Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
BMP8B	656	broad.mit.edu	37	1	40226046	40226046	+	3'UTR	SNP	G	A	A	rs12094291	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40226046G>A	uc001cdz.1	-	7					PPIE_uc001cdv.2_Intron|PPIE_uc001cdw.2_Intron	NM_001720	NP_001711	P34820	BMP8B_HUMAN	bone morphogenetic protein 8B preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGAGGGGCCCGATCCAGATGA	0.632													3	23	---	---	---	---	PASS
PRDX1	5052	broad.mit.edu	37	1	45984673	45984673	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45984673A>G	uc001cnz.2	-	1	75	c.43T>C	c.(43-45)TTC>CTC	p.F15L	PRDX1_uc001coa.2_Missense_Mutation_p.F15L|PRDX1_uc001cob.2_Missense_Mutation_p.F15L|PRDX1_uc001coc.2_Missense_Mutation_p.F15L	NM_181697	NP_859048	Q06830	PRDX1_HUMAN	peroxiredoxin 1	15	Thioredoxin.				cell proliferation|cell redox homeostasis|hydrogen peroxide catabolic process|skeletal system development	melanosome|mitochondrion|nucleus	protein binding|thioredoxin peroxidase activity				0	Acute lymphoblastic leukemia(166;0.155)					GTGGCTTTGAAGTTGGGGGCA	0.403													41	199	---	---	---	---	PASS
FAM151A	338094	broad.mit.edu	37	1	55089083	55089083	+	5'UTR	SNP	G	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55089083G>T	uc001cxn.2	-	1					ACOT11_uc001cxm.1_Intron	NM_176782	NP_788954	Q8WW52	F151A_HUMAN	hypothetical protein LOC338094							integral to membrane					0						ACGCTCTCTGGGGAATGCCCC	0.602													14	159	---	---	---	---	PASS
LRRC8B	23507	broad.mit.edu	37	1	90049715	90049715	+	Silent	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90049715C>T	uc001dni.2	+	7	2013	c.1506C>T	c.(1504-1506)ATC>ATT	p.I502I	LRRC8B_uc001dnh.2_Silent_p.I502I|LRRC8B_uc001dnj.2_Silent_p.I502I	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	502	LRR 2.					integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGGGAAAAATCCCACGCTGGG	0.453													30	140	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144829025	144829025	+	Intron	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144829025A>G	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elr.3_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTGATCAGTCAGACATTTTAA	0.473													3	7	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74043728	74043728	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74043728A>C	uc002sjr.1	+	3	2499	c.2378A>C	c.(2377-2379)CAA>CCA	p.Q793P		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	793										ovary(2)	2						aaagcaacccaacccagttca	0.358													3	22	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141143576	141143576	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141143576T>C	uc002tvj.1	-	67	11389	c.10417A>G	c.(10417-10419)AAA>GAA	p.K3473E		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3473	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGTCTTTTTATCTGTAATG	0.408										TSP Lung(27;0.18)			56	252	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202590152	202590152	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202590152T>C	uc002uyo.2	-	20	3630	c.3274A>G	c.(3274-3276)AAG>GAG	p.K1092E	ALS2_uc002uyp.3_Missense_Mutation_p.K1092E|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	1092	MORN 2.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TTCATTGCCTTGTTTGGGATT	0.383													74	327	---	---	---	---	PASS
OSBPL10	114884	broad.mit.edu	37	3	31774806	31774806	+	Silent	SNP	G	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31774806G>T	uc003cev.2	-	7	1419	c.1038C>A	c.(1036-1038)ACC>ACA	p.T346T	OSBPL10_uc003ceu.1_Silent_p.T103T|OSBPL10_uc011axf.1_Silent_p.T282T	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	346					lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		AAATTGCCCAGGTTATGTTGG	0.502													38	86	---	---	---	---	PASS
ITIH4	3700	broad.mit.edu	37	3	52864693	52864693	+	5'UTR	SNP	T	G	G	rs2071041	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52864693T>G	uc003dfz.2	-	1					ITIH4_uc011bem.1_5'Flank|ITIH4_uc011ben.1_5'Flank|ITIH4_uc010hmp.1_Intron|MUSTN1_uc010hmq.1_Intron	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4						acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GCTTCTGAACTCGACAGCAAG	0.547													4	43	---	---	---	---	PASS
PCCB	5096	broad.mit.edu	37	3	136045815	136045815	+	Intron	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136045815T>A	uc003eqy.1	+						PCCB_uc003eqz.1_Intron|PCCB_uc011bmc.1_Intron|PCCB_uc011bmd.1_Missense_Mutation_p.L338M	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	CCCACTTTATTTGGAGATCTT	0.493													23	73	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52944944	52944944	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52944944T>C	uc003gzl.2	+	8	1342	c.1064T>C	c.(1063-1065)ATC>ACC	p.I355T	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.I323T|SPATA18_uc003gzk.1_Missense_Mutation_p.I355T	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	355					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			CACTTCAAGATCCATGTGAGA	0.383													10	214	---	---	---	---	PASS
ADH1A	124	broad.mit.edu	37	4	100205829	100205829	+	Intron	SNP	T	G	G	rs28364311	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100205829T>G	uc003hur.1	-						uc003hum.1_Intron|ADH1A_uc011ceg.1_Intron|ADH1A_uc010ilf.1_5'Flank	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit						ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	CCATAACTAATGTGCAAACTC	0.473													6	94	---	---	---	---	PASS
TBCK	93627	broad.mit.edu	37	4	107157650	107157650	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107157650C>T	uc010ilv.2	-	14	1612	c.1247G>A	c.(1246-1248)AGC>AAC	p.S416N	TBCK_uc003hyb.2_Missense_Mutation_p.S159N|TBCK_uc003hye.2_Missense_Mutation_p.S377N|TBCK_uc003hyc.2_Missense_Mutation_p.S353N|TBCK_uc003hyd.2_Missense_Mutation_p.S244N|TBCK_uc003hyf.2_Missense_Mutation_p.S416N	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like	416						intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						CTCATTATTGCTGTTTGAATG	0.343													14	76	---	---	---	---	PASS
SLC25A4	291	broad.mit.edu	37	4	186066922	186066922	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186066922C>G	uc003ixd.2	+	3	737	c.608C>G	c.(607-609)CCT>CGT	p.P203R	SLC25A4_uc003ixe.2_RNA	NM_001151	NP_001142	P12235	ADT1_HUMAN	adenine nucleotide translocator 1	203					energy reserve metabolic process|interspecies interaction between organisms|mitochondrial genome maintenance|negative regulation of necrotic cell death|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane	adenine transmembrane transporter activity|protein binding			ovary(1)	1		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	GGGATGCTGCCTGACCCCAAG	0.577													15	72	---	---	---	---	PASS
SNX18	112574	broad.mit.edu	37	5	53814577	53814577	+	Nonsense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53814577T>A	uc003jpj.3	+	1	985	c.795T>A	c.(793-795)TAT>TAA	p.Y265*	SNX18_uc011cqg.1_Nonsense_Mutation_p.Y265*|SNX18_uc003jpi.3_Nonsense_Mutation_p.Y265*	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform b	265					cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				TGGGGCCCTATGGCCCCGAGT	0.627													9	69	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76249908	76249908	+	Missense_Mutation	SNP	C	T	T	rs79810800		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76249908C>T	uc003ker.2	+	3	510	c.230C>T	c.(229-231)CCG>CTG	p.P77L	CRHBP_uc010izx.2_Missense_Mutation_p.P77L	NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	77					female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		GCCGACCGGCCGCAGCTGCAC	0.652													7	48	---	---	---	---	PASS
SLC23A1	9963	broad.mit.edu	37	5	138707793	138707793	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138707793C>A	uc003leh.2	-	14	1796	c.1699G>T	c.(1699-1701)GTC>TTC	p.V567F	SLC23A1_uc003leg.2_Missense_Mutation_p.V571F	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	567					brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CCTTTGAAGACTGGGCAGATA	0.408													59	335	---	---	---	---	PASS
NDUFA2	4695	broad.mit.edu	37	5	140027216	140027216	+	5'UTR	SNP	T	C	C	rs778593	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140027216T>C	uc003lgp.2	-	1					IK_uc011czk.1_5'Flank|IK_uc003lgq.2_5'Flank	NM_002488	NP_002479	O43678	NDUA2_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		NADH(DB00157)	GGCCAAGTGCTCCGGTCTGAC	0.577													2	16	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29055049	29055049	+	5'UTR	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29055049C>T	uc003nlx.2	-	1						NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						TTTCGCACTCCTAAAAAAATG	0.348													9	42	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36922553	36922553	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36922553G>T	uc003ona.2	+	1	345	c.17G>T	c.(16-18)AGT>ATT	p.S6I	PI16_uc003omz.1_Missense_Mutation_p.S6I|PI16_uc003onb.2_Missense_Mutation_p.S6I	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	6						extracellular region|integral to membrane	peptidase inhibitor activity				0						GGCTCCTGCAGTTTCctgatg	0.498													4	22	---	---	---	---	PASS
REPS1	85021	broad.mit.edu	37	6	139233902	139233902	+	Silent	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139233902C>T	uc003qii.2	-	16	2550	c.1971G>A	c.(1969-1971)CCG>CCA	p.P657P	REPS1_uc003qig.3_Silent_p.P630P|REPS1_uc011edr.1_Silent_p.P656P|REPS1_uc003qij.2_Silent_p.P566P|REPS1_uc003qik.2_Silent_p.P263P	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	657	Interaction with RALBP1 (By similarity).					coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GAAAACTGACCGGCAGGACTT	0.428													15	85	---	---	---	---	PASS
SNX10	29887	broad.mit.edu	37	7	26404071	26404071	+	Intron	SNP	G	A	A	rs2253569	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26404071G>A	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_Intron|SNX10_uc010kuw.2_5'UTR	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						TAGAGTGAATGTTGAGATCAT	0.323													3	26	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50607651	50607651	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50607651T>C	uc003tpf.3	-	3	363	c.277A>G	c.(277-279)ATG>GTG	p.M93V	DDC_uc010kza.2_Missense_Mutation_p.M93V|DDC_uc003tpg.3_Missense_Mutation_p.M93V	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	93	1.|2 X approximate tandem repeats.				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	CCGCACAGCATGTCCGCAAGC	0.662													4	26	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	132169702	132169702	+	Intron	SNP	G	A	A	rs112214523	byFrequency	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132169702G>A	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Missense_Mutation_p.A481V	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						AGCAATGTTCGCCCCAGGTGG	0.483													10	104	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150554402	150554402	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150554402T>C	uc003why.1	+	3	5062	c.844T>C	c.(844-846)TTC>CTC	p.F282L	ABP1_uc003whz.1_Missense_Mutation_p.F282L|ABP1_uc003wia.1_Missense_Mutation_p.F282L	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	282					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	GCCGCCCCTCTTCTCCTCCCA	0.682													4	10	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151879304	151879304	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151879304C>G	uc003wla.2	-	36	5860	c.5641G>C	c.(5641-5643)GTG>CTG	p.V1881L	MLL3_uc003wkz.2_Missense_Mutation_p.V942L	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1881	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGTGAAAACACTTGCGGTGAG	0.537			N		medulloblastoma								19	114	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428250	12428250	+	Intron	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428250C>G	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		AAGTAACCATCGGTAGTCCTG	0.383													7	43	---	---	---	---	PASS
MRPL15	29088	broad.mit.edu	37	8	55055338	55055338	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55055338G>A	uc003xsa.2	+	4	608	c.545G>A	c.(544-546)AGA>AAA	p.R182K		NM_014175	NP_054894	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15 precursor	182					translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			TATGATCCAAGAAGTCTGGGT	0.368													53	187	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104934028	104934028	+	Intron	SNP	G	A	A	rs6468897	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104934028G>A	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_Intron|RIMS2_uc003ylv.1_Missense_Mutation_p.V129I	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGTCATTACGTTTACTCTTC	0.353										HNSCC(12;0.0054)			8	125	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532886	84532886	+	3'UTR	SNP	T	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532886T>G	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						CTCAGGGAGATTCCAAAGATG	0.433													4	27	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138703212	138703212	+	Silent	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138703212G>A	uc004cgr.3	-	17	4752	c.4752C>T	c.(4750-4752)AAC>AAT	p.N1584N	CAMSAP1_uc004cgq.3_Silent_p.N1474N|CAMSAP1_uc010nbg.2_Silent_p.N1306N	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	1584	CKK.					cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GCCACAGGTGGTTGTGGATTG	0.522													5	19	---	---	---	---	PASS
RSU1	6251	broad.mit.edu	37	10	16737058	16737058	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16737058T>A	uc001iok.2	-	7	997	c.695A>T	c.(694-696)CAT>CTT	p.H232L	RSU1_uc001iol.2_Missense_Mutation_p.H232L|RSU1_uc001iom.2_Missense_Mutation_p.H179L	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2	232					cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		CTCAAAAACATGGGACACGCC	0.408													17	83	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97135759	97135759	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97135759A>G	uc001kkp.2	-	17	1753	c.1708T>C	c.(1708-1710)TTC>CTC	p.F570L	SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Missense_Mutation_p.F172L|SORBS1_uc001kkn.2_Missense_Mutation_p.F357L|SORBS1_uc001kkm.2_Missense_Mutation_p.F426L|SORBS1_uc001kko.2_Missense_Mutation_p.F592L|SORBS1_uc001kkq.2_Missense_Mutation_p.F455L|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Missense_Mutation_p.F524L|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	570					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TCCGAAAAGAATTTATACCAA	0.378													39	150	---	---	---	---	PASS
COMMD9	29099	broad.mit.edu	37	11	36302301	36302301	+	Silent	SNP	T	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36302301T>G	uc001mwn.3	-	2	175	c.138A>C	c.(136-138)ACA>ACC	p.T46T	COMMD9_uc009ykj.2_Intron|COMMD9_uc010rfb.1_Silent_p.T46T	NM_014186	NP_054905	Q9P000	COMD9_HUMAN	COMM domain containing 9 isoform 1	46										ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				AGCTGGAACATGTAACATCCA	0.448													42	121	---	---	---	---	PASS
SLC22A25	387601	broad.mit.edu	37	11	62933774	62933774	+	Intron	SNP	C	G	G	rs2226866	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62933774C>G	uc001nwr.1	-						SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_Intron|SLC22A25_uc001nws.1_Intron|SLC22A25_uc001nwt.1_3'UTR	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter						transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						ATCTGTGGAACCTAAATCCTA	0.403													3	19	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65272965	65272965	+	RNA	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65272965T>C	uc010roh.1	+	1		c.7733T>C			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GGGCAACCACTTTTCCCTAGC	0.483													46	127	---	---	---	---	PASS
FAM86C	55199	broad.mit.edu	37	11	71507299	71507299	+	Intron	SNP	G	T	T	rs141915276	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71507299G>T	uc001oqv.3	+						FAM86C_uc009ysr.2_Intron|FAM86C_uc001oqw.3_Intron|FAM86C_uc009yss.2_Intron|FAM86C_uc010rqq.1_RNA|uc001oqx.1_Intron	NM_018172	NP_060642	Q9NVL1	FA86C_HUMAN	hypothetical protein LOC55199 isoform 1												0						GGGGGCCGGGGAAAAGCTAGG	0.652													5	62	---	---	---	---	PASS
MMP1	4312	broad.mit.edu	37	11	102661080	102661080	+	3'UTR	SNP	G	A	A	rs2239008	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102661080G>A	uc001phi.2	-	10					uc001phh.1_Intron|MMP1_uc010ruv.1_3'UTR	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1						blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		AAAATAGACAGTTCTTCAGGA	0.318													4	51	---	---	---	---	PASS
BTG1	694	broad.mit.edu	37	12	92539272	92539272	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92539272C>T	uc001tby.3	-	1	402	c.40G>A	c.(40-42)GAG>AAG	p.E14K	BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	NM_001731	NP_001722	P62324	BTG1_HUMAN	B-cell translocation protein 1	14					cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				GCGGCGATCTCGCCTATCATG	0.463			T	MYC	BCLL								4	31	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133220012	133220012	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133220012C>G	uc001uks.1	-	34	4469	c.4425G>C	c.(4423-4425)CAG>CAC	p.Q1475H	POLE_uc001ukq.1_5'Flank|POLE_uc001ukr.1_Missense_Mutation_p.Q279H|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.Q1448H	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1475					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GGTAGCTGAACTGGGCCAGAG	0.577								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					24	114	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19413025	19413025	+	RNA	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19413025A>G	uc010tcj.1	-	1		c.33085T>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AATAACCTGCACATCCATGCA	0.299													5	61	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19413033	19413033	+	RNA	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19413033G>A	uc010tcj.1	-	1		c.33077C>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GCACATCCATGCACTAAAAAG	0.294													5	47	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20403973	20403973	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20403973T>A	uc001vwj.1	+	1	148	c.148T>A	c.(148-150)TCT>ACT	p.S50T		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	50	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TGTCATTATTTCTTTTGACTC	0.373													74	811	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404157	20404157	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404157A>G	uc001vwj.1	+	1	332	c.332A>G	c.(331-333)GAG>GGG	p.E111G		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	111	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GTTGGGAGTGAGATGATGTTG	0.418													54	389	---	---	---	---	PASS
CCNB1IP1	57820	broad.mit.edu	37	14	20784718	20784718	+	5'UTR	SNP	G	T	T	rs1132644	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20784718G>T	uc001vwv.2	-	5					CCNB1IP1_uc001vww.2_5'UTR|CCNB1IP1_uc001vwx.2_5'UTR|CCNB1IP1_uc001vwy.2_5'UTR|CCNB1IP1_uc001vwz.2_5'UTR|CCNB1IP1_uc010ahh.1_RNA	NM_182851	NP_878271	Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1 isoform 3							chromosome|nucleus	ligase activity|metal ion binding|protein binding		HMGA2/CCNB1IP1(2)	soft_tissue(2)|ovary(1)	3	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		CTGAAGAGAGGCCTAAGAAGG	0.348			T	HMGA2	leiomyoma								4	63	---	---	---	---	PASS
POLE2	5427	broad.mit.edu	37	14	50110308	50110308	+	3'UTR	SNP	C	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50110308C>A	uc001wwu.2	-	19					SDCCAG1_uc010anj.1_Intron|POLE2_uc010ann.2_3'UTR|POLE2_uc001wwv.2_RNA	NM_002692	NP_002683	P56282	DPOE2_HUMAN	DNA-directed DNA polymerase epsilon 2						DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity			ovary(1)|skin(1)	2	all_epithelial(31;0.0021)|Breast(41;0.0124)					ATATCAGAATCACATAAGATA	0.254													17	74	---	---	---	---	PASS
ALKBH1	8846	broad.mit.edu	37	14	78140153	78140153	+	3'UTR	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78140153T>C	uc001xuc.1	-	6					ALKBH1_uc001xud.1_RNA	NM_006020	NP_006011	Q13686	ALKB1_HUMAN	alkylated DNA repair protein alkB homolog						DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)|skin(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GATCTCCAAGTCTCAGCTGTC	0.453													55	196	---	---	---	---	PASS
AMN	81693	broad.mit.edu	37	14	103394801	103394801	+	Silent	SNP	A	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103394801A>T	uc001ymg.3	+	4	279	c.246A>T	c.(244-246)GGA>GGT	p.G82G	AMN_uc001ymh.3_Silent_p.G28G	NM_030943	NP_112205	Q9BXJ7	AMNLS_HUMAN	amnionless protein precursor	82	Extracellular (Potential).				lipid metabolic process|lipoprotein metabolic process|multicellular organismal development	integral to membrane|plasma membrane					0				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGCTTCAGGAGCCGGATTCG	0.726													4	10	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51837940	51837940	+	Nonsense_Mutation	SNP	A	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51837940A>C	uc002abf.2	-	8	995	c.770T>G	c.(769-771)TTA>TGA	p.L257*	DMXL2_uc010ufy.1_Nonsense_Mutation_p.L257*|DMXL2_uc010bfa.2_Nonsense_Mutation_p.L257*	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	257	WD 3.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ACATGAAGTTAACAACACATT	0.378													71	225	---	---	---	---	PASS
RPS27L	51065	broad.mit.edu	37	15	63449680	63449680	+	5'UTR	SNP	C	G	G	rs2292038	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63449680C>G	uc002aly.2	-	1					RPS27L_uc002alx.2_5'Flank	NM_015920	NP_057004	Q71UM5	RS27L_HUMAN	ribosomal protein S27-like						DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|positive regulation of anti-apoptosis|translation	nucleus|ribosome	caspase activator activity|metal ion binding|structural constituent of ribosome|translation activator activity				0						GATCTGCGCTCGGCATCAACT	0.622													4	54	---	---	---	---	PASS
LYSMD4	145748	broad.mit.edu	37	15	100269538	100269538	+	Silent	SNP	C	T	T	rs150607972		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100269538C>T	uc002bvk.2	-	3	744	c.681G>A	c.(679-681)CTG>CTA	p.L227L	LYSMD4_uc002bvj.1_Intron|LYSMD4_uc010bou.1_Intron|LYSMD4_uc002bvl.2_Silent_p.L228L|LYSMD4_uc002bvm.2_3'UTR|LYSMD4_uc010bov.2_Silent_p.L227L			Q5XG99	LYSM4_HUMAN	SubName: Full=cDNA FLJ77040, highly similar to Homo sapiens LysM, putative peptidoglycan-binding, domain containing 4, mRNA; SubName: Full=LysM, putative peptidoglycan-binding, domain containing 4, isoform CRA_c;	227	Helical; (Potential).				cell wall macromolecule catabolic process	integral to membrane					0	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			CAATACCAATCAGCAGCATGA	0.478													41	202	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24268220	24268220	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24268220G>A	uc002dmf.2	+	1	1345	c.145G>A	c.(145-147)GAA>AAA	p.E49K		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	49					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		AAGTGATAATGAAACCAGCAG	0.443													29	137	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57060312	57060312	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57060312C>G	uc002ekk.1	+	6	1682	c.1457C>G	c.(1456-1458)GCT>GGT	p.A486G	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.A291G|NLRC5_uc002ekl.2_Missense_Mutation_p.A291G|NLRC5_uc002ekm.2_Missense_Mutation_p.A291G|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	486	NACHT.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				CCCTTGATAGCTTTTGGGGCC	0.592													11	60	---	---	---	---	PASS
AKAP10	11216	broad.mit.edu	37	17	19809465	19809465	+	3'UTR	SNP	T	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19809465T>G	uc002gwo.2	-	15						NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					TCATTGGCTGTGTTGAAGAAT	0.363													11	34	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33679558	33679558	+	Silent	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33679558T>C	uc010ctp.2	-	7	2965	c.2523A>G	c.(2521-2523)GCA>GCG	p.A841A	SLFN11_uc010ctq.2_Silent_p.A841A|SLFN11_uc002hjh.3_Silent_p.A841A|SLFN11_uc002hjg.3_Silent_p.A841A|SLFN11_uc010ctr.2_Silent_p.A841A	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	841						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACATATCACATGCATCACTGA	0.483													42	163	---	---	---	---	PASS
KRT222	125113	broad.mit.edu	37	17	38821207	38821207	+	Intron	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38821207T>A	uc002hvc.2	-						KRT222_uc010wfk.1_Intron|KRT222_uc002hvb.2_5'UTR|KRT222_uc010cxc.2_5'UTR	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21							intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						TGGGTAGACATGGACTGTCTC	0.458													27	94	---	---	---	---	PASS
AOC2	314	broad.mit.edu	37	17	40997011	40997011	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40997011T>C	uc002ibu.2	+	1	403	c.368T>C	c.(367-369)ATC>ACC	p.I123T	AOC2_uc002ibt.2_Missense_Mutation_p.I123T	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	123					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GCACTGGCCATCGTCCTCTTT	0.657													14	55	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57737836	57737836	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57737836G>A	uc002ixq.1	+	7	1497	c.1054G>A	c.(1054-1056)GCT>ACT	p.A352T	CLTC_uc002ixp.2_Missense_Mutation_p.A352T|CLTC_uc002ixr.1_Missense_Mutation_p.A356T	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	352	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCTGAGAATGGCTGTACGTAA	0.423			T	ALK|TFE3	ALCL|renal 								81	334	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78059827	78059827	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78059827T>A	uc010dht.2	+	14	2288	c.2261T>A	c.(2260-2262)CTT>CAT	p.L754H	CCDC40_uc002jxm.3_Missense_Mutation_p.L537H|CCDC40_uc002jxn.3_Missense_Mutation_p.L150H	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	754	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CCCCTGGAGCTTGAAATCAAA	0.443													18	68	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78938204	78938204	+	3'UTR	SNP	G	C	C	rs3751936	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78938204G>C	uc002jyt.1	+	34					RPTOR_uc010wug.1_3'UTR|RPTOR_uc002jyu.1_3'UTR	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						GGGGCACGGGGCGTCGGCTGC	0.652													3	5	---	---	---	---	PASS
IMPA2	3613	broad.mit.edu	37	18	12008391	12008391	+	Intron	SNP	C	T	T	rs17593321	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12008391C>T	uc002kqp.1	+						IMPA2_uc002kqo.1_Intron|IMPA2_uc010dlb.1_5'UTR|IMPA2_uc002kqq.1_Intron	NM_014214	NP_055029	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2						inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)	GAAAACCTCTCGGCAAGGCCA	0.463													3	32	---	---	---	---	PASS
C18orf8	29919	broad.mit.edu	37	18	21109584	21109584	+	Intron	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21109584T>A	uc010xax.1	+						C18orf8_uc002kul.2_Intron|C18orf8_uc010xay.1_Intron|NPC1_uc010dlu.1_RNA	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TAAGACCACATTTTTTTCTCC	0.423													46	180	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12491498	12491498	+	Missense_Mutation	SNP	C	T	T	rs4804664	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12491498C>T	uc002mts.3	-	4	1044	c.578G>A	c.(577-579)CGT>CAT	p.R193H				Q96GE5	ZN799_HUMAN	Homo sapiens cDNA clone IMAGE:30340957, **** WARNING: chimeric clone ****.	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						AGTGGTTTCACGTCTTTGAAG	0.428													9	167	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12491654	12491654	+	Missense_Mutation	SNP	C	T	T	rs57371898	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12491654C>T	uc002mts.3	-	4	888	c.422G>A	c.(421-423)CGT>CAT	p.R141H				Q96GE5	ZN799_HUMAN	Homo sapiens cDNA clone IMAGE:30340957, **** WARNING: chimeric clone ****.	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						CTCCCCAGTACGTGTTCTTTC	0.373													7	167	---	---	---	---	PASS
LYPD3	27076	broad.mit.edu	37	19	43969757	43969757	+	5'UTR	SNP	A	G	G	rs2259013	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43969757A>G	uc002owl.1	-	1					LYPD3_uc002owm.2_5'UTR	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein							anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)				TCCCCCCTGGATGTGCCGCCT	0.682													4	42	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21690005	21690005	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21690005C>T	uc002wsj.2	+	4	1259	c.1205C>T	c.(1204-1206)GCG>GTG	p.A402V	PAX1_uc010zsl.1_Missense_Mutation_p.A402V|PAX1_uc010zsm.1_Missense_Mutation_p.A378V	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	402					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						CCTCCTCTGGCGCCCCCCGGG	0.741													2	0	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628251	29628251	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628251A>G	uc010ztl.1	+	3	195	c.163A>G	c.(163-165)AAT>GAT	p.N55D	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.N7D					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GTTGGCCTCAAATAGCTGCTT	0.358													14	207	---	---	---	---	PASS
SLC2A10	81031	broad.mit.edu	37	20	45355557	45355557	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45355557T>A	uc002xsl.2	+	3	1440	c.1343T>A	c.(1342-1344)TTC>TAC	p.F448Y		NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10	448	Helical; Name=11; (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GGAAGAGCCTTCGCCTTCTGC	0.537													34	151	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32638828	32638828	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32638828G>A	uc002yow.1	-	5	933	c.461C>T	c.(460-462)TCC>TTC	p.S154F	TIAM1_uc011adk.1_Missense_Mutation_p.S154F|TIAM1_uc011adl.1_Missense_Mutation_p.S154F|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	154					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GGGCCCATTGGATGTATAGGA	0.537													20	124	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33043798	33043798	+	Nonsense_Mutation	SNP	T	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33043798T>A	uc002ypd.2	-	20	3784	c.3358A>T	c.(3358-3360)AAG>TAG	p.K1120*	SFRS15_uc002ype.2_Nonsense_Mutation_p.K1098*|SFRS15_uc010glu.2_Nonsense_Mutation_p.K1105*	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	1120						nucleus	nucleotide binding|RNA binding				0						TCAGAAGGCTTTAGGACTGCA	0.507													29	74	---	---	---	---	PASS
RCAN1	1827	broad.mit.edu	37	21	35890232	35890232	+	3'UTR	SNP	G	A	A	rs62211555	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35890232G>A	uc002yue.2	-	4					RCAN1_uc002yuc.2_3'UTR|RCAN1_uc002yud.2_3'UTR|RCAN1_uc002yub.2_3'UTR	NM_004414	NP_004405	P53805	RCAN1_HUMAN	calcipressin 1 isoform a						blood circulation|calcium-mediated signaling|central nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AAGGGGACACGGCCTTGATTC	0.522													3	20	---	---	---	---	PASS
TBL1X	6907	broad.mit.edu	37	X	9684325	9684325	+	3'UTR	SNP	A	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9684325A>C	uc010ndq.2	+	18					TBL1X_uc004csq.3_3'UTR|TBL1X_uc010ndr.2_3'UTR|TBL1X_uc004csr.2_3'UTR|TBL1X_uc004css.2_3'UTR	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN	transducin beta-like 1X isoform a						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)				AATTCTAATGACCAGCCGTGA	0.428													6	19	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41091721	41091721	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41091721C>G	uc004dfb.2	+	45	8290	c.7657C>G	c.(7657-7659)CAA>GAA	p.Q2553E	USP9X_uc004dfc.2_Missense_Mutation_p.Q2537E	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	2553					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						CCAACGAGCACAAGAAAATTA	0.458													15	96	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64958995	64958995	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64958995G>A	uc004dwf.2	+	12	1706	c.1508G>A	c.(1507-1509)CGC>CAC	p.R503H		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	503					leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						GCCAAGGACCGCAGTGAGGAG	0.547			T	ALK	ALCL								5	28	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100604757	100604757	+	3'UTR	SNP	T	G	G	rs700	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100604757T>G	uc004ehg.2	-	19					TIMM8A_uc004ehd.2_5'Flank|TIMM8A_uc011mri.1_5'Flank|BTK_uc004ehf.2_3'UTR|BTK_uc010nnh.2_RNA|BTK_uc010nni.2_RNA|BTK_uc004ehe.2_RNA|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_RNA|BTK_uc010nnl.2_3'UTR|BTK_uc010nnm.2_3'UTR|BTK_uc010nnn.2_3'UTR|BTK_uc010nno.2_3'UTR	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						AGGGGCCTTTTTGTATTGAGT	0.473									Agammaglobulinemia_X-linked				6	114	---	---	---	---	PASS
SEPT6	23157	broad.mit.edu	37	X	118750540	118750540	+	3'UTR	SNP	A	G	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118750540A>G	uc004ert.2	-	10					SEPT6_uc010nqk.2_RNA|SEPT6_uc004ers.2_3'UTR	NM_145802	NP_665801	Q14141	SEPT6_HUMAN	septin 6 isoform D						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						ACAGGGACACATGAACACTTG	0.438													8	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9769	9769	+	RNA	SNP	T	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9769T>C	uc011mfi.1	+	1		c.1107T>C			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TCCCTTCACCATTTCCGACGG	0.448													2	1	---	---	---	---	PASS
TNFRSF4	7293	broad.mit.edu	37	1	1147245	1147245	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1147245delA	uc001ade.2	-						TNFRSF4_uc001adf.2_Intron	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,						immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGGGGTCCACAGGAGGGGCCC	0.756													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24814056	24814057	+	IGR	INS	-	GGGA	GGGA	rs138251460	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24814056_24814057insGGGA								NIPAL3 (14584 upstream) : RCAN3 (15330 downstream)																							aaaGAGGGCGGGggagggaggg	0.040													4	4	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34631184	34631185	+	Intron	DEL	CA	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34631184_34631185delCA	uc001bxn.1	-						CSMD2_uc001bxm.1_5'Flank|C1orf94_uc001bxs.3_5'Flank	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCCCCCTCTCcacacacacaca	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118236234	118236237	+	IGR	DEL	CTTC	-	-	rs60203653	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118236234_118236237delCTTC								FAM46C (65224 upstream) : GDAP2 (169871 downstream)																							tcctttctttcttcctttctttct	0.000													4	3	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241950968	241950968	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241950968delA	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			actccatctcaaaaaaaaaaa	0.154													4	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87112438	87112438	+	Intron	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87112438delT	uc002srs.3	+						uc010fgu.1_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						AATTAAtttcttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91899558	91899559	+	IGR	INS	-	AAAGAGGAAGGTAAGA	AAAGAGGAAGGTAAGA	rs141170900	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91899558_91899559insAAAGAGGAAGGTAAGA								LOC654342 (51583 upstream) : GGT8P (63809 downstream)																							GATAAGGAGTCAAAGAGGAAGG	0.292													4	3	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109374753	109374753	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109374753delA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						acaccatctcaaaaaaaaaaa	0.085													7	5	---	---	---	---	
CYP27C1	339761	broad.mit.edu	37	2	127960745	127960746	+	Intron	INS	-	AA	AA	rs71394673		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127960745_127960746insAA	uc002tod.2	-							NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,							membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		cttcatctcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164606328	164606331	+	IGR	DEL	TCCT	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164606328_164606331delTCCT								FIGN (13815 upstream) : GRB14 (743002 downstream)																							TGGGGTATCCtccttccttccttc	0.265													3	5	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241724234	241724234	+	Intron	DEL	G	-	-	rs113212728		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241724234delG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCTCTGGGGCGGGGGGGGGGA	0.657													4	2	---	---	---	---	
CHCHD6	84303	broad.mit.edu	37	3	126583216	126583216	+	Intron	DEL	C	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126583216delC	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719	Q9BRQ6	CHCH6_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						atcaccacctccaccatcact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152434376	152434387	+	IGR	DEL	CCTTCCTTCCTT	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152434376_152434387delCCTTCCTTCCTT								MBNL1 (250808 upstream) : P2RY1 (118349 downstream)																							ccttcctttcccttccttccttccttccttcc	0.099													6	4	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176744032	176744032	+	Intron	DEL	A	-	-	rs112275760		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176744032delA	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CAGCCTCAGGAAAAAAAAAAA	0.318													6	3	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937314	195937315	+	Intron	INS	-	TAAAG	TAAAG	rs59406858		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937314_195937315insTAAAG	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		agagaaagaaagaaagaaaaga	0.233													6	4	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85617467	85617470	+	Intron	DEL	TTAT	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85617467_85617470delTTAT	uc003hpd.2	-						WDFY3_uc003hpe.1_Intron	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		tattcccctcttatttgtggtttc	0.127													16	7	---	---	---	---	
MANBA	4126	broad.mit.edu	37	4	103630548	103630560	+	Intron	DEL	AAAGAAAGAAAAA	-	-	rs28782317		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103630548_103630560delAAAGAAAGAAAAA	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		aggaagaaagaaagaaagaaaaaaaagaaagaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111991873	111991874	+	IGR	DEL	GT	-	-	rs148372593		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111991873_111991874delGT								MIR297 (210070 upstream) : None (None downstream)																							gtatatatgcgtgtgtgtgtgt	0.050													4	2	---	---	---	---	
EDNRA	1909	broad.mit.edu	37	4	148453478	148453478	+	Intron	DEL	A	-	-	rs34658974		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148453478delA	uc003iky.2	+						EDNRA_uc011cid.1_Intron|EDNRA_uc010ipe.1_Intron|EDNRA_uc010ipf.1_Intron|EDNRA_uc010ipg.1_Intron	NM_001957	NP_001948	P25101	EDNRA_HUMAN	endothelin receptor type A isoform a precursor						activation of adenylate cyclase activity|artery smooth muscle contraction|cell proliferation|glucose transport|respiratory gaseous exchange	integral to plasma membrane	endothelin-A receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|breast(1)	2	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Bosentan(DB00559)	attttgcctcaaaaaaaaaaa	0.144													9	5	---	---	---	---	
GLRB	2743	broad.mit.edu	37	4	158025092	158025093	+	Intron	DEL	TG	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158025092_158025093delTG	uc003ipj.2	+							NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	tgtgtgtgtttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
GLRB	2743	broad.mit.edu	37	4	158025114	158025115	+	Intron	DEL	TA	-	-	rs34144061		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158025114_158025115delTA	uc003ipj.2	+							NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	tgtgtgtgtgtagtctttagag	0.000													4	2	---	---	---	---	
FNIP2	57600	broad.mit.edu	37	4	159710474	159710477	+	Intron	DEL	TGTG	-	-	rs11730562	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159710474_159710477delTGTG	uc003iqe.3	+						FNIP2_uc003iqd.2_Intron	NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		tgtgtgtgtatgtgtgtgtgtgtg	0.235													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	177885815	177885816	+	IGR	DEL	TC	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177885815_177885816delTC								VEGFC (171920 upstream) : NEIL3 (345175 downstream)																							tcttttcttttcttttcttttc	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20095674	20095675	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs59909046		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20095674_20095675insAAGAAAGG								CDH18 (107367 upstream) : None (None downstream)																							gaaagaaaggaaagaaaggaag	0.054													9	4	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64595644	64595644	+	Intron	DEL	A	-	-	rs3832321		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64595644delA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTATATGAAGAAAAAAAAATT	0.308													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	68456802	68456803	+	IGR	DEL	TT	-	-	rs35308607		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68456802_68456803delTT								SLC30A5 (30923 upstream) : CCNB1 (6110 downstream)																							TGTGTCCGCCtttttttttttt	0.257													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70828418	70828421	+	Intron	DEL	TTTG	-	-	rs34000891		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70828418_70828421delTTTG	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAGCAATGATTTTGTTTGTTTGTG	0.279													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167290464	167290465	+	Intron	DEL	AC	-	-	rs36213538		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167290464_167290465delAC	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		tactaaaaatacacacacacac	0.000													4	4	---	---	---	---	
UNC5A	90249	broad.mit.edu	37	5	176285711	176285712	+	Intron	DEL	AA	-	-	rs57037749		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176285711_176285712delAA	uc003mey.2	+						UNC5A_uc003mex.1_Intron	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGAaagaaagaaagagagagag	0.173													4	2	---	---	---	---	
FGFR4	2264	broad.mit.edu	37	5	176524096	176524110	+	Intron	DEL	TCCTCCTGCTCCTCT	-	-	rs113339725		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176524096_176524110delTCCTCCTGCTCCTCT	uc003mfl.2	+						FGFR4_uc003mfm.2_Intron|FGFR4_uc011dfu.1_Intron|FGFR4_uc003mfo.2_Intron	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1						insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	ttcctcctcctcctcctgctcctcttcctcctcct	0.191										TSP Lung(9;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177398373	177398396	+	IGR	DEL	AGGACGAAGAGCTGGAGAGCGCCA	-	-	rs145131557		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177398373_177398396delAGGACGAAGAGCTGGAGAGCGCCA								LOC728554 (87106 upstream) : PROP1 (20840 downstream)																							GTCCCCGGGGAGGACGAAGAGCTGGAGAGCGCCAAGGACGACGA	0.531													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97633316	97633319	+	IGR	DEL	CCTT	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97633316_97633319delCCTT								OCM2 (13900 upstream) : LMTK2 (102878 downstream)																							tccctccctcccttccttccttct	0.010													3	3	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138316323	138316323	+	Intron	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138316323delT	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						TCCCCAAAGCtttttttttgg	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149390804	149390807	+	IGR	DEL	GAAA	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149390804_149390807delGAAA								ZNF767 (68923 upstream) : KRBA1 (21295 downstream)																							aaagaaaaaggaaagaaagaaaga	0.000													4	2	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													4	3	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	99006489	99006490	+	Intron	INS	-	GAAGAAGGAGAA	GAAGAAGGAGAA	rs146393102	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99006489_99006490insGAAGAAGGAGAA	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron|MATN2_uc010mbi.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			ggaggaggagggaagaaggaga	0.149													9	5	---	---	---	---	
TMEM74	157753	broad.mit.edu	37	8	109711375	109711390	+	Intron	DEL	TTCCTTCCTTCCTTCC	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109711375_109711390delTTCCTTCCTTCCTTCC	uc003ymx.2	-									Q96NL1	TMM74_HUMAN	Homo sapiens cDNA FLJ30668 fis, clone FCBBF1000675.						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			cctccctcttttccttccttccttccttccttcctt	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																							cttccttccttcctccctccct	0.124													11	7	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	120940982	120940983	+	Intron	DEL	TC	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120940982_120940983delTC	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTGGGTTCTTTCTTTTTTTTTT	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125850034	125850035	+	IGR	INS	-	T	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125850034_125850035insT								MTSS1 (109304 upstream) : LOC157381 (101849 downstream)																							tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
RFK	55312	broad.mit.edu	37	9	79002634	79002637	+	Intron	DEL	GGCC	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79002634_79002637delGGCC	uc004akd.2	-						RFK_uc004ake.2_Intron	NM_018339	NP_060809	Q969G6	RIFK_HUMAN	riboflavin kinase						riboflavin biosynthetic process	cytosol	ATP binding|metal ion binding|riboflavin kinase activity				0					Riboflavin(DB00140)	TATGTCCCTAggccgggggcagtg	0.142													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90097458	90097469	+	IGR	DEL	AGGAAGGAAGGA	-	-	rs28433935		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90097458_90097469delAGGAAGGAAGGA								C9orf170 (322817 upstream) : DAPK1 (15189 downstream)																							ggagggagggaggaaggaaggaaggaaggaag	0.108													4	2	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994275	114994277	+	Intron	DEL	AGA	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994275_114994277delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agaagagaagagaagagaagaga	0.079													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44851404	44851405	+	IGR	INS	-	TG	TG	rs140988366	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44851404_44851405insTG								HNRNPA3P1 (565539 upstream) : CXCL12 (14202 downstream)																							AGGGgtgtgtatgtgtgtgtgt	0.441													4	2	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72268564	72268599	+	Intron	DEL	TGTGTGTGTGTGCAGGCCTGTGGGAGCTGCGGAACC	-	-	rs72223134	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72268564_72268599delTGTGTGTGTGTGCAGGCCTGTGGGAGCTGCGGAACC	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						tgtgtgtgtgtgtgtgtgtgtgCAGGCCTGTGGGAGCTGCGGAACCTGTGTGTGTG	0.449													3	3	---	---	---	---	
RNLS	55328	broad.mit.edu	37	10	90264599	90264600	+	Intron	DEL	AG	-	-	rs72278132		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90264599_90264600delAG	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1						agagagagacagagtgtgtgtg	0.000													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97131604	97131604	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97131604delA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTACCTAACCAAAAAAAAAAA	0.264													5	3	---	---	---	---	
MTG1	92170	broad.mit.edu	37	10	135232951	135232952	+	Intron	INS	-	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135232951_135232952insC	uc001lnd.2	+						MTG1_uc010qve.1_Intron	NM_138384	NP_612393	Q9BT17	MTG1_HUMAN	GTP_binding protein precursor							mitochondrion	GTP binding|protein binding			skin(1)	1		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		TCAGTGCTGGGCCCCCTGGTGC	0.663													3	3	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14512339	14512339	+	Intron	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14512339delT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						ATACttttgcttttttttttt	0.119													4	3	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14746856	14746859	+	Intron	DEL	TCTT	-	-	rs10534250		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14746856_14746859delTCTT	uc001mln.2	+						PDE3B_uc001mlm.2_Intron|PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						tctttctttctctttctttctttc	0.078													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110846603	110846606	+	IGR	DEL	GGAA	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110846603_110846606delGGAA								ARHGAP20 (262691 upstream) : C11orf53 (280101 downstream)																							AAGGGAATGGggaaggaaggaagg	0.201													8	5	---	---	---	---	
TARBP2	6895	broad.mit.edu	37	12	53895601	53895602	+	Intron	INS	-	C	C	rs138441746	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53895601_53895602insC	uc001sdo.2	+						MAP3K12_uc001sdm.1_5'Flank|MAP3K12_uc001sdn.1_5'Flank|TARBP2_uc009znb.2_Intron|TARBP2_uc001sdp.2_Intron|TARBP2_uc001sdq.2_Intron|TARBP2_uc001sdr.2_Intron|TARBP2_uc001sds.2_Intron|TARBP2_uc001sdt.2_Intron|TARBP2_uc001sdu.2_Intron|TARBP2_uc001sdv.2_Intron	NM_134323	NP_599150	Q15633	TRBP2_HUMAN	TAR RNA binding protein 2 isoform a						miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding			central_nervous_system(1)	1						AATGCATTCTTCCCCCCTTGCT	0.564													3	3	---	---	---	---	
DPY19L2	283417	broad.mit.edu	37	12	64057726	64057727	+	Intron	INS	-	ATA	ATA	rs35480058		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64057726_64057727insATA	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		aataaattgttatattaatttt	0.252													3	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGacacacacacacacacacacagacacacacac	0.234													4	3	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122801517	122801517	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122801517delA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		AGTCACTCGCAAAAAAAAAAA	0.308													4	2	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76409591	76409591	+	Intron	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76409591delA	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTTAAAATGTAAATGATTGAA	0.274													11	5	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79694164	79694167	+	Intron	DEL	CCTT	-	-	rs75601745		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79694164_79694167delCCTT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		tcccttcctcccttcctcccttcc	0.123													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	54004802	54004803	+	Intron	INS	-	A	A	rs112182674		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54004802_54004803insA	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		ACCCCACCGCCAAAAAAAAAAA	0.188													1	5	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55657630	55657630	+	Intron	DEL	G	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55657630delG	uc002acv.1	-						CCPG1_uc002acy.2_Intron|CCPG1_uc002acu.1_Intron|CCPG1_uc002acw.1_Intron|CCPG1_uc002acx.2_Intron|CCPG1_uc010bfk.1_Intron|CCPG1_uc002acz.1_Intron	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		ttttttttttgtttttttttt	0.050													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56038833	56038833	+	IGR	DEL	G	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56038833delG								PRTG (3656 upstream) : NEDD4 (80298 downstream)																							aaaaaaaaaagaaGCTCCTGG	0.279													3	4	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9127676	9127677	+	IGR	INS	-	C	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9127676_9127677insC								USP7 (70335 upstream) : C16orf72 (57860 downstream)																							cttccttccttccttccttcct	0.015													6	4	---	---	---	---	
ACSM5	54988	broad.mit.edu	37	16	20442095	20442097	+	Intron	DEL	AAG	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20442095_20442097delAAG	uc002dhe.2	+							NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						aaaggaaagaaagaggaaaggaa	0.054													3	4	---	---	---	---	
CIRH1A	84916	broad.mit.edu	37	16	69190057	69190057	+	Intron	DEL	C	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69190057delC	uc002ews.3	+						CIRH1A_uc002ewr.2_Intron|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ttctttctttctttttttttt	0.159													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87072314	87072319	+	IGR	DEL	AGAGAA	-	-	rs67597393		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87072314_87072319delAGAGAA								FOXL1 (457011 upstream) : FBXO31 (290625 downstream)																							gaagggagagagagaaagagaaagag	0.097													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	10175321	10175321	+	IGR	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10175321delA								GAS7 (73453 upstream) : MYH13 (28862 downstream)																							ggaccctgtcaaaaaaaaaag	0.000													4	2	---	---	---	---	
GSDMA	284110	broad.mit.edu	37	17	38121480	38121482	+	Intron	DEL	AAG	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38121480_38121482delAAG	uc002htl.1	+						GSDMA_uc002htm.1_5'Flank	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1						apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0						gaaagaaagaaagaaggaaggaa	0.064													4	4	---	---	---	---	
TMUB2	79089	broad.mit.edu	37	17	42266286	42266286	+	Intron	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42266286delT	uc002ifo.2	+						C17orf65_uc002ifn.2_5'Flank|TMUB2_uc002ifp.2_Intron|TMUB2_uc010wiu.1_Intron|TMUB2_uc002ifq.2_Intron|TMUB2_uc002ifr.2_Intron|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Intron|TMUB2_uc002ifu.2_Intron|TMUB2_uc002ifv.2_Intron|TMUB2_uc002ifw.1_Intron|TMUB2_uc002ifx.2_Intron|TMUB2_uc002ify.2_5'Flank	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain							integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ACTGAACTCCTTTTTTTTTTT	0.478													4	2	---	---	---	---	
RNF126P1	376412	broad.mit.edu	37	17	55120290	55120297	+	5'Flank	DEL	TTCCTTCC	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55120290_55120297delTTCCTTCC	uc002iuw.2	+							NR_002818				Homo sapiens ring finger protein 126 pseudogene 1, mRNA (cDNA clone IMAGE:5166840), with apparent retained intron.												0						tcctttccttttccttccttccttcctt	0.014													5	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544130	80544130	+	Intron	DEL	C	-	-	rs57940566	by1000genomes	TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544130delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggccgggggggga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32549345	32549363	+	IGR	DEL	TTCCTTCCTTCCTTCTTTC	-	-	rs60874169		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32549345_32549363delTTCCTTCCTTCCTTCTTTC								TSHZ3 (709155 upstream) : ZNF507 (287151 downstream)																							tctcccttctttccttccttccttctttcttccttcctt	0.146													4	2	---	---	---	---	
ACTN4	81	broad.mit.edu	37	19	39218707	39218708	+	Intron	DEL	CT	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39218707_39218708delCT	uc002oja.1	+						ACTN4_uc002ojb.1_Intron	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCATTAACTGctctctctctct	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47803957	47803960	+	IGR	DEL	TCCT	-	-	rs34256769		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47803957_47803960delTCCT								PRR24 (24978 upstream) : C5AR1 (9144 downstream)																							TCTCTATTTCtccttccttccttc	0.069													2	4	---	---	---	---	
KLK1	3816	broad.mit.edu	37	19	51327163	51327163	+	5'Flank	DEL	G	-	-	rs34301743		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51327163delG	uc002ptk.1	-						KLK1_uc010ycg.1_5'Flank	NM_002257	NP_002248	P06870	KLK1_HUMAN	kallikrein 1 preproprotein						proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGGACAATTGCCCCCCCCCC	0.637													4	2	---	---	---	---	
ZNF836	162962	broad.mit.edu	37	19	52667684	52667685	+	Intron	DEL	GA	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52667684_52667685delGA	uc010ydi.1	-						ZNF836_uc010ydj.1_Intron	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						aggagggagggagagagagaga	0.000													4	3	---	---	---	---	
HM13	81502	broad.mit.edu	37	20	30156903	30156904	+	Intron	INS	-	T	T	rs11376444		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30156903_30156904insT	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTTTATTGTTGTTTTTTTTTTT	0.490											OREG0025852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
C20orf186	149954	broad.mit.edu	37	20	31695006	31695006	+	Intron	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31695006delT	uc010zue.1	+							NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0						caagactcagttaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57104948	57104949	+	Intron	INS	-	TT	TT	rs150113339		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57104948_57104949insTT	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																		tgggcctggagttttttttttt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21797194	21797194	+	IGR	DEL	T	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21797194delT								None (None upstream) : C21orf131 (317720 downstream)																							TTGAGCATCATTTTTTTTTTA	0.368													4	2	---	---	---	---	
PIWIL3	440822	broad.mit.edu	37	22	25153627	25153632	+	Intron	DEL	ACACAC	-	-	rs62232189		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25153627_25153632delACACAC	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						tgtatatattacacacacacacacac	0.000													4	2	---	---	---	---	
KAL1	3730	broad.mit.edu	37	X	8655634	8655635	+	Intron	INS	-	AC	AC			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8655634_8655635insAC	uc004csf.2	-							NM_000216	NP_000207	P23352	KALM_HUMAN	Kallmann syndrome 1 protein precursor						axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity			ovary(3)|pancreas(1)	4						TAATCCAGTAAacacacacaca	0.193													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	21844464	21844464	+	IGR	DEL	A	-	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21844464delA								SMPX (68234 upstream) : MBTPS2 (13192 downstream)																							cctgtctcagaaaaaaaaaaa	0.065													4	2	---	---	---	---	
HDAC8	55869	broad.mit.edu	37	X	71770930	71770931	+	Intron	DEL	CA	-	-	rs72423698		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71770930_71770931delCA	uc004eau.2	-						HDAC8_uc011mqe.1_Intron|HDAC8_uc011mqf.1_Intron|HDAC8_uc011mqg.1_Intron|HDAC8_uc011mqh.1_Intron|HDAC8_uc010nlk.1_Intron|HDAC8_uc004eav.2_Intron|HDAC8_uc004eaw.2_Intron	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8						chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)	GAAGTCAGCGcacacacacaca	0.272													4	3	---	---	---	---	
