Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PEX14	5195	broad.mit.edu	37	1	10690081	10690081	+	3'UTR	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10690081C>A	uc001arn.2	+	9					PEX14_uc009vmv.2_3'UTR|PEX14_uc010oam.1_3'UTR|PEX14_uc010oan.1_3'UTR|PEX14_uc009vmw.2_3'UTR	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		AGGATGGCATCTAGTGTGCCC	0.687													7	8	---	---	---	---	PASS
DNALI1	7802	broad.mit.edu	37	1	38022628	38022628	+	Silent	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38022628C>T	uc001cbj.2	+	1	109	c.99C>T	c.(97-99)TAC>TAT	p.Y33Y	SNIP1_uc001cbi.2_5'Flank|SNIP1_uc010oid.1_5'Flank|DNALI1_uc010oie.1_RNA	NM_003462	NP_003453	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	11					cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGCTCAAGTACGACACCCCAG	0.602													13	39	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45484067	45484067	+	3'UTR	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45484067G>A	uc001cnd.2	-	14						NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					CAGTGCCCTTGGCCTGACCTG	0.542											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	33	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65143848	65143848	+	Silent	SNP	T	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65143848T>C	uc001dbo.1	+	23	3051	c.2946T>C	c.(2944-2946)TGT>TGC	p.C982C	CACHD1_uc001dbp.1_Silent_p.C737C|CACHD1_uc001dbq.1_Silent_p.C737C|CACHD1_uc010opa.1_Silent_p.C226C	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	1033	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						GCAGGGACTGTTTTGGGGTGC	0.338													18	59	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78045311	78045311	+	Silent	SNP	T	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78045311T>C	uc001dhq.2	-	10	2459	c.1983A>G	c.(1981-1983)AAA>AAG	p.K661K	ZZZ3_uc001dhr.2_Silent_p.K167K|ZZZ3_uc001dhp.2_Silent_p.K660K	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	661	HTH myb-type.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						GTTCCAGCTTTTTCTAAGCCA	0.328													34	161	---	---	---	---	PASS
NEXN	91624	broad.mit.edu	37	1	78383401	78383401	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78383401C>A	uc001dic.3	+	3	475	c.178C>A	c.(178-180)CAA>AAA	p.Q60K	NEXN_uc001dia.3_Missense_Mutation_p.Q60K|NEXN_uc009wcb.1_Intron|NEXN_uc001dib.3_Intron|NEXN_uc001did.1_5'Flank|NEXN_uc001dif.1_5'Flank	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)	60	Glu-rich.				regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		AAGAAAAGAACAATATATTAG	0.333													8	58	---	---	---	---	PASS
DNTTIP2	30836	broad.mit.edu	37	1	94335473	94335473	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94335473G>A	uc001dqf.2	-	7	2243	c.2205C>T	c.(2203-2205)ATC>ATT	p.I735I	DNTTIP2_uc010otm.1_RNA	NM_014597	NP_055412	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal,	735					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TTTCAGCCATGATCTCTGAGT	0.328													24	57	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112303111	112303111	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112303111T>A	uc001ebs.2	+	4	938	c.581T>A	c.(580-582)CTC>CAC	p.L194H	DDX20_uc010owf.1_5'UTR|DDX20_uc001ebt.2_5'UTR	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	194	Helicase ATP-binding.				assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTAAGCAACTCATAGAACTT	0.318													7	123	---	---	---	---	PASS
VANGL1	81839	broad.mit.edu	37	1	116233918	116233918	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116233918C>A	uc001efv.1	+	8	1764	c.1493C>A	c.(1492-1494)CCA>CAA	p.P498Q	VANGL1_uc009wgy.1_Missense_Mutation_p.P496Q	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1	498	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		AAGAAAATTCCATTCATCATA	0.413													6	112	---	---	---	---	PASS
FCER1A	2205	broad.mit.edu	37	1	159277845	159277845	+	3'UTR	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159277845G>T	uc001ftq.2	+	6						NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor							integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TTATAGAAATGCTTCATTAAA	0.259													2	1	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196695938	196695938	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196695938G>A	uc001gtj.3	+	14	2344	c.2104G>A	c.(2104-2106)GCC>ACC	p.A702T		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	702	Sushi 12.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						ACATGGCTGGGCCCAGCTTTC	0.363													50	84	---	---	---	---	PASS
NR5A2	2494	broad.mit.edu	37	1	200014711	200014711	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200014711A>C	uc001gvb.2	+	4	668	c.462A>C	c.(460-462)GAA>GAC	p.E154D	NR5A2_uc001gvc.2_Missense_Mutation_p.E108D|NR5A2_uc009wzh.2_Missense_Mutation_p.E114D|NR5A2_uc010pph.1_Missense_Mutation_p.E82D	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	154	Nuclear receptor.				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					TGAAGCTAGAAGGTAAGATTC	0.358													20	49	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74607187	74607187	+	5'UTR	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74607187C>A	uc002skx.2	-	1					DCTN1_uc002skw.1_5'Flank|DCTN1_uc010ffd.2_5'UTR|DCTN1_uc002sky.2_Intron	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1						cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						GCCTCTACCCCCTCCCCCAGC	0.617													9	24	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	206997774	206997774	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206997774C>A	uc002vbe.2	-	14	1575	c.1448G>T	c.(1447-1449)AGA>ATA	p.R483I	NDUFS1_uc010ziq.1_Missense_Mutation_p.R497I|NDUFS1_uc010zir.1_Missense_Mutation_p.R447I|NDUFS1_uc010zis.1_Missense_Mutation_p.R426I|NDUFS1_uc010zit.1_Missense_Mutation_p.R372I|NDUFS1_uc010ziu.1_Missense_Mutation_p.R367I	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	483					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	TCCATCATTTCTTTGGAGTGC	0.343													21	55	---	---	---	---	PASS
SP140L	93349	broad.mit.edu	37	2	231254640	231254640	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231254640G>T	uc010fxm.1	+	11	957	c.866G>T	c.(865-867)AGA>ATA	p.R289I	SP140L_uc010fxo.1_Intron	NM_138402	NP_612411	Q9H930	LY10L_HUMAN	SP140 nuclear body protein-like	289						nucleus	DNA binding|metal ion binding			central_nervous_system(1)	1						TCAGCTTCAAGAAAGCACAAA	0.428													11	68	---	---	---	---	PASS
SP140L	93349	broad.mit.edu	37	2	231254641	231254641	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231254641A>T	uc010fxm.1	+	11	958	c.867A>T	c.(865-867)AGA>AGT	p.R289S	SP140L_uc010fxo.1_Intron	NM_138402	NP_612411	Q9H930	LY10L_HUMAN	SP140 nuclear body protein-like	289						nucleus	DNA binding|metal ion binding			central_nervous_system(1)	1						CAGCTTCAAGAAAGCACAAAG	0.433													11	68	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191470	10191470	+	Splice_Site	SNP	G	T	T	rs5030817		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191470G>T	uc003bvc.2	+	3	677	c.464_splice	c.e3-1	p.V155_splice	VHL_uc003bvd.2_Splice_Site_p.V114_splice	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(17)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGCCCTTCCAGTGTATACTCT	0.493		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				15	15	---	---	---	---	PASS
PKD2L2	27039	broad.mit.edu	37	5	137275829	137275829	+	Intron	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137275829G>T	uc003lby.2	+						FAM13B_uc003lbz.2_3'UTR|FAM13B_uc003lcb.2_3'UTR|FAM13B_uc003lca.2_3'UTR|PKD2L2_uc003lbw.1_Missense_Mutation_p.R612L|PKD2L2_uc003lbx.2_3'UTR|PKD2L2_uc011cyi.1_3'UTR	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2							integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTGACAAAACGAATTTAAGTA	0.388													45	133	---	---	---	---	PASS
RNF145	153830	broad.mit.edu	37	5	158603776	158603776	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158603776A>C	uc003lxp.2	-	5	798	c.485T>G	c.(484-486)CTT>CGT	p.L162R	RNF145_uc011ddy.1_Missense_Mutation_p.L176R|RNF145_uc003lxo.1_Missense_Mutation_p.L190R|RNF145_uc011ddz.1_Missense_Mutation_p.L179R|RNF145_uc010jiq.1_Missense_Mutation_p.L192R|RNF145_uc011dea.1_Missense_Mutation_p.L178R	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	162	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAAAGGAACAAGGCAGAGTCG	0.393													12	55	---	---	---	---	PASS
HIST1H2BO	8348	broad.mit.edu	37	6	27861305	27861305	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27861305C>T	uc003nkc.1	+	1	103	c.65C>T	c.(64-66)GCC>GTC	p.A22V	HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	NM_003527	NP_003518	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	22					nucleosome assembly	nucleosome|nucleus	DNA binding				0						GTAACCAAGGCCCAGAAAAAG	0.547													38	83	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33133477	33133477	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33133477G>A	uc003ocx.1	-	63	4827	c.4599C>T	c.(4597-4599)GCC>GCT	p.A1533A	COL11A2_uc010jul.1_Silent_p.A103A|COL11A2_uc003ocy.1_Silent_p.A1447A|COL11A2_uc003ocz.1_Silent_p.A1426A	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1533					cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						GACTGCCGGGGGCTCCCCCGG	0.642													28	62	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123104854	123104854	+	Intron	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123104854C>T	uc003pzf.2	+						FABP7_uc003pze.1_3'UTR	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	ATCTTTTGAACCTTGCAGACC	0.368													26	104	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38937718	38937718	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38937718G>A	uc003tgy.2	-	2	59	c.33C>T	c.(31-33)TCC>TCT	p.S11S	VPS41_uc003tgz.2_Silent_p.S11S|VPS41_uc010kxn.2_Silent_p.S11S	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	11					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						ATTCTTCAAGGGACCCAGTTT	0.428													6	89	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766976	77766976	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766976C>G	uc003yav.2	+	10	8071	c.7684C>G	c.(7684-7686)CGC>GGC	p.R2562G	ZFHX4_uc003yau.1_Missense_Mutation_p.R2607G|ZFHX4_uc003yaw.1_Missense_Mutation_p.R2562G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2562	Homeobox 3.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCGAGATAAACGCTTGAGAAC	0.423										HNSCC(33;0.089)			6	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	88455089	88455089	+	RNA	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88455089G>A	uc004aog.1	+	7		c.1385G>A			uc004aoh.1_5'UTR					Homo sapiens cDNA FLJ42532 fis, clone BRACE3003004.																		GTTGGATCACGTAGAAGAACG	0.428													48	110	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	98774946	98774946	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98774946A>T	uc010msa.1	+	4	1933	c.1057A>T	c.(1057-1059)AAC>TAC	p.N353Y	uc011lun.1_Intron					RecName: Full=Uncharacterized protein C9orf102;																		CAGTGGGAAAAACAGCCAGGC	0.398													21	44	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69926368	69926368	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69926368C>A	uc001jnm.3	+	11	2103	c.1918C>A	c.(1918-1920)CCA>ACA	p.P640T	MYPN_uc001jnl.1_Missense_Mutation_p.P640T|MYPN_uc001jnn.3_Missense_Mutation_p.P365T|MYPN_uc001jno.3_Missense_Mutation_p.P640T|MYPN_uc009xps.2_Missense_Mutation_p.P640T|MYPN_uc009xpt.2_Missense_Mutation_p.P640T|MYPN_uc010qit.1_Missense_Mutation_p.P346T|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	640						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AACAAAAACCCCAGAGCCTTC	0.517													14	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	55062213	55062213	+	RNA	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55062213C>A	uc001nhl.1	-	4		c.935G>T								Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit20-11-30-F.																		TAATATGTCTCCAAAAGACTG	0.338													5	17	---	---	---	---	PASS
FAU	2197	broad.mit.edu	37	11	64888530	64888530	+	Intron	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64888530C>A	uc001ocx.2	-						FAU_uc001ocy.1_3'UTR|MRPL49_uc001ocz.1_5'Flank|MRPL49_uc001oda.1_5'Flank	NM_001997	NP_001988	P35544	UBIM_HUMAN	ubiquitin-like protein fubi and ribosomal												0						AAGGAAGGCACCAGCAGGTAA	0.493													45	137	---	---	---	---	PASS
C11orf24	53838	broad.mit.edu	37	11	68029634	68029634	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68029634G>A	uc001onr.3	-	4	1271	c.829C>T	c.(829-831)CCC>TCC	p.P277S	C11orf24_uc001ons.2_Missense_Mutation_p.P277S	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor	277	Extracellular (Potential).|Pro-rich.					integral to membrane					0						GTGTTTGAGGGCATGGGTGTG	0.592													19	50	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78412936	78412936	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78412936G>A	uc001ozl.3	-	28	5185	c.4722C>T	c.(4720-4722)AAC>AAT	p.N1574N	ODZ4_uc009yvb.1_Silent_p.N158N	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1574	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GCTCATACATGTTCTGGGTGT	0.527													38	108	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49960072	49960072	+	Intron	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49960072C>T	uc001ruk.1	-						MCRS1_uc001rui.1_Intron|MCRS1_uc001ruj.1_5'UTR|MCRS1_uc001rul.1_Intron|MCRS1_uc009zlj.1_Intron|MCRS1_uc001rum.1_Intron|MCRS1_uc001run.1_Intron	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1						DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						CCTCCCCAGCCCCCTTCCCCT	0.572													14	15	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19413025	19413025	+	RNA	SNP	A	G	G			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19413025A>G	uc010tcj.1	-	1		c.33085T>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AATAACCTGCACATCCATGCA	0.299													4	38	---	---	---	---	PASS
PPP4R4	57718	broad.mit.edu	37	14	94745003	94745003	+	3'UTR	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94745003C>A	uc001ycs.1	+	25						NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						ATGAAGGAGGCAAAACAAAGG	0.274													4	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	28929371	28929371	+	RNA	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28929371G>T	uc010azc.2	+	14		c.2076G>T								Homo sapiens I.M.A.G.E. clone 321824, mRNA sequence.																		GGAAGGAAAAGGCACACGCTG	0.453													3	33	---	---	---	---	PASS
AP4E1	23431	broad.mit.edu	37	15	51216161	51216161	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51216161G>T	uc001zyx.1	+	4	410	c.380G>T	c.(379-381)AGT>ATT	p.S127I	AP4E1_uc010ufi.1_Missense_Mutation_p.S127I|AP4E1_uc010ufj.1_RNA|AP4E1_uc010ufk.1_RNA	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	127					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CTACATGAAAGTCATGAATTA	0.318													13	90	---	---	---	---	PASS
AP4E1	23431	broad.mit.edu	37	15	51217400	51217400	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51217400A>T	uc001zyx.1	+	5	556	c.526A>T	c.(526-528)AAA>TAA	p.K176*	AP4E1_uc010ufi.1_Nonsense_Mutation_p.K176*|AP4E1_uc010ufj.1_RNA|AP4E1_uc010ufk.1_RNA	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	176					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AATAGAAGATAAACTTCAACA	0.353													26	46	---	---	---	---	PASS
TXNDC11	51061	broad.mit.edu	37	16	11836616	11836616	+	5'UTR	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11836616G>A	uc010buu.1	-	1					TXNDC11_uc002dbg.1_5'UTR	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11						cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						GCTTTATACCGCCGCCGCCGC	0.463													2	4	---	---	---	---	PASS
CBLN1	869	broad.mit.edu	37	16	49313372	49313372	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49313372G>C	uc002efq.2	-	3	864	c.525C>G	c.(523-525)AAC>AAG	p.N175K		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	175	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				CCCCCATCAAGTTTCCCCGCT	0.612													14	83	---	---	---	---	PASS
P2RX1	5023	broad.mit.edu	37	17	3807223	3807223	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3807223G>A	uc002fww.2	-	5	964	c.523C>T	c.(523-525)CGC>TGC	p.R175C		NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1	175	Extracellular (Potential).				platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		GAGTGTTACCGCGGGATGTCG	0.572													11	29	---	---	---	---	PASS
C17orf49	124944	broad.mit.edu	37	17	6919830	6919830	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6919830A>G	uc002gec.2	+	6	1135	c.235A>G	c.(235-237)ACT>GCT	p.T79A	C17orf49_uc002geb.3_Missense_Mutation_p.T140A|C17orf49_uc002ged.2_Missense_Mutation_p.T79A|C17orf49_uc002gee.2_Missense_Mutation_p.T79A|C17orf49_uc010vti.1_Missense_Mutation_p.T45A	NM_174893	NP_777553	Q8IXM2	BAP18_HUMAN	hypothetical protein LOC124944 isoform 2	79	SANT.				chromatin modification	MLL1 complex|NURF complex	DNA binding			large_intestine(1)	1						GATAAAGGCCACTGTGAAACG	0.527													34	173	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35578563	35578563	+	Intron	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35578563G>T	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuz.2_3'UTR	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AAAAAAACATGGAATTGTCAT	0.398													12	20	---	---	---	---	PASS
TMEM104	54868	broad.mit.edu	37	17	72832324	72832324	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72832324G>T	uc002jls.3	+	10	1151	c.989G>T	c.(988-990)CGC>CTC	p.R330L	TMEM104_uc010wrf.1_Intron|TMEM104_uc010wrg.1_Intron|TMEM104_uc010dfx.2_Missense_Mutation_p.R330L	NM_017728	NP_060198	Q8NE00	TM104_HUMAN	transmembrane protein 104	330	Extracellular (Potential).					integral to membrane					0	all_lung(278;0.23)					TTCTGCTTCCGCGGCGACAGC	0.622													39	74	---	---	---	---	PASS
CYTH1	9267	broad.mit.edu	37	17	76677108	76677108	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76677108C>A	uc002jvw.2	-	11	976	c.905G>T	c.(904-906)GGA>GTA	p.G302V	CYTH1_uc010wtv.1_RNA	NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2	303	PH.				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						AGGGATGATTCCACGGGGCTC	0.468													89	120	---	---	---	---	PASS
TUBB4	10382	broad.mit.edu	37	19	6501365	6501365	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6501365G>A	uc002mfg.1	-	3	317	c.210C>T	c.(208-210)CCC>CCT	p.P70P	TUBB4_uc002mff.1_5'UTR	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	70					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		CCATGGTGCCGGGTTCCAGGT	0.617													4	29	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50118189	50118189	+	Silent	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50118189C>T	uc002poo.3	+	8	4947	c.4947C>T	c.(4945-4947)TTC>TTT	p.F1649F		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	828							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ATGTAAAGTTCCTGGAAAATG	0.512													15	48	---	---	---	---	PASS
C20orf103	24141	broad.mit.edu	37	20	9496942	9496942	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9496942A>G	uc002wni.1	+	4	638	c.409A>G	c.(409-411)AGG>GGG	p.R137G	C20orf103_uc010zrc.1_Missense_Mutation_p.R93G	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor	137	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			GGCGACTTGGAGGCTGAGCAA	0.582													19	45	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33875579	33875579	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33875579C>T	uc010zux.1	-	4	1121	c.1003G>A	c.(1003-1005)GTC>ATC	p.V335I	EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Intron	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	335										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GGGCTTGGGACATCAGGCCTG	0.667													7	12	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17672507	17672507	+	Intron	SNP	C	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17672507C>T	uc002zmk.1	-						CECR1_uc010gqu.1_Intron|CECR1_uc011agi.1_Intron|CECR1_uc011agj.1_3'UTR|CECR1_uc002zmj.1_Intron	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1						adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CCTCCCCTCCCAGCCTAGTAG	0.557													60	162	---	---	---	---	PASS
CACNG2	10369	broad.mit.edu	37	22	36960524	36960524	+	Silent	SNP	G	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36960524G>A	uc003aps.1	-	4	1128	c.846C>T	c.(844-846)ACC>ACT	p.T282T		NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2	282					membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						CGGTGGGCGTGGTGGCGGCCT	0.607													15	58	---	---	---	---	PASS
ELFN2	114794	broad.mit.edu	37	22	37770000	37770000	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37770000C>G	uc003asq.3	-	3	2361	c.1575G>C	c.(1573-1575)GAG>GAC	p.E525D		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	525	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					CCTGGCCGTTCTCGAGGTCCG	0.602													20	27	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133511613	133511613	+	5'UTR	SNP	A	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133511613A>T	uc004exj.2	+	2					PHF6_uc004exk.2_5'UTR|PHF6_uc011mvk.1_5'UTR|PHF6_uc004exh.2_5'UTR|PHF6_uc010nrr.2_5'UTR|PHF6_uc004exi.2_5'UTR	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ATTTCTTGAGACTTAAAGTGG	0.328													12	140	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151815617	151815617	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151815617G>C	uc004ffp.1	+	4	535	c.515G>C	c.(514-516)CGG>CCG	p.R172P		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	172	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGAACGGTGCGGTACGGCATC	0.517													18	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	745643	745643	+	IGR	DEL	C	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:745643delC								LOC100133331 (65907 upstream) : NCRNA00115 (15944 downstream)																							TTCAAAGTGACAGACTGTGGG	0.299													11	5	---	---	---	---	
AKR7A3	22977	broad.mit.edu	37	1	19610328	19610328	+	Intron	DEL	A	-	-	rs11581031		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19610328delA	uc001bbv.1	-							NM_012067	NP_036199	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3						cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ctgtccccccaaaaaaaaaac	0.149													4	2	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	65915368	65915368	+	Intron	DEL	T	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65915368delT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		cctatttatcttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	29196308	29196315	+	IGR	DEL	CCTTCCTT	-	-	rs58912655		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29196308_29196315delCCTTCCTT								WDR43 (25228 upstream) : FAM179A (7849 downstream)																							cttcccttccccttccttccttccttcc	0.014													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61483709	61483709	+	Intron	DEL	A	-	-	rs34025877		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61483709delA	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AATGCTCAGCaaaaaaatttt	0.244													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156126552	156126552	+	IGR	DEL	A	-	-	rs77418096		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156126552delA								KCNJ3 (413538 upstream) : None (None downstream)																							ccataatggcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160634565	160634566	+	Intron	DEL	CC	-	-	rs35013477		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160634565_160634566delCC	uc002ubb.3	-						LY75_uc010fos.2_Intron|CD302_uc002uba.2_Intron|CD302_uc010zco.1_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TAAAAATAAACCCTTTTATTAG	0.233													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	185259444	185259445	+	IGR	DEL	TG	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185259444_185259445delTG								None (None upstream) : ZNF804A (203648 downstream)																							TCTCCCCAGTtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204938862	204938863	+	IGR	DEL	AC	-	-	rs66854814		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204938862_204938863delAC								ICOS (112566 upstream) : PARD3B (471653 downstream)																							TTAATGCATAacacacacacac	0.277													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241724234	241724234	+	Intron	DEL	G	-	-	rs113212728		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241724234delG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCTCTGGGGCGGGGGGGGGGA	0.657													6	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52621519	52621519	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52621519delT	uc003des.2	-	19	2985	c.2973delA	c.(2971-2973)AAAfs	p.K991fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.K991fs|PBRM1_uc003der.2_Frame_Shift_Del_p.K959fs|PBRM1_uc003det.2_Frame_Shift_Del_p.K1006fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.K1006fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.K991fs|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Frame_Shift_Del_p.K990fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.K903fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.K337fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	991	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CATACAACCATTTTTCACCTC	0.323			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								38	21	---	---	---	---	
EIF4E3	317649	broad.mit.edu	37	3	71739005	71739006	+	Intron	INS	-	A	A	rs5005116		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71739005_71739006insA	uc003dov.3	-						EIF4E3_uc011bgc.1_Intron|EIF4E3_uc003dox.2_Intron|EIF4E3_uc011bgd.1_Intron|EIF4E3_uc010hoc.2_Intron	NM_001134651	NP_001128123	Q8N5X7	IF4E3_HUMAN	eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)		TTGttttttttaaaaaaaaaaa	0.248													6	3	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113167135	113167135	+	Intron	DEL	T	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113167135delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						CTTGAAAGACTTTTTTTTTTT	0.323													4	4	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134546231	134546232	+	Intron	DEL	AT	-	-	rs35969551		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134546231_134546232delAT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						acacacacacatacacacacac	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180863907	180863907	+	IGR	DEL	A	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180863907delA								DNAJC19 (156377 upstream) : SOX2OT (417602 downstream)																							tagaaaatccaaaaaaaaaaa	0.005													4	2	---	---	---	---	
ATP11B	23200	broad.mit.edu	37	3	182615385	182615385	+	Intron	DEL	T	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182615385delT	uc003flb.2	+						ATP11B_uc003flc.2_Intron|ATP11B_uc010hxg.2_Intron|ATP11B_uc010hxh.1_5'Flank	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TTTTTCTAGATTTTTTTTATA	0.234													3	4	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193360957	193360958	+	Intron	INS	-	A	A	rs139186175	by1000genomes	TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193360957_193360958insA	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GTAGAGCTTTTAAAAAAAAATC	0.267													4	6	---	---	---	---	
KIAA0226	9711	broad.mit.edu	37	3	197401752	197401752	+	3'UTR	DEL	A	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197401752delA	uc003fyc.2	-	20					KIAA0226_uc003fyd.3_3'UTR|MIR922_hsa-mir-922|MI0005714_5'Flank	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.						autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		ACAAGTCAGTaaaaaaaaaaa	0.403													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103837966	103837969	+	IGR	DEL	TCTC	-	-	rs138155987		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103837966_103837969delTCTC								NUDT12 (939476 upstream) : RAB9BP1 (597206 downstream)																							ttcttttctttctctctctctctc	0.000													4	3	---	---	---	---	
GPX6	257202	broad.mit.edu	37	6	28471800	28471801	+	3'UTR	DEL	AC	-	-	rs67996303		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28471800_28471801delAC	uc011dlj.1	-	6					GPX6_uc010jrg.1_RNA	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor						response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)	TAATCTTCAAacacacacacac	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	115632546	115632571	+	IGR	DEL	TTCTTTCTTCTTTCTTTCTTTCTCCT	-	-	rs6936184		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115632546_115632571delTTCTTTCTTCTTTCTTTCTTTCTCCT								HS3ST5 (969006 upstream) : FRK (630122 downstream)																							ccttccttccttctttcttctttctttctttctcctttccttcctt	0.044													2	4	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145011209	145011210	+	Intron	DEL	TG	-	-	rs7768069		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145011209_145011210delTG	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		caaaagtttctgtttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98108111	98108111	+	IGR	DEL	T	-	-	rs36009788		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98108111delT								BAIAP2L1 (77684 upstream) : NPTX2 (138486 downstream)																							tttctttctcttttttttttt	0.214													3	3	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156962829	156962829	+	Intron	DEL	C	-	-	rs66735407		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156962829delC	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ttttttttttctttttAACCA	0.174													9	4	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286492	92286494	+	Intron	DEL	GGC	-	-	rs144940722	by1000genomes	TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286492_92286494delGGC	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						tggtggtggtggcggtgatggag	0.010													4	3	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94984623	94984623	+	Intron	DEL	A	-	-	rs71511611		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94984623delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	actcagtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140777551	140777552	+	Intron	INS	-	GGAA	GGAA	rs140080287	by1000genomes	TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140777551_140777552insGGAA	uc004cog.2	+						uc004cof.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TTCTCGCTGACGGATCACAGTG	0.614													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34220055	34220056	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34220055_34220056insTTCCTTCCTTCC								NRP1 (596049 upstream) : PARD3 (180042 downstream)																							AGATAAGTGGAttccttccttc	0.188													3	3	---	---	---	---	
VAX1	11023	broad.mit.edu	37	10	118897632	118897632	+	5'UTR	DEL	C	-	-	rs56950787		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897632delC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		GGGGGGGGGGCGGAGAAGGAA	0.438													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50228603	50228603	+	IGR	DEL	A	-	-	rs112861391		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50228603delA								OR4C12 (224566 upstream) : LOC441601 (10397 downstream)																							TAGTAacgtgaaaaaaaaaat	0.179													4	2	---	---	---	---	
GAL	51083	broad.mit.edu	37	11	68458593	68458593	+	3'UTR	DEL	T	-	-	rs75147512		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68458593delT	uc001oob.2	+	6						NM_015973	NP_057057	P22466	GALA_HUMAN	galanin preproprotein						growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		TCATTTAAGATTTTTTTTTTT	0.358													4	2	---	---	---	---	
TAS2R8	50836	broad.mit.edu	37	12	10961511	10961511	+	5'Flank	DEL	T	-	-	rs36044129		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10961511delT	uc010shh.1	-							NM_023918	NP_076407	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8						sensory perception of taste	integral to membrane	taste receptor activity			ovary(2)	2						TTTAGATGCATTTTTTTTTTC	0.318													3	3	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51854857	51854858	+	Intron	INS	-	T	T			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51854857_51854858insT	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TTACTGTCTTCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50299783	50299783	+	Intron	DEL	T	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299783delT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		CCAACCCTACttttttttttt	0.174													4	2	---	---	---	---	
IRF9	10379	broad.mit.edu	37	14	24631142	24631144	+	Intron	DEL	TTG	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24631142_24631144delTTG	uc001wmq.2	+						RNF31_uc001wmp.2_Intron|IRF9_uc010alj.2_5'Flank	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,						interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)		TTGGGGGGTTttgttgttgttgt	0.365													4	2	---	---	---	---	
HEATR5A	25938	broad.mit.edu	37	14	31819967	31819970	+	Intron	DEL	TTTG	-	-	rs72055697		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31819967_31819970delTTTG	uc001wrf.3	-						HEATR5A_uc010ami.2_Intron|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TAGGTAAGTTtttgtttgtttgtt	0.176													6	3	---	---	---	---	
MTSS1L	92154	broad.mit.edu	37	16	70714812	70714812	+	Intron	DEL	G	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70714812delG	uc002ezj.2	-						MTSS1L_uc002ezk.1_5'Flank	NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like						filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1						GTGGTTGGGCGGGGGGGGGGC	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20978234	20978237	+	IGR	DEL	CCTC	-	-	rs75278704		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20978234_20978237delCCTC								USP22 (31161 upstream) : DHRS7B (52021 downstream)																							ttccttctttcctccctccctccc	0.015													3	3	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3085192	3085192	+	Intron	DEL	T	-	-	rs148266515		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3085192delT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GTATCTGTGATTTTTTTTTTT	0.294													3	5	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67563417	67563418	+	Intron	INS	-	T	T	rs33943534		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563417_67563418insT	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CTTTATACTACttttttttttt	0.173													4	3	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18174948	18174948	+	Intron	DEL	C	-	-	rs57369001		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18174948delC	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						Ctctttctttctttttttttt	0.249													4	2	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46130218	46130218	+	Intron	DEL	C	-	-	rs5828242		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46130218delC	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron|EML2_uc010ekk.1_Intron	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CTGAACttttctttttttttt	0.254													5	5	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ttttttttttctttttttttt	0.199													8	5	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55512434	55512438	+	3'UTR	DEL	CTTAT	-	-	rs4200	byFrequency	TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55512434_55512438delCTTAT	uc002qij.2	+	13					NLRP2_uc010yfp.1_3'UTR|NLRP2_uc010esn.2_3'UTR|NLRP2_uc010eso.2_3'UTR|NLRP2_uc010esp.2_3'UTR	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGCACACATCCTTATCTTTGTTACA	0.415													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889854	58889854	+	Intron	DEL	C	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889854delC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		atccatccatccatccatcca	0.000													4	2	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136560	46136565	+	Intron	DEL	ACACAC	-	-			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136560_46136565delACACAC	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		ttatatgaatacacacacacacacac	0.155													11	5	---	---	---	---	
GPR64	10149	broad.mit.edu	37	X	19039072	19039073	+	Intron	INS	-	A	A			TCGA-B0-5113-01A-01D-1421-08	TCGA-B0-5113-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19039072_19039073insA	uc004cyx.2	-						GPR64_uc004cyy.2_Intron|GPR64_uc004cyz.2_Intron|GPR64_uc004czb.2_Intron|GPR64_uc004czc.2_Intron|GPR64_uc004czd.2_Intron|GPR64_uc004cze.2_Intron|GPR64_uc004czf.2_Intron|GPR64_uc004cza.2_Intron|GPR64_uc004cyw.2_Intron|GPR64_uc010nfj.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1						neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					gactctgcctcaaaaaaaaaag	0.109													4	7	---	---	---	---	
