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	CTGTGGGGGTCCCACCCTGGG	0.607													4	2	---	---	---	---	
IP6K3	117283	broad.mit.edu	37	6	33697913	33697913	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33697913delC	uc010jvf.2	-						IP6K3_uc003ofb.2_Intron	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3						inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0						GTTTATTTCTCCCCCCAGCCA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33860685	33860685	+	5'Flank	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33860685delC	uc003ogi.1	-						uc003ogj.1_Intron|uc003ogl.3_5'Flank|uc011drw.1_5'Flank|uc003ogm.1_5'Flank|uc011dry.1_5'Flank					Homo sapiens cDNA FLJ33147 fis, clone UTERU2000218.																		GGGTTCCTGGCCCATGGCCCT	0.602													4	2	---	---	---	---	
BRPF3	27154	broad.mit.edu	37	6	36172807	36172808	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36172807_36172808insA	uc003olv.3	+						BRPF3_uc010jwb.2_Intron|BRPF3_uc011dtj.1_Intron|BRPF3_uc010jwc.2_Intron|BRPF3_uc011dtk.1_Intron	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3						histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						GAGAATTCTAGGGGAGAGTGGA	0.515													4	2	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39530248	39530248	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39530248delT	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TAGGCCTTAGTTTTTGATACC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42082159	42082168	+	IGR	DEL	TGGGCCCACA	-	-	rs5875792		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42082159_42082168delTGGGCCCACA								C6orf132 (9670 upstream) : GUCA1A (40976 downstream)																							CTTTcccacttgggcccacatgggcccaca	0.386													3	3	---	---	---	---	
GPR110	266977	broad.mit.edu	37	6	47012649	47012649	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47012649delA	uc003oyt.2	-						GPR110_uc003oyu.1_5'Flank	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						TGCTGGGGGGAAAAAAAAGAA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	47330853	47330854	+	IGR	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47330853_47330854delCA								TNFRSF21 (53173 upstream) : CD2AP (114671 downstream)																							tccccactaccacacacacaca	0.000													3	3	---	---	---	---	
PAQR8	85315	broad.mit.edu	37	6	52241647	52241647	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52241647delG	uc003pao.3	+							NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member						cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					AGGGATGAGTGGTGGTTGAGG	0.403													4	2	---	---	---	---	
GCLC	2729	broad.mit.edu	37	6	53371455	53371455	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53371455delA	uc003pbw.1	-						GCLC_uc003pbv.1_Intron	NM_001498	NP_001489	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit						anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding			ovary(1)|central_nervous_system(1)	2	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	ACTGAACAATAAAAAAAAAAA	0.303													6	4	---	---	---	---	
BMP5	653	broad.mit.edu	37	6	55639375	55639375	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55639375delA	uc003pcq.2	-						BMP5_uc011dxf.1_Intron	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATAACAATTTAAAAAAATATT	0.368													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57226694	57226694	+	Intron	DEL	A	-	-	rs887549	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57226694delA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CAAGGGTTATAGGGGGAAAAA	0.393													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57454042	57454042	+	Intron	DEL	G	-	-	rs67619850		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57454042delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ataaaagacaggatagtgtta	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58386108	58386108	+	IGR	DEL	A	-	-	rs146905857		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58386108delA								GUSBL2 (98384 upstream) : None (None downstream)																							AGGATTTCTGAAAAAAAAAAT	0.428													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66649146	66649149	+	IGR	DEL	AACA	-	-	rs150201090		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66649146_66649149delAACA								MCART3P (149771 upstream) : None (None downstream)																							CTAGCCAAAGAACAAACAGACAAA	0.098													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66770011	66770012	+	IGR	INS	-	AA	AA			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66770011_66770012insAA								MCART3P (270636 upstream) : None (None downstream)																							AAGAATCAGTTAGAAAATGGTG	0.416													4	2	---	---	---	---	
MTO1	25821	broad.mit.edu	37	6	74189234	74189234	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74189234delA	uc003pgy.3	+						MTO1_uc010kav.2_Intron|MTO1_uc003pgz.3_Intron|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Intron|MTO1_uc010kaw.1_5'Flank	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						taaaaacattaaaaaaaaaTT	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80518862	80518862	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80518862delG								RNY4 (67193 upstream) : ELOVL4 (105674 downstream)																							CAGCCTCAGAGACAGATTTCA	0.473													4	2	---	---	---	---	
IBTK	25998	broad.mit.edu	37	6	82911439	82911439	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82911439delT	uc003pjl.1	-						IBTK_uc011dyu.1_Intron|IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CAAGCAACTCttttttttttt	0.134													4	2	---	---	---	---	
IBTK	25998	broad.mit.edu	37	6	82936712	82936712	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82936712delT	uc003pjl.1	-						IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AAAGTATTACTTTTTTTAATC	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85699959	85699959	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85699959delA								TBX18 (226060 upstream) : NT5E (459343 downstream)																							ctgttttttgaaaaaaaataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95999846	95999846	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95999846delG								None (None upstream) : MANEA (25567 downstream)																							CCTGGTCTGAGGGGGACTTTC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	97981115	97981116	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97981115_97981116delGA	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																		aagacacactgaactgactgag	0.000													4	2	---	---	---	---	
FBXL4	26235	broad.mit.edu	37	6	99369862	99369863	+	Intron	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99369862_99369863delAG	uc003ppf.1	-						FBXL4_uc003ppg.1_Intron|FBXL4_uc003pph.1_Intron	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4						ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TCACAGGACTAGGGCACTCTAT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	101488225	101488225	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101488225delA								ASCC3 (159001 upstream) : GRIK2 (358680 downstream)																							aatttccaccaaaaaaaatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	101660841	101660841	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101660841delA								ASCC3 (331617 upstream) : GRIK2 (186064 downstream)																							GACTTCCTCTAACTGCCACAC	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	103726441	103726441	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103726441delA								None (None upstream) : None (None downstream)																							ggtcataactaaggctcagaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106288363	106288364	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106288363_106288364delAA								PREP (437394 upstream) : PRDM1 (245831 downstream)																							CATAGGGCCTAAAGAGCAGCTT	0.455													4	2	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109963904	109963904	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109963904delA	uc003ptn.2	-						AKD1_uc003ptr.3_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						gggatgtgagaaaaaaaaagt	0.040													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	111962785	111962786	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111962785_111962786delAA								TRAF3IP2 (35311 upstream) : FYN (19701 downstream)																							TTGGTTTTCTAACTTAGGGTAA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112907836	112907837	+	IGR	DEL	TA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112907836_112907837delTA								RFPL4B (235338 upstream) : None (None downstream)																							gtttgggttttattcttgtttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127744379	127744380	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127744379_127744380delTG								ECHDC1 (79625 upstream) : C6orf174 (15172 downstream)																							CATACTTTGCTGTGTGTGATCA	0.366													4	2	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128718505	128718505	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128718505delT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron|PTPRK_uc003qbm.3_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AATACTTATCTTTTTTTTTTC	0.229													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	137801713	137801713	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137801713delA								IFNGR1 (261146 upstream) : OLIG3 (11623 downstream)																							TAAGGGGTTTACATTCCAGTG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140860643	140860643	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140860643delA								None (None upstream) : None (None downstream)																							aaaatcccctaatcccactac	0.114													4	2	---	---	---	---	
ADAT2	134637	broad.mit.edu	37	6	143752193	143752194	+	Intron	INS	-	A	A	rs9496630	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143752193_143752194insA	uc003qjj.2	-							NM_182503	NP_872309	Q7Z6V5	ADAT2_HUMAN	deaminase domain containing 1						tRNA processing		hydrolase activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		CCAGACGAATTAAAAAAAAAGA	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145435450	145435451	+	IGR	INS	-	A	A	rs141892653	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145435450_145435451insA								UTRN (261282 upstream) : EPM2A (510995 downstream)																							CTTTCTTTGACAAAAAAAACAA	0.297													4	3	---	---	---	---	
C6orf103	79747	broad.mit.edu	37	6	147104091	147104092	+	Intron	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147104091_147104092delAG	uc010khx.2	+						C6orf103_uc003qlp.2_Intron|C6orf103_uc003qlq.2_Intron|C6orf103_uc003qlr.2_Intron	NM_024694	NP_078970	Q8N7X0	CAN7L_HUMAN	hypothetical protein LOC79747						oxygen transport|proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|heme binding|oxygen binding			central_nervous_system(2)|lung(1)	3		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.04e-08)|GBM - Glioblastoma multiforme(68;0.0113)		GACTGGAactaggggtatttaa	0.183													4	2	---	---	---	---	
IPCEF1	26034	broad.mit.edu	37	6	154568824	154568824	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154568824delA	uc003qpx.2	-						IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368	Q8WWN9	ICEF1_HUMAN	phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0						GCTGAACCTGAAAAAAAAAAA	0.403													7	7	---	---	---	---	
LPA	4018	broad.mit.edu	37	6	160956470	160956472	+	Intron	DEL	GTG	-	-	rs77010356		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160956470_160956472delGTG	uc003qtl.2	-							NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	ggtggtagtagtggtagtggtag	0.049													4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	161923203	161923203	+	Intron	DEL	T	-	-	rs6941948	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161923203delT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		ATCATGTCCATTTTGGGCCAT	0.269													4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162032305	162032306	+	Intron	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162032305_162032306delTC	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		AATCTGTGGGTCTAGAACTTAC	0.287													4	2	---	---	---	---	
QKI	9444	broad.mit.edu	37	6	163991477	163991477	+	Intron	DEL	T	-	-	rs67007203		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163991477delT	uc003qui.2	+						QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TGTTAACCAGTTTTTTTTTTT	0.284													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165120000	165120001	+	IGR	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165120000_165120001delTC								None (None upstream) : C6orf118 (573154 downstream)																							tctcctgctttctcaaaacctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165380184	165380184	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165380184delA								None (None upstream) : C6orf118 (312971 downstream)																							CTTCAACAGTAATATGGAAGT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168064390	168064390	+	IGR	DEL	C	-	-	rs4263560	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168064390delC								TCP10 (266392 upstream) : C6orf123 (120831 downstream)																							GTGAACAACACAAAAAAAACC	0.383													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169763473	169763475	+	IGR	DEL	ATA	-	-	rs144900569		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169763473_169763475delATA								THBS2 (109336 upstream) : WDR27 (93832 downstream)																							GACTGTTATGATAATGATTCCTG	0.350													4	2	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170059789	170059790	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170059789_170059790delCA	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc003qwz.1_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GGCCCCAGGCCACACACACACC	0.629													6	3	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2019369	2019370	+	Intron	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2019369_2019370delCC	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TGAAGCGGAGCCCAAGGGCTGC	0.663													4	2	---	---	---	---	
NUDT1	4521	broad.mit.edu	37	7	2290259	2290260	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2290259_2290260insT	uc003slp.1	+						NUDT1_uc003slq.1_Intron|NUDT1_uc003slr.1_Intron|NUDT1_uc003sls.1_Intron|NUDT1_uc003slt.1_Intron|NUDT1_uc003slu.1_Intron|NUDT1_uc003slv.1_Intron	NM_198949	NP_945187	P36639	8ODP_HUMAN	nudix-type motif 1 isoform p22						DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		cgcccggctaatttttttgtat	0.000								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					2	5	---	---	---	---	
WIPI2	26100	broad.mit.edu	37	7	5240192	5240193	+	Intron	INS	-	T	T	rs138666092	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5240192_5240193insT	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		ttttttgtttgtttttttttga	0.035													0	6	---	---	---	---	
CYTH3	9265	broad.mit.edu	37	7	6208863	6208863	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6208863delT	uc003spt.2	-						CYTH3_uc011jws.1_Intron	NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						TTGATGtttatttttttgaga	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	7769235	7769235	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7769235delC	uc011jxf.1	+											SubName: Full=cDNA FLJ54628; SubName: Full=HCG19535; SubName: Full=Hypothetical gene supported by AK027125;																		CTGGATTGTTCCCCAGACTTC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17431158	17431158	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17431158delA								AHR (45383 upstream) : SNX13 (399228 downstream)																							TAAAGCTTGTAAGAGAGAAAC	0.383													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21714659	21714659	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21714659delA	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						tctttcatctaaatgactgta	0.000									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24408245	24408245	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24408245delT								NPY (76768 upstream) : MPP6 (204840 downstream)																							tgcaactttatttagggtgtt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31296357	31296358	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31296357_31296358insT								ADCYAP1R1 (150046 upstream) : NEUROD6 (80724 downstream)																							cctgtggttgatttttttctgg	0.000													4	2	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	31954557	31954558	+	Intron	INS	-	AA	AA			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31954557_31954558insAA	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			CATCTGCCCCCAATATCTCCAT	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35568714	35568714	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35568714delA								TBX20 (275472 upstream) : HERPUD2 (103558 downstream)																							CTAACTGAATAAGATTTCATA	0.368													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	36898270	36898275	+	Intron	DEL	AGAGTC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36898270_36898275delAGAGTC	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						aaacagaagaagagtcagagtcagag	0.000													3	3	---	---	---	---	
LOC349114	349114	broad.mit.edu	37	7	39802285	39802285	+	Intron	DEL	G	-	-	rs34678307		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39802285delG	uc003thf.2	+							NR_026999				Homo sapiens cDNA FLJ40085 fis, clone TESTI2002993.												0						CACATCGGCTGTAAGACCCAT	0.423													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	51011087	51011087	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51011087delC								GRB10 (149928 upstream) : COBL (72823 downstream)																							ATAGACAAAACCCCAGACAGA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52391481	52391481	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52391481delT								None (None upstream) : POM121L12 (711868 downstream)																							tttcctcttcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56527180	56527180	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56527180delA								PSPH (343090 upstream) : DKFZp434L192 (36736 downstream)																							gatctgtgctaactctgggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66874270	66874270	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66874270delT								STAG3L4 (87758 upstream) : None (None downstream)																							AAACCTTACCTTTTTTTTTTC	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67088938	67088939	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67088938_67088939insA								STAG3L4 (302426 upstream) : None (None downstream)																							gtgctttaggcaaaaatcaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67308749	67308749	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67308749delG								STAG3L4 (522237 upstream) : None (None downstream)																							TCCCTGCTGTGGGAGATAAAA	0.388													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70775843	70775844	+	Intron	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70775843_70775844delAG	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CTGCTGGTGTAGAAGAGAATGG	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	74033699	74033699	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74033699delG								GTF2IRD1 (16781 upstream) : GTF2I (38331 downstream)																							CCTCCCTGTAGGTCATCCCCG	0.602													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74162130	74162131	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74162130_74162131insA	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_5'Flank	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						aactttgtctcaaaaaaaaaaa	0.134													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79648718	79648718	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79648718delC								MAGI2 (565828 upstream) : GNAI1 (115422 downstream)																							CAGGAGAGCACCATAGGTGGC	0.468											OREG0018151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79756025	79756025	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79756025delC								MAGI2 (673135 upstream) : GNAI1 (8115 downstream)																							AATTAAAGCACCACTCTTTCA	0.318													4	2	---	---	---	---	
CD36	948	broad.mit.edu	37	7	80283943	80283943	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80283943delT	uc003uhc.2	+						CD36_uc003uhd.3_Intron|CD36_uc011kgv.1_Intron|CD36_uc003uhe.3_Intron|CD36_uc003uhf.3_Intron|CD36_uc003uhg.3_Intron|CD36_uc003uhh.3_Intron	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						GAAATAAGCCTTTTTGGGAGC	0.318													4	2	---	---	---	---	
ANKIB1	54467	broad.mit.edu	37	7	92018654	92018654	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92018654delT	uc003ulw.2	+						ANKIB1_uc010lew.1_Intron	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTGGTTTTGTTTTTTTTTTG	0.308													3	3	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101839857	101839857	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101839857delT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TTGGTCTTGGTTTTTTTTTCC	0.463													8	4	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104490987	104490987	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104490987delC	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						ACCACTACCTCCAACACCCTG	0.368													4	2	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	108000692	108000692	+	Intron	DEL	A	-	-	rs148972023	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108000692delA	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						GTGAGAAGGGAAAAAAAAGAT	0.368													4	2	---	---	---	---	
CFTR	1080	broad.mit.edu	37	7	117181705	117181705	+	Intron	DEL	T	-	-	rs34560599		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117181705delT	uc003vjd.2	+						CFTR_uc011knq.1_Intron	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	AAGACATTCATTTTTTTTCTC	0.368									Cystic_Fibrosis				2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	118561223	118561223	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118561223delG								ANKRD7 (678441 upstream) : None (None downstream)																							attgtcttttgaaaatttgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123916278	123916278	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123916278delT	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																		TATTGCCTCCTTCCCACCTCC	0.502											OREG0018284	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124893214	124893214	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124893214delG	uc010lky.1	-											Homo sapiens chromosome 7 isolate HA_003154 mRNA sequence.																		atgaagtcatggggatagtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125049194	125049194	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125049194delT								POT1 (479157 upstream) : None (None downstream)																							ACTAGGTAAATAAAAGATAAC	0.254													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127651277	127651277	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127651277delG	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						GAAGCAAGAAGAGCTAGAAAT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128736164	128736165	+	IGR	DEL	TT	-	-	rs66837005		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128736164_128736165delTT								TPI1P2 (38871 upstream) : LOC407835 (30160 downstream)																							GGAATGAATCtttttttttttt	0.173													9	4	---	---	---	---	
NRF1	4899	broad.mit.edu	37	7	129369578	129369579	+	Intron	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129369578_129369579delTT	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						TTTTTCCCTCTTAATCAGCAAT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131677329	131677329	+	IGR	DEL	G	-	-	rs68157541		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131677329delG								PODXL (435953 upstream) : PLXNA4 (130763 downstream)																							CAGCAACTAAGGGGAAGCAGA	0.418													3	3	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	131810378	131810378	+	3'UTR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131810378delT	uc003vra.3	-	32					PLXNA4_uc003vqz.3_3'UTR	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						ttttgttttgttttttttAAA	0.428													4	2	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133173181	133173181	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133173181delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				CATCTTTTTCTTTTTCCTTCC	0.373													4	2	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133858050	133858050	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133858050delG	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						tggtgcaTATGTTTGTCCTCT	0.244													4	2	---	---	---	---	
TRIM24	8805	broad.mit.edu	37	7	138260804	138260804	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138260804delG	uc003vuc.2	+						TRIM24_uc003vub.2_Intron	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha						cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						accccaagctgggaagtatag	0.139													4	2	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138470489	138470490	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138470489_138470490delCA	uc003vug.2	-						ATP6V0A4_uc003vuh.2_Intron	NM_020632	NP_065683	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						cacacacacgcacacacacaca	0.307													4	2	---	---	---	---	
ZC3HAV1L	92092	broad.mit.edu	37	7	138711886	138711887	+	Intron	INS	-	CT	CT	rs139388624	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138711886_138711887insCT	uc003vum.1	-							NM_080660	NP_542391	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like												0						CTAAACAGCCCGACACTGGTAT	0.505													6	3	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138950807	138950807	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138950807delT	uc011kqr.1	+						UBN2_uc003vuv.2_Intron	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						TAGGAGATTCTTTTTTTTTTT	0.219													3	4	---	---	---	---	
HIPK2	28996	broad.mit.edu	37	7	139366491	139366492	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139366491_139366492delCA	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					TAAGGAGAGTCACAGCGTGCGG	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141241646	141241647	+	IGR	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141241646_141241647delCA								MRPS33 (526865 upstream) : AGK (9431 downstream)																							agcaactggtcacacttaacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	145570497	145570497	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145570497delA								None (None upstream) : CNTNAP2 (242956 downstream)																							agtatggctgaaaaaaaaaaa	0.060													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146849085	146849085	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146849085delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTAGTTATGGAAAAAAATGTG	0.353										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146913651	146913658	+	Intron	DEL	TATTTACA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146913651_146913658delTATTTACA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			acactaaacttatttacagtcttattta	0.000										HNSCC(39;0.1)			3	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154550948	154550948	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154550948delC	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTCACTGCTTCCCCAGTCTTC	0.527													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157864850	157864851	+	Intron	INS	-	C	C	rs150537994	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157864850_157864851insC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|uc003wnt.1_5'Flank	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ATTCAGTTGAACCTTTTGGTTC	0.297													2	4	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6491624	6491624	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6491624delA	uc003wqi.2	+						uc003wqm.2_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		acgtaaagctaaaaatgaaga	0.000													4	2	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	9990672	9990672	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9990672delC	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	ATCATGTTTTCCCACGGACTG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	16601020	16601020	+	IGR	DEL	T	-	-	rs72188266		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16601020delT								MSR1 (550720 upstream) : FGF20 (249314 downstream)																							AGTTTTGAGATTTTTTTTTAT	0.323													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21148156	21148157	+	IGR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21148156_21148157delAG								None (None upstream) : GFRA2 (401373 downstream)																							GCCTCTCATTAGCCACATGGCT	0.480													4	2	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25424745	25424746	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25424745_25424746insA	uc003xek.2	+							NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		CAAATCTGCTGAAAAAAAAAAG	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	28155185	28155185	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28155185delA								ELP3 (106518 upstream) : PNOC (19464 downstream)																							CAGGAGAGGGAAATGAGACGC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	31249839	31249839	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31249839delT								WRN (218563 upstream) : NRG1 (247429 downstream)																							acaattctggttataacagtg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37212442	37212442	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37212442delG								KCNU1 (418801 upstream) : ZNF703 (340859 downstream)																							ccaggagataggacttcaaca	0.159													4	2	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40594222	40594222	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40594222delA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			TGAGCAGAGGAAGGCTCGTGA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43394994	43394995	+	IGR	DEL	AG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43394994_43394995delAG								POTEA (176666 upstream) : None (None downstream)																							ATTGGGAGGCAGAGAGAGAAGT	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59085630	59085630	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59085630delT								FAM110B (23353 upstream) : UBXN2B (238193 downstream)																							catcgcgcacttcctccctgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59232343	59232343	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59232343delA								FAM110B (170066 upstream) : UBXN2B (91480 downstream)																							ATGTGATATGAAAAAAAACGA	0.164													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63531092	63531092	+	Intron	DEL	T	-	-	rs77877209		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63531092delT	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				TTGTGGTGGCTTTTTTTTTTC	0.363													4	2	---	---	---	---	
C8orf45	157777	broad.mit.edu	37	8	67795863	67795863	+	Intron	DEL	A	-	-	rs79553261		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67795863delA	uc003xwz.3	+						C8orf45_uc003xwv.2_Intron|C8orf45_uc011lev.1_Intron|C8orf45_uc011lew.1_Intron|C8orf45_uc011lex.1_Intron|C8orf45_uc003xwy.3_Intron	NM_173518	NP_775789	Q4G0Z9	CH045_HUMAN	minichromosome maintenance complex						DNA replication		ATP binding|DNA binding			ovary(1)	1	Breast(64;0.186)		Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)			atcctgtctcaaaaaaaaaaa	0.109													3	4	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72963342	72963342	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72963342delA	uc003xza.2	-						uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TGGCTATTATAATCATTGTTC	0.373													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78934071	78934072	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78934071_78934072delAA								None (None upstream) : PKIA (494264 downstream)																							TCAGAAAAAGAAAAAAAAAAAC	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81508156	81508156	+	IGR	DEL	T	-	-	rs112489078		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81508156delT								ZBTB10 (73548 upstream) : ZNF704 (42613 downstream)																							TTCACACCCATTTTTTTCTTT	0.294													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	82561018	82561018	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82561018delG								FABP12 (117468 upstream) : IMPA1 (8133 downstream)																							CAGAGGTCATGGGCTGTTGCT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94426300	94426302	+	IGR	DEL	CTA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94426300_94426302delCTA								C8orf83 (396399 upstream) : FAM92A1 (286471 downstream)																							ATCTGCATGCCTACTCTGACCCT	0.330													4	2	---	---	---	---	
PABPC1	26986	broad.mit.edu	37	8	101724540	101724540	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101724540delT	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron|PABPC1_uc003yju.2_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TATATCTACATGTATGAATTT	0.313													84	62	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106390293	106390294	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106390293_106390294delCA	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TATTATATGTCACTATGATTTT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	108746761	108746761	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108746761delG								ANGPT1 (236507 upstream) : RSPO2 (164784 downstream)																							gtttcctgttgggtttgtcca	0.000													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110417160	110417160	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110417160delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATAGCTGAATTATGATGCTT	0.254										HNSCC(38;0.096)			8	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	118490015	118490015	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118490015delG								SLC30A8 (301063 upstream) : MED30 (42950 downstream)																							ttataggccaggaggcaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122036700	122036700	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122036700delC								SNTB1 (212391 upstream) : HAS2 (588571 downstream)																							gtccgaTAGACCAGGGCCCAG	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122558116	122558116	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122558116delT								SNTB1 (733807 upstream) : HAS2 (67155 downstream)																							GCAGAGAAAGTGAGCTTGAGA	0.488													4	2	---	---	---	---	
FBXO32	114907	broad.mit.edu	37	8	124547336	124547337	+	Intron	INS	-	T	T	rs150174812	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124547336_124547337insT	uc003yqr.2	-						FBXO32_uc003yqq.2_5'Flank|FBXO32_uc010mdk.2_Intron	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1											skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ACACACAGCACTGTACTCTTCA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131060644	131060645	+	IGR	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131060644_131060645delCT								FAM49B (31747 upstream) : ASAP1 (3708 downstream)																							aatcgtgctgctcaagcgcttg	0.153													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134143264	134143264	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134143264delC	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ACAGCTTCAACAAGACCGGCA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134676758	134676758	+	IGR	DEL	T	-	-	rs35254543		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134676758delT								ST3GAL1 (92575 upstream) : ZFAT (813275 downstream)																							TGGTTCTCAGTTCTGTTGCCA	0.458													3	3	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141180755	141180756	+	Intron	INS	-	AA	AA			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141180755_141180756insAA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						ATGAGGATCAGAAAGAGCCTTA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143245906	143245906	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143245906delG								MIR1302-7 (378232 upstream) : NCRNA00051 (33811 downstream)																							AATgaaggatggaggatggac	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1965873	1965873	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1965873delA								DMRT2 (908320 upstream) : SMARCA2 (49469 downstream)																							ACGGAGGGAGAAAAAAAGTAA	0.264													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	3119342	3119342	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3119342delT								KIAA0020 (275212 upstream) : RFX3 (105307 downstream)																							CTGACTCTGATTTTTTTTTTA	0.368													3	3	---	---	---	---	
KIAA1432	57589	broad.mit.edu	37	9	5707956	5707956	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5707956delT	uc003zji.2	+						KIAA1432_uc003zjh.2_Intron|KIAA1432_uc003zjl.3_Intron	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a							integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		cctgggttcctccactgctgc	0.000													4	2	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6644125	6644125	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6644125delA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	GGTAAATAATAAAATTTGGAC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7600398	7600398	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7600398delT								KDM4C (424751 upstream) : C9orf123 (196095 downstream)																							ttcacacctgttagaatggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7741377	7741378	+	IGR	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7741377_7741378delTC								KDM4C (565730 upstream) : C9orf123 (55115 downstream)																							ttcggtactatcagtaatctac	0.000													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9206404	9206404	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9206404delG	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		agtgagagttgggggaggcaa	0.005										TSP Lung(15;0.13)			4	2	---	---	---	---	
SNAPC3	6619	broad.mit.edu	37	9	15433270	15433270	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15433270delA	uc003zlt.2	+						SNAPC3_uc011lmt.1_Intron|SNAPC3_uc003zlu.2_Intron	NM_001039697	NP_001034786	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|snRNA transcription|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding				0				GBM - Glioblastoma multiforme(50;2.15e-06)		tctggaacagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	16243125	16243125	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16243125delC								C9orf93 (271230 upstream) : BNC2 (166377 downstream)																							GACTTGTCCTCCCTGGCTATA	0.373													4	2	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20965666	20965666	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20965666delC	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		aaacattaagcccattgaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	22344351	22344352	+	IGR	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22344351_22344352delGG								CDKN2BAS (223260 upstream) : DMRTA1 (102488 downstream)																							atggagagttggaaacaatagt	0.163													4	2	---	---	---	---	
SMU1	55234	broad.mit.edu	37	9	33062301	33062302	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33062301_33062302insT	uc003zsf.1	-						SMU1_uc010mjo.1_Intron|SMU1_uc010mjp.1_Intron|SMU1_uc011lnu.1_Intron	NM_018225	NP_060695	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog							cytoplasm|nucleus				ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		AACCCCAACTATTTTTGGCCAT	0.460													4	2	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33513484	33513486	+	5'Flank	DEL	TGT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33513484_33513486delTGT	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						TTACCATGAGTGTAGAAAGAAAA	0.374													4	2	---	---	---	---	
VCP	7415	broad.mit.edu	37	9	35060143	35060143	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35060143delA	uc003zvy.2	-						VCP_uc003zvz.2_Intron|VCP_uc010mkh.1_Intron|VCP_uc010mki.1_Intron	NM_007126	NP_009057	P55072	TERA_HUMAN	valosin-containing protein						activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding			upper_aerodigestive_tract(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			agagagagagaaaaaaaaaat	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	37082483	37082483	+	Intron	DEL	A	-	-	rs67174182		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37082483delA	uc003zzp.1	+											Homo sapiens cDNA FLJ13634 fis, clone PLACE1011133.																		CTTGGGAGTCAACGTACAGGG	0.229													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38629223	38629224	+	IGR	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38629223_38629224delCA								C9orf122 (5948 upstream) : CNTNAP3 (443542 downstream)																							TGATGCATTCcacacacacaca	0.054													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460715	66460716	+	5'Flank	INS	-	T	T	rs58550614		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460715_66460716insT	uc004aeb.2	-						uc004aec.2_Intron					Homo sapiens cDNA clone IMAGE:3941306, partial cds.																		tgtatttgttgtttttggtgtc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66471063	66471064	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66471063_66471064insA								FAM74A4 (976677 upstream) : LOC442421 (25406 downstream)																							ttggagaagacaaaaaaataaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66477869	66477869	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66477869delA								FAM74A4 (983483 upstream) : LOC442421 (18601 downstream)																							aataaaccataaaaaaatctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68421945	68421945	+	IGR	DEL	A	-	-	rs74488106		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68421945delA								FAM27B (627756 upstream) : MIR1299 (580294 downstream)																							ccagctaattaaaaaatatat	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68424949	68424949	+	IGR	DEL	T	-	-	rs66909768		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68424949delT								FAM27B (630760 upstream) : MIR1299 (577290 downstream)																							ATTTAGAGCATTTTAACTATa	0.244													3	5	---	---	---	---	
ALDH1A1	216	broad.mit.edu	37	9	75653526	75653527	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75653526_75653527delCA	uc011lsh.1	-							NM_000689	NP_000680	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1A1						cellular aldehyde metabolic process|ethanol oxidation|xenobiotic metabolic process	cytosol	aldehyde dehydrogenase (NAD) activity|androgen binding|Ras GTPase activator activity|retinal dehydrogenase activity			ovary(3)|lung(1)	4					NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TTGCTTTCTTCAAAGATCAATT	0.431													4	2	---	---	---	---	
GCNT1	2650	broad.mit.edu	37	9	79081798	79081799	+	Intron	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79081798_79081799delCC	uc010mpf.2	+						GCNT1_uc010mpg.2_Intron|GCNT1_uc010mph.2_Intron|GCNT1_uc004akf.3_Intron	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein						protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						ttttctagtgccaagctttgtg	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81524765	81524766	+	IGR	INS	-	AG	AG			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81524765_81524766insAG								PSAT1 (579758 upstream) : TLE4 (662112 downstream)																							AAGACAGAGACAGAGAGAGAGA	0.252													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82333095	82333095	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82333095delT	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						GGGCTTTATCTTTTTTTTTTT	0.393													3	3	---	---	---	---	
FRMD3	257019	broad.mit.edu	37	9	86119811	86119811	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86119811delG	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						attgataaatgaatgaatTAA	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92740083	92740083	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92740083delA								LOC100129066 (405409 upstream) : DIRAS2 (632031 downstream)																							TGTCAACTGCAAACCTGAGAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92944459	92944460	+	IGR	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92944459_92944460delAC								LOC100129066 (609785 upstream) : DIRAS2 (427654 downstream)																							TTAGCCCCAGACAACCGTAGTG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93694066	93694067	+	IGR	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93694066_93694067insC								SYK (33233 upstream) : AUH (282032 downstream)																							AGCAGTAGTCACCCCTGCAGTA	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93917406	93917406	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93917406delG								SYK (256573 upstream) : AUH (58693 downstream)																							AATGGCAGCTGGGAGAGCACA	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94886011	94886011	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94886011delA								SPTLC1 (8321 upstream) : LOC100128076 (9105 downstream)																							ATTAATGATTaaaaaaaagaa	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	95566216	95566217	+	IGR	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95566216_95566217delGT								BICD2 (39133 upstream) : ANKRD19 (5676 downstream)																							gtgtgtgtgagtgtgtgagaga	0.089													5	4	---	---	---	---	
C9orf102	375748	broad.mit.edu	37	9	98739708	98739708	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98739708delT	uc004avu.2	+						uc010msa.1_Intron|uc011lun.1_Intron			Q5T890	RAD26_HUMAN	Homo sapiens cDNA, FLJ97452.						DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				TAGCTTTCTCTTTTATGATCA	0.378													4	2	---	---	---	---	
CDC14B	8555	broad.mit.edu	37	9	99314777	99314777	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99314777delT	uc004awj.2	-						CDC14B_uc004awk.2_Intron|CDC14B_uc004awl.2_Intron|CDC14B_uc004awi.2_Intron	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2						activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				tttccaaacattttttttttc	0.144													2	4	---	---	---	---	
ANP32B	10541	broad.mit.edu	37	9	100767635	100767636	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100767635_100767636insA	uc004aya.2	+							NM_006401	NP_006392	Q92688	AN32B_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32							cytoplasm|nucleus					0		Acute lymphoblastic leukemia(62;0.0559)				acagaaaatagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TGFBR1	7046	broad.mit.edu	37	9	101906758	101906758	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101906758delT	uc004azc.2	+						TGFBR1_uc004azd.2_Intron|TGFBR1_uc011lvc.1_Intron	NM_004612	NP_004603	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor I						activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding			lung(2)|ovary(1)	3		Acute lymphoblastic leukemia(62;0.0559)				AACTGATAACTTTTTTTTTGC	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102173013	102173013	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102173013delT								SEC61B (180113 upstream) : NR4A3 (411124 downstream)																							agtcagcatcttttttttttt	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102332950	102332951	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102332950_102332951insT								SEC61B (340050 upstream) : NR4A3 (251186 downstream)																							gcacaaggtgatttttttttag	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103150069	103150069	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103150069delT	uc004bau.2	+						uc004bav.1_Intron					Homo sapiens cDNA FLJ31789 fis, clone NT2RI2008656.																		cttttcctgctttccctttcc	0.000													4	2	---	---	---	---	
ALDOB	229	broad.mit.edu	37	9	104188531	104188531	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104188531delA	uc004bbk.2	-							NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate						fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GTCTTATTTTAAAATTTCTTT	0.204													4	2	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107588687	107588688	+	Intron	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107588687_107588688insC	uc004bcl.2	-							NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CTCCAAGATATCCCCCTGCTCT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110196933	110196933	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110196933delT								RAD23B (102464 upstream) : KLF4 (50202 downstream)																							TGACATATGATTTTTTTTTTT	0.269													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111447775	111447776	+	IGR	INS	-	ACTC	ACTC	rs139600665	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111447775_111447776insACTC								None (None upstream) : ACTL7B (169095 downstream)																							GGAGGAAACTTAAATACATGGC	0.149													7	5	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	115985342	115985343	+	5'Flank	INS	-	A	A	rs34814598		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115985342_115985343insA	uc004bgs.2	-						FKBP15_uc010muu.1_Intron|SLC31A1_uc004bgu.2_Intron|SLC31A1_uc004bgv.3_Intron|FKBP15_uc011lxd.1_5'Flank|FKBP15_uc010mut.1_5'Flank|FKBP15_uc004bgt.2_5'Flank	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						gccttttCTTTAAAAAAAAAAA	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122171341	122171341	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122171341delT								DBC1 (39602 upstream) : MIR147 (835916 downstream)																							CACTTAAGAGTTTAGGTTTTA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122340426	122340427	+	IGR	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122340426_122340427delGG								DBC1 (208687 upstream) : MIR147 (666830 downstream)																							TCCTCACCATGGAGACAAAACC	0.441													4	2	---	---	---	---	
C5	727	broad.mit.edu	37	9	123752240	123752240	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123752240delA	uc004bkv.2	-							NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	TGAAAGAAACAAAAAAAAAAA	0.358													4	3	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126310691	126310692	+	Intron	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126310691_126310692delTT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						TTTCATGAACTTTTCCTACAGA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	129306264	129306265	+	IGR	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129306264_129306265delGG								FAM125B (32565 upstream) : LMX1B (70483 downstream)																							aaaagaatgagggagaagaatc	0.040													4	2	---	---	---	---	
ZBTB43	23099	broad.mit.edu	37	9	129596298	129596298	+	3'UTR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129596298delA	uc004bql.2	+	3					ZBTB43_uc010mxf.2_3'UTR	NM_014007	NP_054726	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGAGAAGCTTAAAAAAAAAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130746486	130746487	+	IGR	DEL	TG	-	-	rs111563137		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130746486_130746487delTG								FAM102A (3991 upstream) : NAIF1 (77026 downstream)																							ATTAACATTTtgtgtgtgtgtg	0.208													4	2	---	---	---	---	
SLC27A4	10999	broad.mit.edu	37	9	131100883	131100884	+	5'Flank	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131100883_131100884delAA	uc004but.2	+						SLC27A4_uc004buu.2_5'Flank	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0						tccgtctcggaaaaaaaaaaaa	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132211859	132211859	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132211859delG								C9orf106 (126977 upstream) : C9orf50 (162647 downstream)																							GAGGCTCTTCGGGAGTCACAA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132280938	132280938	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132280938delT								C9orf106 (196056 upstream) : C9orf50 (93568 downstream)																							ttctgggatattttttttccc	0.005													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	136619137	136619140	+	IGR	DEL	AGCT	-	-	rs34153485		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136619137_136619140delAGCT								SARDH (14060 upstream) : VAV2 (7877 downstream)																							gaccccttagagctagctataagc	0.000													5	4	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136710946	136710946	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136710946delC	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GGATGCCAGTCCCAGCAGAGA	0.488													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137560318	137560319	+	Intron	INS	-	GAGA	GAGA	rs147930860	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137560318_137560319insGAGA	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TAGGGTAGCAGGAGAGAACAGC	0.297													4	2	---	---	---	---	
C9orf139	401563	broad.mit.edu	37	9	139923507	139923508	+	Intron	INS	-	A	A	rs78466644		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139923507_139923508insA	uc004ckp.1	+						ABCA2_uc011mel.1_5'Flank|ABCA2_uc011mem.1_5'Flank|ABCA2_uc004ckl.1_5'Flank|ABCA2_uc004ckm.1_5'Flank	NM_207511	NP_997394	Q6ZV77	CI139_HUMAN	hypothetical protein LOC401563												0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		TCAGTTTCCCCCCTGTGAATGG	0.629											OREG0019625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	7	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	463378	463380	+	Intron	DEL	TCA	-	-	rs66897425		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:463378_463380delTCA	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AAAGACGAACTCATCAGAGAACT	0.404													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2454704	2454704	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2454704delG								ADARB2 (674986 upstream) : PFKP (655048 downstream)																							GACTCTGCGTGGATTGTGCCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	7851909	7851910	+	IGR	INS	-	C	C			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7851909_7851910insC								ATP5C1 (2154 upstream) : TAF3 (8763 downstream)																							CTTGAAATTTTCCCCCAACTTC	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10567334	10567334	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10567334delT								None (None upstream) : SFTA1P (259068 downstream)																							ttttttgcaatttttttttag	0.000													4	2	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18116364	18116364	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18116364delG	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						aaaaaaaaaagaaaTCCCTCT	0.333													4	2	---	---	---	---	
SPAG6	9576	broad.mit.edu	37	10	22705259	22705259	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22705259delA	uc001iri.2	+						SPAG6_uc001irj.2_Intron|SPAG6_uc010qct.1_Intron|SPAG6_uc009xkh.2_Intron	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1						cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						tctctgtaataaaatattgtc	0.080													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24212570	24212571	+	Intron	INS	-	T	T	rs145991258	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24212570_24212571insT	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						aagccacaacaacaggtcacca	0.000													0	6	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24415887	24415887	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24415887delT	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						tgggtctctctttttgtttgc	0.000													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24787375	24787375	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24787375delA	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Intron|KIAA1217_uc001iry.2_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TCAGAGAATGAAGGAGCTATG	0.353													4	2	---	---	---	---	
ZNF438	220929	broad.mit.edu	37	10	31156116	31156116	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31156116delA	uc010qdz.1	-						ZNF438_uc001ivn.2_Intron|ZNF438_uc010qdy.1_Intron|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Intron|ZNF438_uc001ivp.3_Intron|ZNF438_uc010qea.1_Intron|ZNF438_uc010qeb.1_Intron|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				gctggcttttaaaaaaatatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45283899	45283900	+	IGR	DEL	CA	-	-	rs35293939		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45283899_45283900delCA								CXCL12 (403357 upstream) : TMEM72 (122864 downstream)																							TACCTCACGCcacacacacaca	0.257													4	2	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68978564	68978564	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68978564delT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						tccagcctggtttttcagttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69604923	69604923	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69604923delC								DNAJC12 (6986 upstream) : SIRT1 (39504 downstream)																							GAACAGAAGACCTGGGCCAGA	0.418													4	2	---	---	---	---	
KIAA0913	23053	broad.mit.edu	37	10	75558549	75558550	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75558549_75558550insA	uc009xrl.2	+						KIAA0913_uc001jve.2_Intron|KIAA0913_uc001jvf.2_Intron|KIAA0913_uc001jvh.2_Intron|KIAA0913_uc001jvi.2_Intron|KIAA0913_uc010qkr.1_Intron|KIAA0913_uc001jvj.2_Intron|KIAA0913_uc009xrn.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053								zinc ion binding			breast(1)	1	Prostate(51;0.0112)					TTGGAACTGGGACTATAACCTG	0.411													4	2	---	---	---	---	
LOC283050	283050	broad.mit.edu	37	10	80732895	80732896	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80732895_80732896delAC	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0						ACACAAACAGACACACACACAC	0.446													6	3	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	83798180	83798180	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83798180delT	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		atttttaccattttacccact	0.000													4	2	---	---	---	---	
LRIT1	26103	broad.mit.edu	37	10	85991413	85991413	+	3'UTR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85991413delC	uc001kcz.1	-	4						NM_015613	NP_056428	Q9P2V4	LRIT1_HUMAN	retina specific protein PAL							integral to endoplasmic reticulum membrane					0						agtttcttaaccccccacccc	0.000													4	2	---	---	---	---	
LIPF	8513	broad.mit.edu	37	10	90426739	90426739	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90426739delT	uc001kfg.1	+						LIPF_uc009xtk.2_Intron|LIPF_uc001kfh.1_Intron|LIPF_uc010qmt.1_Intron|LIPF_uc010qmu.1_Intron	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor						lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)		AATTAGAGGCTTTTTTTTTTT	0.353													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92805803	92805803	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92805803delC								ANKRD1 (124771 upstream) : NUDT9P1 (105958 downstream)																							acatcaaactccatctcttga	0.104													4	2	---	---	---	---	
C10orf4	118924	broad.mit.edu	37	10	95458560	95458560	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95458560delA	uc001kiz.1	-						C10orf4_uc001kiv.1_Intron|C10orf4_uc001kja.1_Intron|C10orf4_uc001kjb.1_Intron|C10orf4_uc009xuh.1_Intron	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein							nucleus	protein binding				0		Colorectal(252;0.122)				TATAGAGAACACAAACCACAG	0.109													4	2	---	---	---	---	
PLCE1	51196	broad.mit.edu	37	10	95996613	95996614	+	Intron	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95996613_95996614delCT	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				CTTAATCTCCCTCTCTCTCTCT	0.337													4	2	---	---	---	---	
DNMBP	23268	broad.mit.edu	37	10	101639372	101639373	+	Intron	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101639372_101639373delTG	uc001kqj.2	-						DNMBP_uc010qpl.1_Intron|DNMBP_uc001kqg.2_Intron|DNMBP_uc001kqh.2_Intron	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AGGAATAGCCTGTGAAGTATCA	0.396													4	2	---	---	---	---	
C10orf26	54838	broad.mit.edu	37	10	104575412	104575413	+	3'UTR	INS	-	TT	TT	rs141934086	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104575412_104575413insTT	uc001kwe.3	+	4					C10orf26_uc001kwf.3_3'UTR|C10orf26_uc009xxg.1_Intron	NM_017787	NP_060257	Q9NX94	OPA1L_HUMAN	hypothetical protein LOC54838 isoform 2							integral to membrane				central_nervous_system(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;6.14e-09)|all cancers(201;1.66e-07)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TTCCTTCCACCTTTTTTTATTT	0.460													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112189372	112189373	+	IGR	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112189372_112189373delCA								SMNDC1 (124665 upstream) : DUSP5 (68252 downstream)																							cctgcgtcatcactcccgtgtc	0.173													4	2	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112358801	112358801	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112358801delA	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CAAAGAGCTTAAAAAAAAAAA	0.234													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	118913386	118913386	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118913386delT								VAX1 (15574 upstream) : KCNK18 (43614 downstream)																							GTGGAATGACTTTTTTttcat	0.030													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121059307	121059308	+	Intron	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121059307_121059308delTG	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		TTTAAGCAGAtgtgtgtgtgtg	0.267													2	4	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127583269	127583269	+	Intron	DEL	C	-	-	rs10709545		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127583269delC	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AATACTAATGCTAATCCTTTA	0.303													2	5	---	---	---	---	
ADAM12	8038	broad.mit.edu	37	10	127841158	127841158	+	Intron	DEL	A	-	-	rs1674908	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127841158delA	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		ctttttttttaattaagattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	129573920	129573921	+	IGR	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129573920_129573921delAC								FOXI2 (34470 upstream) : CLRN3 (102193 downstream)																							acaaaacaatacacacacacac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134825137	134825138	+	IGR	DEL	TG	-	-	rs146580658		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134825137_134825138delTG								C10orf93 (69073 upstream) : GPR123 (59295 downstream)																							gcttgtgtgatgtgttttcgtg	0.000													3	4	---	---	---	---	
SCGB1C1	147199	broad.mit.edu	37	11	190325	190326	+	5'Flank	DEL	CA	-	-	rs77529988		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:190325_190326delCA	uc001loa.1	+							NM_145651	NP_663626	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		gtcagagcgccagttattaagc	0.000													4	4	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1261806	1261806	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1261806delG	uc009ycr.1	+						MUC5B_uc001ltb.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AATGATTGATGGGATACCCCA	0.617													4	2	---	---	---	---	
ST5	6764	broad.mit.edu	37	11	8763875	8763875	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8763875delT	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Intron	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		tgccattaaattttttttttg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	10928123	10928123	+	IGR	DEL	G	-	-	rs78375949		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10928123delG								ZBED5 (48503 upstream) : GALNTL4 (364298 downstream)																							agctgtcactggggagaaatg	0.139													2	4	---	---	---	---	
USP47	55031	broad.mit.edu	37	11	11977960	11977961	+	3'UTR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11977960_11977961insA	uc001mjs.2	+	28					USP47_uc001mjr.2_3'UTR|USP47_uc009ygi.2_3'UTR	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47						base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		TGCAAAAAAATAAAAAAAAACA	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13163020	13163021	+	IGR	DEL	AG	-	-	rs141719686		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13163020_13163021delAG								RASSF10 (130373 upstream) : ARNTL (136304 downstream)																							CACATTTTTCAGAGTGAGGCCA	0.465													4	2	---	---	---	---	
ARNTL	406	broad.mit.edu	37	11	13373589	13373590	+	Intron	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13373589_13373590insG	uc001mkr.2	+						ARNTL_uc001mko.2_Intron|ARNTL_uc001mkp.2_Intron|ARNTL_uc001mkq.2_Intron|ARNTL_uc001mks.2_Intron|ARNTL_uc001mkt.2_Intron|ARNTL_uc001mku.2_Intron|ARNTL_uc009ygm.1_Intron|ARNTL_uc001mkv.1_Intron|ARNTL_uc001mkw.2_5'Flank	NM_001178	NP_001169	O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear						circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)		aggattgggctggggtgagggt	0.000													4	2	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14854498	14854498	+	Intron	DEL	T	-	-	rs80137325		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14854498delT	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TGAAAttttcttttttttttt	0.129													9	4	---	---	---	---	
PRMT3	10196	broad.mit.edu	37	11	20514794	20514794	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20514794delA	uc001mqb.2	+						PRMT3_uc001mqc.2_Intron|PRMT3_uc010rdn.1_Intron	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1								zinc ion binding				0						TTTTTTCAGGAAAAAAAAAAT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22622771	22622771	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22622771delA								SLC17A6 (221727 upstream) : FANCF (21308 downstream)																							atacaaaaacaaaaaaactca	0.000													4	2	---	---	---	---	
LGR4	55366	broad.mit.edu	37	11	27414258	27414259	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27414258_27414259insT	uc001mrj.3	-						LGR4_uc001mrk.3_Intron	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						TGTCTCTAGAATTTTTTTTTAA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	29476141	29476141	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29476141delG								None (None upstream) : KCNA4 (555625 downstream)																							GCTGCCTTCAGGAATGTGTGA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44520309	44520310	+	IGR	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44520309_44520310delGA								ALX4 (188593 upstream) : CD82 (66831 downstream)																							gggtggtctggaaagttctgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45737875	45737877	+	5'Flank	DEL	TCC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45737875_45737877delTCC	uc001nas.1	-						uc010rge.1_5'Flank|uc010rgf.1_5'Flank|uc010rgg.1_5'Flank|uc001nau.2_5'Flank					DQ599087																		GCAGTCTTTTTCCTCACTGCCTT	0.473													4	2	---	---	---	---	
PHF21A	51317	broad.mit.edu	37	11	46015731	46015731	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46015731delA	uc001ncc.3	-						PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Intron	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						CTTCAATTTTAAAAATGGAAT	0.358													4	2	---	---	---	---	
AMBRA1	55626	broad.mit.edu	37	11	46439743	46439743	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46439743delT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		tttttttttcttttttttcta	0.169													6	3	---	---	---	---	
MYBPC3	4607	broad.mit.edu	37	11	47356117	47356117	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47356117delT	uc001nfa.3	-							NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac						cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		CTTTCTGCACttttttttttt	0.249													0	6	---	---	---	---	
SPRYD5	84767	broad.mit.edu	37	11	55655356	55655357	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55655356_55655357insA	uc010rip.1	+						SPRYD5_uc010riq.1_Intron	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5							intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TATTAGTACAGAAAAAAAAATA	0.277													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56241756	56241756	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56241756delA								OR5M3 (3783 upstream) : OR5M8 (16155 downstream)																							ACATTCCCACAAAAAAAATGT	0.333													4	2	---	---	---	---	
VWCE	220001	broad.mit.edu	37	11	61057213	61057213	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61057213delA	uc001nra.2	-						VWCE_uc001nrb.2_Intron	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains							extracellular region	calcium ion binding			ovary(1)	1						aaagggcaggaaaaaaaactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61751624	61751624	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61751624delA								FTH1 (16492 upstream) : INCENP (139821 downstream)																							CCCTTCTGttatttttttttt	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64745003	64745003	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64745003delA								C11orf85 (5446 upstream) : BATF2 (10414 downstream)																							AGACACAAGGAGGAAAGCTTG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65678401	65678402	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65678401_65678402insA								FOSL1 (10404 upstream) : C11orf68 (5882 downstream)																							ctgtgtctactaaaaatacaaa	0.000													4	2	---	---	---	---	
SPTBN2	6712	broad.mit.edu	37	11	66490676	66490676	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66490676delA	uc001ojd.2	-							NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2						actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TGCTGGGGATAAAAAAAAAAA	0.413													3	4	---	---	---	---	
PPFIA1	8500	broad.mit.edu	37	11	70136402	70136402	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70136402delG	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCAGAACTTTGTAAAAATGTA	0.219													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70599279	70599279	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70599279delA	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			cagaactgttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLCO2B1	11309	broad.mit.edu	37	11	74898890	74898890	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74898890delA	uc001owb.2	+						SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_Intron|SLCO2B1_uc001owc.2_Intron|SLCO2B1_uc001owd.2_Intron	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	tgattttcctaaaaatgttgg	0.109													3	3	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78611102	78611102	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78611102delC	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						tcaaatgagtccagttgccag	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79242187	79242189	+	IGR	DEL	GCC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79242187_79242189delGCC								ODZ4 (90492 upstream) : None (None downstream)																							AATTTTTTTTGCCCTTTTTTGGC	0.276													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	80631765	80631765	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80631765delC								None (None upstream) : None (None downstream)																							tctctctgctccctgccatgt	0.000													4	2	---	---	---	---	
SYTL2	54843	broad.mit.edu	37	11	85463960	85463961	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85463960_85463961insA	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pbf.3_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTGCCTTCATTaaaaaaaaaaa	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87328531	87328531	+	IGR	DEL	A	-	-	rs72407216		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87328531delA								TMEM135 (293963 upstream) : RAB38 (517900 downstream)																							aaagaaaaggaaaaaaaaaaa	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	96860456	96860456	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96860456delA								JRKL (733729 upstream) : None (None downstream)																							atctaaatgcaatggagttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	97899197	97899197	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97899197delT								None (None upstream) : CNTN5 (992674 downstream)																							gagtttctacttttttttcct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	105132524	105132525	+	IGR	DEL	AG	-	-	rs72240257		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105132524_105132525delAG								CARD18 (122718 upstream) : GRIA4 (348275 downstream)																							ggagatagacagagagagagag	0.292													4	2	---	---	---	---	
KBTBD3	143879	broad.mit.edu	37	11	105943276	105943277	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105943276_105943277insT	uc001pja.2	-						KBTBD3_uc001pjb.2_Intron|KBTBD3_uc009yxm.2_Intron	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3											ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GATTGTTATTCTTTTTTTTAAA	0.208													4	2	---	---	---	---	
ARHGAP20	57569	broad.mit.edu	37	11	110565182	110565182	+	Intron	DEL	A	-	-	rs113748876		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110565182delA	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GCCTAACCATAAATGAATAAA	0.284													3	5	---	---	---	---	
C11orf1	64776	broad.mit.edu	37	11	111754317	111754317	+	Intron	DEL	A	-	-	rs77138369		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111754317delA	uc001pmd.2	+						C11orf1_uc001pme.2_Intron	NM_022761	NP_073598	Q9H5F2	CK001_HUMAN	hypothetical protein LOC64776							nucleus					0		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		actctatctcaaaaaaaaaaa	0.124													7	4	---	---	---	---	
C11orf71	54494	broad.mit.edu	37	11	114270517	114270518	+	3'UTR	INS	-	ACG	ACG			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114270517_114270518insACG	uc001pou.3	-	1					C11orf71_uc001pot.1_Intron|RBM7_uc001pov.2_5'Flank|RBM7_uc001pow.2_5'Flank|RBM7_uc001pox.2_5'Flank	NM_019021	NP_061894	Q6IPW1	CK071_HUMAN	hypothetical protein LOC54494												0		all_cancers(61;1.15e-11)|all_epithelial(67;5.3e-06)|all_hematologic(158;0.000303)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.6e-06)|Epithelial(105;4.31e-05)|all cancers(92;0.00036)		AAATCAATCAACTGTTACACTT	0.401													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115465664	115465665	+	IGR	INS	-	GT	GT	rs139734221	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115465664_115465665insGT								CADM1 (90423 upstream) : None (None downstream)																							AGAGAGAGAGAgtgtgtgtgtg	0.381													6	4	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118391366	118391366	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118391366delA	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		actccatctcaaaaaaaaaaG	0.194			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								4	2	---	---	---	---	
C2CD2L	9854	broad.mit.edu	37	11	118980056	118980056	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118980056delG	uc001pvo.2	+						DPAGT1_uc010ryz.1_5'Flank|C2CD2L_uc001pvn.2_Intron	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24							integral to membrane					0						CTCTCCAGGTGGGGCTGCGGT	0.507													4	2	---	---	---	---	
C2CD2L	9854	broad.mit.edu	37	11	118986572	118986572	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118986572delT	uc001pvo.2	+						C2CD2L_uc001pvn.2_Intron	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24							integral to membrane					0						TTCTTTTTTCTTTTTTTCACG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	120043045	120043045	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120043045delG								TRIM29 (34182 upstream) : OAF (38702 downstream)																							CGCTGATTCTGGGTTTTTTGT	0.537											OREG0021416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121569679	121569680	+	IGR	INS	-	T	T	rs144714664	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121569679_121569680insT								SORL1 (65208 upstream) : LOC399959 (390131 downstream)																							aaatctcagtgccccctcaaca	0.208													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126996588	126996588	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126996588delT								KIRREL3 (123233 upstream) : None (None downstream)																							CTTTCTTTTCTTTTTCTCCTG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127104441	127104441	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127104441delC								KIRREL3 (231086 upstream) : None (None downstream)																							AAGGAGCACTCCACCGGACTC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128527558	128527558	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128527558delA								ETS1 (70105 upstream) : FLI1 (28872 downstream)																							ccagccacccaaagctagcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129934090	129934090	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129934090delC								NCRNA00167 (58709 upstream) : APLP2 (5626 downstream)																							ACCATATTCTCCCAGGCCCAT	0.453													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131461068	131461068	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131461068delC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						CTCCTCCCAGCCCCCACCGCA	0.547													4	2	---	---	---	---	
KCNA6	3742	broad.mit.edu	37	12	4947565	4947565	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4947565delA	uc001qng.2	+							NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						ATGGCACCTTACACACACTGG	0.512										HNSCC(72;0.22)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5501899	5501899	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5501899delT								KCNA5 (345951 upstream) : NTF3 (39381 downstream)																							tttctctgcctttcccccagt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9288514	9288516	+	IGR	DEL	GTA	-	-	rs78822720		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9288514_9288516delGTA								A2M (19956 upstream) : PZP (12921 downstream)																							ACCTTTCTCTGTAGTAGATCTCG	0.365													4	2	---	---	---	---	
CLEC2B	9976	broad.mit.edu	37	12	10007522	10007523	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10007522_10007523delAC	uc001qwn.2	-							NM_005127	NP_005118	Q92478	CLC2B_HUMAN	C-type lectin, superfamily member 2							integral to plasma membrane	sugar binding				0						ATAGGTAAATACACACACATAC	0.282													4	2	---	---	---	---	
CLEC1B	51266	broad.mit.edu	37	12	10149204	10149204	+	Intron	DEL	T	-	-	rs67059054		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10149204delT	uc001qwu.2	-						CLEC1B_uc009zhd.2_Intron	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0						TGACCCACTATGTACCTGAGC	0.408													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14884749	14884749	+	IGR	DEL	T	-	-	rs56336205		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14884749delT								GUCY2C (35230 upstream) : HIST4H4 (36185 downstream)																							tggcttcccctgatgctgtgg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16425932	16425932	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16425932delT								DERA (235618 upstream) : MGST1 (74144 downstream)																							GAGTTTTAGGTTTTTTTTTTT	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27344133	27344133	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27344133delC								C12orf71 (108678 upstream) : STK38L (52945 downstream)																							CAGGGATGCTCATGCTACAAG	0.468													4	2	---	---	---	---	
OVCH1	341350	broad.mit.edu	37	12	29604964	29604964	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29604964delA	uc001rix.1	-							NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TCAGCTTGCTAAGTCCAAGGG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	42407814	42407814	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42407814delG								PDZRN4 (439430 upstream) : GXYLT1 (67836 downstream)																							TTAATTGGATGGGAGTTTAGT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53000188	53000188	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53000188delA								KRT72 (4866 upstream) : KRT73 (1167 downstream)																							AAGTCAAACCAAAAATATGGA	0.239													4	2	---	---	---	---	
OS9	10956	broad.mit.edu	37	12	58089309	58089309	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58089309delA	uc001spj.2	+						OS9_uc010srx.1_Intron|OS9_uc001spk.2_Intron|OS9_uc001spl.2_Intron|OS9_uc001spm.2_Intron|OS9_uc001spn.2_Intron|OS9_uc010sry.1_Intron|OS9_uc010srz.1_Intron	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum						ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ATAAGGATTTAAAAAATCTTT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60489444	60489444	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60489444delT								SLC16A7 (314037 upstream) : None (None downstream)																							CTGTCAGCAGTTTTTTTTTAT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63438955	63438956	+	IGR	INS	-	ACAC	ACAC	rs61922664	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63438955_63438956insACAC								PPM1H (110040 upstream) : AVPR1A (101260 downstream)																							cacacacacagacacacacaca	0.193													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	79251883	79251884	+	IGR	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79251883_79251884delGG								NAV3 (645095 upstream) : SYT1 (5889 downstream)																							aatatcagatgggggagagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80578401	80578401	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80578401delA								PPP1R12A (249166 upstream) : PTPRQ (259725 downstream)																							GAGCATTCCTAAAATTGAGAT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80750462	80750463	+	Intron	INS	-	TA	TA	rs138052341	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80750462_80750463insTA	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																		TCATATATATGTATATATATAT	0.228													4	2	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83147669	83147669	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83147669delG	uc001szt.2	+						TMTC2_uc001szr.1_Intron|TMTC2_uc001szs.1_Intron|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						TATATTAATTGGAAAACATTG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88369298	88369298	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88369298delC								None (None upstream) : C12orf50 (4518 downstream)																							GAAAGGTAGTCgtgttaggca	0.139													22	17	---	---	---	---	
EPYC	1833	broad.mit.edu	37	12	91364205	91364206	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91364205_91364206insT	uc001tbk.2	-							NM_004950	NP_004941	Q99645	EPYC_HUMAN	dermatan sulfate proteoglycan 3 precursor						female pregnancy	proteinaceous extracellular matrix	glycosaminoglycan binding			skin(1)	1						GACTTTCTCAATTTAAGCAAGG	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	101860918	101860920	+	IGR	DEL	AAC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101860918_101860920delAAC								ARL1 (59346 upstream) : SPIC (8279 downstream)																							CTAATTTTAAaacaacaacaaca	0.192													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	104749515	104749516	+	IGR	INS	-	C	C	rs138330943	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104749515_104749516insC								TXNRD1 (5457 upstream) : CHST11 (101233 downstream)																							aagtgcaaaggcctgaggcagc	0.000													4	2	---	---	---	---	
KIAA1033	23325	broad.mit.edu	37	12	105524491	105524492	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105524491_105524492insA	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						ATTCCTGCCCCCATACTATACA	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106424366	106424366	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106424366delC								C12orf75 (659071 upstream) : NUAK1 (32759 downstream)																							TGCACTACAGCCCCCAGCCTA	0.493													4	2	---	---	---	---	
BTBD11	121551	broad.mit.edu	37	12	107952415	107952416	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107952415_107952416insT	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3						cccgtgaaagatttgctgacct	0.104													4	2	---	---	---	---	
SSH1	54434	broad.mit.edu	37	12	109197265	109197265	+	Intron	DEL	G	-	-	rs140438459		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109197265delG	uc001tnm.2	-						SSH1_uc001tnl.2_Intron|SSH1_uc010sxg.1_Intron|SSH1_uc001tnn.3_Intron	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1						actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						GTTCCCAAGAGGGCAGACCCC	0.468											OREG0022099	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109626138	109626138	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109626138delA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	cttcccttccattgccttcct	0.000													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109626141	109626141	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109626141delG	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	cccttccattgccttcctgcc	0.000													4	2	---	---	---	---	
GIT2	9815	broad.mit.edu	37	12	110384815	110384815	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110384815delA	uc001tps.2	-						TCHP_uc001tpo.1_Intron|GIT2_uc001tpr.2_Intron|GIT2_uc001tpq.2_Intron|GIT2_uc001tpv.2_Intron|GIT2_uc001tpu.2_Intron|GIT2_uc001tpt.2_Intron|GIT2_uc010sxu.1_Intron	NM_057169	NP_476510	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting						regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	nucleoplasm	ARF GTPase activator activity|protein binding|zinc ion binding			central_nervous_system(1)	1						TGTGGGGGAGAAAAAAGCAGC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121405195	121405195	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121405195delT								SPPL3 (63044 upstream) : C12orf27 (2446 downstream)																							tggaatctgattttttttaac	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127428209	127428209	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127428209delC	uc001uho.2	-											Homo sapiens cDNA clone IMAGE:4829480.																		tatgcattttctcctgttaat	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130786485	130786486	+	IGR	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130786485_130786486delGA								FZD10 (136201 upstream) : PIWIL1 (36128 downstream)																							cgcagtttctgaacaggccaga	0.000													4	2	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131497082	131497082	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131497082delT	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GTATTTACAATTCCAGGAATA	0.512													4	2	---	---	---	---	
XPO4	64328	broad.mit.edu	37	13	21393350	21393351	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21393350_21393351insA	uc001unq.3	-							NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4						protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		TAACATGCTCCAAAAAAAAGTG	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23403797	23403798	+	IGR	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23403797_23403798delCT								None (None upstream) : SGCG (351262 downstream)																							TCTTTTCAGCCTCTCTCTCTCG	0.416													4	2	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25003724	25003724	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25003724delT	uc001upl.2	-							NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		cttatgacccttttatggttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28547856	28547856	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28547856delG								CDX2 (4539 upstream) : PRHOXNB (4387 downstream)																							TTACCACTCAGGGACCAGGCT	0.448													4	2	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	36134684	36134684	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36134684delA	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc010teg.1_Intron	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		atttttattgaaaagcccttg	0.085													4	2	---	---	---	---	
SMAD9	4093	broad.mit.edu	37	13	37424972	37424972	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37424972delT	uc001uvw.2	-						SMAD9_uc001uvx.2_Intron|SMAD9_uc010tep.1_Intron	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		gcaactccacttgaatgcaac	0.000													4	2	---	---	---	---	
C13orf15	28984	broad.mit.edu	37	13	42041817	42041818	+	Intron	DEL	GC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42041817_42041818delGC	uc001uyi.2	+							NM_014059	NP_054778	Q9H4X1	RGC32_HUMAN	response gene to complement 32						cell cycle|regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus					0		Lung NSC(96;7.5e-06)|Prostate(109;0.0181)|Breast(139;0.0204)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;8.62e-09)|Epithelial(112;8.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000504)|GBM - Glioblastoma multiforme(144;0.000909)|BRCA - Breast invasive adenocarcinoma(63;0.0679)		TTTCACTTTGGCAATAAGACAG	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	54147752	54147752	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54147752delT								OLFM4 (521566 upstream) : MIR1297 (738355 downstream)																							ATTCCTCAACTTTCTCTGTCC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63635652	63635652	+	IGR	DEL	A	-	-	rs67013280		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63635652delA								None (None upstream) : OR7E156P (675916 downstream)																							TGACTCACATAAAAATATTTA	0.289													3	3	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77720556	77720556	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77720556delA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		accaaaacttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87479690	87479690	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87479690delT								None (None upstream) : SLITRK5 (845180 downstream)																							aatcactgtatttggctcaaa	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87575359	87575359	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87575359delA								None (None upstream) : SLITRK5 (749511 downstream)																							tatttagaggaaagggggaga	0.015													4	2	---	---	---	---	
TGDS	23483	broad.mit.edu	37	13	95228830	95228830	+	Intron	DEL	A	-	-	rs116036564	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95228830delA	uc001vlw.2	-						TGDS_uc001vlx.2_Intron	NM_014305	NP_055120	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase						cellular metabolic process		coenzyme binding|dTDP-glucose 4,6-dehydratase activity|protein binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					GTATATATTTAAAAAAAAAAA	0.348													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	99788188	99788188	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99788188delA								DOCK9 (49528 upstream) : UBAC2 (64491 downstream)																							TATTAAGTGGAAAAAATTAAT	0.343													4	2	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101748268	101748269	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101748268_101748269delGA	uc001vox.1	-							NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					cttctccaaggaagatatgcaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107115617	107115617	+	IGR	DEL	A	-	-	rs34983965		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107115617delA								DAOA (972235 upstream) : EFNB2 (26481 downstream)																							AATCTGTGGCAAAAAAATGAG	0.428													4	2	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109360699	109360699	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109360699delT	uc001vqt.1	+						MYO16_uc010agk.1_Intron	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCAGGCATACTTTTTTAGAAG	0.308													4	2	---	---	---	---	
RAB20	55647	broad.mit.edu	37	13	111212581	111212581	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111212581delG	uc001vqy.2	-							NM_017817	NP_060287	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			CTCTTTACCTGGGGGACATTG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	113089068	113089069	+	IGR	DEL	TA	-	-	rs150605231	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113089068_113089069delTA								C13orf28 (67 upstream) : TUBGCP3 (50259 downstream)																							GGGTTTTTTTTAAAAAAAAGAA	0.322													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19830111	19830112	+	IGR	INS	-	CCT	CCT	rs142159711		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19830111_19830112insCCT								POTEG (245169 upstream) : P704P (153842 downstream)																							tgccacagatgcctcacctctc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19891045	19891046	+	Intron	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19891045_19891046delAC	uc001vvq.1	-						uc001vvr.1_Intron|uc010ahe.1_Intron					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		CTCCTTacatacacacacactc	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23100783	23100783	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23100783delT								ABHD4 (19526 upstream) : OXA1L (134948 downstream)																							ggcctttccctttttttctac	0.000													4	2	---	---	---	---	
SLC7A8	23428	broad.mit.edu	37	14	23600368	23600369	+	Intron	INS	-	T	T	rs78858410		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23600368_23600369insT	uc001wiz.2	-						SLC7A8_uc001wiw.2_5'Flank|SLC7A8_uc001wix.2_Intron|SLC7A8_uc010tnk.1_Intron|SLC7A8_uc010tnl.1_Intron|SLC7A8_uc001wiy.2_Intron|SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	AGGGAGATATATTTTTTTTGAG	0.510													4	2	---	---	---	---	
MYH7	4625	broad.mit.edu	37	14	23887642	23887642	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23887642delG	uc001wjx.2	-						MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ACCAGGAGGTGGGTTCAGCTT	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	24336496	24336496	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24336496delT								DHRS2 (221650 upstream) : C14orf165 (54963 downstream)																							ccttggcttattttttttatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	24755446	24755448	+	IGR	DEL	ACC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24755446_24755448delACC								RABGGTA (14643 upstream) : DHRS1 (4358 downstream)																							AGCCAGGGATACCACCACCACAG	0.537													4	2	---	---	---	---	
ARHGAP5	394	broad.mit.edu	37	14	32615162	32615162	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32615162delT	uc001wrl.2	+						ARHGAP5_uc001wrm.2_Intron|ARHGAP5_uc001wrn.2_Intron|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b						cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTGGTTGGGGTTTTTTTTTGG	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	43127774	43127774	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43127774delA								LRFN5 (754024 upstream) : None (None downstream)																							ACATTGAAGTAAAAAGATGTT	0.353													4	2	---	---	---	---	
PYGL	5836	broad.mit.edu	37	14	51404134	51404136	+	Intron	DEL	AGC	-	-	rs150372766		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51404134_51404136delAGC	uc001wyu.2	-						PYGL_uc010tqq.1_Intron|PYGL_uc001wyv.2_Intron|PYGL_uc001wyw.3_Intron	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1						glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	TGATTCTGATAGCAGAAGACTCA	0.320													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52805717	52805718	+	IGR	INS	-	CG	CG			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52805717_52805718insCG								PTGER2 (10397 upstream) : TXNDC16 (91591 downstream)																							CTACACACACACATaccaccac	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56367339	56367339	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56367339delT								C14orf34 (103947 upstream) : PELI2 (217754 downstream)																							tctggaacacttcctgaaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62331248	62331248	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62331248delG								SNAPC1 (68103 upstream) : SYT16 (122555 downstream)																							ATTATGATGTGGTAGAGATGA	0.657													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62577384	62577385	+	IGR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62577384_62577385insT								SYT16 (8957 upstream) : FLJ43390 (6690 downstream)																							TTAGGTTCTAATTTTTTTTTGT	0.347													4	2	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	65914909	65914911	+	Intron	DEL	TAC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65914909_65914911delTAC	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		GTGGAGCTGGTACTAGAAACCAT	0.424													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70930809	70930809	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70930809delA								ADAM21 (4188 upstream) : ADAM20 (58270 downstream)																							ctcagctactaacacaactct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	78591674	78591675	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78591674_78591675delTG								ADCK1 (191378 upstream) : NRXN3 (45253 downstream)																							AAACAGCCCCtgtgtgtgtgtg	0.252													3	3	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	80324289	80324289	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80324289delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GATTAATAACAAAATGGCAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	88118330	88118330	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88118330delC								None (None upstream) : GALC (185834 downstream)																							CACCACGCCACCCACAATTTC	0.373													4	2	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89193484	89193484	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89193484delA	uc001xxg.2	-							NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						gaataacagtaaagtccatgc	0.005													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92503561	92503561	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92503561delA	uc001xzy.2	-						TRIP11_uc001xzz.3_Intron	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TATAAGGAGCAAAAAAATTCA	0.333			T	PDGFRB	AML								4	2	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92917560	92917560	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92917560delG	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron|SLC24A4_uc001yan.2_5'Flank|uc001yal.1_5'Flank|uc001yam.1_5'Flank	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CTGGACGCCTGGAATTGGAGA	0.532													4	2	---	---	---	---	
ITPK1	3705	broad.mit.edu	37	14	93566883	93566884	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93566883_93566884delGA	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		agagaggagggagagagagaga	0.396													4	2	---	---	---	---	
C14orf132	56967	broad.mit.edu	37	14	96523027	96523027	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96523027delT	uc001yff.3	+							NR_023938				Homo sapiens clone 25027 mRNA sequence.												0						CTATTTTCTGTTTTTTTTGGT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99312267	99312267	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99312267delA								C14orf177 (128170 upstream) : BCL11B (323360 downstream)																							AAAATTACGCAAAAAAATTTG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101075779	101075779	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101075779delC								BEGAIN (39648 upstream) : C14orf70 (47826 downstream)																							ggagaagtagccccccagcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22007334	22007334	+	IGR	DEL	C	-	-	rs12908155		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22007334delC								LOC646214 (66595 upstream) : CXADRP2 (7086 downstream)																							ATCTTTAGCTCCCCCAGAGTA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22511509	22511510	+	IGR	DEL	AT	-	-	rs4779341	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22511509_22511510delAT								OR4N3P (97124 upstream) : MIR1268 (1719 downstream)																							GGCTACACACATGTCCCTAAGC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35332577	35332577	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35332577delA								ZNF770 (52123 upstream) : LOC723972 (196950 downstream)																							GGAGGACCATAAAAAATAGTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	42779811	42779811	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42779811delT								ZFP106 (15295 upstream) : SNAP23 (8024 downstream)																							TCCAGAGATATTTTTCAATTT	0.229													4	2	---	---	---	---	
SORD	6652	broad.mit.edu	37	15	45355457	45355457	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45355457delT	uc001zul.3	+						SORD_uc010uel.1_Intron|SORD_uc001zum.3_Intron|SORD_uc010bdz.2_Intron	NM_003104	NP_003095	Q00796	DHSO_HUMAN	sorbitol dehydrogenase						fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding				0		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	NADH(DB00157)	TTTGTATCTATTTTCTTTCTA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	47331371	47331372	+	IGR	INS	-	G	G	rs72576677		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47331371_47331372insG								None (None upstream) : SEMA6D (145031 downstream)																							GTATAAGCAAAAGTGACCTTTC	0.307													4	2	---	---	---	---	
DMXL2	23312	broad.mit.edu	37	15	51765114	51765114	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51765114delT	uc002abf.2	-						DMXL2_uc002abd.2_Intron|DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		acctcctctctttagaacaac	0.000													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53831844	53831845	+	Intron	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53831844_53831845delAA	uc002acj.2	-						WDR72_uc010bfh.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		AAACATTAGGAAAAAAAAAAAC	0.302													4	2	---	---	---	---	
PIGB	9488	broad.mit.edu	37	15	55612211	55612211	+	Intron	DEL	T	-	-	rs77286116		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55612211delT	uc002act.2	+						uc002acs.2_5'Flank|PIGB_uc010ugg.1_Intron	NM_004855	NP_004846	Q92521	PIGB_HUMAN	phosphatidylinositol glycan, class B						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity				0				all cancers(107;0.0255)		TAACCCACTCttttttttttg	0.333													9	4	---	---	---	---	
NARG2	79664	broad.mit.edu	37	15	60759180	60759181	+	Intron	INS	-	T	T	rs74550606		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60759180_60759181insT	uc002agp.2	-						NARG2_uc002ago.2_Intron|NARG2_uc010bgk.2_Intron|NARG2_uc002agr.1_Intron	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						GTCAAAAAAAAttttttttttt	0.139													4	2	---	---	---	---	
MAP2K5	5607	broad.mit.edu	37	15	68083660	68083660	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68083660delA	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						TATTTTCTCTAAGGCAGACTC	0.458													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71633456	71633456	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633456delT	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						tctctctcccttttttttttc	0.154													4	2	---	---	---	---	
C15orf27	123591	broad.mit.edu	37	15	76518530	76518530	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76518530delA	uc010bkp.2	+						ETFA_uc002bbt.2_Intron|ETFA_uc010bkq.1_Intron			Q2M3C6	CO027_HUMAN	RecName: Full=Transmembrane protein C15orf27;							integral to membrane					0						TTTGACTTACAAAAAAAATAT	0.264													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79802200	79802201	+	IGR	INS	-	CA	CA	rs145211227	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79802200_79802201insCA								KIAA1024 (37558 upstream) : MTHFS (335119 downstream)																							ACCCCTGACTTGAGAGGAAGGA	0.520													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	81680618	81680618	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81680618delA								TMC3 (14200 upstream) : MEX3B (653510 downstream)																							GATGAACTGCAAAAAAGTGGC	0.517													4	2	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85465189	85465189	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85465189delT	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TAGGTGAAAGTGACATTGGGC	0.433													4	2	---	---	---	---	
AP3S2	10239	broad.mit.edu	37	15	90418832	90418834	+	Intron	DEL	GAG	-	-	rs137991890		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90418832_90418834delGAG	uc002boq.3	-						AP3S2_uc002bos.3_Intron|AP3S2_uc010bns.2_Intron|AP3S2_uc002bor.3_Intron|AP3S2_uc010bnt.2_Intron	NM_005829	NP_005820	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2						intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			ATACACTTCTGAGGAGCATAATG	0.296											OREG0023464	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92809847	92809848	+	IGR	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92809847_92809848delCT								SLCO3A1 (94182 upstream) : ST8SIA2 (127292 downstream)																							GCCCTAGTGGCTCAGAATCCAG	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95415563	95415564	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95415563_95415564delTG								MCTP2 (388383 upstream) : LOC145820 (560758 downstream)																							actgttatgttgtagagaaagc	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	93482	93482	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:93482delT								None (None upstream) : POLR3K (3518 downstream)																							tgcctagcagtttattgtaga	0.060													4	2	---	---	---	---	
AXIN1	8312	broad.mit.edu	37	16	385674	385675	+	Intron	DEL	CA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:385674_385675delCA	uc002cgp.1	-						AXIN1_uc002cgq.1_Intron	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a						activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				ATGCCAGTACCACACACACCAG	0.366													4	2	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3802457	3802457	+	Intron	DEL	T	-	-	rs141045150		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3802457delT	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTTTTTCCTGTTTTTTTTTTT	0.299			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				4	4	---	---	---	---	
CORO7	79585	broad.mit.edu	37	16	4403921	4403921	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4403921delT	uc002cwf.2	-						CORO7_uc002cwe.2_Intron|TIMM16_uc002cwd.2_5'Flank	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						GTCCCACAGgtttttttgttt	0.269													4	2	---	---	---	---	
C16orf89	146556	broad.mit.edu	37	16	5108296	5108296	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5108296delT	uc010bud.2	-						ALG1_uc002cyj.2_Intron|C16orf89_uc002cyk.3_Intron	NM_152459	NP_689672	Q6UX73	CP089_HUMAN	hypothetical protein LOC146556 isoform 1							extracellular region				ovary(1)|skin(1)	2						gtccagctaattttttttttg	0.000													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7457548	7457548	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7457548delG	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TGGGGTGGTAGGGGCACAGTT	0.393													4	2	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8825490	8825490	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8825490delT	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	ATCACTTTTCTTTTTTttttt	0.219													4	2	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10779077	10779078	+	Intron	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10779077_10779078delTC	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						gtgcttgctttctctctctcct	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11019573	11019574	+	IGR	DEL	AC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11019573_11019574delAC								CIITA (734 upstream) : DEXI (3176 downstream)																							acacacacatacacacacacgc	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13362864	13362864	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13362864delA								SHISA9 (28592 upstream) : ERCC4 (651150 downstream)																							acatccaggtaaaaaaaaata	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13552732	13552732	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13552732delT								SHISA9 (218460 upstream) : ERCC4 (461282 downstream)																							ttgttttttgtttttttttta	0.090													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13910626	13910627	+	IGR	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13910626_13910627insG								SHISA9 (576354 upstream) : ERCC4 (103387 downstream)																							TGAAATCCAAAGGGGGAATATT	0.475													4	2	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17345984	17345984	+	Intron	DEL	A	-	-	rs111331165		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17345984delA	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						GTAATTGCAGAAAAAAAAAAG	0.328													1	5	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23161923	23161923	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23161923delA	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		TGGTTCCATTAAAAAAAAAAT	0.224													10	5	---	---	---	---	
LCMT1	51451	broad.mit.edu	37	16	25122853	25122853	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25122853delA	uc002dnx.1	+						LCMT1_uc002dny.1_5'Flank|LCMT1_uc002dnz.1_5'Flank|LCMT1_uc002doa.1_5'Flank|LCMT1_uc002dnw.1_5'Flank	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a								protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	CCAGACACCTAAGACTACGCT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31995575	31995576	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31995575_31995576delTG								ZNF267 (66949 upstream) : HERC2P4 (167034 downstream)																							GGGGAGAGCATGTGTGTGTGTG	0.609													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32152597	32152597	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32152597delA								ZNF267 (223971 upstream) : HERC2P4 (10013 downstream)																							TAAGGCACATAATGAGCAATT	0.318													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32550518	32550518	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32550518delC								HERC2P4 (386644 upstream) : TP53TG3B (134323 downstream)																							cttaaagaagctttctgagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32819123	32819125	+	IGR	DEL	TCA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32819123_32819125delTCA								TP53TG3B (130245 upstream) : SLC6A10P (69672 downstream)																							tcatttcatctcatcatttcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33051594	33051595	+	IGR	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33051594_33051595insG								SLC6A10P (155131 upstream) : MIR1826 (913913 downstream)																							ttcctttgattggtcctaattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33934022	33934023	+	IGR	INS	-	C	C	rs78524883	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33934022_33934023insC								None (None upstream) : MIR1826 (31485 downstream)																							CATACCAAAAACTTAAAATTTT	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	47763822	47763823	+	IGR	DEL	GT	-	-	rs751300	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47763822_47763823delGT								PHKB (28389 upstream) : ABCC12 (353061 downstream)																							GCGCGCGCGCGTGTGTGTGTGT	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53565216	53565217	+	IGR	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53565216_53565217delCC								AKTIP (28046 upstream) : RPGRIP1L (68606 downstream)																							TGGAAGGTGTCCTTGTCTGCTG	0.579													4	2	---	---	---	---	
RPGRIP1L	23322	broad.mit.edu	37	16	53660441	53660441	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53660441delC	uc002ehp.2	-						RPGRIP1L_uc002eho.3_Intron|RPGRIP1L_uc010vgy.1_Intron|RPGRIP1L_uc010cbx.2_Intron|RPGRIP1L_uc010vgz.1_Intron	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a						negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				TGTGggctggccgtggggact	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54650990	54650990	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54650990delT								IRX3 (330612 upstream) : IRX5 (314121 downstream)																							TCGGTTCCCGTTTTTTTTCCC	0.383											OREG0002605	type=REGULATORY REGION|Gene=IRX3-IRX5|Dataset=Vista Enhancers|EvidenceSubtype=In-vivo LacZ Expression Assay	2	4	---	---	---	---	
NUP93	9688	broad.mit.edu	37	16	56878052	56878053	+	Intron	INS	-	AG	AG			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56878052_56878053insAG	uc002eka.2	+						NUP93_uc002ekb.2_Intron|NUP93_uc010vhi.1_Intron	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						AGAAACCAGCCAGAGAGAGAGG	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64789336	64789336	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64789336delG								None (None upstream) : CDH11 (191349 downstream)																							ggacattgcaggggagaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	65771210	65771210	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65771210delA								LOC283867 (161007 upstream) : CDH5 (629315 downstream)																							TCAGGCACTCAATCAATTAAT	0.433													4	2	---	---	---	---	
CMTM1	113540	broad.mit.edu	37	16	66612550	66612550	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66612550delC	uc002epi.3	+						CMTM1_uc002epb.3_Intron|CMTM1_uc002epc.3_Intron|CMTM1_uc002epd.3_Intron|CMTM1_uc002epe.3_Intron|CMTM1_uc002epf.3_Intron|CMTM1_uc002epg.3_Intron|CMTM1_uc002eph.3_Intron|CMTM1_uc002epl.3_Intron|CMTM1_uc002epj.3_Intron|CMTM1_uc002epk.3_Intron|CMTM1_uc002epa.3_Intron|CMTM1_uc002epn.3_Intron|CMTM1_uc002epo.3_Intron|CMTM1_uc002epp.3_Intron|CMTM1_uc002epq.3_Intron|CMTM1_uc010cds.2_Intron|CMTM1_uc002epr.3_Intron|CMTM1_uc002epm.3_Intron|CMTM1_uc002eps.2_Intron|CMTM2_uc002ept.2_5'Flank|CMTM2_uc010cdu.2_5'Flank	NM_181269	NP_851786	Q8IZ96	CKLF1_HUMAN	chemokine-like factor superfamily 1 isoform 1						chemotaxis	extracellular space|integral to membrane	cytokine activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		ATCCCTTTTTCTGGGAAAGGC	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	71577907	71577907	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71577907delT								CHST4 (5494 upstream) : TAT (22847 downstream)																							cctttttttattttttttcct	0.169													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78872206	78872207	+	Intron	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78872206_78872207delGT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CAGAGTGACAGTGAACCAGGAA	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79386154	79386154	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79386154delT								WWOX (139591 upstream) : MAF (241592 downstream)																							GGGGAGACTCTTTTACCTGTT	0.468													4	2	---	---	---	---	
MBTPS1	8720	broad.mit.edu	37	16	84140061	84140061	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84140061delG	uc002fhi.2	-							NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						ccaagggtctggggaaacagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86031147	86031148	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86031147_86031148insA								IRF8 (74938 upstream) : LOC732275 (334308 downstream)																							gtggtggcatgaaatctgccaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87618038	87618039	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87618038_87618039insA								ZCCHC14 (92578 upstream) : JPH3 (17402 downstream)																							gtctgttatggttgaagagata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88344594	88344594	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88344594delT								BANP (233671 upstream) : ZNF469 (149285 downstream)																							agcctcctcctgcaccaggac	0.000													4	2	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	676750	676751	+	Intron	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:676750_676751delGT	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		gggtacatgggtgtgtgtgttt	0.089													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3826134	3826134	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3826134delA								P2RX1 (6174 upstream) : ATP2A3 (1035 downstream)																							ATTAGATACTAAGCCTTCATG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16904503	16904503	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16904503delA								TNFRSF13B (29101 upstream) : MPRIP (41604 downstream)																							TTTTCTCTGCAAAAAAGACGG	0.483													4	2	---	---	---	---	
MYO15A	51168	broad.mit.edu	37	17	18061472	18061473	+	Intron	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18061472_18061473insG	uc010vxh.1	+						MYO15A_uc010vxi.1_Intron|MYO15A_uc010vxk.1_Intron|MYO15A_uc010vxl.1_Intron|MYO15A_uc002gsl.2_5'Flank|MYO15A_uc010vxm.1_5'Flank|MYO15A_uc002gsm.1_5'Flank	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV						sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					ATCAGGACAATGGGGTCAGACC	0.624													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21349034	21349034	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21349034delT								KCNJ12 (25855 upstream) : C17orf51 (82538 downstream)																							aactctcaccttttttAAAAA	0.000													4	2	---	---	---	---	
C17orf63	55731	broad.mit.edu	37	17	27161544	27161544	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27161544delT	uc010wax.1	-						C17orf63_uc010way.1_Intron|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			tttccaatccttttttttgct	0.000													4	2	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30773562	30773562	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30773562delA	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TTTGTGGCATAAACGCACAGG	0.363													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31824779	31824779	+	Intron	DEL	A	-	-	rs116198523	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31824779delA	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	tttttcagataaaaaaaagga	0.164													4	2	---	---	---	---	
C17orf66	256957	broad.mit.edu	37	17	34189696	34189696	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34189696delT	uc002hke.1	-						C17orf66_uc010wck.1_Intron|C17orf66_uc010wcl.1_Intron|C17orf66_uc010wcm.1_Intron	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957								binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		ctgtgtgttgtttttgcacca	0.204													4	2	---	---	---	---	
HNF1B	6928	broad.mit.edu	37	17	36089957	36089958	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36089957_36089958insA	uc002hok.3	-						HNF1B_uc010wdi.1_Intron	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1						endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GTGTTTTCTGCCCTGCTCCCTG	0.579									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
ATXN7L3	56970	broad.mit.edu	37	17	42270017	42270018	+	3'UTR	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42270017_42270018insT	uc002iga.2	-	12					ATXN7L3_uc010wiv.1_3'UTR|ATXN7L3_uc002ifz.2_3'UTR	NM_001098833	NP_001092303	Q14CW9	AT7L3_HUMAN	ataxin 7-like 3 isoform b						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|metal ion binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ATCTGTTTGGCTTTTTAAAAAA	0.500													4	2	---	---	---	---	
LRRC37A2	474170	broad.mit.edu	37	17	44597373	44597374	+	Intron	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44597373_44597374delGT	uc002ikn.1	+						ARL17A_uc002iko.3_Intron	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor							integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GTGTGCTTGAGTGTGTGTGTGT	0.436													9	4	---	---	---	---	
GOSR2	9570	broad.mit.edu	37	17	45095277	45095277	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45095277delA	uc010wkh.1	+						uc010wki.1_5'Flank	NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			TCACTCCAACAAGAAGCCCCA	0.532													4	2	---	---	---	---	
CALCOCO2	10241	broad.mit.edu	37	17	46940630	46940631	+	3'UTR	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46940630_46940631delGT	uc002iof.2	+	13					CALCOCO2_uc010wlp.1_3'UTR|CALCOCO2_uc010wlq.1_3'UTR|CALCOCO2_uc010wlr.1_3'UTR|CALCOCO2_uc010wls.1_3'UTR	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						GAGGGTCTCAGTACAAGGGCCC	0.480													4	2	---	---	---	---	
PPM1E	22843	broad.mit.edu	37	17	57048297	57048297	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57048297delT	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			TATTCTATTCTTTTTTTCCTC	0.383													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64301000	64301001	+	Intron	INS	-	GGT	GGT	rs145199789	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64301000_64301001insGGT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	GGTTAAGAGGAGGTCAGCTGTG	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	67062637	67062637	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67062637delA								ABCA9 (5501 upstream) : ABCA6 (12210 downstream)																							GACAACATTTAAAAAGGGAAA	0.398													4	2	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67193525	67193525	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67193525delA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					GCTAAAATTGAAAaaaaaaag	0.219													3	3	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6132457	6132457	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6132457delC	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				GAATTCATCACCCCAGCAGCC	0.493													4	2	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13299844	13299844	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13299844delA	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		cctgtctcttaaaaaaaaaaG	0.224													3	3	---	---	---	---	
GREB1L	80000	broad.mit.edu	37	18	18929189	18929189	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18929189delT	uc010xam.1	+						GREB1L_uc002ktf.1_Intron|GREB1L_uc010dlp.1_Intron	NM_001142966	NP_001136438	Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast							integral to membrane					0						aattatgttattttttttttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	23477171	23477171	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23477171delT								ZNF521 (544957 upstream) : SS18 (119048 downstream)																							TCCTGTTTTGTTTTTTTTCTC	0.453													4	2	---	---	---	---	
DSC3	1825	broad.mit.edu	37	18	28602694	28602694	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28602694delT	uc002kwj.3	-						DSC3_uc002kwi.3_Intron	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein						homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TTGCTCACAGTTTAACACATT	0.274													4	3	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29848873	29848873	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29848873delT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTTCACTGGGTTTTTTTTTTA	0.284													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33082760	33082761	+	IGR	DEL	AA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33082760_33082761delAA								INO80C (4805 upstream) : GALNT1 (79017 downstream)																							CCAGATACTGAAAGAGGCAGCT	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36624950	36624950	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36624950delG								None (None upstream) : LOC647946 (161938 downstream)																							GTTAAATCATGGTAGTAGTCA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38187300	38187300	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38187300delA								LOC647946 (807018 upstream) : KC6 (872938 downstream)																							aaaacaaaacaaaaaaaaaaC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49365125	49365125	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49365125delT								MEX3C (641435 upstream) : DCC (501446 downstream)																							GATTAGCTtattttttttaat	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57446322	57446322	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57446322delG								CCBE1 (81678 upstream) : PMAIP1 (120870 downstream)																							CTTCTCTCTTGACTCATTAGA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60290616	60290616	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60290616delT								ZCCHC2 (36654 upstream) : PHLPP1 (92118 downstream)																							tagtctttaattttttcttcc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68544276	68544276	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68544276delC								SOCS6 (546842 upstream) : None (None downstream)																							aattccctagccccatgcccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71078547	71078547	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71078547delC								NETO1 (543737 upstream) : FBXO15 (662041 downstream)																							GTCATCCCTTCCCACAAAGCA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75198228	75198228	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75198228delG								GALR1 (216134 upstream) : None (None downstream)																							AAGTCATGCtggaaaagtgca	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76166962	76166962	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76166962delC								None (None upstream) : SALL3 (573313 downstream)																							AAGAGGGGCTCCCGGGAAGGG	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76408660	76408678	+	IGR	DEL	CACAGCCAAACCCAAAGAC	-	-	rs113272744	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76408660_76408678delCACAGCCAAACCCAAAGAC								None (None upstream) : SALL3 (331597 downstream)																							CCATGAACATCACAGCCAAACCCAAAGACCACAGCCATG	0.420													4	2	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77670552	77670552	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77670552delT	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		AATTTGAGCATTTTTTTCGCA	0.388													4	2	---	---	---	---	
C19orf34	255193	broad.mit.edu	37	19	1954126	1954127	+	5'UTR	INS	-	A	A	rs149176689	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1954126_1954127insA	uc002lum.2	-	2					CSNK1G2_uc002lul.3_Intron	NM_152771	NP_689984			chromosome 19 open reading frame 34												0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCTGATGCGTTAAACCCAT	0.624													2	9	---	---	---	---	
FSD1	79187	broad.mit.edu	37	19	4319984	4319985	+	Intron	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4319984_4319985delGG	uc002lzy.2	+						FSD1_uc002lzz.2_Intron|FSD1_uc002maa.2_Intron	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing						cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGGGGCCTGGGGAGGATCTC	0.525													4	2	---	---	---	---	
SAFB	6294	broad.mit.edu	37	19	5642481	5642481	+	Intron	DEL	A	-	-	rs66503750		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5642481delA	uc002mcf.2	+						SAFB_uc010xiq.1_Intron|SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		acaaacaaacaaaaaaaAAAA	0.144													6	4	---	---	---	---	
OR7G3	390883	broad.mit.edu	37	19	9237849	9237852	+	5'Flank	DEL	TCTT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9237849_9237852delTCTT	uc010xkl.1	-							NM_001001958	NP_001001958	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						tctttctttctctttctttctttc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	11192318	11192318	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11192318delT								SMARCA4 (19359 upstream) : LDLR (7739 downstream)																							CAGAACATTCTTTTTTTTTTC	0.443													4	2	---	---	---	---	
ECSIT	51295	broad.mit.edu	37	19	11617345	11617346	+	Intron	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11617345_11617346delTT	uc002msb.2	-						ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_Intron|ECSIT_uc010dyc.1_Intron|ECSIT_uc010dyd.2_Intron|ECSIT_uc010xma.1_Intron	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate						innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						TTCCACttcctttttttttttt	0.243													4	2	---	---	---	---	
DNAJB1	3337	broad.mit.edu	37	19	14628248	14628248	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14628248delA	uc002myz.1	-						DNAJB1_uc010xnr.1_Intron	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1						chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		GGAAGAGAAGAAAAAAAAAAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15700868	15700869	+	IGR	INS	-	CT	CT	rs138111403	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15700868_15700869insCT								CYP4F22 (37741 upstream) : CYP4F8 (25160 downstream)																							tgtatTACACCGTGTTGGCGAC	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21062544	21062581	+	IGR	DEL	CATTCACCACAGTGGCACCCTGTTCACTGTCACCAACT	-	-	rs73007025	byFrequency	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21062544_21062581delCATTCACCACAGTGGCACCCTGTTCACTGTCACCAACT								ZNF626 (218142 upstream) : ZNF85 (43499 downstream)																							GTGAGTCATGCATTCACCACAGTGGCACCCTGTTCACTGTCACCAACTCTTTCACCAC	0.471													3	3	---	---	---	---	
ZNF681	148213	broad.mit.edu	37	19	23928252	23928252	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23928252delT	uc002nrk.3	-						ZNF681_uc002nrl.3_Intron|ZNF681_uc002nrj.3_Intron	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AAGGCCCTAAttttttttttt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30331958	30331958	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30331958delT								CCNE1 (16740 upstream) : C19orf2 (82593 downstream)																							GATTTTTTGCTTTTTTTTCCC	0.368													4	2	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	30920132	30920132	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30920132delT	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					cagtcagcacttcctgagcac	0.413													4	2	---	---	---	---	
CCDC123	84902	broad.mit.edu	37	19	33454740	33454740	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33454740delA	uc002nty.2	-						CCDC123_uc010edg.2_Intron|CCDC123_uc002ntz.1_Intron|CCDC123_uc002nua.2_Intron|CCDC123_uc002nub.1_Intron	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)					CACCACTTTCAAAAACCTACA	0.299													4	2	---	---	---	---	
PEPD	5184	broad.mit.edu	37	19	33879985	33879985	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33879985delG	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron|PEPD_uc002nuq.3_5'Flank	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					CTGACTGTTTGGGGGCCAAGA	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34020959	34020959	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34020959delA								PEPD (8158 upstream) : CHST8 (91902 downstream)																							TGCCGTGATGAAATGACAGGA	0.393													4	2	---	---	---	---	
CHST8	64377	broad.mit.edu	37	19	34116774	34116774	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34116774delT	uc002nus.3	+						CHST8_uc002nut.3_Intron	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					tcaaaataaaTTTTTTTTTTT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42296193	42296193	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42296193delC								CEACAM6 (20080 upstream) : CEACAM3 (4341 downstream)																							GAAGACTTTTCCATTACTATG	0.488													4	2	---	---	---	---	
RPS19	6223	broad.mit.edu	37	19	42366105	42366108	+	Intron	DEL	ACTA	-	-	rs149774805		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42366105_42366108delACTA	uc002ort.2	+							NM_001022	NP_001013	P39019	RS19_HUMAN	ribosomal protein S19						endocrine pancreas development|erythrocyte differentiation|gas transport|positive regulation of cellular component movement|response to extracellular stimulus|ribosomal small subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						ACCGACCTTCACTAACTAAGGGGC	0.495									Diamond-Blackfan_Anemia				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45106659	45106660	+	IGR	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45106659_45106660delGA								CEACAM22P (46509 upstream) : PVR (40438 downstream)																							AGAACCAACTGAGAGAGAGAGA	0.322													4	2	---	---	---	---	
EHD2	30846	broad.mit.edu	37	19	48233069	48233070	+	Intron	DEL	TC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48233069_48233070delTC	uc002phj.3	+						EHD2_uc010xyu.1_Intron|EHD2_uc010xyv.1_Intron	NM_014601	NP_055416	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CTCTGCAGTGtctctctctctc	0.317													4	2	---	---	---	---	
BSPH1	100131137	broad.mit.edu	37	19	48484530	48484530	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48484530delT	uc002phs.1	-							NM_001128326	NP_001121798	Q075Z2	BSPH1_HUMAN	bovine seminal plasma protein-like 1 precursor						single fertilization	extracellular region					0						ACACTATAGGTTTTTATTTCT	0.318													4	2	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50752697	50752697	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50752697delT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ggtctctgcctctctgtctct	0.000													9	4	---	---	---	---	
NAPSB	256236	broad.mit.edu	37	19	50839091	50839091	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50839091delG	uc002prw.2	-						NR1H2_uc002prv.3_Intron	NR_002798				Homo sapiens napsin B pseudogene, mRNA sequence.											central_nervous_system(1)	1						CCAGGTGGGTGGGGCTTCGTG	0.493													4	2	---	---	---	---	
MYBPC2	4606	broad.mit.edu	37	19	50952875	50952875	+	Intron	DEL	A	-	-	rs1880920		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50952875delA	uc002psf.2	+							NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		accggcagggaaaagcctctg	0.169													4	2	---	---	---	---	
TTYH1	57348	broad.mit.edu	37	19	54929199	54929200	+	Intron	INS	-	AT	AT	rs78924771	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54929199_54929200insAT	uc002qfq.2	+						TTYH1_uc010yey.1_Intron|TTYH1_uc002qfr.2_Intron|TTYH1_uc002qft.2_Intron|TTYH1_uc002qfu.1_5'Flank	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1						cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		cacacacacacacTGTGCCACT	0.455													4	3	---	---	---	---	
NAT14	57106	broad.mit.edu	37	19	55998035	55998035	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55998035delG	uc002qle.1	+	3	413	c.333delG	c.(331-333)CTGfs	p.L111fs	SSC5D_uc002qlg.3_5'Flank	NM_020378	NP_065111	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14	111	N-acetyltransferase.				positive regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	integral to membrane|nucleus	DNA binding|N-acetyltransferase activity			central_nervous_system(1)|pancreas(1)	2	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		GTGGGGTCCTGGCTCTGGCCC	0.771													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57845628	57845628	+	IGR	DEL	A	-	-	rs34852934		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57845628delA								ZNF543 (3484 upstream) : ZNF304 (17017 downstream)																							gacagcaaacaaaaaaaaaag	0.000													4	2	---	---	---	---	
SCRT2	85508	broad.mit.edu	37	20	654835	654836	+	Intron	DEL	CT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:654835_654836delCT	uc002wec.2	-						SRXN1_uc002web.2_Intron	NM_033129	NP_149120	Q9NQ03	SCRT2_HUMAN	scratch 2 protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTGCCCAGCACTCTCTCTCTCT	0.550													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	8905672	8905673	+	IGR	INS	-	T	T	rs146393262	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8905672_8905673insT								PLCB1 (40127 upstream) : PLCB4 (144028 downstream)																							tgttccatgactttttttttgt	0.069													4	3	---	---	---	---	
C20orf103	24141	broad.mit.edu	37	20	9495893	9495894	+	Intron	INS	-	T	T	rs140860346	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9495893_9495894insT	uc002wni.1	+						C20orf103_uc010zrc.1_Intron	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor							integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			AGGATTTTTAATTTTTTTAACT	0.391													4	2	---	---	---	---	
MKKS	8195	broad.mit.edu	37	20	10392994	10392994	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10392994delC	uc002wnt.1	-						MKKS_uc002wnu.1_Intron|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome protein						brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0						TGGCTATAATCACTGCATTTT	0.348									Bardet-Biedl_syndrome				4	2	---	---	---	---	
MKKS	8195	broad.mit.edu	37	20	10392996	10392997	+	Intron	INS	-	GA	GA	rs144364144	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10392996_10392997insGA	uc002wnt.1	-						MKKS_uc002wnu.1_Intron|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome protein						brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0						GCTATAATCACTGCATTTTTAG	0.356									Bardet-Biedl_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10865272	10865272	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10865272delT								JAG1 (210578 upstream) : None (None downstream)																							caggcatgagttcagagcaca	0.030													4	2	---	---	---	---	
FLRT3	23767	broad.mit.edu	37	20	14315163	14315164	+	Intron	INS	-	G	G			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14315163_14315164insG	uc002wov.1	-						MACROD2_uc002wot.2_Intron|MACROD2_uc002wou.2_Intron|FLRT3_uc002wow.1_Intron	NM_198391	NP_938205	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3						cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			kidney(1)	1		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		TTTTGCCCACTGGGGGGTGGTA	0.431													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15621419	15621419	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15621419delT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ctattctccctttttatgatg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18347514	18347514	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18347514delG								ZNF133 (49876 upstream) : C20orf12 (16498 downstream)																							ggagcagggtggaggtcagtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18754286	18754287	+	IGR	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18754286_18754287insA								DTD1 (9728 upstream) : HSPC072 (14328 downstream)																							ggcttcattttaaaaaaattct	0.000													4	2	---	---	---	---	
RIN2	54453	broad.mit.edu	37	20	19940389	19940389	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19940389delT	uc002wro.1	+						RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Intron	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						ACAGACAGAATAGGAGAAGGG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25120935	25120935	+	IGR	DEL	A	-	-	rs35547397		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25120935delA								VSX1 (58168 upstream) : LOC284798 (499 downstream)																							AATTCTCTCCAAAAAAAAACT	0.448													4	2	---	---	---	---	
FOXS1	2307	broad.mit.edu	37	20	30433709	30433709	+	5'Flank	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30433709delA	uc002wwt.1	-							NM_004118	NP_004109	O43638	FOXS1_HUMAN	forkhead box S1						anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|insulin receptor signaling pathway|lymphangiogenesis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|neural crest cell fate commitment|neuromuscular process controlling balance|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of multicellular organism growth|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|somitogenesis|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)	1						acagaggcagaaacatatgaa	0.214													4	2	---	---	---	---	
C20orf112	140688	broad.mit.edu	37	20	31082489	31082490	+	Intron	DEL	GG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31082489_31082490delGG	uc002wxw.1	-									Q96MY1	CT112_HUMAN	Homo sapiens cDNA FLJ31724 fis, clone NT2RI2006703, moderately similar to Homo sapiens nolp mRNA.												0						ccttacaactgggaaccacgtg	0.292													4	2	---	---	---	---	
C20orf114	92747	broad.mit.edu	37	20	31888843	31888843	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31888843delA	uc002wyw.1	+						C20orf114_uc002wyx.1_5'Flank	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor							extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						TATCTGGTACAAAAAATAAAA	0.343													4	2	---	---	---	---	
CBFA2T2	9139	broad.mit.edu	37	20	32161776	32161776	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32161776delG	uc002wzg.1	+						CBFA2T2_uc010zug.1_Intron|CBFA2T2_uc002wze.1_Intron|CBFA2T2_uc002wzf.1_Intron|CBFA2T2_uc002wzh.1_Intron|CBFA2T2_uc002wzi.1_5'Flank	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						ttttttttttgtagaggtggg	0.000													4	2	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	35017286	35017286	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35017286delC	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CTGAAAGGGGCACCCAGATGG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36050071	36050072	+	IGR	INS	-	TG	TG	rs148881882	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36050071_36050072insTG								SRC (16252 upstream) : BLCAP (95748 downstream)																							ACTGCATCCTCtgtgtgtgtgt	0.446													4	3	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40054993	40054993	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40054993delT	uc002xka.1	-							NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TTAAAATAAGTTTTTTTTTTC	0.403													6	4	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45923115	45923116	+	Intron	INS	-	A	A	rs113678762		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45923115_45923116insA	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			aacaaacaaacaaaaaaaaaaa	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48925119	48925119	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48925119delC	uc002xvk.2	+											Homo sapiens cDNA FLJ33286 fis, clone ASTRO2014174.																		TTAAGTCCCTCCTGTATGCAA	0.353													4	2	---	---	---	---	
FAM65C	140876	broad.mit.edu	37	20	49211643	49211644	+	Intron	DEL	GC	-	-	rs6091180	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49211643_49211644delGC	uc002xvm.2	-						FAM65C_uc010zyt.1_Intron|FAM65C_uc010zyu.1_Intron	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876											ovary(2)	2						ctcctcctatgcagatagggaa	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51491098	51491100	+	IGR	DEL	GGA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51491098_51491100delGGA								ZFP64 (682574 upstream) : TSHZ2 (97777 downstream)																							ggagtcttctggaagcccaggga	0.005													4	2	---	---	---	---	
DOK5	55816	broad.mit.edu	37	20	53241891	53241891	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53241891delC	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901	Q9P104	DOK5_HUMAN	docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)			TCCTGTTTTTCCAGATGGTGG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53622341	53622341	+	IGR	DEL	C	-	-	rs5842047		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53622341delC								DOK5 (354632 upstream) : CBLN4 (950156 downstream)																							GGGAGAAGGTCTTAACCCCAT	0.458													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54521737	54521738	+	IGR	DEL	CC	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54521737_54521738delCC								None (None upstream) : CBLN4 (50759 downstream)																							caagATTATTCCAAGTGCTGGA	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56347843	56347843	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56347843delT								PMEPA1 (61302 upstream) : C20orf85 (378140 downstream)																							GCTGAGGACCTTTTCCTTGGC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56666284	56666284	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56666284delA								PMEPA1 (379743 upstream) : C20orf85 (59699 downstream)																							cccttcctggaacacaccaac	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58524302	58524303	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58524302_58524303delTG								C20orf177 (1743 upstream) : CDH26 (9179 downstream)																							TTTTTTTTTTTGTACAGGAAAT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9536599	9536599	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9536599delA								None (None upstream) : None (None downstream)																							CTAGTATAATACAGTCTTCAC	0.408													2	4	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10910617	10910620	+	Intron	DEL	CTCA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10910617_10910620delCTCA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gagacagagtctcactgtcaccca	0.108													7	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11023566	11023566	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11023566delC	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CGCTTTAATTCTTTTAATAGA	0.284													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAGGAAAAGTTATGTATAT	0.124													2	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11073982	11073982	+	Intron	DEL	T	-	-	rs147988084		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11073982delT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaataactgcttttttcatgg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16502061	16502061	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16502061delG								NRIP1 (64935 upstream) : USP25 (600435 downstream)																							ggggcatattgggggagtggt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20110147	20110147	+	Intron	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20110147delG	uc010glf.1	-						uc002ykx.2_Intron					Homo sapiens, clone IMAGE:5392784, mRNA.																		GAAAGAGAAAGGACAAAACAC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21516907	21516908	+	IGR	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21516907_21516908delTT								None (None upstream) : C21orf131 (598006 downstream)																							AACAATCATATTTTAAGGTGAA	0.183													4	2	---	---	---	---	
GABPA	2551	broad.mit.edu	37	21	27137274	27137274	+	Intron	DEL	T	-	-	rs71651639		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27137274delT	uc002ylx.3	+						GABPA_uc002yly.3_Intron	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha						positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						CGAGGTACAGTTTTTTTTTTA	0.204													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	27560763	27560763	+	IGR	DEL	G	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27560763delG								APP (17317 upstream) : CYYR1 (277766 downstream)																							gcaactgtttggggagagagg	0.000													4	2	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32621283	32621284	+	Intron	INS	-	A	A	rs141253112	by1000genomes	TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32621283_32621284insA	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						ATGTCCCAAGTAAAAAAAAGCC	0.317													4	2	---	---	---	---	
TMEM50B	757	broad.mit.edu	37	21	34832975	34832975	+	Intron	DEL	A	-	-	rs72012130		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34832975delA	uc002yrt.1	-						TMEM50B_uc002yrs.1_Intron|TMEM50B_uc010gmb.1_Intron	NM_006134	NP_006125	P56557	TM50B_HUMAN	transmembrane protein 50B							endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						ATGATGATTTAAAAAAAAAAC	0.264													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40535666	40535666	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40535666delA								ETS2 (338790 upstream) : PSMG1 (11724 downstream)																							ctgcctactcaacaacttcac	0.000													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44109905	44109906	+	Intron	DEL	GA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44109905_44109906delGA	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						ATGCCTTTCTGATAAAGAGACA	0.500													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44109908	44109908	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44109908delA	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						CCTTTCTGATAAAGAGACAGA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44467423	44467423	+	IGR	DEL	G	-	-	rs35192629		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44467423delG								PKNOX1 (13735 upstream) : CBS (5878 downstream)																							ctttacataagtggggtcacg	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47491448	47491449	+	IGR	DEL	TG	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47491448_47491449delTG								COL6A1 (66485 upstream) : COL6A2 (26584 downstream)																							tctgcccacttGTGAACATGAT	0.134													4	2	---	---	---	---	
PRMT2	3275	broad.mit.edu	37	21	48060766	48060767	+	Intron	INS	-	T	T			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48060766_48060767insT	uc002zjx.2	+						PRMT2_uc002zjw.2_Intron|PRMT2_uc002zjy.2_Intron|PRMT2_uc010gqm.2_Intron|PRMT2_uc011aga.1_Intron|PRMT2_uc011agb.1_Intron|PRMT2_uc011agc.1_Intron|PRMT2_uc002zjz.1_5'Flank	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1						developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		ctctattcttattttttttttc	0.099													4	2	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16272508	16272509	+	Intron	INS	-	A	A			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16272508_16272509insA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron|uc002zlk.2_5'Flank	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						TGGCTTTTATGAAAAAAAAAAC	0.282													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17237187	17237188	+	IGR	INS	-	T	T	rs143051422		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17237187_17237188insT								psiTPTE22 (57666 upstream) : XKR3 (27125 downstream)																							aaaatgctagctttttaaaaaa	0.050													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25781617	25781617	+	IGR	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25781617delC								LRP5L (4073 upstream) : ADRBK2 (179244 downstream)																							CCTTACATCTCCCCACCTCAC	0.632													4	2	---	---	---	---	
HPS4	89781	broad.mit.edu	37	22	26863466	26863466	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26863466delT	uc003acl.2	-						HPS4_uc003aci.2_Intron|HPS4_uc003acj.2_Intron|HPS4_uc003ack.2_5'UTR|HPS4_uc003acn.2_Intron|HPS4_uc010gvd.1_Intron|HPS4_uc003ach.2_Intron	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a						lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						cattatttccttaagatatat	0.000									Hermansky-Pudlak_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27348357	27348357	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27348357delA								MIAT (233408 upstream) : MN1 (795909 downstream)																							GCAGACGTTTAAAAAAAAAAT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	30872846	30872846	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30872846delA								SEC14L3 (4812 upstream) : SDC4P (4431 downstream)																							atagtagcctaaaacaatagc	0.000													4	2	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40677500	40677500	+	Intron	DEL	T	-	-	rs71838517		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40677500delT	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						TAAACCTGTATTTTTTTTTTT	0.308													6	3	---	---	---	---	
PPPDE2	27351	broad.mit.edu	37	22	42002100	42002100	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42002100delT	uc003ban.1	-						PPPDE2_uc011apb.1_Intron	NM_015704	NP_056519	Q6ICB0	PPDE2_HUMAN	PPPDE peptidase domain containing 2												0						gttttctggcttttattccaa	0.040													4	2	---	---	---	---	
PNPLA5	150379	broad.mit.edu	37	22	44277690	44277691	+	Intron	INS	-	GT	GT			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44277690_44277691insGT	uc003beg.2	-						PNPLA5_uc011aqc.1_Intron|PNPLA5_uc003beh.2_Intron	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5						lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				AGAAGGGCCAGCAGCGTTGGCC	0.639													4	2	---	---	---	---	
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45200537	45200537	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45200537delC	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						CTTCCAGATGCCAGCATCTAA	0.572													4	2	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46092421	46092421	+	Intron	DEL	C	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46092421delC	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		tcgccacttgcccacgcagaa	0.100													4	2	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47307815	47307815	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47307815delA	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		accctgtctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49460912	49460912	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49460912delA								FAM19A5 (313170 upstream) : C22orf34 (347264 downstream)																							agtctttgtcaaagctgccct	0.179													4	2	---	---	---	---	
AGTR2	186	broad.mit.edu	37	X	115303402	115303402	+	Intron	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115303402delT	uc004eqh.3	+							NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2						behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						AATCACTCACTTTTTTTTTGC	0.323													6	4	---	---	---	---	
SLC6A14	11254	broad.mit.edu	37	X	115584445	115584448	+	Intron	DEL	TAAA	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115584445_115584448delTAAA	uc004eqi.2	+							NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid						cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	AAAGTTGCTTTAAATAAAATTTAA	0.255													18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	6210550	6210550	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6210550delT								TSPY2 (93497 upstream) : TTTY1B (47892 downstream)																							AAAAGAAACCTTTTTTTTTTT	0.264													10	5	---	---	---	---	
TTTY16	252948	broad.mit.edu	37	Y	7568124	7568124	+	Intron	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:7568124delA	uc004frf.1	-							NR_001552				Homo sapiens TTTY16 mRNA, partial sequence.												0						caaaaacaacaaaaaaaaaac	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8287132	8287133	+	IGR	DEL	TT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8287132_8287133delTT								TTTY12 (608411 upstream) : TTTY18 (264278 downstream)																							AGGCGTTGTCTTTTTTTTTTTT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8489228	8489228	+	IGR	DEL	T	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8489228delT								TTTY12 (810507 upstream) : TTTY18 (62183 downstream)																							ACTGCAGCACTTTTTTTTTGT	0.333													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9931476	9931476	+	IGR	DEL	T	-	-	rs111973660		TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9931476delT								TTTY22 (280622 upstream) : None (None downstream)																							atgtcatttgtttcttttctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	14522467	14522468	+	IGR	DEL	GT	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14522467_14522468delGT								None (None upstream) : TTTY15 (251830 downstream)																							AGGAAGGCAAGTGTGAACCCCA	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	15981759	15981759	+	IGR	DEL	A	-	-			TCGA-CZ-5457-01A-01D-1501-10	TCGA-CZ-5457-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15981759delA								TMSB4Y (163862 upstream) : VCY (115894 downstream)																							CTTTCTTTTTACGAGCCGTTA	0.328													4	2	---	---	---	---	
