Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5925110	5925110	+	Intron	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5925110C>A	uc001alq.1	-						NPHP4_uc001alr.1_3'UTR	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CACTGCCCGTCTCCAGGCTGG	0.627													3	28	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11188164	11188164	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11188164G>T	uc001asd.2	-	43	6051	c.5930C>A	c.(5929-5931)ACA>AAA	p.T1977K	MTOR_uc001asc.2_Missense_Mutation_p.T182K	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1977	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						AGAAGCCACTGTCAGTGGGTA	0.478													61	105	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16259441	16259441	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16259441C>T	uc001axk.1	+	11	6910	c.6706C>T	c.(6706-6708)CCT>TCT	p.P2236S	SPEN_uc010obp.1_Missense_Mutation_p.P2195S	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2236	RID.|Interaction with MSX2 (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTTCCCAGCACCTCCACCTTA	0.567													41	91	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16946434	16946434	+	RNA	SNP	C	T	T	rs367060		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946434C>T	uc010ocf.1	-	3		c.464G>A			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CTCAGCCTTCCGCCGGGCCAG	0.672													3	18	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43905719	43905719	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43905719G>A	uc001cjk.1	+	36	4975	c.4513G>A	c.(4513-4515)GGA>AGA	p.G1505R		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2404						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CACACCCACAGGTATGCAAGT	0.577													19	89	---	---	---	---	PASS
HSD3B2	3284	broad.mit.edu	37	1	119965210	119965210	+	Silent	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119965210G>A	uc001ehs.2	+	3	1859	c.1086G>A	c.(1084-1086)CGG>CGA	p.R362R	HSD3B2_uc001eht.2_Silent_p.R362R|HSD3B2_uc001ehu.2_Intron	NM_000198	NP_000189	P26439	3BHS2_HUMAN	3 beta-hydroxysteroid dehydrogenase 2	362					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	TTGTGGACCGGCACAAGGAGA	0.512													4	72	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144829025	144829025	+	Intron	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144829025A>G	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elr.3_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTGATCAGTCAGACATTTTAA	0.473													3	10	---	---	---	---	PASS
PRUNE	58497	broad.mit.edu	37	1	151001376	151001376	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151001376C>T	uc001ewh.1	+	7	1025	c.889C>T	c.(889-891)CGG>TGG	p.R297W	PRUNE_uc001ewi.1_Missense_Mutation_p.R115W|PRUNE_uc010pco.1_Missense_Mutation_p.R65W|PRUNE_uc001ewj.1_Intron|PRUNE_uc001ewk.1_Intron	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	prune	297						cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGAGCCAGTGCGGCAGTTGGC	0.498													23	97	---	---	---	---	PASS
TDRKH	11022	broad.mit.edu	37	1	151751219	151751219	+	Silent	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151751219A>G	uc009wnb.1	-	6	1007	c.825T>C	c.(823-825)AGT>AGC	p.S275S	TDRKH_uc001eyy.2_Silent_p.S51S|TDRKH_uc001ezb.3_Silent_p.S271S|TDRKH_uc001ezc.3_Silent_p.S230S|TDRKH_uc001eza.3_Silent_p.S275S|TDRKH_uc001ezd.3_Silent_p.S275S|TDRKH_uc010pdn.1_Silent_p.S51S	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	275							RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCTGTCATCACTAGGTTTCT	0.507													23	93	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170940893	170940893	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170940893G>A	uc001ghg.2	+	8	615	c.485G>A	c.(484-486)AGT>AAT	p.S162N	C1orf129_uc009wvy.2_Splice_Site|C1orf129_uc010plz.1_Missense_Mutation_p.S162N	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	162							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CATTAGATAAGTGTTGATGCT	0.408													6	545	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186136027	186136027	+	Missense_Mutation	SNP	G	A	A	rs150494959	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186136027G>A	uc001grq.1	+	100	15756	c.15527G>A	c.(15526-15528)CGT>CAT	p.R5176H	HMCN1_uc001grs.1_Missense_Mutation_p.R745H	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5176	EGF-like 2; calcium-binding (Potential).				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TGTGTGGTCCGTTGTGGAAGT	0.463													29	135	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8919170	8919170	+	Silent	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8919170G>T	uc002qzc.2	-	19	2652	c.2470C>A	c.(2470-2472)CGG>AGG	p.R824R	KIDINS220_uc010yiv.1_Silent_p.R590R|KIDINS220_uc002qzd.2_Silent_p.R782R|KIDINS220_uc010yiw.1_Silent_p.R825R	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	824	KAP NTPase.|Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTGAATCCCGAAGCACACTA	0.408													70	415	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17698910	17698910	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17698910C>G	uc002rcl.1	-	1	797	c.773G>C	c.(772-774)AGT>ACT	p.S258T	RAD51AP2_uc010exn.1_Missense_Mutation_p.S249T	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	258										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CTGAGGGACACTTATTGTGCC	0.348													5	236	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	26029201	26029201	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26029201G>A	uc002rgs.2	-	3	370	c.149C>T	c.(148-150)ACT>ATT	p.T50I		NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	50					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGAGGAGAAGTCCCACTGCA	0.373													10	25	---	---	---	---	PASS
LOC401010	401010	broad.mit.edu	37	2	132202007	132202007	+	5'UTR	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132202007G>C	uc002tst.2	-	1						NR_002826				SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);												0						ACCATGGCGAGGGTCACAGGA	0.577													16	57	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166183424	166183424	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166183424T>G	uc002udc.2	+	13	2369	c.2079T>G	c.(2077-2079)GAT>GAG	p.D693E	SCN2A_uc002udd.2_Missense_Mutation_p.D693E|SCN2A_uc002ude.2_Missense_Mutation_p.D693E	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	693					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	TTTCCATGGATTTATTGGAAG	0.373													58	210	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207170060	207170060	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207170060G>T	uc002vbp.2	+	5	1058	c.808G>T	c.(808-810)GTT>TTT	p.V270F		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	270							nucleic acid binding|zinc ion binding			ovary(3)	3						AGATAAGTTGGTTTTGTGGAA	0.363													8	33	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211438033	211438033	+	Silent	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211438033A>G	uc002vee.3	+	2	270	c.138A>G	c.(136-138)GCA>GCG	p.A46A	CPS1_uc010fur.2_Silent_p.A52A	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	46	Anthranilate phosphoribosyltransferase homolog.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CACAGACAGCACACATTGTCC	0.393													5	312	---	---	---	---	PASS
CYP27A1	1593	broad.mit.edu	37	2	219677097	219677097	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219677097A>G	uc002viz.3	+	3	1033	c.599A>G	c.(598-600)AAC>AGC	p.N200S		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	200					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	GCTTCGGGGAACCAGGTGTCG	0.552													5	305	---	---	---	---	PASS
MSL3L2	151507	broad.mit.edu	37	2	234775439	234775439	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234775439T>A	uc010znf.1	-	2	641	c.403A>T	c.(403-405)ACT>TCT	p.T135S		NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						CTCCTATTAGTATTTGTGGCA	0.468													9	39	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191479	10191479	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191479C>G	uc003bvc.2	+	3	685	c.472C>G	c.(472-474)CTG>GTG	p.L158V	VHL_uc003bvd.2_Missense_Mutation_p.L117V	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	158	Interaction with Elongin BC complex.		L -> V (in VHLD; type I).|L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L158V(8)|p.L158Q(6)|p.L158P(3)|p.L158fs*16(3)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.L158fs*15(1)|p.T157_K159del(1)|p.Y156*(1)|p.L158fs*6(1)|p.L158fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGTGTATACTCTGAAAGAGCG	0.498		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				9	41	---	---	---	---	PASS
CCDC51	79714	broad.mit.edu	37	3	48474087	48474087	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48474087G>C	uc003csz.2	-	4	1088	c.967C>G	c.(967-969)CAG>GAG	p.Q323E	PLXNB1_uc003csx.2_5'Flank|CCDC51_uc003cta.2_Missense_Mutation_p.Q214E|CCDC51_uc003ctb.2_Missense_Mutation_p.Q214E|CCDC51_uc003ctc.2_Missense_Mutation_p.Q323E|CCDC51_uc003ctd.2_Missense_Mutation_p.Q214E	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	323						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCATCAAGCTGCTCTCGTAAG	0.527													17	67	---	---	---	---	PASS
CCDC51	79714	broad.mit.edu	37	3	48474088	48474088	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48474088C>T	uc003csz.2	-	4	1087	c.966G>A	c.(964-966)GAG>GAA	p.E322E	PLXNB1_uc003csx.2_5'Flank|CCDC51_uc003cta.2_Silent_p.E213E|CCDC51_uc003ctb.2_Silent_p.E213E|CCDC51_uc003ctc.2_Silent_p.E322E|CCDC51_uc003ctd.2_Silent_p.E213E	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	322						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CATCAAGCTGCTCTCGTAAGC	0.527													17	69	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53845422	53845422	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53845422A>T	uc003dgv.3	+	48	6638	c.6475A>T	c.(6475-6477)ACC>TCC	p.T2159S	CACNA1D_uc003dgu.3_Missense_Mutation_p.T2179S|CACNA1D_uc003dgy.3_Missense_Mutation_p.T2135S|CACNA1D_uc003dgw.3_Missense_Mutation_p.T1826S|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	2159	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	GATATGCATCACCACCTTGTA	0.582													8	26	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124303724	124303724	+	Intron	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124303724C>T	uc003ehg.2	+						KALRN_uc003ehi.2_Intron|KALRN_uc003ehk.2_Missense_Mutation_p.A19V|KALRN_uc003ehj.2_Missense_Mutation_p.A19V	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TGGCTCTTTGCTAAGTGCTGC	0.672													4	19	---	---	---	---	PASS
KY	339855	broad.mit.edu	37	3	134338074	134338074	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134338074C>T	uc010hty.2	-	8	688	c.626G>A	c.(625-627)CGC>CAC	p.R209H	KY_uc011blw.1_Missense_Mutation_p.R209H|KY_uc011blx.1_Missense_Mutation_p.R188H|KY_uc003eqr.1_5'UTR	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	209						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						GAAGGCTTGGCGGTCCTTCTC	0.562													4	145	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170185029	170185029	+	Silent	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170185029G>A	uc003fgz.2	-	8	2446	c.2130C>T	c.(2128-2130)TAC>TAT	p.Y710Y	CLDN11_uc011bpt.1_Intron|uc003fha.1_5'Flank	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	710						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CCTCTGTGGCGTAGGAGAAAC	0.587													26	91	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184689536	184689536	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184689536G>A	uc003fpb.1	+	39	3581	c.3410G>A	c.(3409-3411)CGT>CAT	p.R1137H	VPS8_uc010hyd.1_Missense_Mutation_p.R1047H|VPS8_uc010hye.1_Missense_Mutation_p.R566H	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	1139							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CAGCAGCAACGTGAGGTAGGA	0.294													7	38	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48555266	48555266	+	Silent	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48555266G>T	uc003gyh.1	-	36	5006	c.4401C>A	c.(4399-4401)ATC>ATA	p.I1467I	FRYL_uc003gyk.2_Silent_p.I1467I|FRYL_uc003gyg.1_Silent_p.I163I|FRYL_uc003gyi.1_Silent_p.I356I	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1467					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AGCTGGAAGTGATGCGATAAT	0.363													4	167	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82377759	82377759	+	Intron	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82377759C>A	uc003hmi.1	-						RASGEF1B_uc003hmj.1_Intron|RASGEF1B_uc010ijq.1_Intron|RASGEF1B_uc003hmk.2_Missense_Mutation_p.A162S	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CCCACCCAGGCTCTGCCTGGG	0.483													6	95	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115769372	115769372	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115769372A>C	uc003ibu.2	-	9	2618	c.1939T>G	c.(1939-1941)TGG>GGG	p.W647G	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	647	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TTTTCTTACCAGTCTATTCCT	0.348													26	131	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126240912	126240912	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126240912G>T	uc003ifj.3	+	1	3346	c.3346G>T	c.(3346-3348)GGG>TGG	p.G1116W		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1116	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GCAGAGGGCTGGGTCGTTTGT	0.378													5	326	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141578684	141578684	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141578684C>A	uc010ioj.2	-	12	2476	c.2204G>T	c.(2203-2205)GGA>GTA	p.G735V		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	735						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ACAATACCTTCCCAAAACGGT	0.423													7	370	---	---	---	---	PASS
TRIM2	23321	broad.mit.edu	37	4	154216562	154216562	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154216562C>A	uc003ing.2	+	6	1004	c.803C>A	c.(802-804)ACC>AAC	p.T268N	TRIM2_uc003inh.2_Missense_Mutation_p.T295N	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2	268						cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GGCACGGAGACCGAGGTCCTA	0.602													4	28	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186188308	186188308	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186188308A>T	uc003ixh.2	+	5	787	c.598A>T	c.(598-600)AGG>TGG	p.R200W		NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	200					cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GAAGCAACTAAGGTATTTGGT	0.413													39	182	---	---	---	---	PASS
PELO	53918	broad.mit.edu	37	5	52096851	52096851	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52096851C>T	uc003jos.2	+	2	1608	c.623C>T	c.(622-624)GCC>GTC	p.A208V	ITGA1_uc003jov.2_Intron|ITGA1_uc003jou.2_Intron|PELO_uc003jot.1_Intron	NM_015946	NP_057030	Q9BRX2	PELO_HUMAN	pelota homolog	208					cell cycle|cell division|translation	cytoplasm|nucleus	endonuclease activity|metal ion binding|protein binding				0		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				ATCCTGGTGGCCAGCCCAGGA	0.517													4	150	---	---	---	---	PASS
SFRS12	140890	broad.mit.edu	37	5	65458025	65458025	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65458025C>G	uc003juo.2	+	5	812	c.152C>G	c.(151-153)CCA>CGA	p.P51R	SFRS12_uc003jun.2_Missense_Mutation_p.P167R|SFRS12_uc010iwy.2_Missense_Mutation_p.P51R	NM_139168	NP_631907	Q8WXA9	SREK1_HUMAN	splicing factor, arginine/serine-rich 12 isoform	51					mRNA processing|RNA splicing	spliceosomal complex	nucleic acid binding|nucleotide binding|protein binding				0		Lung NSC(167;9.34e-06)|Prostate(74;0.00187)|Ovarian(174;0.0545)|Breast(144;0.0928)|Colorectal(97;0.234)		Lung(70;0.00449)		CCACAGCCACCACTTATGGGA	0.413													21	124	---	---	---	---	PASS
FCHO2	115548	broad.mit.edu	37	5	72333026	72333026	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72333026A>G	uc003kcl.2	+	10	1014	c.898A>G	c.(898-900)AAA>GAA	p.K300E	FCHO2_uc011csl.1_Missense_Mutation_p.K267E|FCHO2_uc011csk.1_Missense_Mutation_p.K300E|FCHO2_uc011csm.1_Missense_Mutation_p.K106E	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a	300										ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TAAAAAGGAAAAAGATGCAGA	0.259													9	69	---	---	---	---	PASS
PCSK1	5122	broad.mit.edu	37	5	95759098	95759098	+	Silent	SNP	T	C	C	rs145659863		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95759098T>C	uc003kls.1	-	4	668	c.462A>G	c.(460-462)AAA>AAG	p.K154K		NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	154	Catalytic.				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCGTAATGCCTTTTTGCCAAA	0.448													3	93	---	---	---	---	PASS
SLC17A2	10246	broad.mit.edu	37	6	25926001	25926001	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25926001C>G	uc011dkb.1	-	1	107	c.24G>C	c.(22-24)AGG>AGC	p.R8S	SLC17A2_uc011dkc.1_Missense_Mutation_p.R8S|SLC17A2_uc003nfl.2_Missense_Mutation_p.R8S			O00624	NPT3_HUMAN	SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;	8					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1						CTTTACCTTTCCTGGTGGCAG	0.473													9	468	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	28503665	28503665	+	IGR	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28503665G>T								GPX5 (937 upstream) : SCAND3 (35743 downstream)																							ttaatcatagGAATAGTATGT	0.075													16	53	---	---	---	---	PASS
LYPLA2P1	653639	broad.mit.edu	37	6	33333333	33333333	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33333333G>A	uc003shx.2	-	1	807	c.673C>T	c.(673-675)CCT>TCT	p.P225S		NR_001444				SubName: Full=Lysophospholipase II; Flags: Fragment;												0						AGTTAGACAGGAGGCAGCAGC	0.577													3	19	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35922767	35922767	+	Intron	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35922767T>C	uc003olm.2	-						SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						CTTTTTATTTTGATTGACCTT	0.254													9	46	---	---	---	---	PASS
FRS3	10817	broad.mit.edu	37	6	41739170	41739170	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41739170C>A	uc003orc.1	-	7	910	c.666G>T	c.(664-666)CAG>CAT	p.Q222H		NM_006653	NP_006644	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	222					fibroblast growth factor receptor signaling pathway	plasma membrane	fibroblast growth factor receptor binding|insulin receptor binding			ovary(2)	2	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTCCCCGGGCCTGCGGGAGGA	0.662													4	113	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90388338	90388338	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90388338A>C	uc003pnn.1	-	75	12508	c.12392T>G	c.(12391-12393)TTT>TGT	p.F4131C		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4131					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGGTGTTTAAAGAGGTCTGA	0.443													67	260	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101248186	101248186	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101248186G>A	uc003pqk.2	-	6	1446	c.1117C>T	c.(1117-1119)CGG>TGG	p.R373W	ASCC3_uc011eai.1_Missense_Mutation_p.R275W|ASCC3_uc003pql.2_Missense_Mutation_p.R373W	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	373					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTTTGTATCCGCAATTCCTTA	0.348													5	255	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117677884	117677884	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117677884G>T	uc003pxp.1	-	25	4248	c.4049C>A	c.(4048-4050)CCA>CAA	p.P1350Q	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1350	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTATATCAATGGTTTCTCTAG	0.408			T	GOPC|ROS1	glioblastoma|NSCLC								39	171	---	---	---	---	PASS
STL	7955	broad.mit.edu	37	6	125233396	125233396	+	RNA	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125233396A>T	uc003pzq.2	-	7		c.1338T>A				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0						GCTCCATGGTATATGGTATGT	0.408			T	ETV6	B-ALL								24	132	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2946320	2946320	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2946320G>C	uc003smv.2	-	25	3821	c.3417C>G	c.(3415-3417)ATC>ATG	p.I1139M		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1139	Guanylate kinase-like.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCTCCTCGCCGATCTTGTCCT	0.652			Mis		DLBCL								21	122	---	---	---	---	PASS
PHF14	9678	broad.mit.edu	37	7	11078422	11078422	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11078422T>G	uc003sry.1	+	11	2451	c.2016T>G	c.(2014-2016)AAT>AAG	p.N672K	PHF14_uc011jxi.1_Missense_Mutation_p.N387K|PHF14_uc003srz.2_Missense_Mutation_p.N672K|PHF14_uc011jxj.1_Missense_Mutation_p.N387K	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2	672							zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		AAAACCTGAATGGAAAACTTC	0.348													7	33	---	---	---	---	PASS
LOC643955	643955	broad.mit.edu	37	7	62752443	62752443	+	3'UTR	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62752443G>C	uc011kdj.1	-	3						NR_003952				Homo sapiens cDNA clone IMAGE:30377995, containing frame-shift errors.												0						CTTATGTCTAGTAAGGTTTGA	0.438													6	34	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91668040	91668040	+	Nonsense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91668040C>G	uc003ulg.2	+	17	4871	c.4646C>G	c.(4645-4647)TCA>TGA	p.S1549*	AKAP9_uc003ule.2_Nonsense_Mutation_p.S1561*|AKAP9_uc003ulf.2_Nonsense_Mutation_p.S1549*|AKAP9_uc003uli.2_Nonsense_Mutation_p.S1174*	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1561					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CTGACTATTTCAGAAGAAATG	0.308			T	BRAF	papillary thyroid								54	193	---	---	---	---	PASS
GATAD1	57798	broad.mit.edu	37	7	92085934	92085934	+	3'UTR	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92085934A>G	uc003ulx.1	+	5					GATAD1_uc011khq.1_RNA	NM_021167	NP_066990	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			ctgtagccccagctattGCAc	0.184													13	46	---	---	---	---	PASS
ZNHIT1	10467	broad.mit.edu	37	7	100866818	100866818	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100866818A>G	uc003uye.2	+	3	746	c.254A>G	c.(253-255)CAG>CGG	p.Q85R	ZNHIT1_uc003uyf.2_RNA	NM_006349	NP_006340	O43257	ZNHI1_HUMAN	zinc finger, HIT domain containing 1	85							metal ion binding|protein binding			large_intestine(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					AAAAACTTTCAGGCCCTGTTG	0.582													3	162	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120911339	120911339	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120911339G>A	uc003vjq.3	+	22	3170	c.2723G>A	c.(2722-2724)AGT>AAT	p.S908N		NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	908						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TCCAATCAGAGTGAAGTACAG	0.323													17	119	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124404430	124404430	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124404430C>T	uc003vli.2	-	1	1252	c.601G>A	c.(601-603)GCC>ACC	p.A201T		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	201	Extracellular (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AGTCCATTGGCCGTCTTGGAC	0.622													4	93	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142568043	142568043	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142568043T>G	uc011kst.1	+	18	3471	c.2684T>G	c.(2683-2685)TTG>TGG	p.L895W	EPHB6_uc011ksu.1_Missense_Mutation_p.L895W|EPHB6_uc003wbs.2_Missense_Mutation_p.L603W|EPHB6_uc003wbt.2_Missense_Mutation_p.L369W|EPHB6_uc003wbu.2_Missense_Mutation_p.L603W|EPHB6_uc003wbv.2_Missense_Mutation_p.L279W	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	895	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					CTACTTATGTTGGACACTTGG	0.562													88	287	---	---	---	---	PASS
SMARCD3	6604	broad.mit.edu	37	7	150945693	150945693	+	5'UTR	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150945693C>A	uc003wjs.2	-	1					SMARCD3_uc003wjt.2_Intron|SMARCD3_uc003wju.2_Intron|SMARCD3_uc011kvh.1_5'UTR|SMARCD3_uc010lqa.1_5'UTR	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin						cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ctctcttcctctttctttccc	0.498													10	46	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8088411	8088411	+	RNA	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8088411A>G	uc011kwt.1	+	2		c.275A>G			FLJ10661_uc010lrq.2_RNA|FLJ10661_uc003wsf.3_RNA	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						GAGCTGCTGCAGGATATTTTG	0.488													5	72	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73848635	73848635	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73848635T>C	uc003xzb.2	+	3	1633	c.1045T>C	c.(1045-1047)TTT>CTT	p.F349L		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	349	Helical; Name=Segment S5; (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			GATAATGATATTTTCCAGCCT	0.473													66	262	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113349921	113349921	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113349921C>T	uc003ynu.2	-	43	6851	c.6692G>A	c.(6691-6693)CGA>CAA	p.R2231Q	CSMD3_uc003yns.2_Missense_Mutation_p.R1433Q|CSMD3_uc003ynt.2_Missense_Mutation_p.R2191Q|CSMD3_uc011lhx.1_Missense_Mutation_p.R2127Q|CSMD3_uc003ynw.1_5'UTR	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2231	Extracellular (Potential).|Sushi 12.					integral to membrane|plasma membrane		p.R2231Q(1)		ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAAACCATTTCGAAACGGGCG	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			6	195	---	---	---	---	PASS
PPAPDC2	403313	broad.mit.edu	37	9	4663275	4663275	+	3'UTR	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4663275T>G	uc003zin.2	+	1					C9orf68_uc003zik.2_Intron|C9orf68_uc003zil.2_Intron|C9orf68_uc010mhj.2_Intron|C9orf68_uc011lly.1_Intron|C9orf68_uc011llz.1_Intron|C9orf68_uc003zim.2_Intron	NM_203453	NP_982278	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain							integral to membrane	hydrolase activity				0	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		ACCATCTCATTGATTATGGCA	0.493													33	158	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6013437	6013437	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6013437T>G	uc003zjr.2	-	1	2182	c.2171A>C	c.(2170-2172)CAT>CCT	p.H724P	RANBP6_uc011lmf.1_Missense_Mutation_p.H372P|RANBP6_uc003zjs.2_Missense_Mutation_p.H312P	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	724					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		AACATTGTCATGGAAATAAAA	0.418													33	149	---	---	---	---	PASS
FANCG	2189	broad.mit.edu	37	9	35078167	35078167	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35078167A>T	uc003zwb.1	-	4	973	c.481T>A	c.(481-483)TTG>ATG	p.L161M	FANCG_uc003zwa.1_5'Flank|FANCG_uc010mkj.1_Intron|FANCG_uc011lot.1_Missense_Mutation_p.L161M	NM_004629	NP_004620	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	161					cell cycle checkpoint|DNA repair|mitochondrion organization	mitochondrion|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|large_intestine(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCTAGTAACAAGGCCAGGTCC	0.592			Mis|N|F|S			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				23	98	---	---	---	---	PASS
RNF38	152006	broad.mit.edu	37	9	36376116	36376116	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36376116A>T	uc003zzh.2	-	3	362	c.171T>A	c.(169-171)GAT>GAA	p.D57E	RNF38_uc003zzi.2_Missense_Mutation_p.D7E|RNF38_uc003zzj.2_5'UTR|RNF38_uc003zzk.2_5'UTR|RNF38_uc003zzl.2_5'UTR|RNF38_uc003zzm.2_5'UTR	NM_022781	NP_073618	Q9H0F5	RNF38_HUMAN	ring finger protein 38 isoform 1	57							zinc ion binding			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)			GACTTGGACTATCTTCACTCT	0.423													17	77	---	---	---	---	PASS
CTSL2	1515	broad.mit.edu	37	9	99797965	99797965	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99797965C>G	uc004awt.2	-	6	829	c.632G>C	c.(631-633)TGT>TCT	p.C211S	CTSL2_uc010msi.2_Missense_Mutation_p.C211S|CTSL2_uc004awu.2_Missense_Mutation_p.C156S|CTSL2_uc010msj.1_Missense_Mutation_p.C156S	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein	211						lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				TCTGTACTTACAGATTTCATC	0.463													4	57	---	---	---	---	PASS
TMOD1	7111	broad.mit.edu	37	9	100286582	100286582	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100286582G>A	uc004axk.1	+	2	325	c.112G>A	c.(112-114)GAC>AAC	p.D38N	TMOD1_uc004axl.1_Missense_Mutation_p.D38N	NM_003275	NP_003266	P28289	TMOD1_HUMAN	tropomodulin 1	38					muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		GGATGAGCTGGACCCTGATGT	0.512													18	56	---	---	---	---	PASS
OR1J2	26740	broad.mit.edu	37	9	125273078	125273078	+	5'UTR	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125273078A>T	uc004bmj.1	+	4					OR1J2_uc011lyv.1_5'Flank	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|pancreas(1)|breast(1)	5						AGGGCAAAGGAGTATGAGCCC	0.468													26	166	---	---	---	---	PASS
GOLGA1	2800	broad.mit.edu	37	9	127690521	127690521	+	Silent	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127690521G>A	uc004bpc.2	-	6	687	c.345C>T	c.(343-345)GCC>GCT	p.A115A	GOLGA1_uc010mws.2_RNA|GOLGA1_uc010mwt.1_Silent_p.A90A	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	115	Potential.					Golgi cisterna membrane				ovary(1)	1						TGGCTCTGTTGGCTTGGAATG	0.428													25	87	---	---	---	---	PASS
LCN1	3933	broad.mit.edu	37	9	138416709	138416709	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138416709A>G	uc004cfz.1	+	5	495	c.437A>G	c.(436-438)GAG>GGG	p.E146G	LCN1_uc004cga.1_Missense_Mutation_p.E146G	NM_002297	NP_002288	P31025	LCN1_HUMAN	lipocalin 1 precursor	146					proteolysis|response to stimulus|sensory perception of taste	extracellular region	cysteine-type endopeptidase inhibitor activity|transporter activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		GAAGCCTTGGAGGACTTTGAG	0.652													2	9	---	---	---	---	PASS
CSTF2T	23283	broad.mit.edu	37	10	53457955	53457955	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53457955C>T	uc001jjp.2	-	1	1401	c.1355G>A	c.(1354-1356)GGC>GAC	p.G452D	PRKG1_uc001jjm.2_Intron|PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_015235	NP_056050	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit	452	Gly-rich.|1-7; approximate.|9 X 5 AA tandem repeats of M-E-T-R-[AG].				mRNA processing	nucleus	nucleotide binding|RNA binding			ovary(1)	1				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		TGCATCCATGCCCCTTGCTTC	0.537													4	181	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88203067	88203067	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88203067C>T	uc001kdo.2	-	17	3818	c.3376G>A	c.(3376-3378)GCA>ACA	p.A1126T	WAPAL_uc009xsv.2_Missense_Mutation_p.A385T|WAPAL_uc001kdn.2_Missense_Mutation_p.A1163T|WAPAL_uc009xsw.2_Missense_Mutation_p.A1120T	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	1126	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						AGAAGTAGTGCTGTGTAGGAG	0.403													4	170	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93768666	93768666	+	Silent	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93768666T>G	uc001khr.2	+	27	3992	c.3894T>G	c.(3892-3894)ACT>ACG	p.T1298T		NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1298	Helicase ATP-binding.|ATP (Potential).				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				TAGGAAAAACTTTACAGTCCA	0.333													29	148	---	---	---	---	PASS
OR51T1	401665	broad.mit.edu	37	11	4903629	4903629	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4903629C>T	uc010qyp.1	+	1	581	c.581C>T	c.(580-582)ACT>ATT	p.T194I		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCATAAACACTGTGTCTTTT	0.453													33	151	---	---	---	---	PASS
OR10A4	283297	broad.mit.edu	37	11	6897950	6897950	+	Silent	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6897950T>G	uc010rat.1	+	1	72	c.72T>G	c.(70-72)CTT>CTG	p.L24L		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCACTGAGCTTCAGGCTCTAC	0.453													75	301	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33566496	33566496	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33566496C>G	uc001mup.3	+	2	2208	c.2084C>G	c.(2083-2085)ACA>AGA	p.T695R	C11orf41_uc001mun.1_Missense_Mutation_p.T695R	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	689						integral to membrane				ovary(2)	2						AAAAATGTCACAAACAAGGCC	0.542													7	23	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57076184	57076184	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57076184A>T	uc001njr.2	-	5	4313	c.4001T>A	c.(4000-4002)CTA>CAA	p.L1334Q	TNKS1BP1_uc001njs.2_Missense_Mutation_p.L1334Q|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.L785Q	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	1334	Gly-rich.|Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				ACATCCCCGTAGCCCCTGAGA	0.607													63	269	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65271716	65271716	+	RNA	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65271716C>T	uc010roh.1	+	1		c.6484C>T			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TATCAGCATACTCAAAATTTT	0.408													4	44	---	---	---	---	PASS
P2RY6	5031	broad.mit.edu	37	11	73008585	73008585	+	3'UTR	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73008585A>T	uc001otm.2	+	4					P2RY6_uc001otn.2_3'UTR|P2RY6_uc001oto.2_3'UTR|P2RY6_uc001otp.2_3'UTR|P2RY6_uc001otq.2_3'UTR|P2RY6_uc001otr.2_3'UTR|P2RY6_uc001ots.2_3'UTR	NM_176796	NP_789766	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y6						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1						CATATTTGCCATTGTGTCCGG	0.582													4	18	---	---	---	---	PASS
CD9	928	broad.mit.edu	37	12	6309604	6309604	+	5'UTR	SNP	T	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6309604T>G	uc001qnp.1	+	2					CD9_uc010seu.1_5'UTR|CD9_uc010sev.1_5'UTR|CD9_uc001qnq.1_5'UTR	NM_001769	NP_001760	P21926	CD9_HUMAN	CD9 antigen						cell adhesion|cellular component movement|fusion of sperm to egg plasma membrane|paranodal junction assembly|platelet activation|platelet degranulation	integral to plasma membrane|platelet alpha granule membrane				ovary(1)	1						GTCCCGCCAGTCCCAGCTGCG	0.642													5	22	---	---	---	---	PASS
DDX47	51202	broad.mit.edu	37	12	12977513	12977513	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12977513G>T	uc001rav.2	+	12	1535	c.937G>T	c.(937-939)GCC>TCC	p.A313S	DDX47_uc009zhw.1_Missense_Mutation_p.A313S|DDX47_uc001rax.2_Missense_Mutation_p.A313S|DDX47_uc001ray.2_Missense_Mutation_p.A264S	NM_016355	NP_057439	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	313	Helicase C-terminal.					nucleolus|nucleolus	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding				0		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		TAAGGCCAAGGCCCGTTCCAT	0.418													8	160	---	---	---	---	PASS
ALG10B	144245	broad.mit.edu	37	12	38714151	38714151	+	Silent	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38714151G>A	uc001rln.3	+	3	697	c.558G>A	c.(556-558)CGG>CGA	p.R186R	ALG10B_uc001rlo.3_Silent_p.R156R|ALG10B_uc010skk.1_Silent_p.R126R	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	186	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TCATGTTTCGGCAAACAAATA	0.383													7	499	---	---	---	---	PASS
AAAS	8086	broad.mit.edu	37	12	53708552	53708552	+	Silent	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53708552A>T	uc001scr.3	-	6	691	c.528T>A	c.(526-528)CGT>CGA	p.R176R	AAAS_uc001scs.3_Intron	NM_015665	NP_056480	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency,	176	WD 1.				carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore				ovary(1)	1						CATTATACACACGGACTGAGT	0.547													3	27	---	---	---	---	PASS
CD63	967	broad.mit.edu	37	12	56121064	56121064	+	Silent	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56121064G>A	uc001shm.2	-	2	222	c.126C>T	c.(124-126)ACC>ACT	p.T42T	CD63_uc009znz.2_Intron|CD63_uc001shn.2_Silent_p.T42T|CD63_uc001sho.2_Silent_p.T42T|CD63_uc001shp.2_Silent_p.T42T	NM_001780	NP_001771	P08962	CD63_HUMAN	CD63 antigen isoform A	42	Extracellular (Potential).				platelet activation|platelet degranulation	integral to plasma membrane|late endosome membrane|lysosomal membrane|platelet dense granule membrane					0						CCTGGATTATGGTCTGACTCA	0.572													20	155	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66638963	66638963	+	Missense_Mutation	SNP	G	A	A	rs146885838		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66638963G>A	uc001sth.2	+	11	1337	c.1235G>A	c.(1234-1236)CGG>CAG	p.R412Q	IRAK3_uc010ssy.1_Missense_Mutation_p.R351Q	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	412	Protein kinase.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		CCCTGCCCTCGGAATTTCTCT	0.478													54	174	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104171814	104171814	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104171814G>T	uc010swe.1	-	14	1481	c.1440C>A	c.(1438-1440)TTC>TTA	p.F480L	NT5DC3_uc010swd.1_5'Flank	NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	480							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						GGTCTGTGCGGAACAGGCTTC	0.478													27	117	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109826583	109826583	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109826583C>T	uc010sxn.1	+	1	60	c.60C>T	c.(58-60)GAC>GAT	p.D20D		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						TGCTATTGGACGCGTACACCA	0.532													62	286	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117672492	117672492	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117672492A>T	uc001twm.1	-	21	3799	c.3113T>A	c.(3112-3114)CTG>CAG	p.L1038Q		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1038	FAD-binding FR-type.|FAD (By similarity).				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GAAGACACCCAGGTGGTCCCC	0.592													13	59	---	---	---	---	PASS
RNF10	9921	broad.mit.edu	37	12	121002894	121002894	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121002894G>T	uc001typ.3	+	11	2168	c.1685G>T	c.(1684-1686)AGA>ATA	p.R562I	RNF10_uc010szk.1_RNA|RNF10_uc001tyq.3_Missense_Mutation_p.R473I	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10	562					negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGCGTCACAGATATCTCTCT	0.473													54	262	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25281239	25281239	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25281239G>A	uc001upp.2	+	16	2435	c.2248G>A	c.(2248-2250)GGG>AGG	p.G750R	ATP12A_uc010aaa.2_Missense_Mutation_p.G756R	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	750	Cytoplasmic (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	GATTGCCATGGGGATAGCAGG	0.552													15	69	---	---	---	---	PASS
ALG5	29880	broad.mit.edu	37	13	37567752	37567752	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37567752G>C	uc001uvy.2	-	4	410	c.343C>G	c.(343-345)CAG>GAG	p.Q115E	ALG5_uc010teq.1_Intron|ALG5_uc010ter.1_RNA	NM_013338	NP_037470	Q9Y673	ALG5_HUMAN	dolichyl-phosphate beta-glucosyltransferase	115	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate beta-glucosyltransferase activity|oligosaccharyl transferase activity				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		TTTGAGGTCTGATCTTTACTG	0.343													42	237	---	---	---	---	PASS
FNTB	2342	broad.mit.edu	37	14	65511120	65511120	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65511120C>T	uc001xia.2	+	9	1079	c.914C>T	c.(913-915)GCG>GTG	p.A305V	FNTB_uc010tsl.1_Missense_Mutation_p.A339V|FNTB_uc010tsm.1_Missense_Mutation_p.A259V|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_Missense_Mutation_p.A61V|FNTB_uc010tso.1_Missense_Mutation_p.A220V	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	305	PFTB 4.				protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TTCTGGCAGGCGGGGCTCCTG	0.602													19	94	---	---	---	---	PASS
ABCD4	5826	broad.mit.edu	37	14	74757105	74757105	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74757105C>G	uc001xpr.2	-	12	1368	c.1216G>C	c.(1216-1218)GAT>CAT	p.D406H	ABCD4_uc001xps.2_Missense_Mutation_p.D247H|ABCD4_uc001xpt.2_Missense_Mutation_p.D247H|ABCD4_uc010tur.1_Missense_Mutation_p.D302H|ABCD4_uc001xpu.2_Missense_Mutation_p.D143H	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4	406	ABC transporter.					ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		AGGCTCAGATCCTTGATTAGG	0.607											OREG0022800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	64	239	---	---	---	---	PASS
DLK1	8788	broad.mit.edu	37	14	101201286	101201286	+	3'UTR	SNP	T	C	C	rs145282046	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101201286T>C	uc001yhs.3	+	5					DLK1_uc001yhu.3_3'UTR	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog precursor						multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)				GAGCTTACTATACGCGGTCTG	0.498													18	79	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43873430	43873430	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43873430A>G	uc001zrw.2	-	9	1117	c.934T>C	c.(934-936)TTC>CTC	p.F312L	PPIP5K1_uc001zrx.1_Missense_Mutation_p.F312L|PPIP5K1_uc001zru.2_Missense_Mutation_p.F312L|PPIP5K1_uc001zry.3_Missense_Mutation_p.F312L|PPIP5K1_uc001zrv.2_Missense_Mutation_p.F312L|PPIP5K1_uc001zrz.1_Missense_Mutation_p.F312L|PPIP5K1_uc010udr.1_Missense_Mutation_p.F312L	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	312					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						TCTACCTTGAAAGCTACGCAG	0.498													35	194	---	---	---	---	PASS
PARP6	56965	broad.mit.edu	37	15	72542434	72542434	+	Splice_Site	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72542434C>T	uc002auc.2	-	18	1878	c.1419_splice	c.e18-1	p.H473_splice	PARP6_uc002aua.2_Splice_Site_p.H319_splice|PARP6_uc002aub.2_Splice_Site|PARP6_uc002aud.3_Splice_Site|PARP6_uc002auf.1_Splice_Site_p.H474_splice	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6								NAD+ ADP-ribosyltransferase activity				0						GTGGGACCCACTGTAAGGCAG	0.512													4	42	---	---	---	---	PASS
DCUN1D3	123879	broad.mit.edu	37	16	20871576	20871576	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20871576A>G	uc002dhz.2	-	3	688	c.547T>C	c.(547-549)TAC>CAC	p.Y183H	ERI2_uc002dht.3_Intron	NM_173475	NP_775746	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain	183	DCUN1.				negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of apoptosis|response to gamma radiation|response to UV-C	perinuclear region of cytoplasm				ovary(2)	2				GBM - Glioblastoma multiforme(48;0.249)		GTAAACCGGTAGAGATCCTTG	0.478													56	242	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30734516	30734516	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30734516C>T	uc002dze.1	+	24	4510	c.4125C>T	c.(4123-4125)CTC>CTT	p.L1375L	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.L1170L|SRCAP_uc010bzz.1_Silent_p.L945L	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1375	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GGCCTCTTCTCAAGCTGGTCC	0.602													36	178	---	---	---	---	PASS
LPCAT2	54947	broad.mit.edu	37	16	55565881	55565881	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55565881A>T	uc002eie.3	+	5	879	c.698A>T	c.(697-699)AAA>ATA	p.K233I	LPCAT2_uc002eic.2_5'Flank	NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	233	Lumenal (Potential).				cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						ATTACTTTTAAACCAGGTGAG	0.264													38	186	---	---	---	---	PASS
RANBP10	57610	broad.mit.edu	37	16	67778202	67778202	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67778202C>T	uc002eud.2	-	4	673	c.557G>A	c.(556-558)GGC>GAC	p.G186D	RANBP10_uc010ceo.2_5'UTR|RANBP10_uc010vju.1_Intron|RANBP10_uc010vjv.1_Missense_Mutation_p.G69D|RANBP10_uc010vjx.1_Missense_Mutation_p.G186D|RANBP10_uc010vjy.1_Missense_Mutation_p.G54D	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	186	B30.2/SPRY.									ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		AAGGCTGTGGCCATTCTTGGT	0.577													21	81	---	---	---	---	PASS
NFATC3	4775	broad.mit.edu	37	16	68208354	68208354	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68208354A>G	uc002evo.1	+	6	2062	c.1852A>G	c.(1852-1854)ATG>GTG	p.M618V	NFATC3_uc010vkl.1_Missense_Mutation_p.M139V|NFATC3_uc010vkm.1_Missense_Mutation_p.M139V|NFATC3_uc010vkn.1_Missense_Mutation_p.M139V|NFATC3_uc010vko.1_Missense_Mutation_p.M139V|NFATC3_uc010vkp.1_Missense_Mutation_p.M139V|NFATC3_uc010vkq.1_Missense_Mutation_p.M139V|NFATC3_uc002evl.2_Missense_Mutation_p.M139V|NFATC3_uc002evk.2_Missense_Mutation_p.M618V|NFATC3_uc002evm.1_Missense_Mutation_p.M618V|NFATC3_uc002evn.1_Missense_Mutation_p.M618V|NFATC3_uc010vkr.1_Missense_Mutation_p.M139V|NFATC3_uc010vks.1_Missense_Mutation_p.M139V|NFATC3_uc010vkt.1_Missense_Mutation_p.M139V|NFATC3_uc010vku.1_Missense_Mutation_p.M139V|NFATC3_uc010vkv.1_Missense_Mutation_p.M139V|NFATC3_uc010vkw.1_Missense_Mutation_p.M139V|NFATC3_uc010vkx.1_Missense_Mutation_p.M139V|NFATC3_uc010vky.1_Missense_Mutation_p.M139V|NFATC3_uc010vkz.1_Missense_Mutation_p.M139V|NFATC3_uc010vla.1_Missense_Mutation_p.M139V|NFATC3_uc010vlb.1_Missense_Mutation_p.M139V|NFATC3_uc010vlc.1_Missense_Mutation_p.M139V	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,	618					inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		AGGTCATGAAATGGTTGTGAC	0.343													61	353	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89865333	89865333	+	Intron	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89865333G>A	uc002fou.1	-						FANCA_uc010vpn.1_Intron|FANCA_uc002fov.1_3'UTR|FANCA_uc002fow.1_3'UTR|FANCA_uc002fox.1_3'UTR|FANCA_uc010ciu.1_3'UTR|FANCA_uc002foy.2_3'UTR	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform						DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TTCCAGAGGCGGAACAGGATA	0.597			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				17	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161061	90161061	+	Intron	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161061G>A	uc002fqp.2	+						uc002fqq.2_Silent_p.A97A					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		AGCTGCGGGCGAGGACTGGGG	0.647													9	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90162513	90162513	+	3'UTR	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90162513T>C	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		GCAACATGAATGACCTGGTGT	0.537													4	162	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7405412	7405412	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7405412T>C	uc002ghf.3	+	15	2777	c.2543T>C	c.(2542-2544)ATT>ACT	p.I848T		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	848					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				GAGGGGCTCATTGACACGGCT	0.587													5	30	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10535165	10535165	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535165C>A	uc002gmq.1	-	34	5202	c.5125G>T	c.(5125-5127)GAC>TAC	p.D1709Y		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1709	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						TCGTTGGAGTCCAGGAGCTCC	0.647													15	76	---	---	---	---	PASS
SPAG5	10615	broad.mit.edu	37	17	26919586	26919586	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26919586C>A	uc002hbq.2	-	3	768	c.676G>T	c.(676-678)GAG>TAG	p.E226*	SGK494_uc010waq.1_Intron	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	226					cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					CGCACAGCCTCAGTTCTACTG	0.493													5	212	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	T	T	rs425487	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274415C>T	uc002hvz.2	-	1	192	c.153G>A	c.(151-153)AGG>AGA	p.R51R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667													6	47	---	---	---	---	PASS
SEPT4	5414	broad.mit.edu	37	17	56599131	56599131	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56599131A>T	uc002iwm.1	-	7	1009	c.881T>A	c.(880-882)CTG>CAG	p.L294Q	SEPT4_uc002iwk.1_Missense_Mutation_p.L147Q|SEPT4_uc010wnw.1_Missense_Mutation_p.L147Q|SEPT4_uc002iwl.1_Missense_Mutation_p.L147Q|SEPT4_uc002iwn.1_Missense_Mutation_p.L195Q|SEPT4_uc002iwo.1_Missense_Mutation_p.L275Q|SEPT4_uc002iwp.1_3'UTR|SEPT4_uc010wnx.1_Missense_Mutation_p.L309Q|SEPT4_uc010wny.1_Missense_Mutation_p.L286Q|SEPT4_uc010dcy.1_3'UTR	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1	294	GTP (By similarity).				apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGGAGGTGTCAGTGTGTCTGC	0.562													7	124	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63149596	63149596	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63149596C>A	uc002jfe.2	+	2	224	c.114C>A	c.(112-114)AAC>AAA	p.N38K	RGS9_uc010dem.2_Missense_Mutation_p.N38K|RGS9_uc002jfd.2_Missense_Mutation_p.N38K|RGS9_uc002jff.2_RNA	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	38	DEP.				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						GAATGCAGAACCAGAGGGTCC	0.532													23	180	---	---	---	---	PASS
NOL11	25926	broad.mit.edu	37	17	65735643	65735643	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65735643G>C	uc002jgd.1	+	16	1857	c.1854G>C	c.(1852-1854)AAG>AAC	p.K618N	NOL11_uc010wql.1_Missense_Mutation_p.K436N|NOL11_uc010deu.1_Missense_Mutation_p.K213N|SNORA38B_uc010dev.2_5'Flank	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	618						nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGTTTCTTAAGTATTTGTATT	0.328													25	137	---	---	---	---	PASS
WIPI1	55062	broad.mit.edu	37	17	66422217	66422217	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66422217G>A	uc010dey.2	-	12	1383	c.1292C>T	c.(1291-1293)CCT>CTT	p.P431L	WIPI1_uc002jhd.3_RNA|WIPI1_uc010wqo.1_Missense_Mutation_p.P349L|WIPI1_uc002jhe.3_RNA|MIR635_hsa-mir-635|MI0003650_5'Flank	NM_017983	NP_060453	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting	431					macroautophagy|vesicle targeting, trans-Golgi to endosome	autophagic vacuole membrane|clathrin-coated vesicle|cytosol|endosome membrane|PAS complex|pre-autophagosomal structure membrane|trans-Golgi network	androgen receptor binding|estrogen receptor binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding				0						AATGCTCACAGGAGGAAACTC	0.517													15	70	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67189998	67189998	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67189998A>T	uc010dfa.1	-	14	2357	c.1478T>A	c.(1477-1479)TTT>TAT	p.F493Y	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.F94Y	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	493	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TATTTTAGCAAATACCCTGAG	0.333													48	233	---	---	---	---	PASS
TSEN54	283989	broad.mit.edu	37	17	73519837	73519837	+	Silent	SNP	C	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73519837C>G	uc002jof.1	+	10	1440	c.1407C>G	c.(1405-1407)CCC>CCG	p.P469P	LLGL2_uc002jog.1_5'Flank|LLGL2_uc010dgf.1_5'Flank|LLGL2_uc002joh.2_5'Flank|LLGL2_uc002joi.2_5'Flank	NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog	469					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGGCAAACCCTATGCCCGGA	0.552													7	40	---	---	---	---	PASS
RNF152	220441	broad.mit.edu	37	18	59483736	59483736	+	5'UTR	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59483736G>T	uc002lih.1	-	2						NM_173557	NP_775828	Q8N8N0	RN152_HUMAN	ring finger protein 152						apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)				AAGGTGAAGGGGAAGGAGCTG	0.547													4	67	---	---	---	---	PASS
THEG	51298	broad.mit.edu	37	19	362387	362387	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:362387T>A	uc002lol.2	-	8	992	c.953A>T	c.(952-954)GAT>GTT	p.D318V	THEG_uc002lom.2_Missense_Mutation_p.D294V	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	318					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCGAGGATCTCGGTCAGG	0.587													20	134	---	---	---	---	PASS
C19orf21	126353	broad.mit.edu	37	19	757806	757806	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:757806C>T	uc002lpo.2	+	2	943	c.860C>T	c.(859-861)ACC>ATC	p.T287I		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	287										upper_aerodigestive_tract(1)	1		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCGGGGACCCCCAAGGAG	0.657													14	81	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1807166	1807166	+	Splice_Site	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1807166C>T	uc002ltw.2	-	6	849	c.615_splice	c.e6+1	p.M205_splice	ATP8B3_uc002ltv.2_Splice_Site_p.M152_splice|ATP8B3_uc002ltx.2_Splice_Site|ATP8B3_uc002lty.1_5'Flank|ATP8B3_uc002ltz.1_Splice_Site_p.M152_splice	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3						ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGCACTCACCATGTCGTCC	0.662													22	106	---	---	---	---	PASS
GNA11	2767	broad.mit.edu	37	19	3113446	3113446	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3113446G>A	uc002lxd.2	+	3	682	c.440G>A	c.(439-441)CGC>CAC	p.R147H		NM_002067	NP_002058	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein),	147					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			eye(70)|skin(16)	86		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		TGCTACGACCGCAGGCGCGAG	0.662			Mis		uveal melanoma								3	50	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066745	9066745	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066745G>T	uc002mkp.2	-	3	20905	c.20701C>A	c.(20701-20703)CAA>AAA	p.Q6901K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6903	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACAGAGGATTGTGACCCATGT	0.488													75	340	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839672	15839672	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839672C>T	uc002nbm.2	+	1	839	c.819C>T	c.(817-819)ACC>ACT	p.T273T		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	273	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					AGGGTGACACCCTGATGGCCA	0.552													26	113	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39360340	39360340	+	Silent	SNP	G	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39360340G>C	uc002ojq.2	-	10	1393	c.1005C>G	c.(1003-1005)CCC>CCG	p.P335P	RINL_uc002ojr.1_5'UTR|RINL_uc010xuo.1_Silent_p.P449P	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	335	VPS9.						GTPase activator activity			pancreas(1)	1						CGGCCCCCAGGGGATCTGGGA	0.612											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	98	---	---	---	---	PASS
AKT2	208	broad.mit.edu	37	19	40742001	40742001	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40742001T>C	uc002onf.2	-	11	1233	c.971A>G	c.(970-972)GAC>GGC	p.D324G	AKT2_uc010egs.2_Missense_Mutation_p.D281G|AKT2_uc010egt.2_Missense_Mutation_p.D262G|AKT2_uc010xvj.1_Missense_Mutation_p.D262G|AKT2_uc010egu.1_Missense_Mutation_p.D262G|AKT2_uc002one.2_Missense_Mutation_p.D220G	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase	324	Protein kinase.				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ATAGTCATTGTCCTCCAGCAC	0.637			A		ovarian|pancreatic 								4	41	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41594410	41594410	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41594410C>T	uc002opt.2	+	1	43	c.34C>T	c.(34-36)CTG>TTG	p.L12L		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	12					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	GGTGACCTTGCTGGCCTGCCT	0.577													12	39	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50243342	50243342	+	Silent	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50243342T>C	uc002ppm.2	-	10	1607	c.1596A>G	c.(1594-1596)CTA>CTG	p.L532L		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	532							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CTGTCAGCAGTAGGTTCTTGG	0.622													4	215	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51362940	51362940	+	3'UTR	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51362940G>A	uc002pts.1	+	5					KLK3_uc010ycj.1_Intron|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_Intron	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3						negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		AGATGGTCCTGGCCCTTGTCC	0.632													4	20	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754843	54754843	+	Intron	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754843A>G	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.S598P|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGGTGGGGAGGCCTGGGGG	0.607													5	53	---	---	---	---	PASS
C20orf196	149840	broad.mit.edu	37	20	5843933	5843933	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5843933G>T	uc002wmf.2	+	3	529	c.442G>T	c.(442-444)GCC>TCC	p.A148S		NM_152504	NP_689717	Q8IYI0	CT196_HUMAN	hypothetical protein LOC149840	148											0						TTTTCAAATGGCCCGGGTGAT	0.517													21	76	---	---	---	---	PASS
RALY	22913	broad.mit.edu	37	20	32666319	32666319	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32666319C>T	uc002xab.2	+	9	1183	c.885C>T	c.(883-885)AGC>AGT	p.S295S	RALY_uc002xac.2_Silent_p.S279S|RALY_uc002xad.2_RNA|RALY_uc002xae.1_Silent_p.S295S	NM_016732	NP_057951	Q9UKM9	RALY_HUMAN	RNA binding protein (autoantigenic,	295						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1						AGGAACACAGCCAGGACACAG	0.557													4	117	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39798840	39798840	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39798840C>T	uc002xjp.1	+	24	2860	c.2739C>T	c.(2737-2739)GCC>GCT	p.A913A	PLCG1_uc002xjo.1_Silent_p.A913A|PLCG1_uc010zwe.1_Silent_p.A539A|PLCG1_uc010ggf.2_Silent_p.A237A	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	913	PH 2; second part.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				ATGTTGCTGCCGACTCACAGG	0.612													14	83	---	---	---	---	PASS
SS18L1	26039	broad.mit.edu	37	20	60718863	60718863	+	5'UTR	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60718863C>T	uc002ycb.2	+	1					PSMA7_uc002ybx.1_5'Flank|PSMA7_uc002yby.1_5'Flank|SS18L1_uc011aaa.1_5'UTR|SS18L1_uc002ybz.1_RNA|SS18L1_uc002yca.1_RNA	NM_198935	NP_945173	O75177	CREST_HUMAN	SS18-like protein 1						chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome kinetochore				ovary(2)	2	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			CGGGCTGAGCCCCGCGCCGCC	0.567			T	SSX1	synovial sarcoma								5	25	---	---	---	---	PASS
EEF1A2	1917	broad.mit.edu	37	20	62129141	62129141	+	5'UTR	SNP	C	T	T	rs60257456	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62129141C>T	uc002yfd.1	-	1					EEF1A2_uc002yfe.1_5'UTR|EEF1A2_uc010gkg.1_5'UTR	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha							nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GAGGGGCTGGCGGGACCCGGG	0.667													4	146	---	---	---	---	PASS
SAMD10	140700	broad.mit.edu	37	20	62607109	62607109	+	Silent	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62607109C>T	uc002yhm.2	-	4	697	c.522G>A	c.(520-522)GTG>GTA	p.V174V	SAMD10_uc002yhn.2_RNA	NM_080621	NP_542188	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	174	SAM.										0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCTGCTGCAGCACCTCCTGCC	0.687													11	23	---	---	---	---	PASS
C21orf99	149992	broad.mit.edu	37	21	14414844	14414844	+	RNA	SNP	T	C	C	rs148060711	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14414844T>C	uc002yiy.3	+	2		c.281T>C			C21orf99_uc002yja.3_RNA					Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						ACTGGGCCTGTGCCAATGGCC	0.433													5	94	---	---	---	---	PASS
C21orf99	149992	broad.mit.edu	37	21	14414855	14414855	+	RNA	SNP	A	G	G	rs141732548	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14414855A>G	uc002yiy.3	+	2		c.292A>G			C21orf99_uc002yja.3_RNA					Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						GCCAATGGCCATGCAGAAGTA	0.448													9	94	---	---	---	---	PASS
CBR3	874	broad.mit.edu	37	21	37518699	37518699	+	Silent	SNP	C	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37518699C>A	uc002yve.2	+	3	951	c.723C>A	c.(721-723)ATC>ATA	p.I241I	uc002yvc.1_Intron|uc002yvd.1_Intron|uc002yvf.1_Intron	NM_001236	NP_001227	O75828	CBR3_HUMAN	carbonyl reductase 3	241						cytosol|nucleus	carbonyl reductase (NADPH) activity|NADPH binding				0						AAGACAGCATCAGGACTGTGG	0.567													15	78	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659734	24659734	+	RNA	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659734T>C	uc002zzs.3	+	7		c.3466T>C			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						CTCTCTCCTGTGGGAGGGGGG	0.632													3	21	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659741	24659741	+	RNA	SNP	G	A	A	rs144618782	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659741G>A	uc002zzs.3	+	7		c.3473G>A			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						CTGTGGGAGGGGGGAATGTTC	0.622													4	20	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19378823	19378823	+	3'UTR	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19378823A>T	uc004czk.1	-	30					MAP3K15_uc004czj.1_3'UTR|PDHA1_uc004czg.3_3'UTR|PDHA1_uc004czh.3_3'UTR|PDHA1_uc011mjc.1_3'UTR|PDHA1_uc011mjd.1_3'UTR|PDHA1_uc010nfk.2_3'UTR|PDHA1_uc010nfl.2_3'UTR|MAP3K15_uc004czi.1_3'UTR	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					TTAACAAAACATGTAGCGTGG	0.408													17	59	---	---	---	---	PASS
ZFX	7543	broad.mit.edu	37	X	24228654	24228654	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24228654G>A	uc004dbf.2	+	9	1837	c.1579G>A	c.(1579-1581)GAG>AAG	p.E527K	ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Missense_Mutation_p.E566K|ZFX_uc010nfz.2_Missense_Mutation_p.E183K	NM_003410	NP_003401	P17010	ZFX_HUMAN	zinc finger protein, X-linked	527	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(2)	2						CTGTGAATACGAGACAGCTGA	0.443													46	149	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83724059	83724059	+	Silent	SNP	T	C	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83724059T>C	uc004eek.1	-	3	781	c.672A>G	c.(670-672)CCA>CCG	p.P224P	HDX_uc011mqv.1_Silent_p.P224P|HDX_uc004eel.1_Silent_p.P166P	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	224						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GAATCCCAACTGGTTCAATTT	0.418													80	338	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106092530	106092530	+	Intron	SNP	G	A	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106092530G>A	uc004emo.2	+						MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Silent_p.E631E	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TTATTGGGGAGAAGTAGAAAA	0.333													53	114	---	---	---	---	PASS
IRS4	8471	broad.mit.edu	37	X	107977280	107977280	+	Silent	SNP	A	G	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107977280A>G	uc004eoc.2	-	1	2328	c.2295T>C	c.(2293-2295)AAT>AAC	p.N765N		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	765	CRK-binding.					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						CATCCTCTTTATTAGTATCAG	0.478													8	517	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135431578	135431578	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135431578A>T	uc004ezu.1	+	6	6004	c.5713A>T	c.(5713-5715)AAT>TAT	p.N1905Y	GPR112_uc010nsb.1_Missense_Mutation_p.N1700Y|GPR112_uc010nsc.1_Missense_Mutation_p.N1672Y	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1905	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					ACCTACATCCAATGAGATGGA	0.433													64	318	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994211	140994211	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994211C>T	uc004fbt.2	+	4	1307	c.1021C>T	c.(1021-1023)CCT>TCT	p.P341S	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	341							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCCAGATTCCTATGACCTC	0.468										HNSCC(15;0.026)			83	343	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151123279	151123279	+	Missense_Mutation	SNP	C	T	T	rs80186670	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151123279C>T	uc004ffi.2	-	9	1469	c.1415G>A	c.(1414-1416)CGC>CAC	p.R472H	GABRE_uc011myd.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	472	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GATGCAGAGGCGGCCCTGCTG	0.522													11	64	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10132438	10132438	+	Intron	DEL	T	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10132438delT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTGTTATCGCTTTTTTTTTTA	0.308													4	2	---	---	---	---	
DNAJC16	23341	broad.mit.edu	37	1	15891040	15891041	+	Intron	INS	-	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15891040_15891041insT	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron|DNAJC16_uc001awu.2_Intron	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ttattttttacttttttttttt	0.158													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145366613	145366614	+	Intron	DEL	CT	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145366613_145366614delCT	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		tcactttctcctctctctctct	0.371													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185992421	185992421	+	Intron	DEL	T	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185992421delT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAACCTAGGGTTTTTTTTTTT	0.269													4	2	---	---	---	---	
ZNF678	339500	broad.mit.edu	37	1	227882638	227882641	+	Intron	DEL	TTCC	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227882638_227882641delTTCC	uc009xeu.1	+									F5GXA7	F5GXA7_HUMAN	Homo sapiens cDNA: FLJ22822 fis, clone KAIA3968.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)				cttccttcctttccttccttcctt	0.225													4	2	---	---	---	---	
RHOU	58480	broad.mit.edu	37	1	228873641	228873641	+	Intron	DEL	T	-	-	rs35672194		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228873641delT	uc001htf.2	+							NM_021205	NP_067028	Q7L0Q8	RHOU_HUMAN	ras homolog gene family, member U						regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding				0	Breast(184;0.162)	Prostate(94;0.183)				AGGGGCCAGGTTATTGGCCGG	0.542													2	4	---	---	---	---	
SLC4A5	57835	broad.mit.edu	37	2	74489490	74489490	+	Intron	DEL	C	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74489490delC	uc002sko.1	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002skn.2_Intron|SLC4A5_uc010ffc.1_Intron|SLC4A5_uc002skp.1_Intron|SLC4A5_uc002sks.1_Intron	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						GGAAGAAATTCtttttttttt	0.284													4	5	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109297018	109297021	+	Intron	DEL	AAAG	-	-	rs59337195		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109297018_109297021delAAAG	uc002teg.2	+						LIMS1_uc002tef.2_Intron|LIMS1_uc002teh.2_Intron|LIMS1_uc002tei.2_Intron|LIMS1_uc002tej.2_Intron|LIMS1_uc002tek.3_Intron	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						aaaaaaaaaaaaaGGTTCTTGAGA	0.230													13	6	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130367861	130367861	+	Intron	DEL	T	-	-	rs72391450		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130367861delT	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TCTATGTATCTTTTTTTTTTT	0.299													5	3	---	---	---	---	
SENP2	59343	broad.mit.edu	37	3	185318829	185318829	+	Intron	DEL	C	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185318829delC	uc003fpn.2	+						SENP2_uc011brv.1_Intron|SENP2_uc011brw.1_Intron	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2						mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			Cttttcttgtctttttttttt	0.199													10	7	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24875814	24875815	+	Intron	INS	-	G	G	rs2255337	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24875814_24875815insG	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						GGGAGGAGGCCGGGGGGCGGTT	0.436													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32441392	32441393	+	IGR	INS	-	T	T	rs71556927		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441392_32441393insT								HLA-DRA (28571 upstream) : HLA-DRB1 (43770 downstream)																							AATTATGGGGAGGAGGTTACTG	0.505													4	3	---	---	---	---	
SLC17A5	26503	broad.mit.edu	37	6	74320415	74320415	+	Intron	DEL	A	-	-	rs10707321		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74320415delA	uc003phn.3	-						SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_Intron|SLC17A5_uc011dyo.1_Intron	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin						anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						ATTTCATGAGAAAAAAAAAAT	0.308													6	3	---	---	---	---	
NT5DC1	221294	broad.mit.edu	37	6	116437119	116437119	+	Intron	DEL	T	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116437119delT	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_152729	NP_689942	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		AGCAGTGACCTTTTTTTTTTC	0.328													4	2	---	---	---	---	
WIPI2	26100	broad.mit.edu	37	7	5270696	5270696	+	3'UTR	DEL	A	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5270696delA	uc003snv.2	+	13					WIPI2_uc003snw.2_3'UTR|WIPI2_uc003snx.2_3'UTR|WIPI2_uc003sny.2_3'UTR|WIPI2_uc010ksv.2_3'UTR|WIPI2_uc003soa.2_3'UTR|WIPI2_uc003sob.2_3'UTR	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		AGACTTTATTAAAAAAAAAAA	0.418													4	3	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73456758	73456758	+	Intron	DEL	A	-	-	rs72489767		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456758delA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	accttgtgtcaaaaaaaaaaa	0.239			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	2	---	---	---	---	
BLNK	29760	broad.mit.edu	37	10	97975268	97975275	+	Intron	DEL	AGAATGGG	-	-	rs12761346	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97975268_97975275delAGAATGGG	uc001kls.3	-						BLNK_uc001kme.3_Intron|BLNK_uc001klt.3_Intron|BLNK_uc009xvc.2_Intron|BLNK_uc001klu.3_Intron|BLNK_uc001klv.3_Intron|BLNK_uc001klw.3_Intron|BLNK_uc001klx.3_Intron|BLNK_uc001kly.3_Intron|BLNK_uc001klz.3_Intron|BLNK_uc001kma.3_Intron|BLNK_uc001kmb.3_Intron|BLNK_uc001kmc.3_Intron|BLNK_uc001kmd.3_Intron|BLNK_uc009xvd.2_Intron	NM_013314	NP_037446	Q8WV28	BLNK_HUMAN	B-cell linker isoform 1						B cell differentiation|humoral immune response|inflammatory response|intracellular signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(2)	2		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		GAATTTGCAAAGAATGGGAGACACCCTT	0.298													6	3	---	---	---	---	
FAM175B	23172	broad.mit.edu	37	10	126508159	126508160	+	Intron	INS	-	T	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126508159_126508160insT	uc001lib.3	+							NM_032182	NP_115558	Q15018	F175B_HUMAN	hypothetical protein LOC23172							BRISC complex	polyubiquitin binding				0						TAGATTTTTTGATGTATTAATA	0.183													6	3	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840578	840578	+	Intron	DEL	A	-	-	rs143525015	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840578delA	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGGCCTCACCCCCCCCGC	0.607													3	4	---	---	---	---	
KIF18A	81930	broad.mit.edu	37	11	28116025	28116025	+	Intron	DEL	A	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28116025delA	uc001msc.2	-							NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						ttgccaaagtaaaaaAAAAAA	0.095													9	4	---	---	---	---	
PIWIL4	143689	broad.mit.edu	37	11	94316343	94316344	+	Intron	DEL	CT	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94316343_94316344delCT	uc001pfa.2	+						PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_Intron	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGCTCTGGAACTCTCTTTGGAC	0.307													2	4	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	102996096	102996096	+	Intron	DEL	T	-	-	rs34114270		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102996096delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGCTAAAGGCTTTTTTTTTTT	0.289													6	3	---	---	---	---	
PDS5B	23047	broad.mit.edu	37	13	33315050	33315050	+	Intron	DEL	T	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315050delT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CCTTTCAACCTTTTTTTTTTT	0.358													2	5	---	---	---	---	
LECT1	11061	broad.mit.edu	37	13	53283015	53283015	+	Intron	DEL	A	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53283015delA	uc001vhf.2	-						LECT1_uc001vhg.2_Intron|LECT1_uc001vhh.2_Intron	NM_007015	NP_008946	O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1 isoform 1						cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane				ovary(2)	2		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		TTGGGCTAATAGTTAAACATA	0.328													4	6	---	---	---	---	
ANKRD10	55608	broad.mit.edu	37	13	111545198	111545199	+	Intron	INS	-	GT	GT	rs147785874	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111545198_111545199insGT	uc001vrn.2	-						ANKRD10_uc001vrm.2_Intron|ANKRD10_uc001vro.1_3'UTR|ANKRD10_uc001vrp.1_3'UTR	NM_017664	NP_060134	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10											central_nervous_system(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			CCTTTTGTTAAGTCCCATCTTC	0.465													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103615591	103615592	+	IGR	DEL	AA	-	-	rs141928659		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103615591_103615592delAA								TNFAIP2 (11815 upstream) : EIF5 (184901 downstream)																							actccatctcaaaaaaaaaaaa	0.178													4	2	---	---	---	---	
ADAD2	161931	broad.mit.edu	37	16	84230068	84230080	+	Intron	DEL	CAACCCCTTCGCT	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84230068_84230080delCAACCCCTTCGCT	uc002fhr.2	+						ADAD2_uc002fhq.2_Intron|uc002fhs.1_Intron	NM_001145400	NP_001138872	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2 isoform						RNA processing	intracellular	adenosine deaminase activity|double-stranded RNA binding				0						AATCCCAGCGCAACCCCTTCGCTCAACCCCTTC	0.601													17	11	---	---	---	---	
SPNS3	201305	broad.mit.edu	37	17	4350374	4350375	+	Intron	DEL	GT	-	-	rs3055435		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4350374_4350375delGT	uc002fxt.2	+						SPNS3_uc002fxu.2_Intron	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						GGGACGGGGGGTGGTGGTCAGG	0.450													8	7	---	---	---	---	
CHRNB1	1140	broad.mit.edu	37	17	7359369	7359380	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs67180661		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7359369_7359380delTTTTTTTTTTTT	uc002ghb.2	+						CHRNB1_uc010vty.1_Intron	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit						behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				tttttttggctttttttttttttttttttttt	0.241													4	2	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16649658	16649659	+	Intron	INS	-	CTC	CTC			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16649658_16649659insCTC	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						tttctaactctctcctccgttc	0.084													8	4	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													4	2	---	---	---	---	
SYT3	84258	broad.mit.edu	37	19	51132916	51132917	+	Intron	DEL	CC	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132916_51132917delCC	uc002pst.2	-						SYT3_uc002psv.2_Intron|SYT3_uc010ycd.1_Intron	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III							cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		ggagtccaggcccccagcccct	0.000													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074004	62074006	+	Intron	DEL	CAC	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074004_62074006delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaaaaccatcaccaccaccatc	0.025													6	6	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													6	3	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41741312	41741313	+	Intron	INS	-	GT	GT	rs143618739	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41741312_41741313insGT	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				cgtgcgtctgcgtgtgtgtgtg	0.272													5	4	---	---	---	---	
YPEL1	29799	broad.mit.edu	37	22	22057997	22057998	+	Intron	INS	-	G	G	rs147967901	by1000genomes	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22057997_22057998insG	uc002zvl.2	-						YPEL1_uc002zvm.2_Intron	NM_013313	NP_037445	O60688	YPEL1_HUMAN	yippee-like 1							nucleus					0	Colorectal(54;0.105)					CAGAAACTCCCGGCGGGGGGAT	0.624													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34046197	34046198	+	Intron	DEL	GA	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34046197_34046198delGA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				tcagaccattgagcaaagttag	0.183													14	8	---	---	---	---	
SUN2	25777	broad.mit.edu	37	22	39138154	39138154	+	Intron	DEL	A	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39138154delA	uc003awh.1	-						SUN2_uc011anz.1_Intron|SUN2_uc011aoa.1_Intron|SUN2_uc003awi.1_Intron|SUN2_uc010gxq.1_Intron|SUN2_uc010gxr.1_Intron|SUN2_uc010gxs.1_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						tctcaaaaagaaaaaaaaaaa	0.194													5	3	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1531852	1531853	+	Intron	DEL	AG	-	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1531852_1531853delAG	uc004cpx.1	-						NCRNA00105_uc004cpv.2_RNA|NCRNA00105_uc004cpw.2_Intron|ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGACAGAGAAGAGAGGGGTGT	0.564													17	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150192021	150192022	+	IGR	INS	-	T	T	rs34005723		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150192021_150192022insT								HMGB3 (32775 upstream) : GPR50 (153037 downstream)																							ACTGTCAATTCTTTTTTTTTTT	0.223													9	7	---	---	---	---	
