Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
EBNA1BP2	10969	broad.mit.edu	37	1	43637236	43637236	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43637236C>A	uc001cin.2	-	3	434	c.237G>T	c.(235-237)GAG>GAT	p.E79D	EBNA1BP2_uc001cio.2_Missense_Mutation_p.E134D|WDR65_uc010ojz.1_5'Flank|WDR65_uc001cip.1_5'Flank|WDR65_uc001ciq.1_5'Flank|EBNA1BP2_uc001cim.2_5'UTR|EBNA1BP2_uc010ojx.1_Missense_Mutation_p.E134D	NM_006824	NP_006815	Q99848	EBP2_HUMAN	EBNA1 binding protein 2 isoform 2	79					ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATCCACCGATCTCCGGTACCG	0.502													52	225	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152324635	152324635	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152324635C>A	uc001ezw.3	-	3	5700	c.5627G>T	c.(5626-5628)AGG>ATG	p.R1876M	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1876							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGATCTCCTTCTTCCAGT	0.507													69	348	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161018362	161018362	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018362C>T	uc001fxl.2	-	12	2795	c.2449G>A	c.(2449-2451)GGT>AGT	p.G817S	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Intron|ARHGAP30_uc001fxm.2_Missense_Mutation_p.G663S|ARHGAP30_uc009wtx.2_Missense_Mutation_p.G490S	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	817	Glu-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTGTCTTCACCATCTCCTTGG	0.547													39	242	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196874273	196874273	+	Intron	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196874273G>T	uc001gto.2	+						CFHR4_uc009wyy.2_Nonsense_Mutation_p.G97*|CFHR4_uc001gtp.2_Nonsense_Mutation_p.G98*	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor							extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						AATTGAAAATGGATTCATTTC	0.284													20	103	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205041696	205041696	+	Silent	SNP	A	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205041696A>C	uc001hbr.2	+	21	3086	c.2817A>C	c.(2815-2817)CGA>CGC	p.R939R	CNTN2_uc001hbq.1_Silent_p.R830R|CNTN2_uc001hbs.2_Silent_p.R727R	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	939	Fibronectin type-III 4.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCCCTTTCCGAAATGAGTCTG	0.532													16	84	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223178568	223178568	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223178568T>C	uc001hnu.1	+	8	3976	c.3829T>C	c.(3829-3831)TAC>CAC	p.Y1277H		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	1277					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		CCCAGATGCCTACAAACACTT	0.517													57	266	---	---	---	---	PASS
PYCR2	29920	broad.mit.edu	37	1	226109762	226109762	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226109762C>A	uc001hpq.2	-	4	491	c.336G>T	c.(334-336)CAG>CAT	p.Q112H	LEFTY1_uc010pvj.1_Intron|PYCR2_uc001hpp.2_Missense_Mutation_p.Q76H|PYCR2_uc001hpr.2_Missense_Mutation_p.Q65H|PYCR2_uc001hps.1_Missense_Mutation_p.Q65H	NM_013328	NP_037460	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member	112					proline biosynthetic process	cytoplasm	binding|pyrroline-5-carboxylate reductase activity				0	Breast(184;0.197)				L-Proline(DB00172)|NADH(DB00157)	TGGGGGCTGGCTGGAATGCCA	0.607													6	25	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1664726	1664726	+	Silent	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1664726G>A	uc002qxa.2	-	14	1828	c.1764C>T	c.(1762-1764)GAC>GAT	p.D588D	PXDN_uc002qxb.1_Silent_p.D588D	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	588	Ig-like C2-type 4.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGCGACCTGCGTCTGCAGGGC	0.527													14	63	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27663740	27663740	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27663740C>T	uc002rko.2	+	15	2094	c.1262C>T	c.(1261-1263)ACA>ATA	p.T421I	NRBP1_uc002rkq.2_Missense_Mutation_p.T420I|NRBP1_uc002rkp.2_Missense_Mutation_p.T421I|NRBP1_uc002rkr.2_Missense_Mutation_p.T212I|KRTCAP3_uc002rks.2_5'Flank|KRTCAP3_uc010ylr.1_5'Flank|KRTCAP3_uc002rkt.2_5'Flank	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	421					ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					GAGGAGGTGACATCACCTGTC	0.602													8	55	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50724852	50724852	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724852C>G	uc010fbq.2	-	14	4095	c.2618G>C	c.(2617-2619)GGT>GCT	p.G873A	NRXN1_uc002rxb.3_Missense_Mutation_p.G505A|NRXN1_uc002rxe.3_Missense_Mutation_p.G833A|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGCCATTTGACCTAAAAGAGA	0.373													9	99	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54883108	54883108	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54883108G>T	uc002rxu.2	+	29	6268	c.6019G>T	c.(6019-6021)GAA>TAA	p.E2007*	SPTBN1_uc002rxx.2_Nonsense_Mutation_p.E1994*|SPTBN1_uc002rxy.2_Nonsense_Mutation_p.E152*|SPTBN1_uc010you.1_5'Flank	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	2007	Spectrin 17.|Interaction with ANK2.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			CGACAAGTGGGAAGACCGATG	0.388													11	43	---	---	---	---	PASS
ORC4L	5000	broad.mit.edu	37	2	148693257	148693257	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148693257T>C	uc002twi.2	-	14	1268	c.1133A>G	c.(1132-1134)CAC>CGC	p.H378R	ORC4L_uc002twj.2_Missense_Mutation_p.H378R|ORC4L_uc010zbo.1_Missense_Mutation_p.H304R|ORC4L_uc010zbp.1_Missense_Mutation_p.H161R|ORC4L_uc010fnr.2_3'UTR|ORC4L_uc010zbq.1_Missense_Mutation_p.H294R|ORC4L_uc002twk.2_Missense_Mutation_p.H378R|ORC4L_uc002twl.1_RNA	NM_181741	NP_859525	O43929	ORC4_HUMAN	origin recognition complex subunit 4	378					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)		TTGCTGCAAGTGTTCAAAAGC	0.383													39	183	---	---	---	---	PASS
PTMA	5757	broad.mit.edu	37	2	232577877	232577877	+	3'UTR	SNP	A	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232577877A>G	uc002vsc.3	+	5					PTMA_uc002vsb.3_3'UTR|PTMA_uc010zmf.1_RNA|MIR1244_hsa-mir-1244-1|MI0006379_5'Flank	NM_001099285	NP_001092755	P06454	PTMA_HUMAN	prothymosin, alpha isoform 1						transcription, DNA-dependent	nucleus					0		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		AGGGTCAGCCATTTTTAATGA	0.343													4	21	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191470	10191470	+	Splice_Site	SNP	G	A	A	rs5030817		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191470G>A	uc003bvc.2	+	3	677	c.464_splice	c.e3-1	p.V155_splice	VHL_uc003bvd.2_Splice_Site_p.V114_splice	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(17)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGCCCTTCCAGTGTATACTCT	0.493		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	29	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49723670	49723670	+	Intron	SNP	T	C	C	rs2329008		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723670T>C	uc003cxg.2	-						MST1_uc011bcs.1_Missense_Mutation_p.K363R|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCCTCCAGCCTTGAGCCCGTG	0.662													2	6	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52439306	52439306	+	Silent	SNP	A	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52439306A>C	uc003ddx.2	-	11	1051	c.936T>G	c.(934-936)GGT>GGG	p.G312G	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	312					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CCTCCTCTGCACCATCTGAGA	0.592			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								14	81	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52620674	52620674	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620674G>A	uc003des.2	-	20	3166	c.3154C>T	c.(3154-3156)CGA>TGA	p.R1052*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.R1052*|PBRM1_uc003der.2_Nonsense_Mutation_p.R1020*|PBRM1_uc003det.2_Nonsense_Mutation_p.R1067*|PBRM1_uc003deu.2_Nonsense_Mutation_p.R1067*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.R1052*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.R1027*|PBRM1_uc003dey.2_Nonsense_Mutation_p.R1027*|PBRM1_uc003dez.1_Nonsense_Mutation_p.R1051*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.R964*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.R398*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1052	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCCTCATCTCGGAAGTTTTCT	0.378			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								8	99	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151165112	151165112	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151165112G>A	uc011bod.1	-	4	2657	c.2657C>T	c.(2656-2658)ACC>ATC	p.T886I		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	886					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATGTTGATTGGTTGTGCCTTG	0.418													146	661	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154018456	154018456	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154018456T>A	uc003ezy.3	-	11	1469	c.1388A>T	c.(1387-1389)GAA>GTA	p.E463V	DHX36_uc010hvq.2_Missense_Mutation_p.E463V|DHX36_uc003ezz.3_Missense_Mutation_p.E463V	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	463						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CTCCATCATTTCTATAACATC	0.308													20	156	---	---	---	---	PASS
MFSD1	64747	broad.mit.edu	37	3	158523240	158523240	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158523240G>T	uc003fcl.1	+	3	336	c.306G>T	c.(304-306)TTG>TTT	p.L102F	MFSD1_uc003fcm.1_Intron|MFSD1_uc003fcn.1_Intron|MFSD1_uc011bow.1_Intron|MFSD1_uc011box.1_Missense_Mutation_p.L29F	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing	102	Helical; (Potential).				transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTGGCTTTTTGATAGACCGAG	0.358													62	339	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193007828	193007828	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193007828G>T	uc011bsq.1	-	26	2869	c.2869C>A	c.(2869-2871)CCA>ACA	p.P957T		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	957					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCAGCTTTGGGTAGGCATGA	0.378													16	97	---	---	---	---	PASS
FAM53A	152877	broad.mit.edu	37	4	1670531	1670531	+	5'UTR	SNP	G	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1670531G>C	uc011bve.1	-	2					FAM53A_uc010ibw.2_5'UTR	NM_001013622	NP_001013644	Q6NSI3	FA53A_HUMAN	dorsal neural-tube nuclear protein							nucleus					0		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			CATCAGACTTGCGAAGGCCCC	0.567													4	25	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2955338	2955338	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2955338T>C	uc003ggj.1	-	5	719	c.647A>G	c.(646-648)GAG>GGG	p.E216G	C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_5'UTR|NOP14_uc003ggk.3_Missense_Mutation_p.E216G|NOP14_uc003ggl.2_Missense_Mutation_p.E216G|NOP14_uc010icq.1_RNA	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14	216					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						CTCCGTGAGCTCGAGGGCATC	0.478													79	435	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125590998	125590998	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125590998T>G	uc003ifg.3	-	3	3700	c.3434A>C	c.(3433-3435)GAT>GCT	p.D1145A	ANKRD50_uc011cgo.1_Missense_Mutation_p.D966A|ANKRD50_uc010inw.2_Missense_Mutation_p.D1145A	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1145	Ser-rich.									central_nervous_system(1)	1						AGGCTGCATATCCCCTCCACC	0.428													60	277	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1255447	1255447	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1255447C>T	uc003jcb.1	-	14	3170	c.3112G>A	c.(3112-3114)GAC>AAC	p.D1038N	TERT_uc003jbz.1_Missense_Mutation_p.D234N|TERT_uc003jca.1_Missense_Mutation_p.D1026N|TERT_uc003jcc.1_Missense_Mutation_p.D975N|TERT_uc003jcd.1_RNA|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	1038	CTE.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GAGGCCGTGTCAGAGATGACG	0.567									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				3	21	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41064635	41064635	+	Silent	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41064635G>T	uc003jmj.3	-	5	889	c.399C>A	c.(397-399)CTC>CTA	p.L133L		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	133							binding			ovary(6)|central_nervous_system(2)	8						TTTGCATGGTGAGCAGGGTCA	0.463													11	45	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75427933	75427933	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75427933C>T	uc003kei.1	+	2	492	c.358C>T	c.(358-360)CGA>TGA	p.R120*		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	120	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GTACAAGGACCGGCGGGAGCT	0.547													11	56	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131323842	131323842	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131323842G>T	uc010jdo.1	-	7	738	c.655C>A	c.(655-657)CCA>ACA	p.P219T	ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Missense_Mutation_p.P244T|ACSL6_uc003kvy.1_Missense_Mutation_p.P244T|ACSL6_uc003kwb.2_Missense_Mutation_p.P209T|ACSL6_uc003kvz.1_Missense_Mutation_p.P184T|ACSL6_uc003kwa.1_Missense_Mutation_p.P230T|ACSL6_uc010jdn.1_Missense_Mutation_p.P234T|ACSL6_uc010jdp.1_5'Flank	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	219	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGAGGCCTGGAGTCTCCTTC	0.562													47	506	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140263639	140263639	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140263639G>A	uc003lif.2	+	1	1786	c.1786G>A	c.(1786-1788)GCG>ACG	p.A596T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.A596T|PCDHA13_uc003lid.2_Missense_Mutation_p.A596T	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	596	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGGTGCGCGCGGTGGACGC	0.706													18	69	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774124	140774124	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774124G>A	uc003lkd.1	+	1	2642	c.1744G>A	c.(1744-1746)GCA>ACA	p.A582T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A582T	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	582	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCCGCTCCGCAGAGCGTGG	0.682													8	141	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145610355	145610355	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145610355T>C	uc003lnz.3	+	6	891	c.725T>C	c.(724-726)GTG>GCG	p.V242A	RBM27_uc003lny.2_Missense_Mutation_p.V242A	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	242					mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTGTTACTGTGATCGCACCT	0.463													45	138	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145610357	145610357	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145610357A>T	uc003lnz.3	+	6	893	c.727A>T	c.(727-729)ATC>TTC	p.I243F	RBM27_uc003lny.2_Missense_Mutation_p.I243F	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	243					mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTTACTGTGATCGCACCTGC	0.463													46	137	---	---	---	---	PASS
HLA-E	3133	broad.mit.edu	37	6	30457316	30457316	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30457316A>G	uc003nqg.2	+	1	46	c.8A>G	c.(7-9)GAT>GGT	p.D3G	HLA-E_uc011dmg.1_RNA|HLA-E_uc011dmh.1_Missense_Mutation_p.M1V	NM_005516	NP_005507	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	3					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			central_nervous_system(4)|ovary(1)	5						ATCATGGTAGATGGAACCCTC	0.582													10	92	---	---	---	---	PASS
ABRA	137735	broad.mit.edu	37	8	107773573	107773573	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107773573G>A	uc003ymm.3	-	2	892	c.838C>T	c.(838-840)CAC>TAC	p.H280Y		NM_139166	NP_631905	Q8N0Z2	ABRA_HUMAN	actin-binding Rho activating protein	280	Interaction with actin (By similarity).				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TCTCCTTTGTGTAGGCGGGTG	0.517													10	62	---	---	---	---	PASS
ABRA	137735	broad.mit.edu	37	8	107773580	107773580	+	Silent	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107773580G>A	uc003ymm.3	-	2	885	c.831C>T	c.(829-831)ACC>ACT	p.T277T		NM_139166	NP_631905	Q8N0Z2	ABRA_HUMAN	actin-binding Rho activating protein	277	Interaction with actin (By similarity).				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TGTGTAGGCGGGTGGACATGG	0.512													10	65	---	---	---	---	PASS
ABRA	137735	broad.mit.edu	37	8	107773583	107773583	+	Silent	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107773583G>A	uc003ymm.3	-	2	882	c.828C>T	c.(826-828)TCC>TCT	p.S276S		NM_139166	NP_631905	Q8N0Z2	ABRA_HUMAN	actin-binding Rho activating protein	276	Interaction with actin (By similarity).				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			GTAGGCGGGTGGACATGGCCA	0.517													10	63	---	---	---	---	PASS
OR51F1	256892	broad.mit.edu	37	11	4790883	4790883	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4790883A>T	uc010qyl.1	-	1	265	c.265T>A	c.(265-267)TTT>ATT	p.F89I		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	89						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CGTGCCTCAAACCAGAGGATA	0.428													16	69	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21250960	21250960	+	Silent	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21250960C>T	uc001mqe.2	+	14	1662	c.1509C>T	c.(1507-1509)ACC>ACT	p.T503T	NELL1_uc001mqf.2_Silent_p.T503T|NELL1_uc009yid.2_Silent_p.T531T|NELL1_uc010rdo.1_Silent_p.T446T|NELL1_uc010rdp.1_Silent_p.T263T	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	503	EGF-like 3.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ACAGCTGCACCTGCAAACCGG	0.572													10	59	---	---	---	---	PASS
CCDC67	159989	broad.mit.edu	37	11	93170919	93170919	+	3'UTR	SNP	A	C	C	rs35499275		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93170919A>C	uc001pdq.2	+	14						NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67											ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TCCCCCCCCCACCCCCGCCAA	0.348													10	20	---	---	---	---	PASS
LARP4	113251	broad.mit.edu	37	12	50821653	50821653	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50821653T>A	uc001rwp.1	+	2	271	c.127T>A	c.(127-129)TGG>AGG	p.W43R	LARP4_uc001rwo.1_Missense_Mutation_p.W43R|LARP4_uc001rwq.1_Missense_Mutation_p.W43R|LARP4_uc001rwr.1_Missense_Mutation_p.W43R|LARP4_uc001rws.1_Missense_Mutation_p.W42R|LARP4_uc001rwm.2_Missense_Mutation_p.W43R|LARP4_uc001rwn.2_5'UTR	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a	43							nucleotide binding|RNA binding			ovary(1)	1						TGAAAGCTCTTGGCATGAAAT	0.398													18	125	---	---	---	---	PASS
LETMD1	25875	broad.mit.edu	37	12	51450212	51450212	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51450212C>G	uc001rxm.2	+	7	898	c.842C>G	c.(841-843)ACT>AGT	p.T281S	LETMD1_uc010smz.1_Missense_Mutation_p.T231S|LETMD1_uc010sna.1_Missense_Mutation_p.N118K|LETMD1_uc001rxl.2_Missense_Mutation_p.T225S|LETMD1_uc009zlv.2_RNA|LETMD1_uc001rxs.2_Missense_Mutation_p.N118K|LETMD1_uc009zlw.2_Missense_Mutation_p.T294S|LETMD1_uc001rxn.2_Missense_Mutation_p.T124S|LETMD1_uc001rxo.2_RNA|LETMD1_uc001rxp.2_Missense_Mutation_p.T164S|LETMD1_uc001rxq.2_Missense_Mutation_p.T157S|LETMD1_uc001rxr.2_RNA|LETMD1_uc001rxt.2_Missense_Mutation_p.T21S	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1	281	Mitochondrial intermembrane (Potential).|LETM1.					integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						ACTCATACAACTGTGATTCAC	0.488													36	189	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124371778	124371778	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124371778C>G	uc001uft.3	+	51	8584	c.8559C>G	c.(8557-8559)AAC>AAG	p.N2853K		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2853	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGATTGAGAACAAAGCGATGA	0.532													4	38	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70681442	70681442	+	Silent	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70681442C>A	uc001vip.2	-	1	1184	c.390G>T	c.(388-390)GTG>GTT	p.V130V	KLHL1_uc010thm.1_Silent_p.V130V|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	130					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CCATGCCTGGCACCACCTCCT	0.582													13	116	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21937419	21937419	+	RNA	SNP	A	T	T	rs7179663	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21937419A>T	uc010tzj.1	-	1		c.3321T>A				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						CTATGCTCACAATAGTTCTTA	0.378													5	113	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90349847	90349847	+	5'UTR	SNP	A	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90349847A>G	uc002bop.3	-	2						NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	AGGGAGCCTCAGGCCAGGCAG	0.622													3	4	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3304667	3304667	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3304667G>A	uc002cun.1	-	2	441	c.401C>T	c.(400-402)CCG>CTG	p.P134L		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	134					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	GCCCCCGTACGGCCGAGGGCC	0.692													3	24	---	---	---	---	PASS
MVP	9961	broad.mit.edu	37	16	29853112	29853112	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29853112C>A	uc002dui.2	+	9	1471	c.1387C>A	c.(1387-1389)CCC>ACC	p.P463T	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc010vdz.1_RNA|MVP_uc002duj.2_Missense_Mutation_p.P463T|MVP_uc010vea.1_Missense_Mutation_p.P57T	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	463	MVP 9.				mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						CTACCGCGTGCCCCACAACGC	0.662													3	28	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31087733	31087733	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31087733C>G	uc002eap.2	+	2	377	c.88C>G	c.(88-90)CTC>GTC	p.L30V	ZNF668_uc002eao.2_5'Flank	NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	30	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CCGAGAACTGCTCCATCCATC	0.647													18	106	---	---	---	---	PASS
PDP2	57546	broad.mit.edu	37	16	66919397	66919397	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66919397G>A	uc002eqk.1	+	2	1372	c.1210G>A	c.(1210-1212)GAT>AAT	p.D404N		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	404					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		GAGGCCCCAGGATAAGTTCCT	0.582													14	103	---	---	---	---	PASS
ASGR2	433	broad.mit.edu	37	17	7010447	7010447	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7010447C>A	uc002gep.3	-	7	800	c.535G>T	c.(535-537)GTC>TTC	p.V179F	ASGR2_uc010vtk.1_Missense_Mutation_p.V16F|ASGR2_uc002gem.1_Missense_Mutation_p.V118F|ASGR2_uc002gen.1_Missense_Mutation_p.V160F|ASGR2_uc002geo.1_Missense_Mutation_p.V174F|ASGR2_uc002ger.3_Missense_Mutation_p.V179F|ASGR2_uc002geq.3_Missense_Mutation_p.V155F	NM_001181	NP_001172	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2 isoform a	179	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|endocytosis	focal adhesion|integral to membrane|nucleolus	asialoglycoprotein receptor activity|protein binding|sugar binding			ovary(1)	1					Antihemophilic Factor(DB00025)	ACCCAGTTGACGGGGCAGCAG	0.662													15	79	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15964798	15964798	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15964798A>G	uc002gpo.2	-	37	6038	c.5798T>C	c.(5797-5799)ATA>ACA	p.I1933T	NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpm.2_Missense_Mutation_p.I453T|NCOR1_uc010vwb.1_Missense_Mutation_p.I517T|NCOR1_uc010coy.2_Missense_Mutation_p.I841T|NCOR1_uc010vwc.1_Missense_Mutation_p.I743T	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1933	Interaction with C1D (By similarity).|CORNR box 1.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GATCACGTCTATGAAGTTAGC	0.478													69	416	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80394586	80394586	+	Silent	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80394586C>T	uc002kew.2	+	6	726	c.675C>T	c.(673-675)TAC>TAT	p.Y225Y	HEXDC_uc002kev.3_Silent_p.Y225Y|HEXDC_uc010diq.2_Silent_p.Y225Y|HEXDC_uc010wvm.1_RNA|HEXDC_uc010wvn.1_5'Flank			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	225					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TCTGGGACTACACGGCCGACC	0.657													6	10	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5407705	5407705	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5407705C>T	uc002kmt.1	-	15	2238	c.2152G>A	c.(2152-2154)GCA>ACA	p.A718T	EPB41L3_uc010wzh.1_Missense_Mutation_p.A549T|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Missense_Mutation_p.A110T	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	718	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TCTACCTGTGCCTTGAGCTCT	0.383													11	138	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67776858	67776858	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67776858A>G	uc002lkp.2	-	28	3847	c.3779T>C	c.(3778-3780)CTG>CCG	p.L1260P	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.L348P	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1260							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AAGGGACGGCAGGCCATAGAA	0.517													15	75	---	---	---	---	PASS
CSNK1G2	1455	broad.mit.edu	37	19	1980183	1980183	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1980183C>A	uc002lul.3	+	13	1752	c.1229C>A	c.(1228-1230)TCG>TAG	p.S410*	CSNK1G2_uc010dsu.2_Nonsense_Mutation_p.S362*	NM_001319	NP_001310	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2	410					sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAGAAAATCGCTGCAGCGA	0.662													10	48	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23543382	23543382	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23543382C>T	uc002nre.2	-	4	2512	c.2399G>A	c.(2398-2400)TGT>TAT	p.C800Y	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.C768Y	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	800	C2H2-type 24.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ACATTCTTCACATTTGTAGGG	0.393													30	169	---	---	---	---	PASS
LGALS13	29124	broad.mit.edu	37	19	40098030	40098030	+	3'UTR	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40098030C>T	uc002omb.2	+	4						NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13						lipid catabolic process|phospholipid metabolic process		carboxylesterase activity|lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			TCTACCTGACCATGGGATTCC	0.448													16	65	---	---	---	---	PASS
DMPK	1760	broad.mit.edu	37	19	46281778	46281778	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46281778G>A	uc002pdd.1	-	4	1128	c.584C>T	c.(583-585)TCG>TTG	p.S195L	DMPK_uc010xxs.1_Missense_Mutation_p.S96L|DMPK_uc002pde.1_Missense_Mutation_p.S195L|DMPK_uc002pdf.1_Missense_Mutation_p.S185L|DMPK_uc002pdg.1_Missense_Mutation_p.S185L|DMPK_uc002pdh.1_Missense_Mutation_p.S185L|DMPK_uc002pdi.1_Missense_Mutation_p.S211L|DMPK_uc010xxt.1_Missense_Mutation_p.S185L	NM_001081563	NP_001075032	Q09013	DMPK_HUMAN	myotonic dystrophy protein kinase isoform 1	195	Protein kinase.				regulation of heart contraction		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)	3		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CCGGTGCACCGAGTCTATGGC	0.627													7	25	---	---	---	---	PASS
SIGLEC16	400709	broad.mit.edu	37	19	50474955	50474955	+	Intron	SNP	C	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50474955C>T	uc002prf.2	+						uc010ybk.1_Silent_p.S3S	NR_002825				Homo sapiens cDNA FLJ50062 complete cds, highly similar to Sialic acid-binding Ig-like lectin 11 precursor.												0						TGATGGTTTCCCAAGCAAACA	0.597													23	150	---	---	---	---	PASS
RNF160	26046	broad.mit.edu	37	21	30339184	30339184	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30339184A>T	uc002ymr.2	-	10	1780	c.1767T>A	c.(1765-1767)GAT>GAA	p.D589E	RNF160_uc010gll.1_RNA	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	543							ligase activity|zinc ion binding				0						CAAGTATCTCATCAGCAAATC	0.368													5	87	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40075845	40075845	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40075845G>A	uc003ayc.2	+	33	5513	c.5513G>A	c.(5512-5514)TGC>TAC	p.C1838Y	CACNA1I_uc003ayd.2_Missense_Mutation_p.C1803Y|CACNA1I_uc003aye.2_Missense_Mutation_p.C1753Y|CACNA1I_uc003ayf.2_Missense_Mutation_p.C1718Y	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1838	Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CCTGCCGGCTGCAAGAAGTGT	0.612													4	18	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70613248	70613248	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70613248G>A	uc004dzu.3	+	21	3197	c.3146G>A	c.(3145-3147)CGT>CAT	p.R1049H	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.R1070H|TAF1_uc004dzv.3_Missense_Mutation_p.R223H	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1049					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AAATTTGCCCGTGGATCAAGG	0.483													22	112	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134427942	134427942	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134427942T>G	uc004eyp.2	-	3	2780	c.125A>C	c.(124-126)AAT>ACT	p.N42T	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'Flank|ZNF75D_uc004eyo.2_Missense_Mutation_p.N42T	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	42					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGGACCAAGATTCTCTATTTT	0.488													44	267	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138713618	138713618	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138713618T>A	uc004fau.2	-	3	518	c.224A>T	c.(223-225)CAA>CTA	p.Q75L	MCF2_uc004fav.2_Missense_Mutation_p.Q75L|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Missense_Mutation_p.Q75L|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Missense_Mutation_p.Q220L|MCF2_uc004faw.2_Missense_Mutation_p.Q135L|MCF2_uc011mwo.1_Missense_Mutation_p.Q135L	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	75	CRAL-TRIO.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					AGGGGTTAATTGCTTGTCATC	0.408													54	251	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153283528	153283528	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153283528G>A	uc004fjs.1	-	7	917	c.838C>T	c.(838-840)CAG>TAG	p.Q280*	IRAK1_uc004fjr.1_Nonsense_Mutation_p.Q280*|IRAK1_uc004fjt.1_Nonsense_Mutation_p.Q280*|IRAK1_uc010nur.2_Intron|IRAK1_uc004fju.2_Nonsense_Mutation_p.Q306*	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	280	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGCCGTTCTGAGCACAGTAG	0.602													8	26	---	---	---	---	PASS
CRYZ	1429	broad.mit.edu	37	1	75185185	75185185	+	Intron	DEL	T	-	-	rs72258036		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75185185delT	uc001dgk.2	-						CRYZ_uc001dgj.2_Intron|CRYZ_uc001dgl.2_Intron|CRYZ_uc001dgm.2_Intron	NM_001130042	NP_001123514	Q08257	QOR_HUMAN	crystallin, zeta isoform a						protein homotetramerization|visual perception|xenobiotic catabolic process	cytosol|Golgi apparatus	mRNA 3'-UTR binding|NADPH binding|NADPH:quinone reductase activity|zinc ion binding				0					Dicumarol(DB00266)	ATATAAATAAttttttttttt	0.134													4	2	---	---	---	---	
FAM102B	284611	broad.mit.edu	37	1	109167068	109167069	+	Intron	INS	-	AC	AC	rs78911235		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109167068_109167069insAC	uc010ouy.1	+							NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		AAAAAAAAAAAAAACCCTTTTC	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855792	148855796	+	IGR	DEL	GGGGC	-	-	rs59107880		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855792_148855796delGGGGC								NBPF16 (97481 upstream) : LOC645166 (72490 downstream)																							ggcggcggggggggcgggaaaaagc	0.395													4	2	---	---	---	---	
TMEM63A	9725	broad.mit.edu	37	1	226040254	226040255	+	Intron	INS	-	GGG	GGG			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226040254_226040255insGGG	uc001hpm.1	-							NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					CTCTTGTGGCTGTGGTTTTGGG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246675118	246675119	+	IGR	INS	-	GTGCC	GTGCC	rs144976585	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246675118_246675119insGTGCC								SMYD3 (4504 upstream) : TFB2M (28749 downstream)																							TTGGTGTCACTGTGCCCTGCCC	0.639													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28210681	28210682	+	Intron	INS	-	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28210681_28210682insA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|uc002rlw.2_5'Flank	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					gaccctgtctcaaaaaaaaaaa	0.099													4	3	---	---	---	---	
LCLAT1	253558	broad.mit.edu	37	2	30723963	30723964	+	Intron	DEL	TA	-	-	rs67154045		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30723963_30723964delTA	uc002rnj.2	+						LCLAT1_uc010ymp.1_Intron|LCLAT1_uc002rnk.1_Intron|LCLAT1_uc002rnl.2_Intron|LCLAT1_uc010ymq.1_Intron	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1						multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						tgtgtgtgtgtatgtgtgtgtg	0.000													2	4	---	---	---	---	
EML4	27436	broad.mit.edu	37	2	42552712	42552713	+	Intron	DEL	TA	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42552712_42552713delTA	uc002rsi.2	+						EML4_uc010fap.2_Intron|EML4_uc002rsj.2_Intron|EML4_uc010faq.2_Intron|EML4_uc010ynv.1_Intron	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						TGAATGATTTtatatatatata	0.272			T	ALK	NSCLC								9	4	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125506995	125506996	+	Intron	DEL	TC	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125506995_125506996delTC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ttccttcctttctctctctctc	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045442	+	3'UTR	DEL	TTTT	-	-	rs78349226		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439_139045442delTTTT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaaaaa	0.377													4	2	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196771178	196771178	+	Intron	DEL	T	-	-	rs35550789		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196771178delT	uc002utj.3	-							NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTTTCTTTCTTTTTTTtttt	0.060													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218537762	218537763	+	Intron	INS	-	G	G	rs142493424	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537762_218537763insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						ATGCCAAAAAAGCGGGGGGAAA	0.431													4	3	---	---	---	---	
SACM1L	22908	broad.mit.edu	37	3	45755730	45755732	+	Intron	DEL	TTT	-	-	rs112928052	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45755730_45755732delTTT	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735	Q9NTJ5	SAC1_HUMAN	suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TGCTATTTTGTTTGTTTTTTTTT	0.300													4	3	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123066917	123066918	+	Intron	DEL	CA	-	-	rs10551109		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123066917_123066918delCA	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		tgtgtctgtgcatgtgtgtgta	0.460													10	6	---	---	---	---	
BDH2	56898	broad.mit.edu	37	4	104012551	104012552	+	Intron	DEL	CT	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104012551_104012552delCT	uc003hwz.2	-						BDH2_uc003hxa.2_Intron	NM_020139	NP_064524	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2						fatty acid beta-oxidation|heme metabolic process|iron ion homeostasis|siderophore biosynthetic process	cytoplasm	3-hydroxybutyrate dehydrogenase activity|NAD binding|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		GTCTCTTTCCCTTATCAAGACT	0.302													12	6	---	---	---	---	
NLN	57486	broad.mit.edu	37	5	65081433	65081433	+	Intron	DEL	A	-	-	rs111882029		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65081433delA	uc003juf.2	+						NLN_uc003jue.2_Intron|NLN_uc003jug.2_Intron|NLN_uc010iww.2_5'Flank	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TCATGAATCCAAAAAAAAAAA	0.249													3	3	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179442525	179442525	+	Intron	DEL	G	-	-	rs66797381		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442525delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaaaggagtagggaaaggagt	0.040													2	5	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7562607	7562607	+	Intron	DEL	T	-	-	rs147191716		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7562607delT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GTAGATTTGGTTTTTTTTTTT	0.358													4	2	---	---	---	---	
ZKSCAN4	387032	broad.mit.edu	37	6	28217849	28217850	+	Intron	INS	-	T	T			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28217849_28217850insT	uc003nks.1	-						ZKSCAN4_uc011dlb.1_Intron	NM_019110	NP_061983	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						TGGtttttttgttttttttttt	0.183													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56427095	56427096	+	Intron	INS	-	TGAGTGTTGAAA	TGAGTGTTGAAA	rs143571870	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56427095_56427096insTGAGTGTTGAAA	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACAGTAATCACACATAAAACAC	0.287													3	3	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	81053717	81053719	+	Intron	DEL	TTG	-	-	rs142572622		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81053717_81053719delTTG	uc003pjd.2	+						BCKDHB_uc003pje.2_3'UTR	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		ATTTACAtttttgttgttgttgt	0.118													3	4	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150094487	150094501	+	Intron	DEL	GTTTTGTTTTGTTTT	-	-	rs71672010		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150094487_150094501delGTTTTGTTTTGTTTT	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		TGTAGAAGGAgttttgttttgttttgttttgtttt	0.130													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21847333	21847333	+	Intron	DEL	T	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21847333delT	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TAATGATGGATTTCAAACACA	0.393									Kartagener_syndrome				4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36561830	36561831	+	Intron	INS	-	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36561830_36561831insA	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						CCATGTTGACCAAGCCACGGCT	0.530													6	3	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71142502	71142502	+	Intron	DEL	T	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71142502delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGCATGCAGAttttttttttt	0.169													6	3	---	---	---	---	
ANGPT2	285	broad.mit.edu	37	8	6357261	6357268	+	3'UTR	DEL	TTCAGATC	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6357261_6357268delTTCAGATC	uc003wqj.3	-	9					MCPH1_uc003wqi.2_Intron|ANGPT2_uc003wqk.3_3'UTR|ANGPT2_uc010lri.2_3'UTR	NM_001147	NP_001138	O15123	ANGP2_HUMAN	angiopoietin 2 isoform a precursor						angiogenesis|blood coagulation|leukocyte migration|negative regulation of blood vessel endothelial cell migration|negative regulation of positive chemotaxis|Tie receptor signaling pathway	extracellular space	metal ion binding|receptor tyrosine kinase binding			upper_aerodigestive_tract(1)	1		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		ACACATCTATTTCAGATCTGCGGAGTGT	0.332													21	10	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													4	7	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39107309	39107310	+	Intron	INS	-	GGAA	GGAA			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39107309_39107310insGGAA	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ggagggagtggggaaggaagga	0.035													3	4	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77415536	77415536	+	Intron	DEL	A	-	-	rs35092699		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77415536delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GGCTTCCTTTAAAAAAAAAAA	0.199													5	3	---	---	---	---	
BRD3	8019	broad.mit.edu	37	9	136917012	136917013	+	Intron	DEL	TT	-	-	rs71757839		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136917012_136917013delTT	uc004cew.2	-						BRD3_uc004cex.2_Intron	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		gttttttttgtttttttttttt	0.079			T	NUT|C15orf55	lethal midline carcinoma of young people								4	2	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634780	45634780	+	Intron	DEL	C	-	-	rs141209668		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634780delC	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						AAAAAAAAAACAAAATTTGTA	0.164													6	4	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	53080211	53080211	+	Intron	DEL	G	-	-	rs34370245		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53080211delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTGGTCAGAAGAAGGTATGCA	0.478													3	3	---	---	---	---	
KIF20B	9585	broad.mit.edu	37	10	91488697	91488706	+	Intron	DEL	TGTGTGTGTA	-	-	rs72295744		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91488697_91488706delTGTGTGTGTA	uc001kgs.1	+						KIF20B_uc001kgr.1_Intron|KIF20B_uc001kgt.1_Intron	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1						cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						tgtgtgtgtgtgtgtgtgtatgtAATTTTT	0.143													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94985788	94985789	+	IGR	INS	-	T	T	rs140557797	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94985788_94985789insT								CYP26A1 (148147 upstream) : MYOF (80398 downstream)																							cccagagggagtgttacagtgc	0.000													0	6	---	---	---	---	
CCDC147	159686	broad.mit.edu	37	10	106158934	106158935	+	Intron	DEL	GT	-	-	rs140937747		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106158934_106158935delGT	uc001kyh.2	+							NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147											ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TTCTTTATGAgtgtgtgtgtgt	0.317													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20065348	20065349	+	Intron	INS	-	A	A			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20065348_20065349insA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						tttttttttccaaaaaaaaaaa	0.213													4	2	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26655628	26655628	+	Intron	DEL	A	-	-	rs143862667		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26655628delA	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ctccatttccaaaaaaaaaaa	0.020													4	2	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47189416	47189417	+	Intron	INS	-	A	A	rs34204386		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189416_47189417insA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TCAGCTTGTTTaaaaaaaaaaa	0.243													3	3	---	---	---	---	
FIBP	9158	broad.mit.edu	37	11	65653641	65653641	+	Intron	DEL	A	-	-	rs5792375		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65653641delA	uc001ogd.2	-						FIBP_uc009yqu.2_Intron|FIBP_uc001oge.2_Intron	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a						fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		ccgtctcattaaaaaaaaaaa	0.209													6	3	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077164	73077165	+	Intron	INS	-	TG	TG	rs150743209	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077164_73077165insTG	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						TCTAGGATAGTtgtgtgtgtgt	0.386													4	4	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494862	49494863	+	Intron	INS	-	A	A	rs145985167	by1000genomes	TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494862_49494863insA	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						GCCCTCCTTTCAAATTAAGTCT	0.317													5	3	---	---	---	---	
KRT7	3855	broad.mit.edu	37	12	52631511	52631514	+	Intron	DEL	TGTG	-	-	rs149565720		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52631511_52631514delTGTG	uc001saa.1	+						KRT7_uc009zmf.1_Intron	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7						cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		ggtgcgtgtatgtgtgtgtgtgtg	0.279													4	2	---	---	---	---	
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs66529359		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	9	1715_1735	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						tccggagccgtagctgctacctccggagccatagctgccac	0.000													7	4	---	---	---	---	
SOAT2	8435	broad.mit.edu	37	12	53514402	53514403	+	Intron	INS	-	A	A	rs35658019		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53514402_53514403insA	uc001sbv.2	+						SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						cagcctgtctcaaaaaaaaaaa	0.193													4	4	---	---	---	---	
TMEM19	55266	broad.mit.edu	37	12	72080802	72080802	+	Intron	DEL	T	-	-	rs34090337		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72080802delT	uc001sws.2	+						TMEM19_uc001swr.1_Intron|TMEM19_uc009zru.1_Intron	NM_018279	NP_060749	Q96HH6	TMM19_HUMAN	transmembrane protein 19							integral to membrane					0		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		TACCTATttcttttttttttt	0.134													4	3	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						CACCTTTGCAtttctttctttctt	0.221													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56038832	56038833	+	IGR	DEL	AG	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56038832_56038833delAG								PRTG (3655 upstream) : NEDD4 (80298 downstream)																							aaaaaaaaaaagaaGCTCCTGG	0.277													4	2	---	---	---	---	
PARP16	54956	broad.mit.edu	37	15	65563598	65563598	+	Intron	DEL	T	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65563598delT	uc002aoo.2	-						PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Intron	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16							integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						atctgaaaggttttttttttg	0.095													4	2	---	---	---	---	
FSD2	123722	broad.mit.edu	37	15	83438317	83438318	+	Intron	INS	-	A	A	rs71455426		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83438317_83438318insA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing											central_nervous_system(1)	1						ggactcatctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19455255	19455258	+	Intron	DEL	ATGG	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19455255_19455258delATGG	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ggatggatacatggatggatggat	0.015													6	4	---	---	---	---	
AATK	9625	broad.mit.edu	37	17	79098839	79098847	+	Intron	DEL	GCAGGGTGA	-	-	rs141491493		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79098839_79098847delGCAGGGTGA	uc010dia.2	-						AATK_uc010dhz.2_5'Flank|hsa-mir-3065|MI0014228_5'Flank	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			aggggcaggggcagggtgagcagggtgag	0.330													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	54969573	54969574	+	IGR	DEL	GT	-	-	rs73961054		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54969573_54969574delGT								WDR7 (272537 upstream) : ST8SIA3 (50147 downstream)																							TGTGTAGGGGgtgtgtgtgtgt	0.297													4	2	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8136735	8136735	+	Intron	DEL	C	-	-	rs112155120		TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8136735delC	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCCCCAGAGACCCCCCCCAAG	0.587													5	3	---	---	---	---	
FARSA	2193	broad.mit.edu	37	19	13036039	13036039	+	Intron	DEL	T	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13036039delT	uc002mvs.2	-						FARSA_uc002mvt.2_Intron|FARSA_uc010xmv.1_Intron|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit						phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	TTCCCACCCCttttttttttt	0.299													4	2	---	---	---	---	
CGB	1082	broad.mit.edu	37	19	49532321	49532321	+	Intron	DEL	C	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49532321delC	uc010yad.1	-						CGB2_uc002plw.2_5'Flank|CGB2_uc010yaf.1_5'Flank	NM_033183	NP_149439	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 8						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	ttctttctttctttttttttt	0.249													5	3	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24753780	24753780	+	Intron	DEL	T	-	-			TCGA-B0-4842-01A-02D-1421-08	TCGA-B0-4842-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24753780delT	uc004dbl.2	+							NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	TGCAAGATAGTTTTTTTTTTT	0.348													4	2	---	---	---	---	
