Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AADACL4	343066	broad.mit.edu	37	1	12711197	12711197	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12711197T>C	uc001auf.2	+	2	224	c.224T>C	c.(223-225)TTA>TCA	p.L75S		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	75	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		ATTCGTTTTTTACATGATAGC	0.463													19	176	---	---	---	---	PASS
SSX2IP	117178	broad.mit.edu	37	1	85112985	85112985	+	3'UTR	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85112985C>T	uc001dkh.2	-	15					SSX2IP_uc001dkf.2_3'UTR|SSX2IP_uc001dkg.2_RNA|SSX2IP_uc010orz.1_3'UTR|SSX2IP_uc001dki.2_3'UTR|SSX2IP_uc010osa.1_3'UTR|SSX2IP_uc001dkj.2_3'UTR	NM_014021	NP_054740	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting						cell adhesion	nucleus|protein complex				ovary(2)	2				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TGGGGGAAGACAGGGAAGTCC	0.333													4	18	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94946103	94946103	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94946103A>G	uc001dqn.3	+	9	870	c.768A>G	c.(766-768)ATA>ATG	p.I256M	ABCD3_uc010oto.1_Missense_Mutation_p.I280M|ABCD3_uc010otp.1_Missense_Mutation_p.I183M|ABCD3_uc009wdr.2_Missense_Mutation_p.I256M|ABCD3_uc001dqo.3_5'Flank	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	256	ABC transmembrane type-1.				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		AGATGACAATAACTGAGCAAA	0.388													31	161	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	97564120	97564120	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97564120C>T	uc001drv.2	-	21	2828	c.2691G>A	c.(2689-2691)CTG>CTA	p.L897L		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	897					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TTTGTTCTTTCAGTCTAATCT	0.353													52	169	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110766481	110766481	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110766481C>T	uc001dzh.2	+	2	1631	c.1574C>T	c.(1573-1575)CCC>CTC	p.P525L	KCNC4_uc001dzf.2_Missense_Mutation_p.P525L|KCNC4_uc009wfr.2_Missense_Mutation_p.P525L|KCNC4_uc001dzg.2_Missense_Mutation_p.P525L|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	525	Cytoplasmic (Potential).				synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GATACCAGCCCCCCTGCCCGG	0.607													11	43	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113616152	113616152	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113616152C>T	uc001edf.1	+	1	322	c.124C>T	c.(124-126)CTC>TTC	p.L42F	LRIG2_uc009wgn.1_5'UTR|uc001ede.1_5'Flank	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	42	LRRNT.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CGGAGCAGGTCTCTGCCCCGC	0.662											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	173	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145359169	145359169	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145359169T>A	uc001end.3	+	74	9369	c.9334T>A	c.(9334-9336)TTG>ATG	p.L3112M	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oyq.1_Intron|NBPF10_uc010oyr.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3037											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCGTGTTGGCTTGGCTGTTGA	0.458													6	488	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152082043	152082043	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152082043T>C	uc001ezp.2	-	2	3650	c.3650A>G	c.(3649-3651)GAG>GGG	p.E1217G	TCHH_uc009wne.1_Missense_Mutation_p.E1217G	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1217					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGCTGATCCTCATCCCGGTA	0.323													3	200	---	---	---	---	PASS
BGLAP	632	broad.mit.edu	37	1	156212968	156212968	+	3'UTR	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156212968G>A	uc001fnt.2	+	4					BGLAP_uc001fns.1_3'UTR	NM_199173	NP_954642	P02818	OSTCN_HUMAN	osteocalcin preproprotein						bone mineralization|cell adhesion|odontogenesis|regulation of bone mineralization|regulation of bone resorption|regulation of osteoclast differentiation		calcium ion binding|hydroxyapatite binding|structural constituent of bone				0	Hepatocellular(266;0.158)				Phytonadione(DB01022)	TCGCTCTGCTGGCCTGGCCGG	0.627													27	132	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169521872	169521872	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169521872G>T	uc001ggg.1	-	8	1364	c.1219C>A	c.(1219-1221)CAT>AAT	p.H407N	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	407	F5/8 type A 2.|Plastocyanin-like 3.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TTCACTGTATGTTTGGTGAAG	0.363													5	419	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169565278	169565278	+	Silent	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169565278A>G	uc001ggi.3	-	12	2051	c.1986T>C	c.(1984-1986)TTT>TTC	p.F662F	SELP_uc001ggh.2_Silent_p.F497F|SELP_uc009wvr.2_Silent_p.F662F	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	662	Extracellular (Potential).|Sushi 8.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	TATTAAAACCAAAGGTTCCCG	0.512													207	494	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204943773	204943773	+	Intron	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204943773C>T	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_3'UTR|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Silent_p.C27C|NFASC_uc001hbk.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TGTTCTGCTGCTCTGTTGTGA	0.418													10	142	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769356	247769356	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769356C>T	uc010pyz.1	+	1	469	c.469C>T	c.(469-471)CTA>TTA	p.L157L		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GGCTAGTTCCCTAATCCATGC	0.483													10	198	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25972794	25972794	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25972794G>T	uc002rgs.2	-	11	1852	c.1631C>A	c.(1630-1632)GCG>GAG	p.A544E	ASXL2_uc002rgt.1_Missense_Mutation_p.A284E	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	544					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGTGGACCCGCTCCTGCTGT	0.463													4	181	---	---	---	---	PASS
C2orf39	92749	broad.mit.edu	37	2	26667780	26667780	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26667780G>A	uc002rhg.2	+	10	1434	c.1360G>A	c.(1360-1362)GCC>ACC	p.A454T	C2orf39_uc010eym.1_RNA	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	454											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGAAGTCCGCCACACAGAT	0.174													4	53	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32640716	32640716	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32640716C>A	uc010ezu.2	+	10	2491	c.2357C>A	c.(2356-2358)TCA>TAA	p.S786*		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	786					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GAGCTGGAATCAAATCTTGCT	0.368													22	135	---	---	---	---	PASS
ZC3H6	376940	broad.mit.edu	37	2	113074843	113074843	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113074843A>C	uc002thq.1	+	7	1304	c.910A>C	c.(910-912)AAA>CAA	p.K304Q		NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6	304	C3H1-type 2.						nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4						GGAGAAAAGAAAAGAGATCTG	0.249													6	32	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128927880	128927880	+	Silent	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128927880G>T	uc002tps.2	+	27	3118	c.2940G>T	c.(2938-2940)CCG>CCT	p.P980P	UGGT1_uc010fme.1_Silent_p.P855P|UGGT1_uc002tpr.2_Silent_p.P956P	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	980					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						AACTGAGGCCGAAGGAAGGGG	0.438													15	54	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141777522	141777522	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141777522G>A	uc002tvj.1	-	12	2911	c.1939C>T	c.(1939-1941)CCC>TCC	p.P647S	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	647	Extracellular (Potential).|LDL-receptor class B 6.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTCCTCTGGGATGAGACATT	0.368										TSP Lung(27;0.18)			16	164	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158406767	158406767	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158406767C>T	uc002tzk.3	-	4	925	c.682G>A	c.(682-684)GAT>AAT	p.D228N	ACVR1C_uc002tzl.3_Missense_Mutation_p.D148N|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.D178N	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	228	Protein kinase.|Cytoplasmic (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						GATCTTTCATCTCTGGAGGAG	0.438													11	192	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179474417	179474417	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179474417G>T	uc010zfg.1	-	221	44253	c.44029C>A	c.(44029-44031)CCC>ACC	p.P14677T	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P8372T|TTN_uc010zfi.1_Missense_Mutation_p.P8305T|TTN_uc010zfj.1_Missense_Mutation_p.P8180T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15604							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACCAATGGGATCTACAGCT	0.403													36	284	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179571283	179571283	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179571283G>T	uc010zfg.1	-	99	25810	c.25586C>A	c.(25585-25587)GCA>GAA	p.A8529E	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A5190E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9456							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCGTTAAATGCCACGCATCG	0.403													16	298	---	---	---	---	PASS
ANKZF1	55139	broad.mit.edu	37	2	220099648	220099648	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220099648G>T	uc002vkg.2	+	10	1479	c.1305G>T	c.(1303-1305)AAG>AAT	p.K435N	ANKZF1_uc010zkv.1_3'UTR|ANKZF1_uc010zkw.1_3'UTR|ANKZF1_uc002vkh.2_Missense_Mutation_p.K225N|ANKZF1_uc002vki.2_Missense_Mutation_p.K435N|ANKZF1_uc002vkj.1_3'UTR	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing	435						intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATTGCCCAAGCGGAGGAGGA	0.522													5	86	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238280845	238280845	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238280845G>A	uc002vwl.2	-	9	4100	c.3815C>T	c.(3814-3816)GCT>GTT	p.A1272V	COL6A3_uc002vwo.2_Missense_Mutation_p.A1066V|COL6A3_uc010znj.1_Missense_Mutation_p.A665V|COL6A3_uc002vwq.2_Missense_Mutation_p.A1066V|COL6A3_uc002vwr.2_Missense_Mutation_p.A865V	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1272	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTGGATGACAGCCACCCGGGT	0.602													3	57	---	---	---	---	PASS
LRRN1	57633	broad.mit.edu	37	3	3886816	3886816	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3886816C>T	uc003bpt.3	+	2	1252	c.491C>T	c.(490-492)GCA>GTA	p.A164V	SUMF1_uc003bps.1_Intron	NM_020873	NP_065924	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1 precursor	164	LRR 4.|Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CATGCTTTTGCAGGCTTAAAA	0.393													4	217	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52439913	52439913	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52439913G>A	uc003ddx.2	-	10	914	c.799C>T	c.(799-801)CAG>TAG	p.Q267*	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	267					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGCTCTGGCTGTGTTACTCTT	0.517			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								14	45	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52440295	52440295	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52440295G>A	uc003ddx.2	-	9	872	c.757C>T	c.(757-759)CAG>TAG	p.Q253*	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	253					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.Q253*(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGTACTGTCTGACGGTTCACC	0.602			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								5	55	---	---	---	---	PASS
ABHD6	57406	broad.mit.edu	37	3	58270837	58270837	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58270837G>A	uc003djs.3	+	7	1117	c.707G>A	c.(706-708)CGC>CAC	p.R236H	ABHD6_uc003djr.2_Missense_Mutation_p.R236H|ABHD6_uc003djt.3_Missense_Mutation_p.R236H	NM_020676	NP_065727	Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	236	Cytoplasmic (Potential).					integral to membrane	acylglycerol lipase activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		GTCGATGTCCGCATCCCTCAT	0.443													5	198	---	---	---	---	PASS
MCM2	4171	broad.mit.edu	37	3	127340675	127340675	+	3'UTR	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127340675C>A	uc003ejp.2	+	16					MCM2_uc011bkm.1_3'UTR|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_3'UTR	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						TCAGTGCCCTCTGTGCTTTAT	0.512													3	16	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132257175	132257175	+	3'UTR	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132257175A>T	uc003eor.2	+	56						NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						CCAAGTCCACATTCCTCCAGC	0.428													6	25	---	---	---	---	PASS
SORCS2	57537	broad.mit.edu	37	4	7533341	7533341	+	Silent	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7533341G>T	uc003gkb.3	+	3	633	c.633G>T	c.(631-633)CCG>CCT	p.P211P	SORCS2_uc011bwi.1_Silent_p.P39P	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	211	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ACATCTGCCCGACCAACAAGA	0.612													4	29	---	---	---	---	PASS
SORCS2	57537	broad.mit.edu	37	4	7533342	7533342	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7533342A>T	uc003gkb.3	+	3	634	c.634A>T	c.(634-636)ACC>TCC	p.T212S	SORCS2_uc011bwi.1_Missense_Mutation_p.T40S	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	212	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						CATCTGCCCGACCAACAAGAG	0.607													4	29	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20599899	20599899	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20599899T>A	uc003gpr.1	+	33	3777	c.3573T>A	c.(3571-3573)GAT>GAA	p.D1191E	SLIT2_uc003gps.1_Missense_Mutation_p.D1183E	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1191	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TTGCCACAGATGAAGACAGCG	0.483													5	277	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69795773	69795773	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69795773G>C	uc003hef.2	-	6	1373	c.1342C>G	c.(1342-1344)CAT>GAT	p.H448D	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	448	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						GGTTGATCATGGTGAATTCTT	0.423													22	173	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126398472	126398472	+	Silent	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126398472A>G	uc003ifj.3	+	13	12456	c.12456A>G	c.(12454-12456)GCA>GCG	p.A4152A	FAT4_uc011cgp.1_Silent_p.A2415A|FAT4_uc003ifi.1_Silent_p.A1630A	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4152	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CTTTGGCAGCACAAGGCATCC	0.393													22	231	---	---	---	---	PASS
ELF2	1998	broad.mit.edu	37	4	140046348	140046348	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140046348G>C	uc003ihp.1	-	3	414	c.208C>G	c.(208-210)CAA>GAA	p.Q70E	ELF2_uc003ihq.2_RNA	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription	70					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					TCAACTTCTTGTTCTTCTGCC	0.398													14	268	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169158930	169158930	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169158930T>C	uc003irp.2	-	31	4473	c.4181A>G	c.(4180-4182)AAG>AGG	p.K1394R		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1394							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAATGAATGCTTTAGCACTGA	0.338													4	133	---	---	---	---	PASS
CDKN2AIP	55602	broad.mit.edu	37	4	184366710	184366710	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184366710A>G	uc003ivp.1	+	2	457	c.295A>G	c.(295-297)AAA>GAA	p.K99E	CDKN2AIP_uc003ivq.1_Translation_Start_Site	NM_017632	NP_060102	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	99					negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AGTTATGGATAAAATACTTAG	0.383													14	112	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3599934	3599934	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599934C>A	uc003jde.2	+	2	924	c.872C>A	c.(871-873)CCG>CAG	p.P291Q		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	291						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						GCCCCAGAGCCGGGCAGCACG	0.726													4	10	---	---	---	---	PASS
NDUFS4	4724	broad.mit.edu	37	5	52954452	52954452	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52954452A>C	uc003jpe.2	+	4	450	c.422A>C	c.(421-423)AAT>ACT	p.N141T		NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4	141					brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	GCAGAAAAAAATGGTATGTTT	0.313													7	158	---	---	---	---	PASS
GZMA	3001	broad.mit.edu	37	5	54401368	54401368	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54401368T>G	uc003jpm.2	+	2	174	c.137T>G	c.(136-138)CTT>CGT	p.L46R		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	46	Peptidase S1.				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				ATGGTCCTACTTAGTCTTGAC	0.403													6	168	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	58270734	58270734	+	Silent	SNP	A	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58270734A>C	uc003jsa.2	-	15	2359	c.2187T>G	c.(2185-2187)GGT>GGG	p.G729G	PDE4D_uc003jrx.2_Silent_p.G593G|PDE4D_uc003jry.2_Silent_p.G427G|PDE4D_uc003jrz.2_Silent_p.G665G|PDE4D_uc003jsb.2_Silent_p.G668G|PDE4D_uc003jrt.2_Silent_p.G427G|PDE4D_uc003jru.2_Silent_p.G505G|PDE4D_uc003jrv.2_Silent_p.G599G|PDE4D_uc003jrw.2_Silent_p.G607G|PDE4D_uc003jrs.2_Silent_p.G438G	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1	729					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TCTCAGTTTGACCCTGCCGGC	0.498													13	253	---	---	---	---	PASS
TRIM23	373	broad.mit.edu	37	5	64892965	64892965	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64892965C>T	uc003jty.2	-	8	1308	c.1222G>A	c.(1222-1224)GTT>ATT	p.V408I	TRIM23_uc003jtw.2_Missense_Mutation_p.V408I|TRIM23_uc003jtx.2_Missense_Mutation_p.V408I	NM_001656	NP_001647	P36406	TRI23_HUMAN	ADP-ribosylation factor domain protein 1 isoform	408	ARF-like.				interspecies interaction between organisms|small GTPase mediated signal transduction	Golgi membrane|lysosomal membrane	enzyme activator activity|GDP binding|GTP binding|GTPase activity|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CCTAACGTAACGACCCGAATT	0.323													28	162	---	---	---	---	PASS
POC5	134359	broad.mit.edu	37	5	74981058	74981058	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74981058C>A	uc003keh.3	-	10	1578	c.1381G>T	c.(1381-1383)GCA>TCA	p.A461S	POC5_uc010izu.2_Missense_Mutation_p.A344S|POC5_uc003keg.3_Missense_Mutation_p.A436S	NM_001099271	NP_001092741	Q8NA72	POC5_HUMAN	proteome of centriole 5 isoform 1	461					cell cycle	centriole				lung(1)	1						GCAGTAGCTGCAGATCCTGCA	0.428													3	24	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145613200	145613200	+	Silent	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145613200T>C	uc003lnz.3	+	7	1204	c.1038T>C	c.(1036-1038)GGT>GGC	p.G346G	RBM27_uc003lny.2_Silent_p.G346G	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	346	Pro-rich.				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			cgggcccaggtccaggcccag	0.393													4	108	---	---	---	---	PASS
SLU7	10569	broad.mit.edu	37	5	159834605	159834605	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159834605A>G	uc003lyg.2	-	11	1158	c.1003T>C	c.(1003-1005)TAT>CAT	p.Y335H		NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7	335					alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCTTGTCATAGGCTTCCCAT	0.388													11	145	---	---	---	---	PASS
GPRIN1	114787	broad.mit.edu	37	5	176026768	176026768	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176026768C>T	uc003meo.1	-	2	243	c.68G>A	c.(67-69)CGA>CAA	p.R23Q		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	23						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTGTGGGTCGGGGTCCTGG	0.642													9	74	---	---	---	---	PASS
EXOC2	55770	broad.mit.edu	37	6	532529	532529	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:532529A>G	uc003mtd.2	-	23	2454	c.2320T>C	c.(2320-2322)TCC>CCC	p.S774P	EXOC2_uc003mte.2_Missense_Mutation_p.S774P|EXOC2_uc011dho.1_Missense_Mutation_p.S369P	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	774					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GGTTCTAAGGAGCCAACGATG	0.378													34	154	---	---	---	---	PASS
GCNT2	2651	broad.mit.edu	37	6	10529342	10529342	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10529342A>T	uc010joo.2	+	3	749	c.198A>T	c.(196-198)AAA>AAT	p.K66N	GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Missense_Mutation_p.K65N|GCNT2_uc010jon.2_Missense_Mutation_p.K65N	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,	66	Lumenal (Potential).					Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		ATGCATTGAAAACTACCCTTG	0.433													38	201	---	---	---	---	PASS
HIST1H3J	8356	broad.mit.edu	37	6	27858524	27858524	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27858524G>A	uc003nka.2	-	1	47	c.47C>T	c.(46-48)GCA>GTA	p.A16V	HIST1H2BO_uc003nkc.1_5'Flank	NM_003535	NP_003526	P68431	H31_HUMAN	histone cluster 1, H3j	16					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						CTTCCGCGGTGCCTTGCCGCC	0.617													7	18	---	---	---	---	PASS
ZNF165	7718	broad.mit.edu	37	6	28053590	28053590	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28053590A>T	uc003nkg.2	+	3	1416	c.332A>T	c.(331-333)GAA>GTA	p.E111V	ZNF165_uc003nkh.2_Missense_Mutation_p.E111V|ZNF165_uc003nki.3_Missense_Mutation_p.E111V	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165	111	SCAN box.				viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TGGGTACATGAACATTACCCA	0.522													15	66	---	---	---	---	PASS
GPR63	81491	broad.mit.edu	37	6	97247000	97247000	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97247000C>A	uc010kcl.2	-	3	1086	c.608G>T	c.(607-609)TGG>TTG	p.W203L	GPR63_uc003pou.2_Missense_Mutation_p.W203L	NM_001143957	NP_001137429	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	203	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GGAAGTTGCCCAAGAAACTGC	0.463													35	141	---	---	---	---	PASS
C6orf103	79747	broad.mit.edu	37	6	147124301	147124301	+	Intron	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147124301T>C	uc010khx.2	+						C6orf103_uc003qlp.2_Intron|C6orf103_uc003qlq.2_Intron|C6orf103_uc003qlr.2_Intron|LOC729176_uc010khy.2_RNA	NM_024694	NP_078970	Q8N7X0	CAN7L_HUMAN	hypothetical protein LOC79747						oxygen transport|proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|heme binding|oxygen binding			central_nervous_system(2)|lung(1)	3		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.04e-08)|GBM - Glioblastoma multiforme(68;0.0113)		ACAAATAAGCTACAAGTTCAC	0.388													10	78	---	---	---	---	PASS
C6orf103	79747	broad.mit.edu	37	6	147124303	147124303	+	Intron	SNP	C	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147124303C>G	uc010khx.2	+						C6orf103_uc003qlp.2_Intron|C6orf103_uc003qlq.2_Intron|C6orf103_uc003qlr.2_Intron|LOC729176_uc010khy.2_RNA	NM_024694	NP_078970	Q8N7X0	CAN7L_HUMAN	hypothetical protein LOC79747						oxygen transport|proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|heme binding|oxygen binding			central_nervous_system(2)|lung(1)	3		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.04e-08)|GBM - Glioblastoma multiforme(68;0.0113)		AAATAAGCTACAAGTTCACTT	0.383													11	78	---	---	---	---	PASS
RAPGEF5	9771	broad.mit.edu	37	7	22165225	22165225	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22165225A>T	uc003svg.2	-	25	2387	c.2074T>A	c.(2074-2076)TTT>ATT	p.F692I		NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	542	Ras-GEF.				nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						TACTCACCAAACTGGTTAGTC	0.438													29	127	---	---	---	---	PASS
INMT	11185	broad.mit.edu	37	7	30793389	30793389	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30793389C>T	uc003tbs.1	+	2	213	c.197C>T	c.(196-198)CCT>CTT	p.P66L	FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Missense_Mutation_p.P65L	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	66						cytoplasm	amine N-methyltransferase activity				0						GGCTCAGGTCCTACCATCTAC	0.532													5	471	---	---	---	---	PASS
KBTBD2	25948	broad.mit.edu	37	7	32909091	32909091	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909091G>A	uc003tdb.2	-	4	2397	c.1738C>T	c.(1738-1740)CGA>TGA	p.R580*	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	580	Kelch 5.										0			GBM - Glioblastoma multiforme(11;0.0499)			ACAGTGCATCGAAAATCTCTC	0.468													7	146	---	---	---	---	PASS
KIAA0895	23366	broad.mit.edu	37	7	36396886	36396886	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36396886C>A	uc003tfd.2	-	3	543	c.492G>T	c.(490-492)TGG>TGT	p.W164C	KIAA0895_uc003tfc.2_Missense_Mutation_p.W151C|KIAA0895_uc011kaw.1_Missense_Mutation_p.W13C|KIAA0895_uc003tfb.2_Missense_Mutation_p.W113C|KIAA0895_uc011kax.1_Missense_Mutation_p.W113C|KIAA0895_uc003tfe.2_Missense_Mutation_p.W151C|KIAA0895_uc011kay.1_Missense_Mutation_p.W113C	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN	hypothetical protein LOC23366 isoform 1	164											0						CCAGGCAGTACCAAGTACCAC	0.468													24	111	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100856398	100856398	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100856398C>T	uc003uyd.2	-	7	1223	c.767G>A	c.(766-768)GGT>GAT	p.G256D	PLOD3_uc010lhs.2_5'Flank	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	256					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CTTAGTGGGACCGTTTCCATG	0.602													9	42	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103293158	103293158	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103293158C>G	uc003vca.2	-	14	1763	c.1603G>C	c.(1603-1605)GCT>CCT	p.A535P	RELN_uc010liz.2_Missense_Mutation_p.A535P	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	535					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AATTTGGTAGCAGGAGTCTGA	0.423													28	176	---	---	---	---	PASS
ST7	7982	broad.mit.edu	37	7	116870009	116870009	+	Silent	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116870009G>A	uc011knn.1	+	14	1541	c.1536G>A	c.(1534-1536)GGG>GGA	p.G512G	ST7_uc003vio.2_3'UTR|ST7_uc003viq.2_3'UTR|ST7_uc011knm.1_3'UTR|ST7_uc003vir.2_3'UTR	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b	Error:Variant_position_missing_in_Q9NRC1_after_alignment						integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TTGAAAAAGGGAAGCCATTCC	0.433													5	33	---	---	---	---	PASS
WNT16	51384	broad.mit.edu	37	7	120965530	120965530	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120965530C>A	uc003vjv.2	+	1	110	c.61C>A	c.(61-63)CTA>ATA	p.L21I		NM_016087	NP_057171	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family,	Error:Variant_position_missing_in_Q9UBV4_after_alignment					anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|keratinocyte differentiation|keratinocyte proliferation|negative regulation of cell death|optic cup formation involved in camera-type eye development|oxidative stress-induced premature senescence|positive regulation of gene expression|positive regulation of JNK cascade|positive regulation of phosphatidylinositol 3-kinase cascade|replicative senescence|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			lung(2)|ovary(2)|large_intestine(1)	5	all_neural(327;0.117)					AAAGACCTCCCTATGGTGGGT	0.453													8	134	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10468848	10468848	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10468848C>T	uc003wtc.2	-	4	2989	c.2760G>A	c.(2758-2760)CGG>CGA	p.R920R		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	920					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CGGACAGCCCCCGAGACCCCG	0.706													12	34	---	---	---	---	PASS
FGF20	26281	broad.mit.edu	37	8	16850608	16850608	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16850608C>T	uc003wxc.1	-	3	742	c.609G>A	c.(607-609)TTG>TTA	p.L203L	FGF20_uc010lsv.1_RNA|FGF20_uc010lsw.1_3'UTR	NM_019851	NP_062825	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	203					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	extracellular region|soluble fraction	growth factor activity			lung(1)	1				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGTCCTTGTACAATTCTGGAA	0.413													9	278	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068103	38068103	+	3'UTR	SNP	G	T	T	rs111385150	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068103G>T	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GCCTGTTGATGACAAGAAGCA	0.338													5	52	---	---	---	---	PASS
PPAPDC1B	84513	broad.mit.edu	37	8	38125965	38125965	+	Silent	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38125965G>C	uc003xlf.3	-	3	219	c.198C>G	c.(196-198)CTC>CTG	p.L66L	PPAPDC1B_uc003xle.3_Silent_p.L25L|PPAPDC1B_uc003xlg.3_Silent_p.L66L|PPAPDC1B_uc010lwd.2_Silent_p.L66L	NM_001102559	NP_001096029	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain	66	Helical; (Potential).				phospholipid dephosphorylation	cytoplasm|integral to membrane|plasma membrane	phosphatidate phosphatase activity				0	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			ACAGTGGAGAGAGAAATGCAA	0.493													2	9	---	---	---	---	PASS
FGFR1	2260	broad.mit.edu	37	8	38275767	38275767	+	Missense_Mutation	SNP	C	G	G	rs121909637		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38275767C>G	uc003xlp.2	-	11	2351	c.1409G>C	c.(1408-1410)CGC>CCC	p.R470P	FGFR1_uc010lwf.2_RNA|FGFR1_uc011lbo.1_Missense_Mutation_p.R468P|FGFR1_uc011lbp.1_Missense_Mutation_p.R381P|FGFR1_uc011lbq.1_Missense_Mutation_p.R379P|FGFR1_uc010lwk.2_Missense_Mutation_p.R460P	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	470	Cytoplasmic (Potential).				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CAGCTCCCAGCGAGGGTCTTC	0.517		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						10	198	---	---	---	---	PASS
FAM110B	90362	broad.mit.edu	37	8	59059205	59059205	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059205A>G	uc003xtj.1	+	5	1296	c.416A>G	c.(415-417)CAC>CGC	p.H139R		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	139						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GGGCACAAGCACAGCTCCCGC	0.642													4	12	---	---	---	---	PASS
ZHX1	11244	broad.mit.edu	37	8	124266979	124266979	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124266979C>A	uc003yqe.2	-	3	1638	c.1208G>T	c.(1207-1209)GGA>GTA	p.G403V	C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.G403V|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.G403V	NM_007222	NP_009153	Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	403	Required for dimerization.|Required for interaction with NFYA.				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GGTGTTTGTTCCAGCCACTTG	0.453													9	141	---	---	---	---	PASS
FAM154A	158297	broad.mit.edu	37	9	18950805	18950805	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18950805G>A	uc003zni.1	-	2	447	c.169C>T	c.(169-171)CGG>TGG	p.R57W	FAM154A_uc010mip.1_5'UTR	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297	57										pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		TGGTACTCCCGCCTTGGCTTG	0.448													4	264	---	---	---	---	PASS
PTAR1	375743	broad.mit.edu	37	9	72338284	72338284	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72338284A>T	uc004ahj.3	-	6	927	c.905T>A	c.(904-906)CTT>CAT	p.L302H	PTAR1_uc004ahi.2_Missense_Mutation_p.L223H	NM_001099666	NP_001093136	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat	302	PFTA 5.				protein prenylation		protein prenyltransferase activity			central_nervous_system(1)	1						GGAATCAATAAGATCAGTGCT	0.398													65	286	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100240743	100240743	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100240743G>A	uc004axj.2	+	13	2414	c.2189G>A	c.(2188-2190)CGG>CAG	p.R730Q	TDRD7_uc011lux.1_Missense_Mutation_p.R656Q|TDRD7_uc010msp.1_5'UTR|TDRD7_uc011luy.1_Missense_Mutation_p.R50Q	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	730	Tudor 2.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				CACAGCAGCCGGGCTCTTGAT	0.408													4	214	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116346645	116346645	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116346645G>C	uc004bhq.2	+	21	3162	c.2953G>C	c.(2953-2955)GAG>CAG	p.E985Q	RGS3_uc004bhs.2_Missense_Mutation_p.E875Q|RGS3_uc004bht.2_Missense_Mutation_p.E704Q|RGS3_uc010muy.2_Intron|RGS3_uc004bhv.2_Missense_Mutation_p.E306Q|RGS3_uc010muz.1_Missense_Mutation_p.E324Q|RGS3_uc004bhw.2_Intron|RGS3_uc011lxh.1_Missense_Mutation_p.E295Q|RGS3_uc004bhx.2_Missense_Mutation_p.E306Q|RGS3_uc004bhy.1_Missense_Mutation_p.E295Q|RGS3_uc004bhz.2_Missense_Mutation_p.E327Q	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	985					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CCTCAAGAAAGAGCTGGGCCG	0.612													13	52	---	---	---	---	PASS
FUBP3	8939	broad.mit.edu	37	9	133485350	133485350	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133485350A>T	uc004bzr.1	+	3	308	c.200A>T	c.(199-201)CAG>CTG	p.Q67L	FUBP3_uc010mzd.1_Missense_Mutation_p.Q7L|FUBP3_uc004bzs.1_5'UTR	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	67					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		GTAGGTAACCAGTTAGGGGCC	0.378													33	168	---	---	---	---	PASS
AKR1C1	1645	broad.mit.edu	37	10	5011032	5011032	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5011032G>T	uc001iho.2	+	10	1307	c.466G>T	c.(466-468)GAT>TAT	p.D156Y	AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc001ihq.2_Missense_Mutation_p.D156Y	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	156					bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	GAAGTGTAAAGATGCAGGATT	0.478													12	127	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30317995	30317995	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30317995G>A	uc001iux.2	-	2	1141	c.1082C>T	c.(1081-1083)ACG>ATG	p.T361M	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.T223M|KIAA1462_uc009xle.1_Missense_Mutation_p.T361M	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	361	Pro-rich.									ovary(4)	4						TATGGGCACCGTGTCTTCCAA	0.612													4	202	---	---	---	---	PASS
CSGALNACT2	55454	broad.mit.edu	37	10	43678701	43678701	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43678701G>T	uc001jan.2	+	8	1675	c.1340G>T	c.(1339-1341)GGA>GTA	p.G447V		NM_018590	NP_061060	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate	447	Lumenal (Potential).				chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Golgi cisterna membrane|integral to Golgi membrane	glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding			ovary(1)	1						CTTACAGGTGGATTTGACATG	0.378													13	305	---	---	---	---	PASS
CUZD1	50624	broad.mit.edu	37	10	124594540	124594540	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124594540C>T	uc001lgq.2	-	7	1396	c.1064G>A	c.(1063-1065)CGT>CAT	p.R355H	CUZD1_uc001lgp.2_Missense_Mutation_p.R74H|CUZD1_uc009yad.2_Missense_Mutation_p.R74H|CUZD1_uc009yaf.2_5'UTR|CUZD1_uc001lgr.2_Missense_Mutation_p.R74H|CUZD1_uc010qty.1_Missense_Mutation_p.R74H|CUZD1_uc009yae.2_Missense_Mutation_p.R74H|CUZD1_uc001lgs.2_Missense_Mutation_p.R355H|CUZD1_uc010qtz.1_Missense_Mutation_p.R355H	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor	355	Extracellular (Potential).|ZP.				cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TTGTTTCTGACGGGTGATCAC	0.343													20	186	---	---	---	---	PASS
HIPK3	10114	broad.mit.edu	37	11	33363111	33363111	+	Silent	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33363111A>G	uc001mul.1	+	8	2046	c.1776A>G	c.(1774-1776)GCA>GCG	p.A592A	HIPK3_uc001mum.1_Silent_p.A592A|HIPK3_uc009yjv.1_Silent_p.A592A	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	592					anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						TGTTTCAGGCATTGACCACAT	0.383													64	257	---	---	---	---	PASS
BSCL2	26580	broad.mit.edu	37	11	62458159	62458159	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62458159G>C	uc001nuo.1	-	10	1391	c.967C>G	c.(967-969)CAG>GAG	p.Q323E	LRRN4CL_uc001nun.2_5'Flank|BSCL2_uc009yoc.1_Silent_p.V275V|BSCL2_uc001nup.2_Missense_Mutation_p.Q323E|BSCL2_uc001nuq.1_Missense_Mutation_p.Q323E|BSCL2_uc001nur.3_Missense_Mutation_p.Q387E|BSCL2_uc009yod.2_Missense_Mutation_p.Q387E|BSCL2_uc001nut.3_Missense_Mutation_p.Q389E|HNRNPUL2_uc001nuu.1_RNA	NM_032667	NP_116056	Q96G97	BSCL2_HUMAN	seipin isoform 2	323	Cytoplasmic (Potential).				cell death	integral to endoplasmic reticulum membrane					0						TCGGACAGCTGACCCTCTGCA	0.602													3	75	---	---	---	---	PASS
SF3B2	10992	broad.mit.edu	37	11	65827424	65827424	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65827424C>T	uc001ogy.1	+	13	1613	c.1573C>T	c.(1573-1575)CCA>TCA	p.P525S		NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	525					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						CTTCGAGCTGCCAGACTTCAT	0.617													9	61	---	---	---	---	PASS
FOLR4	390243	broad.mit.edu	37	11	94040428	94040428	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94040428G>A	uc010rud.1	+	3	425	c.425G>A	c.(424-426)TGC>TAC	p.C142Y		NM_001080486	NP_001073955	A6ND01	FOLR4_HUMAN	folate receptor 4 (delta) homolog	149						extracellular region	folic acid binding|receptor activity			ovary(1)	1						TCTTACACATGCAAATCCAAC	0.617													4	31	---	---	---	---	PASS
AASDHPPT	60496	broad.mit.edu	37	11	105962100	105962100	+	Silent	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105962100C>A	uc001pjc.1	+	4	735	c.589C>A	c.(589-591)CGG>AGG	p.R197R	AASDHPPT_uc010rvn.1_RNA|AASDHPPT_uc001pjd.1_Silent_p.R50R	NM_015423	NP_056238	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde	197					macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		TGAATTGCAGCGGCTTGAATT	0.368													4	232	---	---	---	---	PASS
DDX6	1656	broad.mit.edu	37	11	118656898	118656898	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118656898C>T	uc001pub.2	-	2	424	c.63G>A	c.(61-63)CTG>CTA	p.L21L	DDX6_uc001puc.2_Silent_p.L21L	NM_004397	NP_004388	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6	21					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity			ovary(1)	1	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CAGGGCCTCTCAGCTGACCAT	0.478			T	IGH@	B-NHL								32	133	---	---	---	---	PASS
KLRC3	3823	broad.mit.edu	37	12	10588502	10588502	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10588502T>A	uc001qyh.2	-	1	91	c.84A>T	c.(82-84)AAA>AAT	p.K28N	KLRC2_uc010she.1_Missense_Mutation_p.K28N|KLRC2_uc001qyk.2_Missense_Mutation_p.K28N	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	28	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						AAATGGAGCTTTTATTGCCTT	0.413													83	520	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54893217	54893217	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54893217A>T	uc001sgc.3	+	2	260	c.181A>T	c.(181-183)AAA>TAA	p.K61*	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Nonsense_Mutation_p.K11*	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	61					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TATCAACAAGAAATTTCCCAA	0.408													17	138	---	---	---	---	PASS
PHLDA1	22822	broad.mit.edu	37	12	76424988	76424988	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76424988C>T	uc001sxu.2	-	1	569	c.534G>A	c.(532-534)GGG>GGA	p.G178G		NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,	178	PH.				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				TAAGCAGCAGCCCTTCCTCGG	0.453													7	18	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104182685	104182685	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104182685C>G	uc010swe.1	-	10	1073	c.1032G>C	c.(1030-1032)AAG>AAC	p.K344N		NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	344							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						TCTCATTCATCTTTCGGAAAG	0.403													64	381	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113565939	113565939	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113565939T>A	uc001tum.1	-	4	460	c.167A>T	c.(166-168)GAG>GTG	p.E56V	RASAL1_uc010syp.1_Missense_Mutation_p.E56V|RASAL1_uc001tul.2_Missense_Mutation_p.E56V|RASAL1_uc001tun.1_Missense_Mutation_p.E56V|RASAL1_uc010syq.1_Missense_Mutation_p.E56V|RASAL1_uc001tuo.3_Missense_Mutation_p.E56V|RASAL1_uc010syr.1_Missense_Mutation_p.E56V	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	56	C2 1.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						CACCGTGTACTCCTCCCCCCA	0.622													27	275	---	---	---	---	PASS
RNF34	80196	broad.mit.edu	37	12	121868005	121868005	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121868005G>A	uc001uam.1	+	7	1346	c.1232G>A	c.(1231-1233)CGT>CAT	p.R411H	KDM2B_uc001uaq.2_Intron|KDM2B_uc010szy.1_3'UTR|KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uat.2_3'UTR|KDM2B_uc001uau.2_3'UTR|KDM2B_uc001uao.2_Intron|KDM2B_uc010szx.1_3'UTR|KDM2B_uc001uap.2_Intron	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2	Error:Variant_position_missing_in_Q969K3_after_alignment					apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		GTTGTCCCACGTTCCAAATGG	0.468													11	136	---	---	---	---	PASS
KL	9365	broad.mit.edu	37	13	33635225	33635225	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33635225C>T	uc001uus.2	+	4	2017	c.2009C>T	c.(2008-2010)GCC>GTC	p.A670V	KL_uc001uur.1_3'UTR	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	670	Glycosyl hydrolase-1 2.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		GCAGAGTATGCCCGACTGTGC	0.577													4	86	---	---	---	---	PASS
CDADC1	81602	broad.mit.edu	37	13	49852533	49852533	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49852533C>T	uc001vcu.2	+	7	1174	c.1098C>T	c.(1096-1098)TAC>TAT	p.Y366Y	CDADC1_uc010tgk.1_Silent_p.Y168Y|CDADC1_uc001vcv.2_RNA	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	366							hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		GATGTGGTTACAATGCTTTTC	0.408													81	384	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105414997	105414997	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105414997T>C	uc010axc.1	-	7	6911	c.6791A>G	c.(6790-6792)GAC>GGC	p.D2264G	AHNAK2_uc001ypx.2_Missense_Mutation_p.D2164G	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2264						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCTTTTAGGTCCAGCTTGGG	0.602													20	261	---	---	---	---	PASS
HERC2P2	400322	broad.mit.edu	37	15	23312056	23312056	+	3'UTR	SNP	A	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23312056A>G	uc001yvr.2	-	19					HERC2P2_uc001yvq.2_5'Flank|HERC2P2_uc001yvo.3_5'Flank|HERC2P2_uc001yvp.3_RNA					RecName: Full=Putative HERC2-like protein 3;												0						ACGGCACTGCACCGCTCTTCA	0.647													4	10	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35674026	35674026	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35674026A>C	uc001zja.2	-	7	721	c.659T>G	c.(658-660)ATT>AGT	p.I220S	ATPBD4_uc001ziz.2_Missense_Mutation_p.I204S	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1	220											0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		ATCTTACACAATTATTTTCTT	0.323													4	205	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43322177	43322177	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43322177G>A	uc001zqq.2	-	21	2410	c.2344C>T	c.(2344-2346)CCA>TCA	p.P782S	UBR1_uc010udk.1_Missense_Mutation_p.P782S	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	782					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GCACTGTGTGGCATGGGTTCA	0.388													16	326	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72191150	72191150	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72191150T>C	uc002atl.3	-	25	4167	c.3694A>G	c.(3694-3696)AAC>GAC	p.N1232D	MYO9A_uc010biq.2_Missense_Mutation_p.N852D|MYO9A_uc002atn.1_Missense_Mutation_p.N1213D|MYO9A_uc002atk.2_5'UTR|MYO9A_uc002atm.1_5'UTR	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1232	Tail.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TGCTGCTTGTTTGGTGACTCC	0.448													12	313	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91306308	91306308	+	Silent	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91306308G>A	uc002bpr.2	+	8	2092	c.1995G>A	c.(1993-1995)CTG>CTA	p.L665L	BLM_uc010uqh.1_Silent_p.L665L|BLM_uc010uqi.1_Silent_p.L290L|BLM_uc010bnx.2_Silent_p.L665L|BLM_uc002bps.1_Silent_p.L227L	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	665					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AATTTGGCCTGCATAATTTTA	0.353			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				5	261	---	---	---	---	PASS
MCTP2	55784	broad.mit.edu	37	15	95013670	95013670	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95013670G>T	uc002btj.2	+	20	2534	c.2469G>T	c.(2467-2469)TGG>TGT	p.W823C	MCTP2_uc010boj.2_Missense_Mutation_p.W552C|MCTP2_uc010bok.2_Missense_Mutation_p.W768C|MCTP2_uc002btl.2_Missense_Mutation_p.W411C	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	823					calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TTTTAATCTGGGGTAAGTTTG	0.403													15	225	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3640657	3640657	+	Silent	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3640657G>T	uc002cvp.2	-	12	3609	c.2982C>A	c.(2980-2982)ATC>ATA	p.I994I		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	994	Interaction with PLK1 and TERF2-TERF2IP.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						ACGGCTCTGAGATCTCTCCCT	0.562								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				31	144	---	---	---	---	PASS
A2BP1	54715	broad.mit.edu	37	16	7568250	7568250	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7568250C>T	uc002cys.2	+	5	1117	c.129C>T	c.(127-129)GCC>GCT	p.A43A	A2BP1_uc010buf.1_Silent_p.A43A|A2BP1_uc002cyr.1_Silent_p.A43A|A2BP1_uc002cyt.2_Silent_p.A43A|A2BP1_uc010uxz.1_Silent_p.A86A|A2BP1_uc010uya.1_Silent_p.A79A|A2BP1_uc002cyv.1_Silent_p.A43A|A2BP1_uc010uyb.1_Silent_p.A43A|A2BP1_uc002cyw.2_Silent_p.A63A|A2BP1_uc002cyy.2_Silent_p.A63A|A2BP1_uc002cyx.2_Silent_p.A63A|A2BP1_uc010uyc.1_Silent_p.A63A	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	43					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		AATACACGGCCCCTCATCCCC	0.637													22	157	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24788568	24788568	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24788568G>A	uc002dmm.2	+	5	592	c.478G>A	c.(478-480)GCA>ACA	p.A160T	TNRC6A_uc010bxs.2_5'UTR	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	160					negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TGTTATAGCAGCAAACCTTGG	0.458													57	235	---	---	---	---	PASS
GINS3	64785	broad.mit.edu	37	16	58437126	58437126	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58437126C>A	uc002enh.3	+	2	519	c.311C>A	c.(310-312)CCC>CAC	p.P104H	GINS3_uc010cdj.2_Missense_Mutation_p.P143H|GINS3_uc002enj.3_Intron|GINS3_uc002eni.3_Missense_Mutation_p.P104H	NM_022770	NP_073607	Q9BRX5	PSF3_HUMAN	GINS complex subunit 3 isoform b	104					DNA replication	nucleus					0						AGTGCAGATCCCAATGTGGTG	0.517													11	142	---	---	---	---	PASS
GSG2	83903	broad.mit.edu	37	17	3629514	3629514	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3629514G>T	uc002fwp.2	+	1	2318	c.2285G>T	c.(2284-2286)TGT>TTT	p.C762F	ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin	762	Protein kinase.				cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						AAGACTAAATGTAACACTCCT	0.433													4	74	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579396	7579396	+	Silent	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579396G>A	uc002gim.2	-	4	485	c.291C>T	c.(289-291)GTC>GTT	p.V97V	TP53_uc002gig.1_Silent_p.V97V|TP53_uc002gih.2_Silent_p.V97V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.V97V|TP53_uc010cni.1_Silent_p.V97V|TP53_uc002gij.2_Silent_p.V97V|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.V58V|TP53_uc010cnk.1_Silent_p.V112V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	97	Interaction with WWOX.		V -> I (in familial cancer not matching LFS; germline mutation and in a sporadic cancer; somatic mutation).|V -> F (in a sporadic cancer; somatic mutation).|V -> A (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.S99fs*48(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.V97A(1)|p.V97I(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGGGAAGGGACAGAAGATG	0.637		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			21	65	---	---	---	---	PASS
SUZ12	23512	broad.mit.edu	37	17	30302576	30302576	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30302576A>T	uc002hgs.2	+	7	889	c.667A>T	c.(667-669)AAA>TAA	p.K223*	SUZ12_uc002hgt.2_Nonsense_Mutation_p.K200*	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	223					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CAATCAAACAAAACCCGGAAA	0.403			T	JAZF1	endometrial stromal tumours								19	113	---	---	---	---	PASS
ACSF2	80221	broad.mit.edu	37	17	48538731	48538731	+	Silent	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48538731G>C	uc002iqu.2	+	3	557	c.453G>C	c.(451-453)CTG>CTC	p.L151L	ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Silent_p.L176L|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor	151					fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCATCATTCTGGTGAGGAGGG	0.617													5	27	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3814204	3814204	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3814204G>A	uc002kmf.2	-	2	1094	c.1027C>T	c.(1027-1029)CGG>TGG	p.R343W	DLGAP1_uc010wyz.1_Missense_Mutation_p.R343W|DLGAP1_uc002kme.1_Missense_Mutation_p.R41W|DLGAP1_uc010dkn.2_Missense_Mutation_p.R41W|DLGAP1_uc010wyw.1_Missense_Mutation_p.R49W|DLGAP1_uc010wyx.1_Missense_Mutation_p.R55W|DLGAP1_uc010wyy.1_Missense_Mutation_p.R55W|DLGAP1_uc002kmg.2_Missense_Mutation_p.R41W|DLGAP1_uc002kmk.2_Missense_Mutation_p.R343W	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	343					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				CTGCCACTCCGCATTCTTCGG	0.463													4	236	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39584467	39584467	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39584467C>A	uc002lap.2	+	10	1190	c.1132C>A	c.(1132-1134)CGT>AGT	p.R378S	PIK3C3_uc010xcl.1_Missense_Mutation_p.R315S	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	378					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						AACTGTGAGGCGTTATGCTGT	0.453										TSP Lung(28;0.18)			3	68	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42532882	42532882	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42532882G>T	uc010dni.2	+	4	3873	c.3577G>T	c.(3577-3579)GCA>TCA	p.A1193S		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	1193						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GCTGAGTAGCGCAGACAAAGA	0.542									Schinzel-Giedion_syndrome				3	40	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43262443	43262443	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43262443G>C	uc010dnj.2	+	21	3043	c.2722G>C	c.(2722-2724)GCA>CCA	p.A908P	SLC14A2_uc002lbe.2_Missense_Mutation_p.A908P	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	908						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						AAACAGAAGGGCATCAATCAT	0.507													9	224	---	---	---	---	PASS
TCF3	6929	broad.mit.edu	37	19	1612376	1612376	+	Intron	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1612376C>T	uc002ltr.2	-						TCF3_uc002ltn.2_5'UTR|TCF3_uc002lto.2_Intron|TCF3_uc002ltt.3_Missense_Mutation_p.R548H|TCF3_uc002ltq.2_Intron|TCF3_uc002lts.1_Missense_Mutation_p.R463H	NM_003200	NP_003191	P15923	TFE2_HUMAN	transcription factor 3 isoform E12						B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding			lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATTGGCCATGCGCCTCTCCCG	0.632			T	PBX1|HLF|TFPT	pre B-ALL								4	108	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9065878	9065878	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9065878T>C	uc002mkp.2	-	3	21772	c.21568A>G	c.(21568-21570)AGC>GGC	p.S7190G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7192	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTCCAGAGCTGGGAATCTCC	0.498													37	203	---	---	---	---	PASS
ZNF788	388507	broad.mit.edu	37	19	12222351	12222351	+	5'UTR	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12222351G>A	uc002mtd.2	+	3						NR_027049				RecName: Full=Zinc finger protein 788;												0						GCACACACTGGAGAAAAACCC	0.393													4	29	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33608751	33608751	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33608751C>T	uc002nug.1	+	16	2531	c.2217C>T	c.(2215-2217)GAC>GAT	p.D739D	GPATCH1_uc002nuh.1_Silent_p.D116D	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	739						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					AAGATGTGGACGCACAGGCTG	0.498													13	90	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35540270	35540270	+	Silent	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35540270C>T	uc002nxq.1	+	4	338	c.93C>T	c.(91-93)GCC>GCT	p.A31A	HPN_uc002nxr.1_Silent_p.A31A|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_5'UTR|HPN_uc002nxt.1_5'UTR	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin	31	Helical; Signal-anchor for type II membrane protein; (Potential).				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	TTCTGACAGCCATCGGGGCGG	0.667													8	157	---	---	---	---	PASS
ZNF468	90333	broad.mit.edu	37	19	53344618	53344618	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53344618C>T	uc002qaf.2	-	4	1080	c.929G>A	c.(928-930)CGC>CAC	p.R310H	ZNF468_uc002qae.2_Missense_Mutation_p.R257H	NM_001008801	NP_001008801	Q5VIY5	ZN468_HUMAN	zinc finger protein ZNF468 isoform 2	310	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0358)		GTGTGATTTGCGACTGAAAAC	0.388													6	407	---	---	---	---	PASS
ZNF347	84671	broad.mit.edu	37	19	53644593	53644593	+	Silent	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53644593T>C	uc002qbb.1	-	5	1557	c.1488A>G	c.(1486-1488)GCA>GCG	p.A496A	ZNF347_uc010eql.1_Silent_p.A497A|ZNF347_uc002qbc.1_Silent_p.A497A	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	496	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		GGTTTGAATGTGCTCTAAAGG	0.413													12	387	---	---	---	---	PASS
CPXM1	56265	broad.mit.edu	37	20	2776408	2776408	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2776408C>A	uc002wgu.2	-	11	1621	c.1557G>T	c.(1555-1557)GAG>GAT	p.E519D	CPXM1_uc010gas.2_Intron	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	519					cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						TGGGCGTGAGCTCGCGGGCAG	0.617													6	99	---	---	---	---	PASS
SPEF1	25876	broad.mit.edu	37	20	3759097	3759097	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3759097C>T	uc002wjj.2	-	6	742	c.574G>A	c.(574-576)GAG>AAG	p.E192K		NM_015417	NP_056232	Q9Y4P9	SPEF1_HUMAN	calponin-homology and microtubule-associated	192						cilium axoneme|cytoplasm|cytoskeleton					0						GCCAACAGCTCCTGCTCCTTT	0.701													7	32	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60578313	60578313	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60578313C>A	uc002ybs.2	-	9	2389	c.2389G>T	c.(2389-2391)GCC>TCC	p.A797S		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	797					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GGTAACACGGCGGGTTTCACC	0.493													3	84	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33074643	33074643	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33074643T>C	uc002ypd.2	-	5	797	c.371A>G	c.(370-372)AAA>AGA	p.K124R	SFRS15_uc002ype.2_Missense_Mutation_p.K124R|SFRS15_uc010glu.2_Missense_Mutation_p.K109R|SFRS15_uc002ypf.1_5'Flank|SFRS15_uc002ypg.2_Missense_Mutation_p.K124R	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	124	CID.					nucleus	nucleotide binding|RNA binding				0						AATTTCAATTTTGAACACTCC	0.363													17	159	---	---	---	---	PASS
CBR1	873	broad.mit.edu	37	21	37445149	37445149	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37445149T>G	uc002yvb.1	+	3	932	c.803T>G	c.(802-804)TTT>TGT	p.F268C	uc011aea.1_Intron|SETD4_uc002yva.2_Intron|CBR1_uc010gmy.1_3'UTR	NM_001757	NP_001748	P16152	CBR1_HUMAN	carbonyl reductase 1	268					drug metabolic process|vitamin K metabolic process	cytoplasm	15-hydroxyprostaglandin dehydrogenase (NADP+) activity|carbonyl reductase (NADPH) activity|prostaglandin-E2 9-reductase activity|protein binding				0					Acetohexamide(DB00414)|Lubiprostone(DB01046)	CATGGACAATTTGTTTCAGAG	0.547													14	71	---	---	---	---	PASS
POFUT2	23275	broad.mit.edu	37	21	46705584	46705584	+	Intron	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46705584C>A	uc002zhc.2	-						POFUT2_uc002zhb.2_Intron|POFUT2_uc002zhd.2_Intron|POFUT2_uc011afp.1_Intron|POFUT2_uc011afq.1_Nonsense_Mutation_p.E131*|LOC642852_uc002zhf.2_5'Flank	NM_133635	NP_598368	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2 isoform C						fucose metabolic process	endoplasmic reticulum	peptide-O-fucosyltransferase activity				0				Colorectal(79;0.243)		GCGTGCCGCTCGGCCTCACCT	0.542													4	116	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17662339	17662339	+	3'UTR	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17662339G>T	uc002zmk.1	-	9					CECR1_uc010gqu.1_3'UTR|CECR1_uc011agi.1_3'UTR|CECR1_uc002zmj.1_3'UTR	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1						adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GCGTGTGCAAGAAGACAGCTT	0.428													16	379	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663086	22663086	+	RNA	SNP	T	G	G	rs1054157	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663086T>G	uc011aim.1	+	29		c.1859T>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						AGCTGCCACATAAGTTGTCCT	0.299													5	53	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663087	22663087	+	RNA	SNP	A	G	G	rs1054158		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663087A>G	uc011aim.1	+	29		c.1860A>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						GCTGCCACATAAGTTGTCCTT	0.303													5	53	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32482294	32482294	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32482294T>C	uc003amc.2	+	10	1341	c.1109T>C	c.(1108-1110)GTG>GCG	p.V370A	SLC5A1_uc011alz.1_Missense_Mutation_p.V243A	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	370	Extracellular (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						CCAACCTTAGTGGTGGAGCTC	0.478													25	126	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42605745	42605745	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42605745T>A	uc003bcj.1	-	1	5701	c.5567A>T	c.(5566-5568)GAG>GTG	p.E1856V	TCF20_uc003bck.1_Missense_Mutation_p.E1856V|TCF20_uc003bnt.2_Missense_Mutation_p.E1856V	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1856					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						AATACAACCCTCATGGACCCA	0.522													28	290	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42605746	42605746	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42605746C>A	uc003bcj.1	-	1	5700	c.5566G>T	c.(5566-5568)GAG>TAG	p.E1856*	TCF20_uc003bck.1_Nonsense_Mutation_p.E1856*|TCF20_uc003bnt.2_Nonsense_Mutation_p.E1856*	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1856					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						ATACAACCCTCATGGACCCAA	0.527													29	292	---	---	---	---	PASS
FBLN1	2192	broad.mit.edu	37	22	45929741	45929741	+	Silent	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45929741G>A	uc003bgj.1	+	7	894	c.747G>A	c.(745-747)GGG>GGA	p.G249G	FBLN1_uc003bgg.1_Silent_p.G249G|FBLN1_uc003bgh.2_Silent_p.G249G|FBLN1_uc010gzz.2_Silent_p.G287G|FBLN1_uc003bgi.1_Silent_p.G249G	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D	249	EGF-like 2; calcium-binding (Potential).				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GCAGCTGCGGGACTGGCTATG	0.582													19	143	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54321069	54321069	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54321069T>C	uc004dtd.1	-	8	2049	c.1610A>G	c.(1609-1611)GAA>GGA	p.E537G	WNK3_uc004dtc.1_Missense_Mutation_p.E537G	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	537					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TTCTTCACATTCAGCCCCAGT	0.468													18	63	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62894018	62894018	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62894018G>T	uc004dvl.2	-	6	1663	c.824C>A	c.(823-825)GCT>GAT	p.A275D	ARHGEF9_uc004dvj.1_Missense_Mutation_p.A164D|ARHGEF9_uc004dvk.1_Missense_Mutation_p.A137D|ARHGEF9_uc011mos.1_Missense_Mutation_p.A254D|ARHGEF9_uc004dvm.1_Missense_Mutation_p.A254D|ARHGEF9_uc011mot.1_Missense_Mutation_p.A222D|ARHGEF9_uc004dvn.2_Missense_Mutation_p.A282D	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	275	DH.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						TCTCATGACAGCCAAAGCAGC	0.423													3	56	---	---	---	---	PASS
RGAG4	340526	broad.mit.edu	37	X	71350607	71350607	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71350607C>T	uc010nlh.1	-	1	1145	c.784G>A	c.(784-786)GCC>ACC	p.A262T	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	262										ovary(2)|skin(1)	3	Renal(35;0.156)					AAGAATTGGGCCAGGAACTGA	0.537													7	164	---	---	---	---	PASS
TSPAN6	7105	broad.mit.edu	37	X	99890219	99890219	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99890219C>A	uc004ega.1	-	3	410	c.307G>T	c.(307-309)GTC>TTC	p.V103F	TSPAN6_uc010nna.1_Missense_Mutation_p.V9F	NM_003270	NP_003261	O43657	TSN6_HUMAN	transmembrane 4 superfamily member 6	103	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			ovary(1)	1						ACCAGTTCGACCAAAAAAACG	0.393													4	16	---	---	---	---	PASS
TSPAN6	7105	broad.mit.edu	37	X	99890220	99890220	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99890220C>A	uc004ega.1	-	3	409	c.306G>T	c.(304-306)TTG>TTT	p.L102F	TSPAN6_uc010nna.1_Missense_Mutation_p.L8F	NM_003270	NP_003261	O43657	TSN6_HUMAN	transmembrane 4 superfamily member 6	102	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			ovary(1)	1						CCAGTTCGACCAAAAAAACGA	0.393													4	18	---	---	---	---	PASS
MORC4	79710	broad.mit.edu	37	X	106186288	106186288	+	Silent	SNP	G	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106186288G>A	uc004emu.3	-	15	2076	c.1833C>T	c.(1831-1833)AGC>AGT	p.S611S	MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Silent_p.S611S|MORC4_uc004emw.3_Silent_p.S359S	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	611							ATP binding|zinc ion binding			ovary(1)	1						ATTTATCATGGCTGTTCTCCC	0.468													7	578	---	---	---	---	PASS
MIB2	142678	broad.mit.edu	37	1	1564953	1564953	+	Intron	DEL	G	-	-	rs112177324		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1564953delG	uc001agg.2	+						MIB2_uc001agh.2_Intron|MIB2_uc001agi.2_Intron|MIB2_uc001agj.2_Intron|MIB2_uc001agk.2_Intron|MIB2_uc001agm.2_Intron|MIB2_uc010nyq.1_Intron|MIB2_uc009vkh.2_Intron|MIB2_uc001agn.2_Intron|MIB2_uc001ago.2_Intron|MMP23B_uc001agp.2_5'Flank|MMP23B_uc001agq.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2						Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GAGGGTGAGTGGGGGGCCCCG	0.716													6	7	---	---	---	---	
CASZ1	54897	broad.mit.edu	37	1	10845186	10845187	+	Intron	INS	-	TTCCTTCT	TTCCTTCT	rs140440931	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10845186_10845187insTTCCTTCT	uc001aro.2	-						CASZ1_uc001arp.1_Intron	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		tctttcctttcttccttccttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16517863	16517878	+	IGR	DEL	GAAGGAAGAAAGGAAG	-	-	rs55734704		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16517863_16517878delGAAGGAAGAAAGGAAG								EPHA2 (35299 upstream) : ARHGEF19 (6721 downstream)																							aaggaaggaagaaggaagaaaggaaggaaggaagaa	0.065													5	3	---	---	---	---	
HP1BP3	50809	broad.mit.edu	37	1	21083867	21083868	+	Intron	INS	-	A	A	rs148987896	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21083867_21083868insA	uc001bdw.1	-						HP1BP3_uc001bdv.1_Intron|HP1BP3_uc010odh.1_Intron|HP1BP3_uc001bdy.1_Intron|HP1BP3_uc001bdz.2_Intron|HP1BP3_uc001bea.2_Intron|HP1BP3_uc010odf.1_Intron|HP1BP3_uc010odg.1_Intron	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74						nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TTATTATTAttttttttttttt	0.109													4	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145412468	145412469	+	Intron	INS	-	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145412468_145412469insA	uc001emp.3	+						HFE2_uc001eni.2_5'Flank|HFE2_uc001enj.2_5'Flank|HFE2_uc001enk.2_5'Flank|HFE2_uc001enl.2_5'Flank	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aggaaggaaggaaggaaggaaA	0.129													3	3	---	---	---	---	
SV2A	9900	broad.mit.edu	37	1	149887466	149887467	+	Intron	DEL	CA	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149887466_149887467delCA	uc001etg.2	-						SV2A_uc001eth.2_Intron	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2						neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	cacacacacgcacacacacaca	0.411													4	2	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149921365	149921365	+	Intron	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149921365delT	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTCCCAACCCTTTTTTTTTTT	0.358													6	4	---	---	---	---	
RUSC1	23623	broad.mit.edu	37	1	155298230	155298230	+	Intron	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155298230delT	uc001fkj.2	+						RAG1AP1_uc010pey.1_Intron|RUSC1_uc001fkk.2_Intron|RUSC1_uc009wqn.1_Intron|RUSC1_uc009wqo.1_Intron|RUSC1_uc001fkl.2_Intron|RUSC1_uc001fkp.2_Intron|RUSC1_uc001fkq.2_Intron|RUSC1_uc010pgb.1_Intron|RUSC1_uc009wqp.1_Intron|RUSC1_uc001fkn.2_Intron|RUSC1_uc001fko.2_Intron|RUSC1_uc001fkr.2_Intron|RUSC1_uc001fks.2_Intron	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a							cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			gagccttggattttttttttt	0.005													4	2	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180664544	180664545	+	Intron	INS	-	TGTG	TGTG	rs138687175	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180664544_180664545insTGTG	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						gtagtcccatttgtgtgtgtgt	0.000													4	3	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203802746	203802747	+	Intron	INS	-	TTTTTT	TTTTTT	rs59117283		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203802746_203802747insTTTTTT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATAGGTTTGGGTTTTTTTTTTT	0.257													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240188212	240188212	+	IGR	DEL	A	-	-	rs5782118		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240188212delA								CHRM3 (115497 upstream) : FMN2 (66973 downstream)																							agactctgtcaaaaaaaaaaa	0.000													2	5	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79423063	79423066	+	Intron	DEL	TTTG	-	-	rs3979543		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79423063_79423066delTTTG	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AACTCAGttttttgtttgtttgtt	0.201													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	98248129	98248130	+	IGR	INS	-	GAAG	GAAG	rs141641657	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98248129_98248130insGAAG								ANKRD36B (41701 upstream) : COX5B (14391 downstream)																							tcAgaaagaaagaaggaaggaa	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103483368	103483368	+	IGR	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103483368delT								TMEM182 (49232 upstream) : None (None downstream)																							AAAGAGCTGGTTTTTTTTTTT	0.224													6	3	---	---	---	---	
UXS1	80146	broad.mit.edu	37	2	106739756	106739757	+	Intron	DEL	GA	-	-	rs147399064		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106739756_106739757delGA	uc002tdm.2	-						UXS1_uc002tdl.2_Intron|UXS1_uc002tdn.2_Intron|UXS1_uc002tdo.2_Intron|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						ACTTACAGGGGAAAAAAAAAAA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130676240	130676241	+	IGR	INS	-	AGGA	AGGA			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130676240_130676241insAGGA								None (None upstream) : LOC389033 (4194 downstream)																							ggagggaggggaggaaggaagg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	155889415	155889416	+	IGR	DEL	TC	-	-	rs144560558	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155889415_155889416delTC								KCNJ3 (176401 upstream) : None (None downstream)																							Cgtgtgtgtgtctgtgtgtgtg	0.089													4	2	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159481186	159481187	+	Intron	INS	-	A	A	rs71974509		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159481186_159481187insA	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002tzz.1_Intron|PKP4_uc002uaa.2_Intron	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						TTTAAACCACCAAAAAAAAAAA	0.277										HNSCC(62;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	172522686	172522687	+	IGR	DEL	AC	-	-	rs111355202		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172522686_172522687delAC								CYBRD1 (108043 upstream) : DYNC1I2 (21295 downstream)																							cttttcctgaacacacacacac	0.015													2	4	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60811981	60811990	+	Intron	DEL	TTTTGTTTTG	-	-	rs113183487		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60811981_60811990delTTTTGTTTTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		AGGTTAGTTTttttgttttgttttgttttg	0.124			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97078798	97078799	+	IGR	DEL	AC	-	-	rs72116360		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97078798_97078799delAC								PDHA2 (316174 upstream) : None (None downstream)																							TTTCTCTCTTacacacacacac	0.193													4	2	---	---	---	---	
CDH6	1004	broad.mit.edu	37	5	31267935	31267935	+	Intron	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31267935delT	uc003jhe.1	+						CDH6_uc003jhd.1_Intron	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CTGGTAAGACTTTTTTTTTTT	0.368													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	37086022	37086022	+	IGR	DEL	A	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37086022delA								NIPBL (20102 upstream) : C5orf42 (20308 downstream)																							AATTAATAGGAAAAAAAAaaa	0.204													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51711218	51711218	+	IGR	DEL	A	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51711218delA								None (None upstream) : ITGA1 (372556 downstream)																							ggaaggaaggaaggaaggaag	0.050													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61129109	61129110	+	IGR	INS	-	GAAG	GAAG	rs7707571	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61129109_61129110insGAAG								FLJ37543 (126747 upstream) : KIF2A (472879 downstream)																							aatgaatgaatgaaggaaggaa	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141270157	141270160	+	IGR	DEL	CTTC	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141270157_141270160delCTTC								PCDH1 (12213 upstream) : KIAA0141 (33225 downstream)																							ggtaaattttcttccttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65888988	65888988	+	IGR	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65888988delT								NCRNA00174 (23593 upstream) : LOC493754 (104458 downstream)																							tttttttttcttttttttttt	0.264													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66889485	66889486	+	IGR	INS	-	CCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT	CCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT	rs6150143		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66889485_66889486insCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT								STAG3L4 (102973 upstream) : None (None downstream)																							TGCCATTTTCCccttccttcct	0.292													4	2	---	---	---	---	
NAPEPLD	222236	broad.mit.edu	37	7	102781686	102781687	+	Intron	DEL	TG	-	-	rs139564898	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102781686_102781687delTG	uc003vbc.2	-						NAPEPLD_uc003vbd.2_Intron|NAPEPLD_uc011klj.1_Intron|NAPEPLD_uc003vbe.2_Intron|NAPEPLD_uc003vbf.2_Intron	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						cctgtggagttgtttttttttt	0.297													4	2	---	---	---	---	
TNKS	8658	broad.mit.edu	37	8	9620574	9620574	+	Intron	DEL	T	-	-	rs66959741		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9620574delT	uc003wss.2	+						TNKS_uc011kww.1_Intron	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TTATTATGAAttttttttttt	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101438951	101438953	+	IGR	DEL	ACT	-	-	rs151175364		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101438951_101438953delACT								RNF19A (116624 upstream) : ANKRD46 (83034 downstream)																							caccaccaccactaccatcacca	0.000													2	6	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110500119	110500120	+	Intron	INS	-	GAAGGAAGGA	GAAGGAAGGA	rs10661778		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110500119_110500120insGAAGGAAGGA	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			gagagagagagaggaaggaagg	0.015										HNSCC(38;0.096)			1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	115503769	115503770	+	IGR	DEL	AC	-	-	rs34697555		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115503769_115503770delAC								None (None upstream) : TRPS1 (916955 downstream)																							taacacacatacacacacacac	0.000													4	2	---	---	---	---	
GLIS3	169792	broad.mit.edu	37	9	3971094	3971113	+	Intron	DEL	AGATCGAAGGAAGGAAGGAA	-	-	rs576477	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3971094_3971113delAGATCGAAGGAAGGAAGGAA	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc003zhv.1_Intron|GLIS3_uc003zhy.1_Intron|GLIS3_uc003zhz.1_Intron	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		aaggaaggatagatcgaaggaaggaaggaaggatcgaagg	0.164													4	3	---	---	---	---	
PGM5P2	595135	broad.mit.edu	37	9	69128426	69128427	+	Intron	INS	-	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69128426_69128427insA	uc004aff.3	-							NR_002836				Homo sapiens phosphoglucomutase 5 pseudogene 2, mRNA (cDNA clone IMAGE:4121651), with apparent retained intron.												0						aggaaggaaggaaggaaggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90436742	90436744	+	IGR	DEL	ACA	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90436742_90436744delACA								CTSL3 (34943 upstream) : C9orf79 (60997 downstream)																							CCAGTTAGTGACAACAACAACAA	0.409													4	2	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994262	114994263	+	Intron	DEL	AA	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994262_114994263delAA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						aagagaagagaagagaagagaa	0.059													3	4	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	tctttctttgttttttttttt	0.090													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3325617	3325624	+	IGR	DEL	TTCTTTCC	-	-	rs72763757		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3325617_3325624delTTCTTTCC								PITRM1 (110614 upstream) : KLF6 (492565 downstream)																							ctttctttctttctttccttccttcctt	0.000													4	3	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93695652	93695652	+	Intron	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695652delT	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				TTGCTATTTCTTTTTTTTTTC	0.264													4	2	---	---	---	---	
FANK1	92565	broad.mit.edu	37	10	127596142	127596143	+	Intron	DEL	TG	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127596142_127596143delTG	uc001ljh.3	+						FANK1_uc010quk.1_Intron|FANK1_uc009yan.2_Intron	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ACTCCTGGGAtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													4	3	---	---	---	---	
FRG2B	441581	broad.mit.edu	37	10	135439939	135439940	+	Intron	INS	-	A	A			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135439939_135439940insA	uc010qvg.1	-							NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B							nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ACACATTTCTCAAGTCCCCTGA	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	37618574	37618589	+	IGR	DEL	TTCTTTCCTTCTTTCT	-	-	rs74222933	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37618574_37618589delTTCTTTCCTTCTTTCT								C11orf74 (922184 upstream) : None (None downstream)																							ccttctttccttctttccttctttctttcttttgac	0.000													2	4	---	---	---	---	
SERPING1	710	broad.mit.edu	37	11	57365816	57365816	+	Intron	DEL	G	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57365816delG	uc001nkp.1	+						SERPING1_uc001nkq.1_Intron|SERPING1_uc010rju.1_Intron|SERPING1_uc010rjv.1_Intron|SERPING1_uc001nkr.1_Intron|SERPING1_uc009ymi.1_Intron|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Intron	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1						blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						CTTGTGGGATGGGGGACGGGG	0.687									Hereditary_Angioedema				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70113693	70113696	+	IGR	DEL	AGGA	-	-	rs71974523		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70113693_70113696delAGGA								FADD (60185 upstream) : PPFIA1 (3127 downstream)																							gaaggaagggaggaaggaaggaag	0.118													6	4	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100805112	100805112	+	Intron	DEL	A	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100805112delA	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						gtctaacctgaaaaaaaaata	0.080													6	3	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117651018	117651019	+	Intron	DEL	AG	-	-	rs146014553		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117651018_117651019delAG	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		aaagaaagaaagagagaaagga	0.158													4	2	---	---	---	---	
GUCY2C	2984	broad.mit.edu	37	12	14805097	14805098	+	Intron	INS	-	TATTTATT	TATTTATT	rs139251359	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14805097_14805098insTATTTATT	uc001rcd.2	-							NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor						intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						ttgaTTTTTTAtatttatttat	0.045													4	2	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													6	3	---	---	---	---	
SCARB1	949	broad.mit.edu	37	12	125279967	125279968	+	Intron	INS	-	G	G	rs145223970	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125279967_125279968insG	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc010tbe.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AGCCACAGGCTGGGGGGGGTCA	0.545													7	5	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76395134	76395134	+	Intron	DEL	A	-	-	rs33919449		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76395134delA	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		attcggtctcaaaaaaaaaaa	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81462582	81462582	+	IGR	DEL	G	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81462582delG								SPRY2 (547496 upstream) : None (None downstream)																							CTCTGTATAAGGTAAAGTTAG	0.423													4	2	---	---	---	---	
ZFYVE26	23503	broad.mit.edu	37	14	68276123	68276124	+	Intron	DEL	CT	-	-	rs149519898	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68276123_68276124delCT	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Intron|ZFYVE26_uc010tta.1_Intron	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGATGAAGCACTCttttttttt	0.139													5	3	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79434392	79434396	+	Intron	DEL	CCCCC	-	-	rs148023649		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79434392_79434396delCCCCC	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TTTATGCTGTCCCCCCCCCCCCCCC	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95043934	95043935	+	IGR	INS	-	ATGG	ATGG	rs34159327		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95043934_95043935insATGG								SERPINA4 (7693 upstream) : SERPINA5 (3796 downstream)																							tggatggataaatggatggatg	0.153													4	3	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105344200	105344203	+	Intron	DEL	CCCG	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105344200_105344203delCCCG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_5'Flank	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CCCCCCCCCCCCCGCCACCTGTTT	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46148883	46148884	+	IGR	DEL	AC	-	-	rs141252407		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46148883_46148884delAC								SQRDL (165405 upstream) : None (None downstream)																							ATCTTTTGTAacacacacacac	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5620718	5620724	+	IGR	DEL	TCTTTCC	-	-	rs60705446	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5620718_5620724delTCTTTCC								NLRP1 (132886 upstream) : WSCD1 (351713 downstream)																							cttccttccttctttcctccttccttc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29103592	29103592	+	IGR	DEL	T	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29103592delT								SUZ12P (6525 upstream) : CRLF3 (6111 downstream)																							GTATCATTCCttttttttttt	0.159													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													8	4	---	---	---	---	
QRICH2	84074	broad.mit.edu	37	17	74301246	74301247	+	Intron	INS	-	T	T			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74301246_74301247insT	uc002jrd.1	-						QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						ttttggtttccttttttttttt	0.198													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78516456	78516456	+	5'Flank	DEL	A	-	-	rs143567101		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78516456delA	uc002jyt.1	+						RPTOR_uc002jys.2_5'Flank|RPTOR_uc010wuf.1_5'Flank|RPTOR_uc010wug.1_5'Flank|RPTOR_uc002jyr.1_5'Flank	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						TAAAAACTGCAAAAAAAaaaa	0.224													4	3	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43432246	43432247	+	3'UTR	DEL	AC	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43432246_43432247delAC	uc002lbm.2	-	44						NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						AGCTAAGAAAacacacacacac	0.356													3	4	---	---	---	---	
C19orf12	83636	broad.mit.edu	37	19	30204902	30204903	+	Intron	DEL	TC	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30204902_30204903delTC	uc002nsk.2	-						C19orf12_uc002nsj.2_Intron|C19orf12_uc002nsl.2_Intron|C19orf12_uc002nsm.2_Intron	NM_031448	NP_113636	Q9NSK7	CS012_HUMAN	hypothetical protein LOC83636 isoform 2							integral to membrane					0	Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			tctctttcgttctctctctctc	0.119													4	2	---	---	---	---	
CCNE1	898	broad.mit.edu	37	19	30311455	30311455	+	Intron	DEL	A	-	-	rs77587126		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30311455delA	uc002nsn.2	+						CCNE1_uc002nso.2_Intron|CCNE1_uc002nsp.2_5'Flank	NM_001238	NP_001229	P24864	CCNE1_HUMAN	cyclin E1 isoform 1						androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity			lung(2)	2	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			aaggcacctcaaaaaaaaaac	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32618508	32618512	+	IGR	DEL	AAAGG	-	-			TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32618508_32618512delAAAGG								TSHZ3 (778318 upstream) : ZNF507 (218002 downstream)																							ctcaaaagaaaaaggaaaggaaagg	0.000													3	3	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43579073	43579074	+	Intron	INS	-	TA	TA	rs61135205		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43579073_43579074insTA	uc002ovi.2	-						PSG6_uc010xwk.1_Intron|PSG2_uc002ovr.2_Intron|PSG2_uc002ovq.3_Intron|PSG2_uc010eiq.1_Intron|PSG2_uc002ovs.3_Intron|PSG2_uc002ovt.3_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GGTAATAGGTGTGAGGAAGAAA	0.515													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715837	49715838	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs76677262		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715837_49715838insCTTCCTTC								TRPM4 (746 upstream) : SLC6A16 (77056 downstream)																							AATGTAACCTActtccttcctt	0.035													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9865569	9865570	+	IGR	INS	-	A	A	rs77497487	by1000genomes	TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9865569_9865570insA								None (None upstream) : None (None downstream)																							CTGCTGAGTTTAAATCTTCCTT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	35296123	35296124	+	IGR	DEL	TG	-	-	rs72206919		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35296123_35296124delTG								FAM47B (333089 upstream) : MAGEB16 (520335 downstream)																							atattgcctctgtgtgtgtgtg	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136735045	136735046	+	IGR	DEL	GT	-	-	rs72155813		TCGA-B0-5092-01A-01D-1421-08	TCGA-B0-5092-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136735045_136735046delGT								ZIC3 (80788 upstream) : LOC158696 (961846 downstream)																							GAGCCTTACAgtgtgtgtgtgt	0.287													6	3	---	---	---	---	
