Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CLCNKA	1187	broad.mit.edu	37	1	16353083	16353083	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16353083G>A	uc001axu.2	+	6	631	c.551G>A	c.(550-552)CGC>CAC	p.R184H	CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_Missense_Mutation_p.R184H|CLCNKA_uc010obw.1_Missense_Mutation_p.R141H|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010obx.1_5'Flank|CLCNKA_uc010oby.1_5'Flank	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	184					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GGCCGTGTGCGCACCACGACC	0.642													13	44	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16958060	16958060	+	Intron	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16958060C>T	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						TGTAGCCCCTCTCCATCCTCT	0.657													5	21	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976585	16976585	+	RNA	SNP	C	T	T	rs1135350	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976585C>T	uc010och.1	+	14		c.2306C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						TACGGGGGCCCACTTGCCTGC	0.567													4	28	---	---	---	---	PASS
TMEM50A	23585	broad.mit.edu	37	1	25679398	25679398	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25679398T>C	uc001bke.2	+	5	450	c.300T>C	c.(298-300)GGT>GGC	p.G100G	TMEM50A_uc010oeq.1_Intron|TMEM50A_uc009vrr.2_RNA|TMEM50A_uc009vrs.2_Intron	NM_014313	NP_055128	O95807	TM50A_HUMAN	small membrane protein 1	100	Helical; (Potential).					endoplasmic reticulum|integral to membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		TTTTCGTTGGTTTCATGTTGG	0.333													7	715	---	---	---	---	PASS
MEAF6	64769	broad.mit.edu	37	1	37975131	37975131	+	Silent	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37975131G>A	uc001cbg.1	-	3	236	c.219C>T	c.(217-219)AGC>AGT	p.S73S	MEAF6_uc001cbd.1_Silent_p.S51S|MEAF6_uc001cbe.1_Silent_p.S73S|MEAF6_uc009vvd.1_RNA|MEAF6_uc001cbf.1_RNA|MEAF6_uc001cbh.1_Silent_p.S73S	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	73					histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						GATCATTTTTGCTATTGGAGT	0.473													54	126	---	---	---	---	PASS
PIGK	10026	broad.mit.edu	37	1	77594961	77594961	+	Intron	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77594961A>G	uc001dhk.2	-						PIGK_uc010orj.1_Intron|PIGK_uc009wbx.2_Intron	NM_005482	NP_005473	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|protein thiol-disulfide exchange|proteolysis	GPI-anchor transamidase complex	cysteine-type endopeptidase activity|GPI-anchor transamidase activity|protein binding			ovary(2)|pancreas(1)	3						CACTTTACAGAAACAGTGTGT	0.488													5	13	---	---	---	---	PASS
TBX15	6913	broad.mit.edu	37	1	119426881	119426881	+	3'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119426881C>T	uc001ehl.1	-	8					TBX15_uc009whj.1_3'UTR	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TTCTGGGCCTCCCTCCACAGA	0.348													2	2	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144863482	144863482	+	Intron	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144863482T>C	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001ema.2_3'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATGGCAGAGCTACTCAGCCAC	0.527			T	PDGFRB	MPD								5	72	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148010987	148010987	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148010987T>C	uc001eqf.2	-	14	1958	c.1923A>G	c.(1921-1923)TCA>TCG	p.S641S	LOC200030_uc001eqe.2_Silent_p.S192S|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Silent_p.S118S|NBPF14_uc001eqx.2_Silent_p.S456S|NBPF14_uc001eqq.2_Silent_p.S545S|NBPF14_uc010pad.1_RNA|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	641	NBPF 4.					cytoplasm					0						CTGAAGGAGTTGAATAACATC	0.478													6	355	---	---	---	---	PASS
SELENBP1	8991	broad.mit.edu	37	1	151342244	151342244	+	Silent	SNP	A	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151342244A>C	uc001exx.2	-	2	53	c.6T>G	c.(4-6)GCT>GCG	p.A2A	SELENBP1_uc010pcy.1_Silent_p.A44A|SELENBP1_uc001exy.2_5'UTR|SELENBP1_uc001exz.2_5'UTR|SELENBP1_uc010pcz.1_Silent_p.A2A|SELENBP1_uc009wms.2_5'UTR|SELENBP1_uc009wmt.2_5'UTR|SELENBP1_uc001eya.2_5'UTR|SELENBP1_uc009wmu.2_5'UTR	NM_003944	NP_003935	Q13228	SBP1_HUMAN	selenium binding protein 1	2					protein transport	cytosol|membrane|nucleolus	protein binding|selenium binding				0	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACATTTCGTAGCTGTGGAAG	0.607													14	46	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179079801	179079801	+	Intron	SNP	T	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179079801T>G	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_3'UTR|ABL2_uc001gmg.3_Intron|ABL2_uc001gmi.3_Intron|ABL2_uc001gmh.3_Intron|ABL2_uc010pne.1_Intron	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	gtggcaggggttctcattgct	0.000			T	ETV6	AML								13	113	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185984500	185984500	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185984500G>C	uc001grq.1	+	31	5069	c.4840G>C	c.(4840-4842)GCA>CCA	p.A1614P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1614	Ig-like C2-type 13.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CTCTGATTCAGCAACATATAC	0.398													37	86	---	---	---	---	PASS
CFHR1	3078	broad.mit.edu	37	1	196801227	196801227	+	3'UTR	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196801227G>T	uc001gtn.2	+	6					CFHR1_uc001gtm.2_3'UTR	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor						complement activation	extracellular space					0						TTATTCATACGTAAAATTTTG	0.274													17	7	---	---	---	---	PASS
TLR5	7100	broad.mit.edu	37	1	223285445	223285445	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223285445G>A	uc001hnv.1	-	4	1375	c.929C>T	c.(928-930)ACA>ATA	p.T310I	TLR5_uc001hnw.1_Missense_Mutation_p.T310I	NM_003268	NP_003259	O60602	TLR5_HUMAN	toll-like receptor 5 precursor	310	Extracellular (Potential).|LRR 5.				cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity			ovary(2)|lung(1)|skin(1)	4				GBM - Glioblastoma multiforme(131;0.0851)		ATCCTTGAGTGTCTCAAAGAC	0.443													19	43	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26698883	26698883	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26698883C>A	uc002rhk.2	-	24	3017	c.2890G>T	c.(2890-2892)GCG>TCG	p.A964S	OTOF_uc010yla.1_5'Flank|OTOF_uc002rhh.2_Missense_Mutation_p.A217S|OTOF_uc002rhi.2_Missense_Mutation_p.A274S|OTOF_uc002rhj.2_Missense_Mutation_p.A217S	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	964	Cytoplasmic (Potential).|C2 3.		A -> E (in NSRAN).		cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACATGTGCGCTCGGAGCTGG	0.642													12	27	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29917822	29917822	+	Missense_Mutation	SNP	G	C	C	rs56116528		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29917822G>C	uc002rmy.2	-	3	1753	c.846C>G	c.(844-846)GAC>GAG	p.D282E		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	282	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GGTTCCTGAGGTCATGCAGTG	0.572			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				15	54	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86719365	86719365	+	3'UTR	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86719365T>C	uc002sri.3	+	26					KDM3A_uc010ytj.1_3'UTR|KDM3A_uc010ytk.1_3'UTR	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						CTTGTGAGGGTACTCTGTCTA	0.368													3	42	---	---	---	---	PASS
SLC35F5	80255	broad.mit.edu	37	2	114500419	114500419	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114500419C>A	uc002tku.1	-	7	1024	c.600G>T	c.(598-600)ATG>ATT	p.M200I	SLC35F5_uc002tkt.2_RNA|SLC35F5_uc002tkv.2_Missense_Mutation_p.M194I|SLC35F5_uc002tkw.2_Missense_Mutation_p.M200I	NM_025181	NP_079457	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	200					transport	integral to membrane					0						GTCGAATCTCCATGATATTAC	0.388													81	153	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153526756	153526756	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153526756T>C	uc002tyh.3	-	15	1641	c.1619A>G	c.(1618-1620)GAG>GGG	p.E540G	PRPF40A_uc002tyg.3_5'Flank|PRPF40A_uc010zcd.1_Missense_Mutation_p.E487G	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	567	FF 3.				mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TTGTAACTCCTCATCTTCTGC	0.343													6	302	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	167760331	167760331	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167760331C>T	uc002udx.2	+	1	357	c.339C>T	c.(337-339)GCC>GCT	p.A113A	XIRP2_uc010fpn.2_Silent_p.A113A|XIRP2_uc010fpo.2_Silent_p.A113A|XIRP2_uc010fpp.2_Silent_p.A113A	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTTCCATTGCCCTTGATGAGC	0.498													40	137	---	---	---	---	PASS
ATF2	1386	broad.mit.edu	37	2	175962262	175962262	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175962262T>C	uc002ujl.2	-	11	1150	c.888A>G	c.(886-888)AAA>AAG	p.K296K	ATF2_uc010fqv.2_Silent_p.K247K|ATF2_uc002ujv.2_Silent_p.K43K|ATF2_uc002ujm.2_Silent_p.K238K|ATF2_uc002ujn.2_RNA|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_RNA|ATF2_uc002ujq.2_Silent_p.K296K|ATF2_uc002ujr.2_RNA|ATF2_uc010fqu.2_Silent_p.K278K|ATF2_uc002ujs.2_Silent_p.K238K|ATF2_uc002ujt.2_RNA|ATF2_uc002uju.2_RNA|ATF2_uc002ujw.1_Silent_p.K238K|ATF2_uc002ujx.1_RNA	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2	296					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)			TACCATGACCTTTGACAGTAT	0.433													5	183	---	---	---	---	PASS
FKBP7	51661	broad.mit.edu	37	2	179341870	179341870	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179341870T>G	uc002umk.2	-	2	421	c.292A>C	c.(292-294)ATT>CTT	p.I98L	FKBP7_uc002umm.2_Missense_Mutation_p.I98L|FKBP7_uc002uml.2_RNA|FKBP7_uc010zff.1_Missense_Mutation_p.I94L	NM_181342	NP_851939	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7 isoform a precursor	98	PPIase FKBP-type.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTCATAGCAATGTCTAGGCCT	0.393													46	122	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179403531	179403531	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179403531A>G	uc010zfg.1	-	303	91545	c.91321T>C	c.(91321-91323)TCA>CCA	p.S30441P	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S24136P|TTN_uc010zfi.1_Missense_Mutation_p.S24069P|TTN_uc010zfj.1_Missense_Mutation_p.S23944P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31368							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGATATTGAAAGAATCTCA	0.368													5	209	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190584436	190584436	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190584436T>C	uc002uqw.1	+	10	2150	c.2150T>C	c.(2149-2151)CTA>CCA	p.L717P	ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqx.1_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	788	ARM 2.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ATTCCATCTCTAATCAACCTA	0.403													5	213	---	---	---	---	PASS
ATIC	471	broad.mit.edu	37	2	216184411	216184411	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216184411G>T	uc002vex.3	+	4	421	c.247G>T	c.(247-249)GAA>TAA	p.E83*	ATIC_uc010zjo.1_Nonsense_Mutation_p.E24*|ATIC_uc002vey.3_Nonsense_Mutation_p.E82*	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide	83					IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	TAATATTCCAGAAGATAATGC	0.323			T	ALK	ALCL								83	192	---	---	---	---	PASS
DAZL	1618	broad.mit.edu	37	3	16630109	16630109	+	3'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16630109C>T	uc003cbb.2	-	11					DAZL_uc003cba.2_3'UTR	NM_001351	NP_001342	Q92904	DAZL_HUMAN	deleted in azoospermia-like						germ cell development|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding|translation activator activity				0						TAGTGGAAACCTTTTAGCTTA	0.328													70	100	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39229862	39229862	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39229862C>T	uc003cjk.1	-	2	1296	c.1075G>A	c.(1075-1077)GGG>AGG	p.G359R	XIRP1_uc003cji.2_Missense_Mutation_p.G359R|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	359							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCTTCGTCCCCCTTCAGAGTG	0.587													12	21	---	---	---	---	PASS
ZNF660	285349	broad.mit.edu	37	3	44635652	44635652	+	5'UTR	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44635652A>G	uc003cnl.1	+	3						NM_173658	NP_775929	Q6AZW8	ZN660_HUMAN	zinc finger protein 660						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		AGAGAAGACTAGAGAGGACAC	0.383													4	143	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52692235	52692235	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52692235G>A	uc003des.2	-	5	637	c.625C>T	c.(625-627)CAG>TAG	p.Q209*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.Q209*|PBRM1_uc003der.2_Nonsense_Mutation_p.Q209*|PBRM1_uc003det.2_Nonsense_Mutation_p.Q209*|PBRM1_uc003deu.2_Nonsense_Mutation_p.Q209*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.Q209*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.Q209*|PBRM1_uc003dey.2_Nonsense_Mutation_p.Q209*|PBRM1_uc003dez.1_Nonsense_Mutation_p.Q209*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.Q107*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	209	Bromo 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGCAGTTTCTGAAAAAGTTCG	0.378			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								64	62	---	---	---	---	PASS
SPCS1	28972	broad.mit.edu	37	3	52740855	52740855	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52740855C>T	uc011bei.1	+	3	549	c.344C>T	c.(343-345)ACT>ATT	p.T115I	GLT8D1_uc003dfj.2_5'Flank|GLT8D1_uc003dfk.2_5'Flank|GLT8D1_uc003dfl.2_5'Flank|GLT8D1_uc003dfm.2_5'Flank|GLT8D1_uc003dfn.2_5'Flank|GLT8D1_uc003dfo.1_5'Flank|GLT8D1_uc010hmm.1_5'Flank	NM_014041	NP_054760	Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog	115	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to endoplasmic reticulum membrane|microsome|signal peptidase complex	peptidase activity				0				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		TTCGGGTGGACTGTCTATATA	0.428													6	596	---	---	---	---	PASS
SLC15A2	6565	broad.mit.edu	37	3	121659918	121659918	+	3'UTR	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121659918T>C	uc003eep.2	+	22					SLC15A2_uc011bjn.1_3'UTR	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a						protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	TTTTTTCTTCTACTGGATTAG	0.428													3	50	---	---	---	---	PASS
NMNAT3	349565	broad.mit.edu	37	3	139279898	139279898	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139279898G>T	uc003etj.2	-	4	753	c.713C>A	c.(712-714)ACC>AAC	p.T238N	NMNAT3_uc003etk.2_Missense_Mutation_p.T201N|NMNAT3_uc003etl.2_RNA|NMNAT3_uc010hul.2_Missense_Mutation_p.T149N	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase	238					water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						GCCTTTCCAGGTACTGCCCTT	0.582													44	72	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141161704	141161704	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141161704C>T	uc003etw.2	+	8	1456	c.474C>T	c.(472-474)ATC>ATT	p.I158I	ZBTB38_uc010hun.2_Silent_p.I155I|ZBTB38_uc010huo.2_Silent_p.I158I|ZBTB38_uc003ety.2_Silent_p.I158I|ZBTB38_uc010hup.2_Silent_p.I159I	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	158					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AACCAGCCATCACTAATGGGC	0.398													3	51	---	---	---	---	PASS
EIF4A2	1974	broad.mit.edu	37	3	186505633	186505633	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186505633T>G	uc003fqs.2	+	10	1080	c.1041T>G	c.(1039-1041)AAT>AAG	p.N347K	EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.N348K|EIF4A2_uc003fqv.2_Missense_Mutation_p.N252K|EIF4A2_uc003fqw.2_Missense_Mutation_p.N252K|EIF4A2_uc011bsb.1_3'UTR	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	347	Helicase C-terminal.				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TGGTTATAAATTATGATCTAC	0.353			T	BCL6	NHL								58	128	---	---	---	---	PASS
TMEM44	93109	broad.mit.edu	37	3	194338403	194338403	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194338403G>C	uc010hzn.2	-	6	884	c.715C>G	c.(715-717)CGA>GGA	p.R239G	TMEM44_uc010hzm.2_5'Flank|TMEM44_uc003fuc.2_5'Flank|TMEM44_uc003fue.2_Intron|TMEM44_uc003fud.2_Intron|TMEM44_uc003fuf.2_Intron|TMEM44_uc011bsv.1_Intron|TMEM44_uc003fuh.1_Intron	NM_001011655	NP_001011655	Q2T9K0	TMM44_HUMAN	transmembrane protein 44 isoform b	239	Cytoplasmic (Potential).					integral to membrane					0	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		gcagcggctcgccaatgtccg	0.045													4	24	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47840012	47840012	+	5'UTR	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47840012G>T	uc003gxm.2	-	1					CORIN_uc011bzg.1_5'UTR|CORIN_uc011bzh.1_5'UTR|CORIN_uc011bzi.1_5'UTR|CORIN_uc003gxn.3_5'UTR	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						TATCTTGGTCGCTTTTCTCTC	0.532													15	46	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47840013	47840013	+	5'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47840013C>T	uc003gxm.2	-	1					CORIN_uc011bzg.1_5'UTR|CORIN_uc011bzh.1_5'UTR|CORIN_uc011bzi.1_5'UTR|CORIN_uc003gxn.3_5'UTR	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						ATCTTGGTCGCTTTTCTCTCC	0.527													15	45	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48507571	48507571	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48507571T>C	uc003gyh.1	-	60	9061	c.8456A>G	c.(8455-8457)GAT>GGT	p.D2819G	FRYL_uc003gye.1_Missense_Mutation_p.D7G|FRYL_uc003gyf.1_Missense_Mutation_p.D215G|FRYL_uc003gyg.1_Missense_Mutation_p.D1515G	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2819					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TACTTGTGCATCTGTGTTTAT	0.313													5	211	---	---	---	---	PASS
NHEDC1	150159	broad.mit.edu	37	4	103910985	103910985	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103910985T>C	uc003hww.2	-	3	305	c.183A>G	c.(181-183)AGA>AGG	p.R61R	NHEDC1_uc003hwu.2_Silent_p.R61R|NHEDC1_uc010ilm.2_5'UTR|NHEDC1_uc003hwv.2_RNA|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1	61						integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		TCAATACTCCTCTTAGAGGAC	0.284													8	743	---	---	---	---	PASS
LARP1B	55132	broad.mit.edu	37	4	129043171	129043171	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129043171T>C	uc003iga.2	+	11	1483	c.1352T>C	c.(1351-1353)GTA>GCA	p.V451A	LARP1B_uc003igc.2_5'UTR|LARP1B_uc003ifz.1_Missense_Mutation_p.V451A|LARP1B_uc003igb.1_Missense_Mutation_p.V166A	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2	451							RNA binding				0						ATTTTGATTGTAACTCAGACA	0.368													4	137	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145568088	145568088	+	Silent	SNP	A	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145568088A>C	uc003ijs.1	+	1	916	c.261A>C	c.(259-261)CTA>CTC	p.L87L	uc003ijq.1_5'Flank|HHIP_uc003ijr.1_Silent_p.L87L	NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	87						cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GCCCGGGGCTAGGGCGCCTGG	0.632													8	28	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164466891	164466891	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164466891T>C	uc003iqs.1	-	7	1405	c.428A>G	c.(427-429)GAG>GGG	p.E143G	MARCH1_uc003iqr.1_Missense_Mutation_p.E126G	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	143					antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CTGTAGTTTCTCCCACTGCAA	0.393													5	191	---	---	---	---	PASS
SFRS12	140890	broad.mit.edu	37	5	65465917	65465917	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65465917A>T	uc003juo.2	+	9	1352	c.692A>T	c.(691-693)GAC>GTC	p.D231V	SFRS12_uc003jun.2_Missense_Mutation_p.D347V|SFRS12_uc010iwy.2_Missense_Mutation_p.D231V	NM_139168	NP_631907	Q8WXA9	SREK1_HUMAN	splicing factor, arginine/serine-rich 12 isoform	231	Arg/Glu/Lys/Ser-rich.				mRNA processing|RNA splicing	spliceosomal complex	nucleic acid binding|nucleotide binding|protein binding				0		Lung NSC(167;9.34e-06)|Prostate(74;0.00187)|Ovarian(174;0.0545)|Breast(144;0.0928)|Colorectal(97;0.234)		Lung(70;0.00449)		AGACAGAAAGACAGACGTAGA	0.348													34	81	---	---	---	---	PASS
HMGCR	3156	broad.mit.edu	37	5	74651240	74651240	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74651240C>T	uc003kdp.2	+	14	1929	c.1773C>T	c.(1771-1773)GGC>GGT	p.G591G	HMGCR_uc011cst.1_Silent_p.G611G|HMGCR_uc003kdq.2_Silent_p.G538G	NM_000859	NP_000850	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	591	Catalytic.				cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TGACTCGTGGCCCAGTTGTGC	0.507													4	167	---	---	---	---	PASS
FAM81B	153643	broad.mit.edu	37	5	94783997	94783997	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94783997G>C	uc003kla.1	+	9	1100	c.1054G>C	c.(1054-1056)GAA>CAA	p.E352Q	FAM81B_uc010jbe.1_Missense_Mutation_p.E148Q	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	352	Potential.									ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		TAAAATGGAAGAAAAACTGCT	0.294													73	173	---	---	---	---	PASS
NUDT12	83594	broad.mit.edu	37	5	102886534	102886534	+	3'UTR	SNP	A	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886534A>C	uc003koi.2	-	7					NUDT12_uc011cvb.1_3'UTR	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		GAAATTATTAAATAATACTCA	0.323													46	118	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	124079966	124079966	+	Silent	SNP	C	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124079966C>G	uc003ktq.1	-	1	840	c.717G>C	c.(715-717)GGG>GGC	p.G239G	ZNF608_uc003ktr.1_RNA|ZNF608_uc003kts.1_Silent_p.G239G|ZNF608_uc003ktt.1_Silent_p.G239G	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	239						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGCTCTTGGCCCCAAAGCCAT	0.647													5	4	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128864251	128864251	+	Silent	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128864251A>G	uc003kvb.1	+	6	1191	c.1191A>G	c.(1189-1191)CTA>CTG	p.L397L	ADAMTS19_uc003kvc.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	397	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAAAATGCTAGAGAGTTTTT	0.348													5	239	---	---	---	---	PASS
SLC22A5	6584	broad.mit.edu	37	5	131714102	131714102	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131714102C>T	uc003kww.3	+	2	690	c.426C>T	c.(424-426)GCC>GCT	p.A142A	SLC22A5_uc003kwx.3_Silent_p.A166A	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5	142	Extracellular (Potential).		A -> S (in CDSP).		positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	ACTGGAAGGCCCCACTCACAA	0.502													6	423	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141028860	141028860	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141028860G>A	uc003llk.2	-	6	442	c.391C>T	c.(391-393)CAG>TAG	p.Q131*	FCHSD1_uc010jgg.2_5'Flank|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	131	Potential.								FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCCCTCTGGAGGTTCTCT	0.577													13	83	---	---	---	---	PASS
LMBRD1	55788	broad.mit.edu	37	6	70462198	70462198	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70462198A>G	uc003pfa.2	-	4	473	c.358T>C	c.(358-360)TAC>CAC	p.Y120H	LMBRD1_uc003pez.2_Missense_Mutation_p.Y47H|LMBRD1_uc010kal.2_Missense_Mutation_p.Y47H|LMBRD1_uc003pfb.2_Intron	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	120	Helical; Name=3; (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						TAATAGAAGTAGACAAAAGGG	0.284													5	262	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72960119	72960119	+	Silent	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72960119T>A	uc003pga.2	+	13	2405	c.2328T>A	c.(2326-2328)CGT>CGA	p.R776R	RIMS1_uc011dyb.1_Silent_p.R402R|RIMS1_uc003pgc.2_Silent_p.R402R|RIMS1_uc010kaq.2_Silent_p.R250R|RIMS1_uc011dyc.1_Silent_p.R250R|RIMS1_uc010kar.2_Silent_p.R169R|RIMS1_uc011dyd.1_Silent_p.R235R|RIMS1_uc003pgf.2_5'UTR|RIMS1_uc003pgg.2_5'UTR|RIMS1_uc003pgi.2_5'UTR|RIMS1_uc003pgh.2_5'UTR|RIMS1_uc003pgd.2_5'UTR|RIMS1_uc003pge.2_5'UTR|RIMS1_uc011dye.1_5'Flank|RIMS1_uc003pgb.3_Silent_p.R402R|RIMS1_uc010kas.1_Silent_p.R235R	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	776	C2 1.				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TAGATGGACGTCCTCGAAATC	0.353													63	145	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109769530	109769530	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109769530C>A	uc003ptj.2	-	12	1985	c.1731G>T	c.(1729-1731)GAG>GAT	p.E577D	MICAL1_uc003ptk.2_Missense_Mutation_p.E577D|MICAL1_uc010kdr.2_Missense_Mutation_p.E491D|MICAL1_uc011eaq.1_Missense_Mutation_p.E596D	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	577	CH.				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CCAGCTCATTCTCTGCCACCT	0.592													20	49	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128222118	128222118	+	5'UTR	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128222118A>T	uc003qbi.2	-	2					THEMIS_uc011ebt.1_5'UTR|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform						negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						TGCTCACAGAAACTTGTGGCT	0.527													8	276	---	---	---	---	PASS
MRPL18	29074	broad.mit.edu	37	6	160211819	160211819	+	Intron	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160211819G>A	uc003qsw.3	+						TCP1_uc003qsr.2_5'Flank|TCP1_uc003qss.2_5'Flank|TCP1_uc010kjz.2_5'Flank|TCP1_uc003qst.2_5'Flank|TCP1_uc010kka.1_5'Flank|MRPL18_uc010kkb.2_RNA	NM_014161	NP_054880	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18 precursor						rRNA transport|translation	mitochondrial ribosome	5S rRNA binding|structural constituent of ribosome				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		TTAAGGACGGGGTCAGTGCTG	0.532													10	18	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23749854	23749854	+	5'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23749854C>T	uc003sws.3	+	1					STK31_uc003swt.3_5'UTR|STK31_uc011jze.1_5'UTR|STK31_uc010kuq.2_5'Flank	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						GAAGCTCACGCGGTAAGCCGC	0.657													4	16	---	---	---	---	PASS
HOXA1	3198	broad.mit.edu	37	7	27134190	27134190	+	Silent	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27134190A>G	uc003sye.2	-	2	971	c.877T>C	c.(877-879)TTG>CTG	p.L293L	HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	293						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						GAGATGGGCAAGAGACCCTCC	0.587													4	74	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38288936	38288936	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38288936T>C	uc003tfu.3	-	2	288	c.53A>G	c.(52-54)GAG>GGG	p.E18G	uc003tfv.2_Missense_Mutation_p.E18G|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																		GTCCAGTGACTCTTCTGGCAC	0.403													9	739	---	---	---	---	PASS
POLM	27434	broad.mit.edu	37	7	44118355	44118355	+	Missense_Mutation	SNP	C	A	A	rs151259046		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44118355C>A	uc003tjt.2	-	5	790	c.698G>T	c.(697-699)AGG>ATG	p.R233M	POLM_uc003tjw.1_5'Flank|POLM_uc003tju.2_Missense_Mutation_p.R233M|POLM_uc003tjx.2_Missense_Mutation_p.R233M|POLM_uc003tjv.2_RNA|POLM_uc011kbt.1_Translation_Start_Site|POLM_uc003tka.1_5'Flank|POLM_uc003tjz.3_Missense_Mutation_p.S233I|POLM_uc011kbu.1_Missense_Mutation_p.R200M|POLM_uc010kxy.2_Missense_Mutation_p.R233M	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN	DNA-directed DNA polymerase mu	233					DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						GGTCTGGTACCTCTCTGAGCG	0.512								DNA_polymerases_(catalytic_subunits)					40	91	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70853312	70853312	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70853312G>A	uc003tvy.2	+	3	514	c.514G>A	c.(514-516)GTG>ATG	p.V172M	WBSCR17_uc003tvz.2_Translation_Start_Site	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	172	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCTGCGGTCCGTGCACAGTGC	0.557													5	140	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	86998786	86998786	+	Silent	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86998786G>A	uc003uit.2	+	7	887	c.642G>A	c.(640-642)CCG>CCA	p.P214P	CROT_uc003uiu.2_Silent_p.P242P	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	214					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TGGTCACCCCGCCAGAGCTTC	0.423													6	352	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	87020936	87020936	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87020936A>G	uc003uit.2	+	14	1578	c.1333A>G	c.(1333-1335)AGA>GGA	p.R445G	CROT_uc003uiu.2_Missense_Mutation_p.R473G	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	445					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	AGCTATGACAAGACATTTTTA	0.388													6	379	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91632376	91632376	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91632376A>T	uc003ulg.2	+	8	3370	c.3145A>T	c.(3145-3147)ATG>TTG	p.M1049L	AKAP9_uc003ule.2_Missense_Mutation_p.M1061L|AKAP9_uc003ulf.2_Missense_Mutation_p.M1049L|AKAP9_uc003uli.2_Missense_Mutation_p.M674L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1061					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATCAAAAATAATGGTGGAAGA	0.343			T	BRAF	papillary thyroid								82	88	---	---	---	---	PASS
AGBL3	340351	broad.mit.edu	37	7	134674013	134674013	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134674013T>C	uc011kpw.1	+	3	329	c.76T>C	c.(76-78)TTC>CTC	p.F26L		NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic	26					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						TGAGGATATGTTCATGAAATT	0.269													7	500	---	---	---	---	PASS
PURG	29942	broad.mit.edu	37	8	30853997	30853997	+	3'UTR	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30853997T>A	uc003xim.1	-	2						NM_001015508	NP_001015508	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G isoform B							nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		ATACTTGTCTTCCCTTCCGTG	0.398													5	172	---	---	---	---	PASS
NPBWR1	2831	broad.mit.edu	37	8	53853305	53853305	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53853305C>A	uc011ldu.1	+	1	838	c.838C>A	c.(838-840)CCG>ACG	p.P280T		NM_005285	NP_005276	P48145	NPBW1_HUMAN	G protein-coupled receptor 7	280	Extracellular (Potential).				synaptic transmission	plasma membrane	opioid receptor activity|protein binding			ovary(2)|breast(1)	3		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				CACCGACCTCCCGCAGACGCC	0.642													8	21	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763422	77763422	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763422G>A	uc003yav.2	+	10	4517	c.4130G>A	c.(4129-4131)CGG>CAG	p.R1377Q	ZFHX4_uc003yau.1_Missense_Mutation_p.R1422Q|ZFHX4_uc003yaw.1_Missense_Mutation_p.R1377Q	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1377						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATGCAATTCGGGCTGCGACA	0.458										HNSCC(33;0.089)			3	66	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689533	109689533	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689533T>C	uc004bcz.2	+	3	3629	c.3340T>C	c.(3340-3342)TAC>CAC	p.Y1114H	ZNF462_uc010mto.2_Missense_Mutation_p.Y962H|ZNF462_uc004bda.2_Missense_Mutation_p.Y962H	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1114					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TACTGAGCTTTACTACTGCAA	0.488													32	29	---	---	---	---	PASS
BAMBI	25805	broad.mit.edu	37	10	28971016	28971016	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28971016G>A	uc001iuj.1	+	3	872	c.469G>A	c.(469-471)GTG>ATG	p.V157M	BAMBI_uc001iui.2_3'UTR	NM_012342	NP_036474	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	157	Helical; (Potential).				cell migration|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|positive regulation of protein binding|positive regulation of transcription, DNA-dependent|regulation of cell shape	cytoplasm|integral to membrane|plasma membrane	frizzled binding|type II transforming growth factor beta receptor binding			central_nervous_system(4)	4						GGTCATTGCCGTGCCCATTGC	0.498													4	240	---	---	---	---	PASS
C10orf129	142827	broad.mit.edu	37	10	96954310	96954310	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96954310A>T	uc001kke.2	+	2	193	c.68A>T	c.(67-69)TAT>TTT	p.Y23F	C10orf129_uc009xuu.1_5'UTR	NM_207321	NP_997204	Q6P461	ACSM6_HUMAN	acyl-coenzyme A synthetase ACSM6, mitochondrial	23					fatty acid metabolic process	mitochondrion	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GCCTGCTGCTATCCAAACCAA	0.478													69	158	---	---	---	---	PASS
ENTPD7	57089	broad.mit.edu	37	10	101464245	101464245	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101464245T>C	uc001kqa.3	+	13	1798	c.1620T>C	c.(1618-1620)GGT>GGC	p.G540G	ENTPD7_uc009xwl.2_Silent_p.G542G	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	540	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		AAGCCCATGGTAGCTGGTTCC	0.468													4	165	---	---	---	---	PASS
SFXN4	119559	broad.mit.edu	37	10	120900805	120900805	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120900805T>A	uc001leb.2	-	14	1008	c.963A>T	c.(961-963)AAA>AAT	p.K321N	SFXN4_uc001ldy.2_Missense_Mutation_p.K205N|SFXN4_uc001ldz.2_Missense_Mutation_p.K205N|SFXN4_uc001lea.2_RNA	NM_213649	NP_998814	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	321					iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		GAGACTGAATTTTCTCTTCAA	0.338													123	250	---	---	---	---	PASS
MMP21	118856	broad.mit.edu	37	10	127455387	127455387	+	Silent	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127455387A>G	uc001liu.2	-	7	1554	c.1554T>C	c.(1552-1554)ATT>ATC	p.I518I		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	518	Hemopexin-like 4.				proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGAAAAAGAAAATGGAGTTGT	0.353													6	310	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135101707	135101707	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135101707G>A	uc001lmg.1	-	11	2005	c.1648C>T	c.(1648-1650)CGC>TGC	p.R550C	TUBGCP2_uc001lmf.1_Missense_Mutation_p.R143C|TUBGCP2_uc010qvc.1_Missense_Mutation_p.R578C|TUBGCP2_uc009ybk.1_Missense_Mutation_p.R550C|TUBGCP2_uc010qvd.1_Missense_Mutation_p.R420C|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	550					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCTTCCAGGCGAGGGGGCGTG	0.662													8	20	---	---	---	---	PASS
NLRP6	171389	broad.mit.edu	37	11	285235	285235	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:285235T>A	uc010qvs.1	+	8	2610	c.2610T>A	c.(2608-2610)GAT>GAA	p.D870E	NLRP6_uc010qvt.1_Missense_Mutation_p.D869E	NM_138329	NP_612202	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	870						cytoplasm	ATP binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAAAGCCGGATCTGGTCATCA	0.612													18	31	---	---	---	---	PASS
TRAF6	7189	broad.mit.edu	37	11	36518700	36518700	+	Silent	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36518700A>G	uc001mwr.1	-	5	904	c.564T>C	c.(562-564)TCT>TCC	p.S188S	TRAF6_uc001mws.1_Silent_p.S188S	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	188	Interaction with TAX1BP1.|TRAF-type 1.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				AGTTGTCACAAGAAACCTGTC	0.368													5	208	---	---	---	---	PASS
FAM111A	63901	broad.mit.edu	37	11	58920102	58920102	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58920102A>G	uc010rkp.1	+	5	1188	c.961A>G	c.(961-963)AAA>GAA	p.K321E	FAM111A_uc010rkq.1_Missense_Mutation_p.K321E|FAM111A_uc010rkr.1_Missense_Mutation_p.K321E|FAM111A_uc001nno.2_Missense_Mutation_p.K321E|FAM111A_uc001nnp.2_Missense_Mutation_p.K321E|FAM111A_uc001nnq.2_Missense_Mutation_p.K321E	NM_001142521	NP_001135993	Q96PZ2	F111A_HUMAN	hypothetical protein LOC63901	321					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_epithelial(135;0.139)				AATGAAAGTAAAAAATGGGGA	0.328													36	37	---	---	---	---	PASS
ARAP1	116985	broad.mit.edu	37	11	72396554	72396554	+	3'UTR	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72396554A>T	uc001osu.2	-	35					ARAP1_uc001osv.2_3'UTR|ARAP1_uc001osr.2_3'UTR|ARAP1_uc001oss.2_3'UTR|ARAP1_uc009yth.2_3'UTR|ARAP1_uc010rre.1_3'UTR	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						CCTGCCGGGGAACCCCATGCT	0.637													7	12	---	---	---	---	PASS
PPME1	51400	broad.mit.edu	37	11	73964584	73964584	+	3'UTR	SNP	C	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73964584C>G	uc001ouw.2	+	14					PPME1_uc009yty.2_3'UTR|PPME1_uc001oux.2_3'UTR|P4HA3_uc001ouy.3_Intron	NM_016147	NP_057231	Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1						protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0	Breast(11;3.29e-05)					TCCTCAACATCGAGCTCTGTT	0.517													103	226	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	1005824	1005824	+	Silent	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1005824T>C	uc001qio.3	+	24	6678	c.6171T>C	c.(6169-6171)TCT>TCC	p.S2057S	WNK1_uc001qip.3_Silent_p.S1809S|WNK1_uc001qir.3_Silent_p.S1230S	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2057					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTAACTCCTCTTACATGAGTA	0.418													4	47	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6640678	6640678	+	3'UTR	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6640678A>T	uc001qoo.2	+	32					NCAPD2_uc010sfd.1_3'UTR|GAPDH_uc001qop.1_5'Flank|GAPDH_uc009zep.1_5'Flank|GAPDH_uc001qoq.1_5'Flank|GAPDH_uc001qor.1_5'Flank	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						TCTTTTTTTTAAAAAAAAAAA	0.214													3	15	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44142290	44142290	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44142290A>G	uc001rnq.3	-	3	1522	c.1033T>C	c.(1033-1035)TAT>CAT	p.Y345H	PUS7L_uc001rnr.3_Missense_Mutation_p.Y345H|PUS7L_uc001rns.3_Missense_Mutation_p.Y345H|PUS7L_uc009zkb.2_Missense_Mutation_p.Y32H	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	345					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		ATTGCTTGATAGGTGATGGCT	0.343													5	398	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49440459	49440459	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49440459T>A	uc001rta.3	-	15	4351	c.4351A>T	c.(4351-4353)AGC>TGC	p.S1451C		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1451	Cys-rich.|PHD-type 4.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GTGTGGTAGCTAATATCACAG	0.597			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			14	41	---	---	---	---	PASS
IKBIP	121457	broad.mit.edu	37	12	99007799	99007799	+	Missense_Mutation	SNP	A	G	G	rs142312833	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99007799A>G	uc001tfv.2	-	3	727	c.617T>C	c.(616-618)GTA>GCA	p.V206A	IKBIP_uc001tfw.2_3'UTR	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2	206	Potential.				induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ATTTTTTTCTACTTTCTCTAT	0.318													44	79	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101680185	101680185	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101680185A>G	uc001tia.1	+	5	569	c.413A>G	c.(412-414)GAG>GGG	p.E138G	UTP20_uc009ztz.1_Missense_Mutation_p.E138G	NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	138					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TCGATCCTGGAGACTCAGGAC	0.413													6	346	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104056744	104056744	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104056744C>T	uc001tjw.2	+	18	2176	c.1990C>T	c.(1990-1992)CGA>TGA	p.R664*		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	664	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TCTGCCCCATCGATGTGATGA	0.468													6	163	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104335645	104335645	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104335645C>T	uc001tkb.1	+	11	1449	c.1344C>T	c.(1342-1344)CGC>CGT	p.R448R	HSP90B1_uc010swg.1_Silent_p.R113R|HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	448		ATP (By similarity).			actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	ATGTTTCCCGCGAGACTCTTC	0.443													6	117	---	---	---	---	PASS
TCHP	84260	broad.mit.edu	37	12	110341939	110341939	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110341939A>G	uc001tpn.2	+	3	539	c.386A>G	c.(385-387)GAG>GGG	p.E129G	TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Missense_Mutation_p.E129G	NM_001143852	NP_001137324	Q9BT92	TCHP_HUMAN	trichoplein	129	Glu-rich.|Potential.|Interaction with keratin proteins.				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding			skin(1)	1						GCCAAAGAAGAGCAGAGGAAA	0.567													4	71	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25026513	25026513	+	Intron	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25026513T>C	uc001upl.2	-						PARP4_uc010tdc.1_3'UTR	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CCCGTGGGTCTGGACTATGTG	0.498													24	39	---	---	---	---	PASS
SERPINE3	647174	broad.mit.edu	37	13	51915250	51915250	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51915250T>C	uc001vfh.2	+	1	83	c.23T>C	c.(22-24)CTC>CCC	p.L8P	SERPINE3_uc010tgp.1_Missense_Mutation_p.L8P	NM_001101320	NP_001094790	A8MV23	SERP3_HUMAN	nexin-related serine protease inhibitor	8					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)	2						CTGATCACCCTCTTCCTCTTT	0.542													5	155	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22309720	22309720	+	Intron	SNP	T	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22309720T>A	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wbx.2_Missense_Mutation_p.V35D|uc001wby.2_5'Flank					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		CCCTTCAATGTTCCAGAGGGA	0.483													39	64	---	---	---	---	PASS
PRPF39	55015	broad.mit.edu	37	14	45581684	45581684	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45581684A>C	uc001wvz.3	+	11	1906	c.1736A>C	c.(1735-1737)GAT>GCT	p.D579A	PRPF39_uc001wvy.3_Missense_Mutation_p.D458A|PRPF39_uc010and.2_Missense_Mutation_p.D369A|PRPF39_uc001wwa.1_Missense_Mutation_p.D183A	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog	579					mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						TTTCTTGAAGATTTTGGTTCC	0.269													13	77	---	---	---	---	PASS
WDR25	79446	broad.mit.edu	37	14	100996232	100996232	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100996232G>T	uc010avx.2	+	7	1582	c.1489G>T	c.(1489-1491)GTC>TTC	p.V497F	WDR25_uc001yhm.2_Missense_Mutation_p.V489F|WDR25_uc001yhn.2_Missense_Mutation_p.V497F|WDR25_uc010avy.2_RNA|WDR25_uc001yho.2_Missense_Mutation_p.V240F	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25	497	WD 6.										0		Melanoma(154;0.212)				CGATGGCCGGGTCCTGATGTA	0.662													8	14	---	---	---	---	PASS
GOLGA8C	729786	broad.mit.edu	37	15	20771704	20771704	+	5'UTR	SNP	C	T	T	rs150866675	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20771704C>T	uc010tzc.1	+	5					uc001ytn.2_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E											skin(1)	1						TCTCTGCCTCCGCCTGGTTAG	0.562													4	9	---	---	---	---	PASS
GALK2	2585	broad.mit.edu	37	15	49620171	49620171	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49620171C>T	uc001zxj.1	+	10	1290	c.1192C>T	c.(1192-1194)CGA>TGA	p.R398*	GALK2_uc001zxi.1_Nonsense_Mutation_p.R387*|GALK2_uc010ufb.1_Nonsense_Mutation_p.R374*|GALK2_uc001zxk.2_RNA|GALK2_uc010ufc.1_Nonsense_Mutation_p.R374*	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	398					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		TCAAGGGTCACGACTTACTGG	0.433													4	141	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82809008	82809008	+	Intron	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82809008G>A	uc010unt.1	-						uc002bhl.2_Intron|uc002bhm.2_Intron|uc010unw.1_RNA			A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						TGCTGGAGCTGGGGTGGGAAG	0.642													3	3	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1509163	1509163	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1509163G>A	uc002clv.2	-	7	730	c.620C>T	c.(619-621)CCC>CTC	p.P207L	CLCN7_uc002clw.2_Missense_Mutation_p.P183L	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	207	Selectivity filter part_1 (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				CTTGATCTGGGGGATTCCGCT	0.682													10	17	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30750868	30750868	+	Silent	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30750868A>G	uc002dze.1	+	34	9892	c.9507A>G	c.(9505-9507)GTA>GTG	p.V3169V	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.V2964V	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	3169					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			AGGGTTCAGTAGAGGAGTCTG	0.677													3	10	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48596270	48596270	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48596270T>G	uc002efp.2	-	2	521	c.284A>C	c.(283-285)GAG>GCG	p.E95A		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	95					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				AAACAGGCTCTCTGCCCCAAC	0.438													18	69	---	---	---	---	PASS
GPR56	9289	broad.mit.edu	37	16	57685282	57685282	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57685282C>T	uc002emb.2	+	4	527	c.235C>T	c.(235-237)CGA>TGA	p.R79*	GPR56_uc002elz.1_Intron|GPR56_uc002ema.1_5'UTR|GPR56_uc002emc.2_Nonsense_Mutation_p.R79*|GPR56_uc002emf.2_Nonsense_Mutation_p.R79*|GPR56_uc010vhs.1_Nonsense_Mutation_p.R79*|GPR56_uc002emd.2_Nonsense_Mutation_p.R79*|GPR56_uc002eme.2_Nonsense_Mutation_p.R79*|GPR56_uc010vht.1_Nonsense_Mutation_p.R84*|GPR56_uc002emg.3_Nonsense_Mutation_p.R79*|GPR56_uc010vhu.1_5'UTR	NM_005682	NP_005673	Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56 isoform a	79	Extracellular (Potential).				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity				0						CCCTGCTTCCCGATCCTTCCC	0.577													4	174	---	---	---	---	PASS
PKD1L3	342372	broad.mit.edu	37	16	72033597	72033597	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72033597T>C	uc010vmm.1	-	1	281	c.281A>G	c.(280-282)GAC>GGC	p.D94G		NM_181536	NP_853514			polycystin 1-like 3 precursor												0						GTATTTGTTGTCTTGATGCTT	0.368													5	176	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12647585	12647585	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12647585A>G	uc002gnn.2	+	8	1102	c.803A>G	c.(802-804)TAC>TGC	p.Y268C	MYOCD_uc002gno.2_Missense_Mutation_p.Y268C|MYOCD_uc002gnp.1_Missense_Mutation_p.Y172C|MYOCD_uc002gnq.2_5'UTR	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	268					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TATCACCAGTACATTCCCCCA	0.522													36	53	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33498340	33498340	+	Splice_Site	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33498340G>C	uc002hja.2	+	13	1793	c.1696_splice	c.e13-1	p.T566_splice	UNC45B_uc002hjb.2_Splice_Site_p.T564_splice|UNC45B_uc002hjc.2_Splice_Site_p.T564_splice|UNC45B_uc010cto.2_Splice_Site_p.T485_splice	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1						cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GTGCCTTCCAGACCAGTGACA	0.572											OREG0024327	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	35	---	---	---	---	PASS
HNF1B	6928	broad.mit.edu	37	17	36091725	36091725	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36091725G>C	uc002hok.3	-	4	1127	c.906C>G	c.(904-906)AAC>AAG	p.N302K	HNF1B_uc010wdi.1_Missense_Mutation_p.N276K|HNF1B_uc010cve.1_Missense_Mutation_p.N110K	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	302	Homeobox; HNF1-type.				endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CCTTCCTGCGGTTTGCAAACC	0.612									Hereditary_Prostate_Cancer				29	66	---	---	---	---	PASS
WIPF2	147179	broad.mit.edu	37	17	38420798	38420798	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38420798A>G	uc002hug.1	+	5	610	c.370A>G	c.(370-372)AGG>GGG	p.R124G	WIPF2_uc002huh.1_5'UTR|WIPF2_uc010cww.1_5'UTR|WIPF2_uc002hui.1_Missense_Mutation_p.R124G|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Missense_Mutation_p.R124G	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein	124						cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						TGCTGCCCCAAGGCCTCCAGT	0.577										HNSCC(43;0.11)			6	27	---	---	---	---	PASS
ST6GALNAC2	10610	broad.mit.edu	37	17	74562178	74562178	+	3'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74562178C>T	uc002jsg.3	-	9						NM_006456	NP_006447	Q9UJ37	SIA7B_HUMAN	sialyltransferase 7B						protein glycosylation	integral to Golgi membrane	sialyltransferase activity				0						GGGCTCAGTGCATTGGGGTCA	0.512													31	71	---	---	---	---	PASS
NPC1	4864	broad.mit.edu	37	18	21140211	21140211	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21140211C>A	uc002kum.3	-	6	1139	c.865G>T	c.(865-867)GCA>TCA	p.A289S	NPC1_uc010xaz.1_Missense_Mutation_p.A73S|NPC1_uc010xba.1_Missense_Mutation_p.A134S	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	289	Helical; (Potential).				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CACCACACTGCAAAAAATGCT	0.463													60	120	---	---	---	---	PASS
C18orf21	83608	broad.mit.edu	37	18	33557546	33557546	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33557546C>A	uc002kzc.2	+	4	578	c.474C>A	c.(472-474)AGC>AGA	p.S158R	C18orf21_uc002kzd.2_Missense_Mutation_p.S70R	NM_031446	NP_113634	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	158											0						AAGGCAAGAGCCCAGCATCGG	0.413													21	48	---	---	---	---	PASS
KISS1R	84634	broad.mit.edu	37	19	918608	918608	+	Silent	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:918608C>T	uc002lqk.3	+	2	470	c.309C>T	c.(307-309)TAC>TAT	p.Y103Y		NM_032551	NP_115940	Q969F8	KISSR_HUMAN	G protein-coupled receptor 54	103	Extracellular (Potential).				behavior	integral to membrane|plasma membrane	neuropeptide receptor activity|protein binding			pancreas(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTGCTGTACCCGCTGCCCG	0.697													3	14	---	---	---	---	PASS
C19orf36	113177	broad.mit.edu	37	19	2098312	2098312	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2098312T>C	uc002luw.1	+	6	577	c.500T>C	c.(499-501)GTC>GCC	p.V167A	C19orf36_uc002lux.1_Missense_Mutation_p.V167A|C19orf36_uc010xgw.1_Missense_Mutation_p.V167A	NM_001039846	NP_001034935	Q1ZYL8	IZUM4_HUMAN	hypothetical protein LOC113177 isoform 3	167						extracellular region					0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGTCAGCTGTCCAGGGCCTC	0.657													4	77	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17952457	17952457	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17952457G>C	uc002nhn.3	-	7	1076	c.976C>G	c.(976-978)CAG>GAG	p.Q326E	JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Missense_Mutation_p.Q326E|JAK3_uc010xpx.1_Missense_Mutation_p.Q326E	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	326	FERM.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						ACTAAAATCTGGTTGTCTGTC	0.617		2	Mis		acute megakaryocytic leukemia|								16	39	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58400240	58400240	+	5'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58400240C>T	uc002qqo.2	-	1					ZNF814_uc002qqk.2_RNA|ZNF814_uc010yhl.1_RNA|ZNF814_uc002qqp.2_RNA	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						CACGACGGTCCGTATCCTGGC	0.637													3	12	---	---	---	---	PASS
SIRPB2	284759	broad.mit.edu	37	20	1460664	1460664	+	Silent	SNP	G	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1460664G>T	uc002wfg.2	-	2	360	c.132C>A	c.(130-132)CCC>CCA	p.P44P	SIRPB2_uc002wfh.3_Silent_p.P44P|SIRPB2_uc010zpr.1_5'UTR	NM_001122962	NP_001116434	Q5JXA9	SIRB2_HUMAN	signal-regulatory protein beta 2 isoform 1	44	Ig-like V-type 1.|Extracellular (Potential).					integral to membrane					0						TGGGGCCCTCGGGCTGTAGCA	0.547													7	9	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633992	29633992	+	Intron	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633992A>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAAAATATTCAGAGGAAATGC	0.308													12	204	---	---	---	---	PASS
PARD6B	84612	broad.mit.edu	37	20	49367001	49367001	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49367001A>T	uc002xvo.2	+	3	1338	c.1095A>T	c.(1093-1095)GAA>GAT	p.E365D		NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN	PAR-6 beta	365					axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1						TCTTAGAAGAAGATGGAACAA	0.383													15	29	---	---	---	---	PASS
SLC5A3	6526	broad.mit.edu	37	21	35467345	35467345	+	5'UTR	SNP	A	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35467345A>G	uc002yto.2	+	2					MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864	P53794	SC5A3_HUMAN	solute carrier family 5 (inositol transporters),							integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2						CACCATCAAGACAGCAAACCA	0.403													6	8	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42126633	42126633	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42126633C>T	uc003baz.1	+	9	1113	c.1088C>T	c.(1087-1089)ACG>ATG	p.T363M	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Missense_Mutation_p.T363M|MEI1_uc011apd.1_RNA	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	363							binding			central_nervous_system(1)|skin(1)	2						AAGTGCCACACGGTGTATGGT	0.527													7	288	---	---	---	---	PASS
MAOA	4128	broad.mit.edu	37	X	43515580	43515580	+	5'UTR	SNP	C	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43515580C>T	uc004dfy.2	+	1					MAOA_uc011mkw.1_5'UTR	NM_000240	NP_000231	P21397	AOFA_HUMAN	monoamine oxidase A						behavior|neurotransmitter biosynthetic process|neurotransmitter catabolic process|neurotransmitter secretion|xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	primary amine oxidase activity|protein binding			breast(2)|ovary(1)	3					Almotriptan(DB00918)|Carbidopa(DB00190)|Clonazepam(DB01068)|Dopamine(DB00988)|Fluvoxamine(DB00176)|Ginkgo biloba(DB01381)|Imipramine(DB00458)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Linezolid(DB00601)|Lorazepam(DB00186)|Moclobemide(DB01171)|Nicotine(DB00184)|Norepinephrine(DB00368)|Phenelzine(DB00780)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Rasagiline(DB01367)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)	AGGAGCGTGTCAGCCAAAGCA	0.612													11	21	---	---	---	---	PASS
MAMLD1	10046	broad.mit.edu	37	X	149639659	149639659	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149639659A>T	uc004fee.1	+	3	1890	c.1814A>T	c.(1813-1815)CAG>CTG	p.Q605L	MAMLD1_uc011mxt.1_Missense_Mutation_p.Q567L|MAMLD1_uc011mxu.1_Missense_Mutation_p.Q580L|MAMLD1_uc011mxv.1_Missense_Mutation_p.Q580L|MAMLD1_uc011mxw.1_Missense_Mutation_p.Q532L	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	605	Poly-Gln.				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					caacagcagcagcagcCTGAC	0.478													11	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7108	7108	+	Silent	SNP	G	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7108G>A	uc011mfh.1	+	1	1255	c.207G>A	c.(205-207)AGG>AGA	p.R69R	uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		CCTATTCTCAGGCTACACCCT	0.448													6	57	---	---	---	---	PASS
SLC35E2B	728661	broad.mit.edu	37	1	1667315	1667316	+	Intron	INS	-	A	A	rs74206106		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1667315_1667316insA	uc001ahh.3	-						SLC35E2_uc009vkm.1_Intron|SLC35E2_uc001ahy.2_Intron|SLC35E2_uc001ahz.2_Intron|SLC35E2_uc001aib.1_Intron	NM_001110781	NP_001104251	P0CK96	S352B_HUMAN	similar to solute carrier family 35, member E2							integral to membrane					0						AACTGATTATTACAGCAGCGAG	0.366													5	3	---	---	---	---	
TPRG1L	127262	broad.mit.edu	37	1	3544927	3544927	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3544927delT	uc001akm.2	+						TPRG1L_uc009vlj.2_Intron	NM_182752	NP_877429	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like							cell junction|synaptic vesicle					0	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		ATAGACATTCTTATCTTGCCT	0.403													104	49	---	---	---	---	
SLC25A33	84275	broad.mit.edu	37	1	9627092	9627092	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9627092delA	uc001apw.2	+						SLC25A33_uc001apx.2_Intron	NM_032315	NP_115691	Q9BSK2	S2533_HUMAN	mitochondrial carrier protein MGC4399						transport	integral to membrane|mitochondrial inner membrane					0	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		tctcaaaaagaaaaaaaaaag	0.144													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14786772	14786772	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14786772delG								PRDM2 (635200 upstream) : KAZ (138441 downstream)																							TGTCGGGCTTGGGCATCCCCA	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18216350	18216350	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18216350delG								ACTL8 (62794 upstream) : IGSF21 (217890 downstream)																							CCAAGACTGTGGCGTACTGAG	0.547													4	2	---	---	---	---	
ARID1A	8289	broad.mit.edu	37	1	27087188	27087189	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27087188_27087189insT	uc001bmv.1	+						ARID1A_uc001bmt.1_Intron|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Intron	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a						androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		aaaaaaaaaaattttttttttt	0.139			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								3	3	---	---	---	---	
PTPRU	10076	broad.mit.edu	37	1	29563455	29563455	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29563455delG	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CGGCGAGTATGTTGGGGGTGA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29669807	29669808	+	IGR	INS	-	TT	TT	rs145131769	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29669807_29669808insTT								PTPRU (16492 upstream) : None (None downstream)																							atctctttctctctctggcacc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33508351	33508351	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33508351delC								AK2 (5859 upstream) : ADC (38363 downstream)																							ctgtggttatcccctcatttg	0.134													4	2	---	---	---	---	
KIAA0319L	79932	broad.mit.edu	37	1	35976510	35976510	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35976510delA	uc001byx.2	-						KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron|KIAA0319L_uc010ohx.1_Intron	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				cgcctggcTGAAAAAAAAAAG	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37122357	37122359	+	IGR	DEL	ATC	-	-	rs146424330		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37122357_37122359delATC								CSF3R (173848 upstream) : GRIK3 (138769 downstream)																							TGAAAACAAGATCACCAAAGGAA	0.281													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	50721724	50721724	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50721724delA								ELAVL4 (54184 upstream) : DMRTA2 (161505 downstream)																							CCTAGGAGGTAGGATTCATGG	0.443													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58341999	58341999	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58341999delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CCAGAAGGATAAAAAAAGGAG	0.408													4	2	---	---	---	---	
C1orf141	400757	broad.mit.edu	37	1	67568176	67568176	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67568176delT	uc001ddl.1	-						C1orf141_uc001ddm.1_Intron|C1orf141_uc001ddn.1_Intron	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN	hypothetical protein LOC400757											ovary(1)	1						TGGGAAAACATTTTTTTTTCA	0.378													3	3	---	---	---	---	
IL12RB2	3595	broad.mit.edu	37	1	67821913	67821914	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67821913_67821914insT	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						GAGAGATAAGATATGGATGGCT	0.485													4	2	---	---	---	---	
DPYD	1806	broad.mit.edu	37	1	98240360	98240360	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98240360delA	uc001drv.2	-						DPYD_uc010oub.1_Intron|DPYD_uc001drw.2_Intron	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	AAGAACTAGGAAAAAAAATTC	0.348													4	2	---	---	---	---	
SNX7	51375	broad.mit.edu	37	1	99135247	99135248	+	Intron	INS	-	ACTT	ACTT	rs141773572	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99135247_99135248insACTT	uc010ouc.1	+						SNX7_uc001dsa.2_Intron|SNX7_uc010oud.1_Intron	NM_015976	NP_057060	Q9UNH6	SNX7_HUMAN	sorting nexin 7 isoform a						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		CCACTATGTGAACTTACTGTGT	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99615675	99615675	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99615675delG								LPPR5 (145226 upstream) : LPPR4 (114225 downstream)																							CTTATCAATAGGACAGATCAG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	104359412	104359412	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104359412delT								AMY1A (152240 upstream) : None (None downstream)																							tggagtgccattctagaaccc	0.000													4	2	---	---	---	---	
RSBN1	54665	broad.mit.edu	37	1	114345326	114345326	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114345326delT	uc001edq.2	-						RSBN1_uc001edr.2_Intron	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1							nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGCCTTTACTTttttttttt	0.159													3	3	---	---	---	---	
PTGFRN	5738	broad.mit.edu	37	1	117505089	117505089	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117505089delT	uc001egv.1	+							NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		agaaattctattttagttggt	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142833447	142833448	+	Intron	INS	-	C	C	rs143118963		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142833447_142833448insC	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		agggtgtgtttcccagaccctt	0.064													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145046163	145046163	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145046163delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						tgggtgtggcttttgcctagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146585286	146585286	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146585286delA								LOC728989 (70687 upstream) : PRKAB2 (41401 downstream)																							AGAAGTGGTTAAAAAAGAAAA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148851975	148851975	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148851975delT								NBPF16 (93664 upstream) : LOC645166 (76311 downstream)																							TTTTCTCTTCTTTTTTTCAAT	0.184													4	2	---	---	---	---	
RORC	6097	broad.mit.edu	37	1	151785278	151785278	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151785278delT	uc001ezh.2	-						RORC_uc001ezg.2_Intron|RORC_uc010pdo.1_Intron|RORC_uc010pdp.1_Intron	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACTCATTTTATTTTATAGCAA	0.403													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161544803	161544803	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161544803delT								FCGR3A (24390 upstream) : FCGR2C (6326 downstream)																							TTCCAATCACTTTTAGGATCT	0.328													4	2	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162245456	162245456	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162245456delC	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			GGAAAATAATCCCAGGATTAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	172674781	172674781	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172674781delA								FASLG (38771 upstream) : TNFSF18 (335579 downstream)																							TCATTGATCCAAATGTGAAGC	0.363													4	2	---	---	---	---	
RALGPS2	55103	broad.mit.edu	37	1	178708227	178708227	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178708227delT	uc001glz.2	+						RALGPS2_uc001gly.1_Intron|RALGPS2_uc010pnb.1_Intron	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						AAGTTTTTTCTTTTTTTTGCA	0.303													4	2	---	---	---	---	
CEP350	9857	broad.mit.edu	37	1	180010502	180010502	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180010502delA	uc001gnt.2	+						CEP350_uc009wxl.2_Intron	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4						ATAAAGTTTTAGTACTTTTTA	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	185314540	185314541	+	IGR	INS	-	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185314540_185314541insC								IVNS1ABP (28079 upstream) : HMCN1 (389142 downstream)																							tggagcccccgcccccccaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187058106	187058106	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187058106delT								PLA2G4A (100001 upstream) : None (None downstream)																							ATTAGGCAACTTTTTTTTTTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	191183887	191183887	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191183887delC								FAM5C (737128 upstream) : RGS18 (943705 downstream)																							tccatctcttctaggttttct	0.000													4	2	---	---	---	---	
KCNT2	343450	broad.mit.edu	37	1	196234941	196234941	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196234941delG	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						aagcaaacatgggactctgtg	0.000													4	2	---	---	---	---	
PLXNA2	5362	broad.mit.edu	37	1	208277291	208277291	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208277291delG	uc001hgz.2	-							NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GTCTTCTGCTGGGGCCCTGCA	0.567													4	2	---	---	---	---	
C1orf97	84791	broad.mit.edu	37	1	211594582	211594582	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211594582delA	uc001hil.3	+							NR_026761				Homo sapiens cDNA FLJ27347 fis, clone TST03991.												0						attgccctggaaagacagtga	0.000													4	2	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214620916	214620917	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214620916_214620917insT	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTTCTTACATTTTTTTTTTC	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	220544018	220544018	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220544018delT								RAB3GAP2 (98175 upstream) : MARK1 (157550 downstream)																							CCAGGCTCTCTTTTTTTGTCT	0.498													4	2	---	---	---	---	
MOSC1	64757	broad.mit.edu	37	1	220973760	220973761	+	Intron	INS	-	C	C	rs145322022		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220973760_220973761insC	uc001hms.2	+						MOSC1_uc001hmt.2_Intron	NM_022746	NP_073583	Q5VT66	MOSC1_HUMAN	MOCO sulphurase C-terminal domain containing 1								molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.0358)		CAGATAGTGAAAAGTCACAGCA	0.540													5	3	---	---	---	---	
MOSC1	64757	broad.mit.edu	37	1	220973761	220973762	+	Intron	INS	-	AGC	AGC	rs76240895		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220973761_220973762insAGC	uc001hms.2	+						MOSC1_uc001hmt.2_Intron	NM_022746	NP_073583	Q5VT66	MOSC1_HUMAN	MOCO sulphurase C-terminal domain containing 1								molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.0358)		AGATAGTGAAAAGTCACAGCAC	0.535													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4458074	4458074	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4458074delT								ALLC (707816 upstream) : None (None downstream)																							CCAAATAACATTTTTTTCTTG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6645854	6645854	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6645854delA								LOC400940 (517490 upstream) : CMPK2 (334649 downstream)																							TTTTGCATGCAAAAAAATATT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8043349	8043350	+	IGR	DEL	AG	-	-	rs71402892		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8043349_8043350delAG								RNF144A (859042 upstream) : LOC339788 (19208 downstream)																							CCCATCCCACAGAGTCTTCCAT	0.550													2	7	---	---	---	---	
LPIN1	23175	broad.mit.edu	37	2	11934768	11934771	+	Intron	DEL	AGAG	-	-	rs147581505		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11934768_11934771delAGAG	uc010yjn.1	+						LPIN1_uc010yjm.1_Intron|LPIN1_uc002rbt.2_Intron|LPIN1_uc010yjo.1_Intron	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1						fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AAACGAGCACAGAGAAAGAGATTT	0.422													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12919620	12919620	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12919620delG								TRIB2 (36764 upstream) : None (None downstream)																							caagagcttaggcatatagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13716955	13716955	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13716955delT								TRIB2 (834099 upstream) : None (None downstream)																							CTACAGGGGATTTTTTTTAGT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13790267	13790267	+	IGR	DEL	A	-	-	rs112542456		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13790267delA								TRIB2 (907411 upstream) : FAM84A (982589 downstream)																							ttcaacagggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19513332	19513332	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19513332delG								NT5C1B (742494 upstream) : OSR1 (37915 downstream)																							TCCAAGAATAGGTCTTCATCA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20056519	20056519	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20056519delT								OSR1 (498147 upstream) : TTC32 (39999 downstream)																							CCAAGGCCCCTCTGAAGGCAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23232641	23232641	+	IGR	DEL	A	-	-	rs151291663		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23232641delA								None (None upstream) : KLHL29 (522814 downstream)																							GTTAAGTTTGAAATTAAAGAT	0.488													2	4	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36608261	36608261	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36608261delC	uc002rpd.2	+							NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor						nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CCCGCCCCTACCCCCCACACA	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41847919	41847919	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41847919delG								None (None upstream) : PKDCC (427242 downstream)																							tattcagacaggtaagaaaag	0.045													4	2	---	---	---	---	
MXD1	4084	broad.mit.edu	37	2	70148882	70148882	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70148882delA	uc002sfy.2	+	3	448	c.188delA	c.(187-189)GAAfs	p.E63fs	MXD1_uc010yqp.1_Frame_Shift_Del_p.E63fs|MXD1_uc010yqq.1_5'UTR|MXD1_uc010yqr.1_Intron|MXD1_uc010yqs.1_Intron	NM_002357	NP_002348	Q05195	MAD1_HUMAN	MAX dimerization protein 1	63	Basic motif.				cell proliferation|multicellular organismal development	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0						ACTCACAATGAAATGGAGAAG	0.373													375	164	---	---	---	---	
RAB11FIP5	26056	broad.mit.edu	37	2	73315970	73315970	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73315970delC	uc002siu.3	-						RAB11FIP5_uc002sit.3_Intron	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)						protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						AGAGCCAGTGCCCCCCTCCCC	0.667													4	2	---	---	---	---	
LOC729234	729234	broad.mit.edu	37	2	96687672	96687673	+	Intron	DEL	AC	-	-	rs149809372	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96687672_96687673delAC	uc010fht.2	+							NR_003698				Homo sapiens fumarylacetoacetate hydrolase domain containing 2 pseudogene (LOC729234), non-coding RNA.												0						GAGAGCAAATACACACACATAC	0.465													4	2	---	---	---	---	
RFX8	731220	broad.mit.edu	37	2	102022802	102022802	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102022802delT	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136	Q6ZV50	RFX8_HUMAN	regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						AAAAAGCAAAttttttttttt	0.209													4	3	---	---	---	---	
SULT1C4	27233	broad.mit.edu	37	2	109002475	109002475	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109002475delA	uc002tea.1	+						SULT1C4_uc010ywr.1_Intron|SULT1C4_uc002teb.1_Intron	NM_006588	NP_006579	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member						3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity				0						TCCAATTACTAAAAAAAGAAC	0.328													6	3	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112613017	112613017	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112613017delA	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						ttcaatctgtaaaaaaaaatg	0.010													4	2	---	---	---	---	
FBLN7	129804	broad.mit.edu	37	2	112907960	112907960	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112907960delA	uc002tho.1	+						FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Intron|FBLN7_uc010fkj.1_Intron	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1						cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						GTACCAGAAGAAAAAAAAAAT	0.478													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125440296	125440297	+	Intron	DEL	AG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125440296_125440297delAG	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		atgttgttttagagagagagag	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132364941	132364942	+	IGR	INS	-	G	G	rs145918909	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132364941_132364942insG								CCDC74A (73704 upstream) : C2orf27A (115122 downstream)																							CCATGACCTGTGTGAGTCACAG	0.446													3	3	---	---	---	---	
C2orf27A	29798	broad.mit.edu	37	2	132494456	132494456	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132494456delT	uc002ttf.1	+							NM_013310	NP_037442	Q580R0	CB027_HUMAN	hypothetical protein LOC29798												0						CTTTATAAACTTTTTTATTCT	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134494367	134494369	+	IGR	DEL	ATG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134494367_134494369delATG								NCKAP5 (168336 upstream) : MGAT5 (517461 downstream)																							TGCTTTAATAATGATGATGATGA	0.054													4	2	---	---	---	---	
UBXN4	23190	broad.mit.edu	37	2	136509927	136509927	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136509927delT	uc002tur.2	+						UBXN4_uc002tus.2_5'Flank	NM_014607	NP_055422	Q92575	UBXN4_HUMAN	UBX domain containing 2						response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding			skin(2)	2						aatttttgtatttttagtaga	0.000													4	2	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137529609	137529609	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137529609delT	uc010zbj.1	+											Homo sapiens mRNA for KIAA1679 protein, partial cds.											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		atttagtccctttttttttgt	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	138900879	138900880	+	IGR	INS	-	C	C	rs150934491	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138900879_138900880insC								HNMT (126946 upstream) : SPOPL (358470 downstream)																							GCTACAGTCATCACTGTGATAA	0.277													3	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141104223	141104224	+	Intron	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141104223_141104224delCA	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTGTTTTTGCACACACACACA	0.307										TSP Lung(27;0.18)			4	2	---	---	---	---	
MMADHC	27249	broad.mit.edu	37	2	150443936	150443936	+	5'UTR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150443936delA	uc002txb.2	-	1					MMADHC_uc002txc.2_Intron|MMADHC_uc010fnu.2_Intron	NM_015702	NP_056517	Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency)							mitochondrion				central_nervous_system(1)|skin(1)	2						CTGGGTGGCCAAAATTCAGTC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168439116	168439116	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168439116delT								XIRP2 (322857 upstream) : B3GALT1 (236066 downstream)																							catttttcccttttttatttt	0.000													4	2	---	---	---	---	
DCAF17	80067	broad.mit.edu	37	2	172305520	172305520	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172305520delT	uc002ugx.2	+						DCAF17_uc010zdq.1_Intron|DCAF17_uc010fqf.1_Intron|DCAF17_uc010zdr.1_Intron	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						ATCAtttgtcttttttttttc	0.164													4	3	---	---	---	---	
CDCA7	83879	broad.mit.edu	37	2	174223262	174223262	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174223262delA	uc002uid.1	+						CDCA7_uc002uic.1_Intron|CDCA7_uc010zej.1_Intron|CDCA7_uc010zek.1_Intron	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2						regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			tgcttcttacaaaaaaaagaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174902053	174902053	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174902053delA								SP3 (71990 upstream) : OLA1 (35123 downstream)																							TTTTGATGGGAAGAGAAGGGC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192752768	192752769	+	IGR	DEL	TA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192752768_192752769delTA								SDPR (40787 upstream) : TMEFF2 (61980 downstream)																							CTGTTTAAACTATAGTAAATAA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	195206229	195206229	+	5'Flank	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195206229delA	uc002utf.1	+											Homo sapiens, clone IMAGE:5242593, mRNA.																		TGTCCATGAGAAAAAAAAAAT	0.383													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203661859	203661860	+	Intron	INS	-	TGTGTATATA	TGTGTATATA			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203661859_203661860insTGTGTATATA	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						tCACATTtgtgtgtgtgtgtgt	0.218													4	3	---	---	---	---	
NRP2	8828	broad.mit.edu	37	2	206596420	206596420	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206596420delG	uc002vaw.2	+						NRP2_uc002vat.2_Intron|NRP2_uc002vau.2_Intron|NRP2_uc002vav.2_Intron|NRP2_uc002vax.2_Intron|NRP2_uc002vay.2_Intron|NRP2_uc010fud.2_Intron	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor						angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GAAGAAATTTGGGCTAAAAGA	0.473													4	2	---	---	---	---	
MAP2	4133	broad.mit.edu	37	2	210564194	210564194	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210564194delG	uc002vde.1	+						MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Intron	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	ACAAGGGATTGTTTTAAATCA	0.333													4	2	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	214630506	214630506	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214630506delT	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GGGGGTTCTGTTTTTGGTAAT	0.328													4	2	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	214908249	214908250	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214908249_214908250insT	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TCTCTTTTGTATTTTTTTCTAA	0.178													4	2	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216197390	216197391	+	Intron	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216197390_216197391delAC	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	AAAATCTGATACACACACACAC	0.297			T	ALK	ALCL								4	2	---	---	---	---	
WNT10A	80326	broad.mit.edu	37	2	219756797	219756797	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219756797delT	uc002vjd.1	+							NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCATTCTGTATTAGGTAGAGC	0.567													4	2	---	---	---	---	
SLC23A3	151295	broad.mit.edu	37	2	220028426	220028426	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220028426delT	uc010zks.1	-						NHEJ1_uc002vjp.3_5'Flank|NHEJ1_uc002vjq.3_Intron|SLC23A3_uc010zkr.1_Intron|SLC23A3_uc010fwb.2_Intron	NM_001144889	NP_001138361	Q6PIS1	S23A3_HUMAN	solute carrier family 23 (nucleobase						transmembrane transport	integral to membrane	protein binding|transporter activity				0		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		gtttttttggtttttttttga	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229377115	229377115	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229377115delT								SPHKAP (330754 upstream) : PID1 (511575 downstream)																							CACTATCTCATTTTTCAAGTC	0.259													4	2	---	---	---	---	
TRPM8	79054	broad.mit.edu	37	2	234852616	234852617	+	Intron	INS	-	T	T	rs111991806		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234852616_234852617insT	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AGTGGGAGGTGTTTTTTTTTGT	0.198													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236450862	236450862	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236450862delG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						AGTGGGTCCCGGGGGGGGGCC	0.527													4	2	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238554271	238554271	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238554271delA	uc002vxc.2	+							NM_001137550	NP_001131022	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TTCTTTTGGGAGGTGTGGTGG	0.423													4	2	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238554274	238554274	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238554274delT	uc002vxc.2	+							NM_001137550	NP_001131022	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TTTTGGGAGGTGTGGTGGCTA	0.413													4	2	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	241982862	241982862	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241982862delT	uc002wah.1	+							NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		aaataaagacttttttacaca	0.000													4	2	---	---	---	---	
FBLN2	2199	broad.mit.edu	37	3	13596013	13596014	+	Intron	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13596013_13596014delCA	uc011avb.1	+						FBLN2_uc011auz.1_Intron|FBLN2_uc011ava.1_Intron	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TGCGCGTGCCCACACACACGTT	0.436													4	2	---	---	---	---	
PXK	54899	broad.mit.edu	37	3	58395501	58395502	+	Intron	INS	-	A	A	rs74477836		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58395501_58395502insA	uc003djz.1	+						PXK_uc003djx.1_Intron|PXK_uc003djy.1_Intron|PXK_uc003dka.1_Intron|PXK_uc003dkb.1_Intron|PXK_uc003dkc.1_Intron|PXK_uc011bfe.1_Intron|PXK_uc010hnj.1_Intron|PXK_uc003dkd.1_Intron|PXK_uc010hnk.1_Intron	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase						cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TTTTTTTGGGGAAAAAAAAAGA	0.406													3	3	---	---	---	---	
KCTD6	200845	broad.mit.edu	37	3	58478440	58478441	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58478440_58478441delTG	uc003dkj.3	+						KCTD6_uc003dki.3_Intron	NM_001128214	NP_001121686	Q8NC69	KCTD6_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		TGCCTAGATTTGTGTGTGTGTG	0.505													4	4	---	---	---	---	
UBA3	9039	broad.mit.edu	37	3	69114407	69114407	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69114407delC	uc003dno.2	-						UBA3_uc003dnq.2_Intron|UBA3_uc011bfy.1_Intron|UBA3_uc011bfz.1_Intron	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1						protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		ACCAACTCTTCCTTTTTCCCT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70084664	70084664	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70084664delT								MITF (67178 upstream) : FOXP1 (920073 downstream)																							agggtggccattttagaattc	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72335118	72335119	+	IGR	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72335118_72335119insA								PROK2 (500761 upstream) : RYBP (88632 downstream)																							tgcttaaccagaaaaaaaaata	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98052943	98052943	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98052943delC								OR5H2 (50267 upstream) : OR5K4 (19755 downstream)																							TCTAATTACACCCCCCATGCC	0.368													4	2	---	---	---	---	
ALCAM	214	broad.mit.edu	37	3	105083060	105083060	+	5'Flank	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105083060delA	uc003dvx.2	+						ALCAM_uc003dvv.2_5'Flank|ALCAM_uc003dvw.1_5'Flank|ALCAM_uc003dvy.2_5'Flank	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						TCGCCCCACCAAAAAAACCAT	0.284													4	2	---	---	---	---	
BBX	56987	broad.mit.edu	37	3	107354563	107354563	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107354563delT	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TATTTTCATCttttttttttt	0.134													3	3	---	---	---	---	
CD96	10225	broad.mit.edu	37	3	111373488	111373488	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111373488delG	uc010hpy.1	+							NM_005816	NP_005807	P40200	TACT_HUMAN	CD96 antigen isoform 2 precursor						cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						GAGGGACACTGGGGGGAATAA	0.463									Opitz_Trigonocephaly_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127107089	127107089	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127107089delC	uc003ejj.2	-											Homo sapiens, clone IMAGE:4618125, mRNA.																		CCCAACTCATCCCCCGGCTTC	0.567													4	2	---	---	---	---	
PIK3R4	30849	broad.mit.edu	37	3	130435653	130435654	+	Intron	INS	-	AT	AT	rs140280328	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130435653_130435654insAT	uc003enj.2	-							NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4						fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						CTAGACCACACGTGTGTCTGTC	0.351													2	4	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132245504	132245504	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132245504delA	uc003eor.2	+							NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						TCCTCTTTGGAAAAATTCATT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141995090	141995091	+	IGR	DEL	TG	-	-	rs71629533		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141995090_141995091delTG								GK5 (50662 upstream) : XRN1 (30360 downstream)																							tgtctgtgtttgtgtgtgtgtg	0.257													4	2	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142322700	142322700	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142322700delA	uc010huv.2	+							NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						AGCTGACCACAAAAAAAAAGG	0.343													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147607716	147607717	+	IGR	DEL	GA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147607716_147607717delGA								ZIC1 (473212 upstream) : AGTR1 (807941 downstream)																							atatattcaggaaaggcaagtg	0.158													4	2	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148858603	148858603	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148858603delG	uc003ewu.1	+						HPS3_uc003ewt.1_Intron|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			tttgtaaaatggggatgataa	0.000									Hermansky-Pudlak_syndrome				4	2	---	---	---	---	
SMC4	10051	broad.mit.edu	37	3	160120174	160120174	+	Intron	DEL	T	-	-	rs113729813		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160120174delT	uc003fdh.2	+						IFT80_uc003fda.2_Intron|IFT80_uc011boy.1_5'Flank|IFT80_uc003fdd.1_5'Flank|IFT80_uc003fde.1_5'Flank|SMC4_uc003fdf.1_Intron|SMC4_uc003fdg.1_Intron|SMC4_uc010hwc.1_Intron|SMC4_uc003fdi.2_Intron|SMC4_uc003fdj.2_Intron|SMC4_uc010hwd.2_Intron|uc011boz.1_5'Flank|MIR15B_hsa-mir-15b|MI0000438_5'Flank|uc003fdk.2_5'Flank|MIR16-2_hsa-mir-16-2|MI0000115_5'Flank	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCTTGGATAATTTTTTTTTCT	0.318													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163717004	163717004	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163717004delT								None (None upstream) : MIR1263 (172255 downstream)																							ATGCTCTCCCTTTTCCAGCCA	0.398													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168963106	168963106	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168963106delG	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CCACAAGATAGAAGAAAAATT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182227090	182227093	+	IGR	DEL	AGCA	-	-	rs116532281	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182227090_182227093delAGCA								SOX2OT (768087 upstream) : ATP11B (284198 downstream)																							GTTCTTCCATAGCAAGCAAGCAAG	0.466													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188431177	188431178	+	Intron	INS	-	A	A	rs11445187		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188431177_188431178insA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		aattctggatgaaaaaaaaaaa	0.000			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4973950	4973950	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4973950delG								MSX1 (108292 upstream) : CYTL1 (42366 downstream)																							caccctgtgtggacacagcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8169872	8169872	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8169872delC								ABLIM2 (9313 upstream) : SH3TC1 (31188 downstream)																							agtctggcttcccccacagcc	0.104													4	2	---	---	---	---	
SLC2A9	56606	broad.mit.edu	37	4	10013292	10013295	+	Intron	DEL	AGAC	-	-	rs3834235		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10013292_10013295delAGAC	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						AGGATGTTTtagacagacaggtaa	0.304													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17438910	17438910	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17438910delC								LDB2 (538486 upstream) : QDPR (49110 downstream)																							ctccaaccatcccatccaaac	0.000													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20544483	20544486	+	Intron	DEL	GTGC	-	-	rs10546726	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20544483_20544486delGTGC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						gtgtgtgtgtgtgCGctataagat	0.103													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21816417	21816417	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21816417delC	uc003gqi.1	-							NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GGTAATGTTTCCCCCAGGCAT	0.453													4	2	---	---	---	---	
NMU	10874	broad.mit.edu	37	4	56462530	56462530	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56462530delT	uc003hbc.2	-							NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		ATTTTGGAGGTTTTTTTTTTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57603723	57603723	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57603723delC								HOPX (55851 upstream) : SPINK2 (72311 downstream)																							GTAACATCCTCATGGCAAGGC	0.483													4	2	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62339747	62339747	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62339747delA	uc003hcq.3	+						LPHN3_uc010ihg.1_Intron			Q9HAR2	LPHN3_HUMAN	RecName: Full=Latrophilin-3; AltName: Full=Calcium-independent alpha-latrotoxin receptor 3; AltName: Full=Lectomedin-3; Flags: Precursor;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TTTGCAGAGGAAAAAAAAAAT	0.303													4	2	---	---	---	---	
RASSF6	166824	broad.mit.edu	37	4	74482831	74482831	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74482831delT	uc003hhd.1	-						RASSF6_uc003hhc.1_Intron|RASSF6_uc010iik.1_Intron|RASSF6_uc010iil.1_Intron	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6						apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TTAAGTAATATTGGTTGCAGT	0.308													4	2	---	---	---	---	
MTHFD2L	441024	broad.mit.edu	37	4	75008867	75008867	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75008867delA	uc003hhn.1	+						MTHFD2L_uc011cbj.1_Intron|MTHFD2L_uc003hho.2_Intron	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase 2-like						folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)			ACAAACAAACAAAAAAAACAA	0.378													4	2	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76530541	76530542	+	Intron	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76530541_76530542delAC	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron|CDKL2_uc010iix.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ccatctcaaaacacacacacac	0.114													5	3	---	---	---	---	
FAM175A	84142	broad.mit.edu	37	4	84398556	84398556	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84398556delA	uc003hou.2	-						FAM175A_uc003hov.2_Intron	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						TGTCCGAACCAAAAAAAAAAA	0.343													2	5	---	---	---	---	
MAPK10	5602	broad.mit.edu	37	4	87039086	87039086	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87039086delA	uc003hpq.2	-						MAPK10_uc010ikg.2_Intron|MAPK10_uc003hpr.2_Intron|MAPK10_uc003hps.2_Intron|MAPK10_uc003hpt.2_Intron|MAPK10_uc003hpu.2_Intron|MAPK10_uc003hpv.2_Intron|MAPK10_uc010ikh.1_Intron|uc003hpw.2_5'Flank	NM_138982	NP_620448	P53779	MK10_HUMAN	mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		tatgttctggaaatctgatgg	0.000													4	2	---	---	---	---	
AFF1	4299	broad.mit.edu	37	4	88056446	88056446	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88056446delT	uc003hqj.3	+						AFF1_uc011ccz.1_Intron|AFF1_uc003hqk.3_Intron|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TGCTTTTAACTTTTTTTTTTC	0.269													4	2	---	---	---	---	
HERC3	8916	broad.mit.edu	37	4	89627723	89627723	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89627723delT	uc003hrw.1	+						HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GATTGAGGCCTTTTTTTTTTC	0.388											OREG0016265	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96164986	96164987	+	Intron	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96164986_96164987delAC	uc003htp.1	-						UNC5C_uc010ilc.1_Intron|UNC5C_uc003htq.2_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAAAACACTGACACACACACAC	0.366													4	2	---	---	---	---	
TSPAN5	10098	broad.mit.edu	37	4	99551048	99551049	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99551048_99551049insT	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		CTTCCCTTTCAAAAAAAAGTAT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101574574	101574574	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101574574delA								EMCN (135324 upstream) : PPP3CA (370013 downstream)																							TTACAACATTAAAAAAAATTA	0.333													4	2	---	---	---	---	
CENPE	1062	broad.mit.edu	37	4	104072714	104072714	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104072714delT	uc003hxb.1	-						CENPE_uc003hxc.1_Intron	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E						blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AAGAATCTGCTTTTTATACTG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	114743438	114743438	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114743438delT								CAMK2D (60355 upstream) : ARSJ (78002 downstream)																							tgtgtgtatatttttttccct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	122927553	122927553	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122927553delG								TRPC3 (54644 upstream) : KIAA1109 (164205 downstream)																							GGTGTGTGGAGGGGGCACTGG	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160367968	160367968	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160367968delG								RAPGEF2 (86669 upstream) : None (None downstream)																							GGTCTGGAGTGGGGTGCCCCT	0.542											OREG0016383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	165085502	165085502	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165085502delA	uc003iqs.1	-							NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				gcttgttcagaaaaaaaaatt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	167266395	167266395	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167266395delT								TLL1 (241402 upstream) : SPOCK3 (388141 downstream)																							ACATTTGCTATTTTTTTGTTA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185783316	185783316	+	IGR	DEL	T	-	-	rs10577364		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185783316delT								ACSL1 (36101 upstream) : HELT (156679 downstream)																							tgtgtgtgtgtgtgaacattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	186039119	186039119	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186039119delC								HELT (97161 upstream) : SLC25A4 (25279 downstream)																							caacactattcaacacagcat	0.139													4	2	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186242257	186242258	+	Intron	DEL	AT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186242257_186242258delAT	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGAGATTGAATTTAGTTTTGG	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276385	3276385	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276385delA								C5orf38 (520873 upstream) : IRX1 (319783 downstream)																							ggaaggagggagaggatgaag	0.000													8	4	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5180370	5180370	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5180370delA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc003jdj.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						AAAATCACTGAAAAAAAAATC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12931410	12931410	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12931410delC								None (None upstream) : DNAH5 (759027 downstream)																							ggcggtgattccccctcggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15305207	15305207	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15305207delC								ANKH (433320 upstream) : FBXL7 (195098 downstream)																							AAATGCAGTGCCCAGTGGGAG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20178612	20178612	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20178612delA								CDH18 (190305 upstream) : None (None downstream)																							TCTAATTAAGAAAAAAAAAAA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25144190	25144190	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25144190delA								CDH10 (499279 upstream) : None (None downstream)																							ATATGTAGTTAAAAAAAAAAA	0.294													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30175147	30175147	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30175147delT								None (None upstream) : None (None downstream)																							tgattcaatcttgtttcatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34532998	34532999	+	IGR	INS	-	GT	GT			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34532998_34532999insGT								C1QTNF3 (489681 upstream) : RAI14 (123434 downstream)																							TAGTTTTCTGAGTGTGAGAGTG	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61140257	61140258	+	IGR	DEL	GA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61140257_61140258delGA								FLJ37543 (137895 upstream) : KIF2A (461731 downstream)																							aaacagtttggagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78858831	78858831	+	IGR	DEL	A	-	-	rs111435603	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78858831delA								HOMER1 (49131 upstream) : PAPD4 (49412 downstream)																							CAGATAAAAGAAAAAAAAAAG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92016483	92016484	+	IGR	DEL	TT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92016483_92016484delTT								None (None upstream) : FLJ42709 (728581 downstream)																							atcaagactctttttctctcaa	0.050													4	2	---	---	---	---	
LNPEP	4012	broad.mit.edu	37	5	96321463	96321464	+	Intron	DEL	TT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96321463_96321464delTT	uc003kmv.1	+						LNPEP_uc003kmw.1_Intron	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TCTTTTTTTGTTTTTTTTTTTT	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98447466	98447467	+	IGR	INS	-	T	T	rs138847903	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98447466_98447467insT								CHD1 (185228 upstream) : None (None downstream)																							CATAACAAATGTTTTTTTTTTA	0.218													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99042388	99042388	+	IGR	DEL	A	-	-	rs58483730		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99042388delA								CHD1 (780150 upstream) : LOC100133050 (672821 downstream)																							attaacaaagagttgggcaac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103076277	103076277	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103076277delA								NUDT12 (177787 upstream) : None (None downstream)																							cagatggtctacaggacttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	106063575	106063575	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106063575delT								None (None upstream) : EFNA5 (649016 downstream)																							aagctaccagttttttcccct	0.030													4	2	---	---	---	---	
MAN2A1	4124	broad.mit.edu	37	5	109092808	109092808	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109092808delT	uc003kou.1	+							NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		cttttgcagatttttttttct	0.000													4	2	---	---	---	---	
C5orf13	9315	broad.mit.edu	37	5	111155918	111155918	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111155918delA	uc011cvr.1	-						C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947	Q16612	NP311_HUMAN	neuronal protein 3.1 isoform c							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		aatagatcacaaaaaaaaagt	0.040													4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112508574	112508574	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112508574delT	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ATATCACATATTTTTTTTTTG	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117408650	117408651	+	IGR	DEL	AT	-	-	rs145903316		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117408650_117408651delAT								None (None upstream) : DTWD2 (763920 downstream)																							GTAACTCTCCATATTATTAATA	0.322													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117734782	117734782	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117734782delT								None (None upstream) : DTWD2 (437789 downstream)																							AGATGCTTTCTAAGACACAGA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123925838	123925838	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123925838delA								CSNK1G3 (973376 upstream) : ZNF608 (46772 downstream)																							tcttcactctaaaaacctccc	0.000													4	2	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126705173	126705173	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126705173delA	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGTATTATGTAAAAAAAATCA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	127164106	127164106	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127164106delT								CTXN3 (169785 upstream) : FLJ33630 (112029 downstream)																							ACAAAAGAGGTTCATTAGAAG	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135922300	135922300	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135922300delA								TRPC7 (229227 upstream) : SPOCK1 (388688 downstream)																							GAGAACAAATAAAAAAAAGAC	0.333													4	2	---	---	---	---	
SPOCK1	6695	broad.mit.edu	37	5	136432881	136432881	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136432881delG	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGGCCACTGGGGGGTAGAC	0.507													4	2	---	---	---	---	
BRD8	10902	broad.mit.edu	37	5	137503496	137503496	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137503496delA	uc003lcf.1	-						BRD8_uc003lcc.1_Intron|BRD8_uc011cyl.1_5'Flank|BRD8_uc003lcg.2_Intron|BRD8_uc003lci.2_Intron|BRD8_uc003lch.2_Intron|BRD8_uc011cym.1_Intron|BRD8_uc010jer.1_Intron|BRD8_uc011cyn.1_Intron|BRD8_uc010jes.1_3'UTR	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGTAGCTCCAAAAAAAAGTT	0.378													4	3	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139323750	139323750	+	Intron	DEL	A	-	-	rs34819431		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139323750delA	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tacgatctttaaaaaaaaaat	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141278114	141278114	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141278114delT								PCDH1 (20170 upstream) : KIAA0141 (25271 downstream)																							CAACACTGACTTTTTTTTTCT	0.124													4	2	---	---	---	---	
SH3RF2	153769	broad.mit.edu	37	5	145439175	145439176	+	Intron	INS	-	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145439175_145439176insC	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron|SH3RF2_uc011dbm.1_Intron|SH3RF2_uc003lnu.2_Intron|SH3RF2_uc011dbn.1_Intron|SH3RF2_uc011dbo.1_5'Flank	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTTCTGACAGCCCCCCTacac	0.302													4	2	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145857749	145857749	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145857749delG	uc003lob.2	+						TCERG1_uc003loc.2_Intron|TCERG1_uc011dbt.1_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATTCTTTCTGATAGTTTAAA	0.308													4	2	---	---	---	---	
SPINK14	408187	broad.mit.edu	37	5	147548220	147548220	+	5'Flank	DEL	G	-	-	rs56223812		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147548220delG	uc003loz.1	+							NM_001001325	NP_001001325	Q6IE38	ISK14_HUMAN	Kazal type serine protease inhibitor 5-like 2							extracellular region	serine-type endopeptidase inhibitor activity				0						TACTGTTCCTGTTCCATTTCT	0.498													2	5	---	---	---	---	
CSF1R	1436	broad.mit.edu	37	5	149486401	149486402	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149486401_149486402insT	uc003lrm.2	-							NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor						cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GCCCATAAGCCTCCCTTTGCCT	0.520													4	2	---	---	---	---	
TNIP1	10318	broad.mit.edu	37	5	150447135	150447135	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150447135delA	uc003ltf.2	-						TNIP1_uc010jhm.2_5'Flank|TNIP1_uc010jhn.2_5'Flank|TNIP1_uc011dco.1_Intron|TNIP1_uc003lth.2_Intron|TNIP1_uc003lti.2_Intron|TNIP1_uc003ltg.2_Intron|TNIP1_uc003ltj.2_Intron|TNIP1_uc010jhr.1_Intron|TNIP1_uc003ltk.2_Intron|TNIP1_uc010jhs.1_Intron	NM_006058	NP_006049	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1						defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATTCACCCTAAATGGAACTC	0.353													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168164461	168164462	+	Intron	DEL	CA	-	-	rs80300182	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168164461_168164462delCA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGTGCTGTGcacacacacaca	0.441													2	4	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168633063	168633063	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168633063delA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAATAAAAGGAAAAAGCAGAT	0.463													4	2	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169461229	169461230	+	Intron	INS	-	A	A	rs138978757	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169461229_169461230insA	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tctgatgttagaaaaaaaatTG	0.183													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173213253	173213255	+	IGR	DEL	CTC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173213253_173213255delCTC								BOD1 (169587 upstream) : CPEB4 (102076 downstream)																							gaattaagagCTCCTCAGTGTCT	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173638214	173638214	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173638214delA								HMP19 (102033 upstream) : MSX2 (513361 downstream)																							gtgcttaTTGAAAAAAAAAAA	0.199													5	4	---	---	---	---	
CDHR2	54825	broad.mit.edu	37	5	176018960	176018961	+	Intron	INS	-	GAT	GAT	rs147306326	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176018960_176018961insGAT	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						gtgatgatgacggtggtggtgg	0.000													8	7	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178554751	178554751	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178554751delT	uc003mjw.2	-							NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CCACACACCCTTTGGCCACAT	0.617													4	2	---	---	---	---	
BTNL9	153579	broad.mit.edu	37	5	180470293	180470294	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180470293_180470294delTG	uc003mmt.2	+						BTNL9_uc011dhi.1_Intron	NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor							integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			tgtgtgtgtctgtgtgtgtgtg	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9332949	9332949	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9332949delT								HULC (678872 upstream) : None (None downstream)																							TTGTTTTTTGTTTTTTTTTTT	0.313													4	2	---	---	---	---	
ELOVL2	54898	broad.mit.edu	37	6	11045961	11045962	+	5'Flank	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11045961_11045962insA	uc003mzp.3	-						uc003mzq.1_Intron	NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			TATTTGTTTATAAAAGGCGGAT	0.243													4	2	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	21152653	21152653	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21152653delA	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			taataagggtatactcttgag	0.179													4	2	---	---	---	---	
C6orf134	79969	broad.mit.edu	37	6	30602033	30602033	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30602033delT	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0						GTTAGGGTCAttttttttttc	0.119													6	3	---	---	---	---	
CCHCR1	54535	broad.mit.edu	37	6	31112818	31112826	+	In_Frame_Del	DEL	CCACCTTGC	-	-	rs2073720		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31112818_31112826delCCACCTTGC	uc003nsr.3	-	14	1757_1765	c.1634_1642delGCAAGGTGG	c.(1633-1644)AGCAAGGTGGCC>ACC	p.545_548SKVA>T	CCHCR1_uc011dne.1_In_Frame_Del_p.545_548SKVA>T|CCHCR1_uc003nsq.3_In_Frame_Del_p.598_601SKVA>T|CCHCR1_uc003nsp.3_In_Frame_Del_p.634_637SKVA>T|CCHCR1_uc010jsk.1_In_Frame_Del_p.545_548SKVA>T	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	545_548	Potential.				cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						AGCTGCTGGGCCACCTTGCTCAGCTGCTG	0.656													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32345008	32345010	+	IGR	DEL	AAG	-	-	rs145612252		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32345008_32345010delAAG								C6orf10 (5352 upstream) : BTNL2 (17503 downstream)																							gtgggaggaaaagaagaagcaag	0.000													4	3	---	---	---	---	
KIFC1	3833	broad.mit.edu	37	6	33367780	33367780	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33367780delT	uc003oef.3	+						KIFC1_uc011drf.1_Intron|uc011drg.1_RNA	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1						blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						TTTTTTTAACTTTTTTTTTTC	0.254													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	46941655	46941656	+	IGR	DEL	GA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46941655_46941656delGA								GPR116 (18980 upstream) : GPR110 (26158 downstream)																							GACATCTCCTGAGACAAGGAAA	0.475													4	2	---	---	---	---	
GPR110	266977	broad.mit.edu	37	6	46969278	46969278	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46969278delT	uc003oyt.2	-	14	2818	c.2619delA	c.(2617-2619)AAAfs	p.K873fs	GPR110_uc011dwl.1_Frame_Shift_Del_p.K561fs	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	873	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						AGAATTTGGGTTTGGCAGATA	0.338													752	390	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57304140	57304141	+	Intron	INS	-	TG	TG	rs113443807		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57304140_57304141insTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTGAATTATTTTACTACCTTTG	0.292													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57488800	57488800	+	Intron	DEL	G	-	-	rs111409818		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57488800delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttggttGACAGtttttttttt	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	67995194	67995194	+	IGR	DEL	T	-	-	rs35096592		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67995194delT								None (None upstream) : None (None downstream)																							ttcaaaccactagcaactact	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	69093411	69093411	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69093411delT								None (None upstream) : BAI3 (252221 downstream)																							aaaatctttatttttccttca	0.000													4	2	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74115593	74115594	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74115593_74115594insT	uc003pgw.2	+						DDX43_uc011dyn.1_Intron	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						TTCACTCAATGTTTTTCTTCGA	0.366													34	25	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74490730	74490731	+	Intron	INS	-	TA	TA	rs145114558		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74490730_74490731insTA	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						atgtgtatgcgtgtgtgtgtgt	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	78973110	78973110	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78973110delC								HTR1B (799990 upstream) : IRAK1BP1 (604079 downstream)																							TTTTTTTTTTCTTAACTTTCA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80257503	80257503	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80257503delA								LCA5 (10356 upstream) : SH3BGRL2 (83497 downstream)																							cagtgattagaaaaaaaaatg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	84499465	84499465	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84499465delA								SNAP91 (80338 upstream) : RIPPLY2 (63520 downstream)																							AAATTTTTGCATGTAAATCCA	0.303													4	2	---	---	---	---	
RNGTT	8732	broad.mit.edu	37	6	89624346	89624346	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89624346delA	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron|RNGTT_uc003pmt.2_Intron	NM_003800	NP_003791	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		caccatatacaaaaaaaaagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95176429	95176429	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95176429delA								TSG1 (690230 upstream) : MANEA (848984 downstream)																							GAAAGGGCATAAAAAACAAGA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98559889	98559889	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98559889delA								MIR2113 (87392 upstream) : POU3F2 (722691 downstream)																							acagtaatagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
PREP	5550	broad.mit.edu	37	6	105817054	105817054	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105817054delA	uc003prc.2	-							NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	atataccagcaacgaacaagt	0.085													29	19	---	---	---	---	
FYN	2534	broad.mit.edu	37	6	112165161	112165161	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112165161delA	uc003pvk.2	-							NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a						axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	TACGAAACTTAAAAAAAAATA	0.428													4	2	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124712346	124712346	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124712346delG	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		AGTAGTATCAGGTAAAGCTCC	0.353													4	2	---	---	---	---	
C6orf174	387104	broad.mit.edu	37	6	127833449	127833450	+	Intron	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127833449_127833450insA	uc003qbd.2	-							NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		atatatcatgtaaaaaaaaaag	0.000													4	2	---	---	---	---	
SAMD3	154075	broad.mit.edu	37	6	130468757	130468758	+	Intron	INS	-	A	A	rs72554156		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130468757_130468758insA	uc003qbv.2	-						SAMD3_uc003qbx.2_Intron|SAMD3_uc003qbw.2_Intron	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform											ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		gagctgtagatacaatgcccca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153462043	153462043	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153462043delT								RGS17 (9654 upstream) : OPRM1 (869593 downstream)																							AAACTAAGACTTTTTTTTTCC	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153720199	153720199	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153720199delC								RGS17 (267810 upstream) : OPRM1 (611437 downstream)																							gttcagggtgccataggagca	0.000													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157490505	157490505	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157490505delA	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc010kjl.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GTACGGGGCCAAAAAAAAATC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164197341	164197341	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164197341delA								QKI (202449 upstream) : None (None downstream)																							TTGTGGAGAGAAAAAAAATCC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	170478781	170478782	+	IGR	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170478781_170478782delAC								C6orf208 (275812 upstream) : LOC154449 (84640 downstream)																							acacacacagacacacacacgt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3326983	3326983	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3326983delC								CARD11 (243404 upstream) : SDK1 (14097 downstream)																							TCAACATATGCCCATGTATTC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	8309440	8309440	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8309440delT	uc003srt.1	+											full-length cDNA clone CS0DC002YA18 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																		ctttaaagacttttttttccc	0.000													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	27941164	27941164	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27941164delA	uc003szn.2	-						JAZF1_uc003szm.2_Intron	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						CCTGCTGGGGAAAAAAATCAC	0.453			T	SUZ12	endometrial stromal tumours								4	2	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29487997	29487998	+	Intron	DEL	GA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29487997_29487998delGA	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						CTAGTCATCTGAAGACTTCTAA	0.371													4	2	---	---	---	---	
ZNRF2	223082	broad.mit.edu	37	7	30355443	30355443	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30355443delA	uc003tat.2	+							NM_147128	NP_667339	Q8NHG8	ZNRF2_HUMAN	zinc finger/RING finger 2							cell junction|endosome membrane|lysosomal membrane|presynaptic membrane	ligase activity|zinc ion binding				0						TATCTAACATAAAAAACTGCT	0.393													4	2	---	---	---	---	
NOD1	10392	broad.mit.edu	37	7	30493637	30493637	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30493637delT	uc003tav.2	-						NOD1_uc010kvs.2_Intron	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain						activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						GAATACTTTCTTTTTTTTTCA	0.463													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34120610	34120610	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34120610delT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						TTACAATTTCTTTTTTTTTTC	0.343													4	2	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35028587	35028587	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35028587delG	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						cctatgaggtgggtaacatca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35519190	35519190	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35519190delG								TBX20 (225948 upstream) : HERPUD2 (153082 downstream)																							tgagagtgaaggagtgaaaaa	0.000													4	2	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39274089	39274090	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39274089_39274090insT	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						GGATTTAGTGATTTTTTTTTTC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46792620	46792621	+	IGR	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46792620_46792621insA								IGFBP3 (831749 upstream) : TNS3 (522132 downstream)																							TGCACAGAAAGAAAAAAAAAAC	0.347													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54501301	54501301	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54501301delG								HPVC1 (231187 upstream) : VSTM2A (108718 downstream)																							ggagcaggctgggggttgact	0.000													4	2	---	---	---	---	
VOPP1	81552	broad.mit.edu	37	7	55625156	55625156	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55625156delA	uc003tqs.2	-						VOPP1_uc011kcr.1_Intron	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						AAGATGTTTCAAAAAAAAAAA	0.269													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56699457	56699457	+	IGR	DEL	A	-	-	rs78077053		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56699457delA								DKFZp434L192 (134480 upstream) : ZNF479 (487871 downstream)																							TTCATAGTCCAAAAAAAAAAT	0.294													21	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57768830	57768831	+	IGR	INS	-	T	T	rs144648722		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57768830_57768831insT								ZNF716 (235565 upstream) : None (None downstream)																							ATAATATCTTATTCTTTCTGAC	0.238													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61825815	61825815	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61825815delC								None (None upstream) : LOC643955 (925857 downstream)																							tgtctgacagctttgaagaga	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63316906	63316906	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63316906delA								LOC100287704 (504755 upstream) : ZNF727 (188915 downstream)																							TGAACTGCACAaaaaaaaaca	0.194													3	5	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69124749	69124749	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69124749delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ATCCCAGAGATTTCATCGTTT	0.254													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69521569	69521569	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69521569delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TAGAAGAATGTTAGTGCAGAG	0.428													4	2	---	---	---	---	
WBSCR16	81554	broad.mit.edu	37	7	74470293	74470293	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74470293delT	uc003ubr.2	-						WBSCR16_uc010lca.2_Intron|WBSCR16_uc010lcb.1_Intron	NM_030798	NP_110425	Q96I51	WBS16_HUMAN	Williams-Beuren syndrome chromosome region 16												0						tttttttttgttttttttttg	0.368													4	2	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82388111	82388113	+	Intron	DEL	ATT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82388111_82388113delATT	uc003uhx.2	-							NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTTAAGGACATTTAATCATCAA	0.320													14	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84942535	84942535	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84942535delT								SEMA3D (126364 upstream) : None (None downstream)																							GAATTCCATATTTTTTTCTGA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	87834023	87834023	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87834023delG								ADAM22 (7576 upstream) : SRI (409 downstream)																							AGCACACCTTGGGACTTGTTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91184221	91184234	+	IGR	DEL	GCTGAATGCCTCAC	-	-	rs6150230		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91184221_91184234delGCTGAATGCCTCAC								FZD1 (286090 upstream) : MTERF (247226 downstream)																							GAAACAGATTGCTGAATGCCTCACGCTGAATGCC	0.491													4	2	---	---	---	---	
SLC25A13	10165	broad.mit.edu	37	7	95820705	95820705	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95820705delA	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	CTTTTGCATTAAAAAAAAGCT	0.274													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96724195	96724195	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96724195delA								DLX5 (70052 upstream) : ACN9 (21710 downstream)																							ATTAAGGGGGAAAAAAAAAAG	0.403													4	2	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98618900	98618901	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98618900_98618901insT	uc003ups.2	+									Q9Y4A5	TRRAP_HUMAN	Homo sapiens TRRAP protein (TRRAP) mRNA, complete cds.						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			aaacacacaccaagacacttca	0.000													4	2	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99782538	99782538	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99782538delT	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ttttactaggttttattgtga	0.000													4	2	---	---	---	---	
PSMC2	5701	broad.mit.edu	37	7	103002873	103002873	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103002873delA	uc003vbs.2	+						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011kln.1_3'UTR|PSMC2_uc011klo.1_Intron	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						TAGAATACATAACAACTCACT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	103947330	103947331	+	IGR	INS	-	A	A	rs137857635	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103947330_103947331insA								ORC5L (98867 upstream) : LHFPL3 (21773 downstream)																							GAAATAAGAAGAAAAACACACC	0.342													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105501959	105501959	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105501959delA	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						AGTGATGGGGAAAACGCACAG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108936595	108936595	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108936595delC								C7orf66 (411958 upstream) : EIF3IP1 (662689 downstream)																							CAGAGATTTACCCCGTTTTAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	113434951	113434951	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113434951delA								LOC401397 (676314 upstream) : PPP1R3A (81931 downstream)																							acctctcttcaaaaaaaaagc	0.000													4	2	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	113903405	113903405	+	Intron	DEL	T	-	-	rs11437591		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113903405delT	uc003vgu.2	+						FOXP2_uc003vgt.1_Intron			O15409	FOXP2_HUMAN	Homo sapiens full length insert cDNA clone YX52E07.						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						CTTCTTTTTCTTTTTTTTTTT	0.169													3	5	---	---	---	---	
NAA38	51691	broad.mit.edu	37	7	117824531	117824531	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117824531delC	uc003vjg.2	+							NM_016200	NP_057284	O95777	NAA38_HUMAN	U6 snRNA-associated Sm-like protein LSm8						nuclear mRNA splicing, via spliceosome	nucleus|ribonucleoprotein complex	protein binding|U6 snRNA binding				0						CAAATAAAAACCCAGTGTGAT	0.478													4	2	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126341522	126341522	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126341522delT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	tcactggtagttttacaagga	0.104										HNSCC(24;0.065)			4	2	---	---	---	---	
NRF1	4899	broad.mit.edu	37	7	129367029	129367030	+	Intron	INS	-	GC	GC			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129367029_129367030insGC	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						TTGTCTTGGCTGCAGTGCTGTT	0.510													11	5	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	131954424	131954424	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131954424delT	uc003vra.3	-							NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						AAAAAAGATCTTTTTTTTTTT	0.363													7	5	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	132098315	132098316	+	Intron	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132098315_132098316insA	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						AACCTAAACCCAACTCAGAGCA	0.411													4	2	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133649073	133649074	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133649073_133649074insT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				TTTCTCTTGAGTTTtttttttc	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	137554079	137554079	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137554079delA								DGKI (22470 upstream) : CREB3L2 (5648 downstream)																							tctaaaaaagaaaaaggatag	0.000													4	2	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139834360	139834360	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139834360delT	uc003vvm.2	-							NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					GTTTTAAATCTTTTTTTTTTT	0.274													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144222009	144222009	+	Intron	DEL	T	-	-	rs67874797		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144222009delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	GGATCTGCtattttttttttt	0.333													4	3	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146006444	146006444	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146006444delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GAGTACGCTGAAAATGAAGCA	0.488										HNSCC(39;0.1)			4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157832769	157832769	+	Intron	DEL	G	-	-	rs61055570		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157832769delG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		gagagagagagaaaaaaaaag	0.000													4	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157961577	157961584	+	Intron	DEL	TCAAAATG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157961577_157961584delTCAAAATG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTGGGCTTCATCAAAATGTCATGGACAG	0.486													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158791139	158791139	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158791139delC								WDR60 (52257 upstream) : LOC154822 (9906 downstream)																							CCCCTCCACACCCCCCACGTG	0.697													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6778343	6778344	+	IGR	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6778343_6778344delTG								DEFB1 (42814 upstream) : DEFA6 (3877 downstream)																							TGGCTGTCTTTGTGTGTGTGTG	0.569													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6896778	6896778	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6896778delG								DEFA1B (59164 upstream) : DEFA5 (16051 downstream)																							TCTGCATGCTGGCATCTCTCA	0.512													4	2	---	---	---	---	
SGCZ	137868	broad.mit.edu	37	8	14085447	14085448	+	Intron	DEL	TC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14085447_14085448delTC	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CCCCCTAGCTTCTCTCTCTCTC	0.406													4	2	---	---	---	---	
CNOT7	29883	broad.mit.edu	37	8	17102866	17102866	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17102866delA	uc003wxf.1	-						CNOT7_uc003wxg.1_Intron|CNOT7_uc003wxh.1_Intron|CNOT7_uc003wxi.1_5'Flank|VPS37A_uc003wxj.2_5'Flank|VPS37A_uc003wxk.2_5'Flank	NM_013354	NP_037486	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7						carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		cttgactcataaaaaaaaaaa	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21453888	21453888	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21453888delA								None (None upstream) : GFRA2 (95642 downstream)																							tctagcagctaaaagacagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23758484	23758485	+	IGR	INS	-	C	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23758484_23758485insC								STC1 (46164 upstream) : ADAM28 (393095 downstream)																							AGTATTGCTTTCCCCTGTGTTT	0.426													4	2	---	---	---	---	
SCARA5	286133	broad.mit.edu	37	8	27773933	27773934	+	Intron	INS	-	AT	AT	rs145079746	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27773933_27773934insAT	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Intron	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		tatgtgcaaacgtgtacacatg	0.000													2	4	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40489033	40489033	+	Intron	DEL	G	-	-	rs78083042		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40489033delG	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			gcttagaaaagctgagcaact	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49994733	49994733	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49994733delA								C8orf22 (6092 upstream) : SNTG1 (827616 downstream)																							TGGAGAAAGGAGATGTGTGCT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53997683	53997683	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53997683delT								NPBWR1 (144230 upstream) : OPRK1 (140593 downstream)																							TTCTTTGTTGTTTTTTTTTCA	0.373													2	4	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59543849	59543849	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59543849delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TTTTAGGCACTTTTTTTTTTA	0.259													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60977128	60977128	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60977128delA								TOX (945361 upstream) : CA8 (124295 downstream)																							AGTGGGATGTAAAAAAAAAAA	0.458													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61545578	61545578	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61545578delA								RAB2A (11949 upstream) : CHD7 (45761 downstream)																							TTTGCTGAAGAAAAAAAAAAT	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	70042769	70042769	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70042769delT								C8orf34 (311513 upstream) : SULF1 (336090 downstream)																							TTCCTTCCCCTTTTTTTTTCA	0.338													4	3	---	---	---	---	
NCOA2	10499	broad.mit.edu	37	8	71117842	71117842	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71117842delA	uc003xyn.1	-							NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2						cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTGAGAGGGGAAAAAAAAAGA	0.478			T	RUNXBP2	AML								4	2	---	---	---	---	
JPH1	56704	broad.mit.edu	37	8	75222658	75222658	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75222658delA	uc003yae.2	-						JPH1_uc003yaf.2_Intron|JPH1_uc003yag.1_Intron	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GCAGAGGCCTAAAAATAAGTT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77159836	77159836	+	IGR	DEL	T	-	-	rs74726863		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77159836delT								HNF4G (680777 upstream) : LOC100192378 (363279 downstream)																							acttccagaattttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84260203	84260203	+	IGR	DEL	C	-	-	rs11361785		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84260203delC								None (None upstream) : RALYL (835250 downstream)																							AAAAAGGCAGCAGGTAAGTAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88985426	88985426	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88985426delA								DCAF4L2 (99130 upstream) : MMP16 (64036 downstream)																							AGCTCAAAAGAAAAAAACACA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	90888015	90888015	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90888015delT								RIPK2 (84724 upstream) : OSGIN2 (26081 downstream)																							CTGCTAGATATTTATGCTTAA	0.358													4	2	---	---	---	---	
NBN	4683	broad.mit.edu	37	8	90961889	90961889	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90961889delA	uc003yej.1	-						NBN_uc003yei.1_Intron|NBN_uc011lgb.1_Intron	NM_002485	NP_002476	O60934	NBN_HUMAN	nibrin						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GACATGCTATAATCTAAATTT	0.358								Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	91591205	91591206	+	IGR	INS	-	A	A	rs141435296	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91591205_91591206insA								CALB1 (483518 upstream) : TMEM64 (43017 downstream)																							TTTCAACTTGCACCATAAAAAC	0.376													4	2	---	---	---	---	
RBM12B	389677	broad.mit.edu	37	8	94744278	94744278	+	3'UTR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94744278delA	uc003yfz.2	-	3						NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B								nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AATACCACTTAAAAAAgtgag	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97231372	97231372	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97231372delT								GDF6 (58352 upstream) : UQCRB (7938 downstream)																							AAGGAATCTATTTTTTTTTTG	0.075													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97236417	97236417	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97236417delG								GDF6 (63397 upstream) : UQCRB (2893 downstream)																							gtccaatgaagggacaattaa	0.085													4	2	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	120989630	120989630	+	Intron	DEL	A	-	-	rs112346556		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120989630delA	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CTTTGAACAGAAAAAAAAAAG	0.284													4	3	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121163233	121163233	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121163233delA	uc003yox.2	+							NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ttgaaagagtaaaaaaaaaaa	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128269682	128269682	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128269682delG								FAM84B (699216 upstream) : LOC727677 (32380 downstream)																							CTTTAGGGATGGAAGAACTGC	0.443													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129045570	129045571	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129045570_129045571delTG	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						tgtgtgtgcatgtgtgtgtgta	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131769763	131769764	+	IGR	DEL	AG	-	-	rs77193874		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131769763_131769764delAG								ASAP1 (355547 upstream) : ADCY8 (22784 downstream)																							ATTGAGAAAAAGAAAAAGTGTT	0.436													4	2	---	---	---	---	
NDRG1	10397	broad.mit.edu	37	8	134270442	134270443	+	Intron	DEL	TA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134270442_134270443delTA	uc003yuh.2	-						NDRG1_uc003yuf.1_5'Flank|NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			AGGCTGTGAGTATATATATATA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134330601	134330603	+	IGR	DEL	ACC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134330601_134330603delACC								NDRG1 (21054 upstream) : ST3GAL1 (136488 downstream)																							TCCCTCCAGGACCACCACCACCA	0.350													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135244660	135244660	+	IGR	DEL	A	-	-	rs112859771		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135244660delA								ST3GAL1 (660477 upstream) : ZFAT (245373 downstream)																							aggcaaaaagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140275768	140275768	+	IGR	DEL	A	-	-	rs34975833		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140275768delA								COL22A1 (349532 upstream) : KCNK9 (337314 downstream)																							ggaaattaagagcatggtgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140384747	140384747	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140384747delA								COL22A1 (458511 upstream) : KCNK9 (228335 downstream)																							gggctcgcctaatctccccat	0.000													4	2	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141819467	141819467	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141819467delA	uc003yvu.2	-						PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			cttaggcatgaaacaggaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142704001	142704001	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142704001delG								FLJ43860 (186671 upstream) : MIR1302-7 (163602 downstream)																							cctggaacctgggaatatgtt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143788784	143788785	+	IGR	DEL	AT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143788784_143788785delAT								LY6K (3202 upstream) : C8orf55 (19836 downstream)																							ATTCTCCAAAATATATATGCAT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11146129	11146129	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11146129delT								PTPRD (533406 upstream) : None (None downstream)																							aaatgaagccttctgacacct	0.005													4	2	---	---	---	---	
NFIB	4781	broad.mit.edu	37	9	14234213	14234213	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14234213delT	uc003zle.2	-						NFIB_uc003zlf.2_Intron|NFIB_uc011lmo.1_Intron	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		ATTCTCAGCATCAAAAACCAG	0.373			T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								4	2	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													6	4	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	74061038	74061038	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74061038delG	uc004aii.2	-							NM_206948	NP_996831	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ACAAGCACCTGGGATATTCTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77326583	77326583	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77326583delG								RORB (24468 upstream) : TRPM6 (10828 downstream)																							TGAAAACCAAGGGGGAAAGAT	0.408													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82225591	82225592	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82225591_82225592delTG	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						CCGTTTCTGTTGTGTGTGTGTT	0.312													4	2	---	---	---	---	
FRMD3	257019	broad.mit.edu	37	9	86061904	86061908	+	Intron	DEL	TTTTG	-	-	rs72104485		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86061904_86061908delTTTTG	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						AGATCAGGGTttttgttttgttttg	0.224													3	3	---	---	---	---	
NTRK2	4915	broad.mit.edu	37	9	87292377	87292377	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87292377delT	uc004aoa.1	+						NTRK2_uc004anv.1_Intron|NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron|NTRK2_uc011lsz.1_Intron|NTRK2_uc011lta.1_Intron|NTRK2_uc004aob.1_Intron|NTRK2_uc011ltb.1_Intron	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						CTGAGACATATTTTTGGTTGC	0.453										TSP Lung(25;0.17)			4	2	---	---	---	---	
C9orf3	84909	broad.mit.edu	37	9	97515845	97515845	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97515845delA	uc004auy.2	+						C9orf3_uc011lui.1_Intron|C9orf3_uc004aux.1_Intron	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		gctaagaagcaaagaaaatca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	113005134	113005135	+	IGR	DEL	TG	-	-	rs149901112		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113005134_113005135delTG								C9orf152 (34721 upstream) : TXN (1175 downstream)																							ctcaagcctttgtgtctgtcat	0.000													4	2	---	---	---	---	
MUSK	4593	broad.mit.edu	37	9	113490599	113490600	+	Intron	INS	-	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113490599_113490600insG	uc004bey.2	+						MUSK_uc004bex.2_Intron	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						CTAAGCTACAAGGGGGGAACGC	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126960760	126960760	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126960760delG								LHX2 (165318 upstream) : NEK6 (59126 downstream)																							GCTGACCACTGGGGACTTCTG	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3895779	3895780	+	IGR	DEL	CT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3895779_3895780delCT								KLF6 (68306 upstream) : LOC100216001 (725664 downstream)																							CCTAGGTTGCCTCTCTCTCTCC	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10176386	10176386	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10176386delG								None (None upstream) : SFTA1P (650016 downstream)																							AAACTATACTGGAGCAGCTTC	0.408													4	2	---	---	---	---	
ITGA8	8516	broad.mit.edu	37	10	15655388	15655388	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15655388delC	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						TCTCATCTCACCTAGAGCCTA	0.348													4	2	---	---	---	---	
NSUN6	221078	broad.mit.edu	37	10	18931155	18931155	+	Intron	DEL	A	-	-	rs10829067	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18931155delA	uc010qcp.1	-							NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						TGGGGGGGGGAAAACATCACT	0.343													3	5	---	---	---	---	
MLLT10	8028	broad.mit.edu	37	10	21836883	21836883	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21836883delT	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001iqr.1_Intron|MLLT10_uc001iqq.1_Intron|MLLT10_uc001iqu.1_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						tgtgggttcattttttttact	0.015			T	MLL|PICALM|CDK6	AL								4	2	---	---	---	---	
ZEB1	6935	broad.mit.edu	37	10	31765394	31765394	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31765394delA	uc001ivs.3	+						ZEB1_uc001ivr.3_Intron|ZEB1_uc010qee.1_Intron|ZEB1_uc010qef.1_Intron|ZEB1_uc009xlh.1_Intron|ZEB1_uc009xli.1_Intron|ZEB1_uc009xlj.1_Intron|ZEB1_uc010qeg.1_Intron|ZEB1_uc009xlk.1_Intron|ZEB1_uc001ivt.3_Intron|ZEB1_uc001ivu.3_Intron|ZEB1_uc001ivv.3_Intron|ZEB1_uc010qeh.1_Intron|ZEB1_uc009xll.2_Intron|ZEB1_uc009xlm.1_Intron|ZEB1_uc009xln.1_Intron|ZEB1_uc009xlo.1_Intron|ZEB1_uc009xlp.2_Intron	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b						cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				aatcaatagtaaaaaaaaacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33870946	33870946	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33870946delG								NRP1 (246940 upstream) : PARD3 (529152 downstream)																							tgtgcctgctggccttgctct	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35254572	35254572	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35254572delG								PARD3 (150649 upstream) : CUL2 (44236 downstream)																							CCCGGAAGGAGGGAGGCTTTG	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38976170	38976170	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38976170delA								LOC399744 (235090 upstream) : None (None downstream)																							tcattatatgaaaaaaacact	0.000													2	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47022944	47022945	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47022944_47022945delTG	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						tgtgtgcagttgtgtgtgtgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	54499231	54499232	+	IGR	INS	-	G	G	rs143503108	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54499231_54499232insG								DKK1 (421815 upstream) : MBL2 (25909 downstream)																							CTCAGGCTTGTGGGGGGGTTGT	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	59135515	59135516	+	IGR	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59135515_59135516delAC								None (None upstream) : IPMK (820102 downstream)																							acatatacatacacacacacac	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	62872905	62872905	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62872905delT								RHOBTB1 (111707 upstream) : TMEM26 (293496 downstream)																							ctctaccaactttaacttaat	0.000													4	2	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64216604	64216605	+	Intron	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64216604_64216605delCA	uc001jmc.2	+						ZNF365_uc001jmb.3_Intron	NM_199451	NP_955523	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform C											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					cgcacacatgcacacacacaca	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	64814177	64814177	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64814177delT								EGR2 (235250 upstream) : NRBF2 (78830 downstream)																							TATGCTGCTGTTATAATTCTG	0.199													4	2	---	---	---	---	
AP3M1	26985	broad.mit.edu	37	10	75881508	75881508	+	3'UTR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75881508delA	uc001jwf.2	-	9					AP3M1_uc001jwg.2_3'UTR|AP3M1_uc001jwh.2_3'UTR|AP3M1_uc010qla.1_3'UTR	NM_207012	NP_996895	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit						protein targeting to lysosome|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus|lysosome	protein binding				0	Prostate(51;0.0112)					TAGTAGACCTAAAAAAAATCA	0.353													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80968368	80968368	+	Intron	DEL	C	-	-	rs35380943		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80968368delC	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			TTTGGTGTGTCCCCCACGTGC	0.567													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82768325	82768326	+	IGR	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82768325_82768326delCA								SH2D4B (362009 upstream) : NRG3 (866744 downstream)																							gatacacatgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85921607	85921608	+	IGR	INS	-	TA	TA			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85921607_85921608insTA								GHITM (8296 upstream) : C10orf99 (11946 downstream)																							GACAGAAACTCCAGAGAGAGAG	0.515													4	2	---	---	---	---	
CHST15	51363	broad.mit.edu	37	10	125768842	125768843	+	3'UTR	DEL	AG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125768842_125768843delAG	uc001lhl.2	-	7					CHST15_uc001lhm.2_3'UTR|CHST15_uc001lhn.2_3'UTR	NM_015892	NP_056976	Q7LFX5	CHSTF_HUMAN	B cell RAG associated protein						hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1						AAGAGGCAGCAGAGAGAGAGCC	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134711499	134711500	+	Intron	INS	-	CT	CT	rs140536215	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134711499_134711500insCT	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		GCCCCACTCCCGTCCTCCTCCT	0.589													1	5	---	---	---	---	
KNDC1	85442	broad.mit.edu	37	10	135000590	135000590	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135000590delG	uc001llz.1	+						KNDC1_uc001lma.1_Intron	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TTCCTATTCTGACGGTTTAAA	0.597													4	2	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17415623	17415624	+	Intron	DEL	GT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17415623_17415624delGT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	ttgtgtgtgcgtgtgtgtgtgt	0.307													4	2	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	20845485	20845485	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20845485delA	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						aacaagatggaagggtaatac	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22927390	22927390	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22927390delC	uc001mqq.1	+											full-length cDNA clone CS0DJ011YO21 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).																		gtttattcATCCTGCTACCTC	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23782200	23782200	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23782200delG								SVIP (930818 upstream) : LUZP2 (736356 downstream)																							ataacccaatggaaaatttac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55555124	55555124	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55555124delA								OR5D13 (13267 upstream) : OR5D14 (7908 downstream)																							TTGCTGTCATAAAAATGCCTT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59644775	59644775	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59644775delC								TCN1 (10734 upstream) : PLAC1L (162973 downstream)																							gctcttccttcccagatctga	0.139													4	2	---	---	---	---	
FEN1	2237	broad.mit.edu	37	11	61563635	61563636	+	Frame_Shift_Ins	INS	-	AC	AC			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61563635_61563636insAC	uc001nsg.2	+	2	1174_1175	c.802_803insAC	c.(802-804)TACfs	p.Y268fs		NM_004111	NP_004102	P39748	FEN1_HUMAN	flap structure-specific endonuclease 1	268					base-excision repair|DNA replication, removal of RNA primer|double-strand break repair|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|UV protection	mitochondrion|nucleolus|nucleoplasm	5'-3' exonuclease activity|5'-flap endonuclease activity|damaged DNA binding|double-stranded DNA binding|double-stranded DNA specific exodeoxyribonuclease activity|metal ion binding|protein binding|ribonuclease H activity			ovary(1)	1						CCCCAACAAGTACCCTGTGCCA	0.579								Direct_reversal_of_damage|Editing_and_processing_nucleases					30	17	---	---	---	---	
C11orf51	25906	broad.mit.edu	37	11	71825670	71825670	+	5'Flank	DEL	T	-	-	rs71935347		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71825670delT	uc001orw.2	-						C11orf51_uc009ytc.1_5'Flank|C11orf51_uc001orv.2_5'Flank	NM_014042	NP_054761	P60006	CK051_HUMAN	hypothetical protein LOC25906							intracellular					0						aggggtttggtttttttttga	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79721919	79721919	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79721919delA								ODZ4 (570224 upstream) : None (None downstream)																							ATGTAAGCAGAAAAAGAAAAG	0.418													4	2	---	---	---	---	
ME3	10873	broad.mit.edu	37	11	86375765	86375765	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86375765delG	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	GACAGATGCTGGGGTCTCCTA	0.507													4	2	---	---	---	---	
RAB38	23682	broad.mit.edu	37	11	87852112	87852112	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87852112delA	uc001pcj.1	-							NM_022337	NP_071732	P57729	RAB38_HUMAN	RAB38						protein transport|small GTPase mediated signal transduction	melanosome|plasma membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				agggagctagaaaaaagctta	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88858411	88858411	+	IGR	DEL	T	-	-	rs75664745		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88858411delT								GRM5 (59298 upstream) : TYR (52629 downstream)																							ttctttattgtttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91826711	91826712	+	IGR	DEL	CT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91826711_91826712delCT								None (None upstream) : FAT3 (258550 downstream)																							AACCACAGCCCTCTCTTCATCC	0.386													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95072628	95072628	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95072628delA								SESN3 (106923 upstream) : FAM76B (429478 downstream)																							GAAGGTGTGGAAAAAAGATAC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95408313	95408314	+	IGR	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95408313_95408314delAC								SESN3 (442608 upstream) : FAM76B (93792 downstream)																							CTGACTCCTGACACTAACATTA	0.450													4	4	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	100178751	100178751	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100178751delA	uc001pga.2	+						CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron|CNTN5_uc010ruk.1_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		gtgcaacaacaaaaaaaagca	0.085													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	106504597	106504597	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106504597delA								AASDHPPT (535178 upstream) : GUCY1A2 (53313 downstream)																							gaaatagaagaaaaaaaaagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109709720	109709720	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109709720delG								C11orf87 (409882 upstream) : ZC3H12C (254206 downstream)																							TGATATgcccggctagcttgg	0.279													4	2	---	---	---	---	
NCAM1	4684	broad.mit.edu	37	11	112946697	112946697	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112946697delA	uc009yyq.1	+						NCAM1_uc001pno.2_Intron	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCTAAAATGGAAAAAAAAAGA	0.378													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116178104	116178105	+	IGR	DEL	TC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116178104_116178105delTC								CADM1 (802863 upstream) : BUD13 (440783 downstream)																							AGGGTCTTCTTCTCTCTCTCCA	0.505													4	2	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116847607	116847607	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116847607delA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						ACACAGAACTAAAATAAGTTA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121089523	121089523	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121089523delA								TECTA (28010 upstream) : SC5DL (73865 downstream)																							taggataaccaaaaagctgga	0.000													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126638915	126638915	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126638915delT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ccgcagcacatttccatgcct	0.025													4	2	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5897326	5897326	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5897326delG	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						TTGAATCTAAGCAAAATGTGC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17409719	17409719	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17409719delA								LMO3 (646961 upstream) : RERGL (824085 downstream)																							GAGGAGATAGAAAAAAACCAG	0.338													4	2	---	---	---	---	
SLCO1A2	6579	broad.mit.edu	37	12	21507114	21507114	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21507114delC	uc001res.2	-						SLCO1A2_uc010siq.1_Intron	NM_134431	NP_602307	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ACTAATGTCTCCACTACACTC	0.313													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26842583	26842583	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26842583delC	uc001rhg.2	-							NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GACACTAAAGCCACACTGCTG	0.448													4	2	---	---	---	---	
ERGIC2	51290	broad.mit.edu	37	12	29494956	29494956	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29494956delT	uc001riv.2	-						ERGIC2_uc001riw.2_Intron	NM_016570	NP_057654	Q96RQ1	ERGI2_HUMAN	PTX1 protein						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane|nucleus				ovary(1)	1	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)				Arsenic trioxide(DB01169)	CAGCACAATCttttttttttt	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30290137	30290137	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30290137delT								TMTC1 (352445 upstream) : IPO8 (491786 downstream)																							AACATTTTCCTGGGCATCAGT	0.423													4	2	---	---	---	---	
CNTN1	1272	broad.mit.edu	37	12	41168975	41168975	+	Intron	DEL	T	-	-	rs34028225		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41168975delT	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AGGAAAGTGGTTATTTATCTT	0.174													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53637622	53637622	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53637622delC								RARG (11586 upstream) : MFSD5 (7815 downstream)																							CTAATTGTATCACCACATCTG	0.229													4	2	---	---	---	---	
DNAJC14	85406	broad.mit.edu	37	12	56182115	56182115	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56182115delT	uc001shu.1	-						SARNP_uc009zoa.2_Intron|SARNP_uc001shs.3_Intron|SARNP_uc001sht.2_Intron	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein						protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						ATGAATTAACTTTTTTTTTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58468094	58468094	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58468094delT								XRCC6BP1 (117043 upstream) : LRIG3 (797844 downstream)																							GTAAAGTGAATTTTTTGGAGG	0.333													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	67000773	67000776	+	Intron	DEL	GAGA	-	-	rs111313476		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67000773_67000776delGAGA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCCTTACTTGgagagagagagaga	0.211													2	6	---	---	---	---	
TSPAN8	7103	broad.mit.edu	37	12	71750849	71750849	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71750849delT	uc001swk.1	-							NM_004616	NP_004607	P19075	TSN8_HUMAN	transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			AATGTTTTGATTTTTTTGACA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76388113	76388113	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76388113delT								KRR1 (482695 upstream) : PHLDA1 (31115 downstream)																							TTTAAATACATTTCACCCTGT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	83552724	83552724	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83552724delG								TMTC2 (24661 upstream) : None (None downstream)																							CAGGTCTATAGGGAACTGGGA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	84383517	84383517	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84383517delA								TMTC2 (855454 upstream) : SLC6A15 (869752 downstream)																							ATATTTGAATAAAAACACCTT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88149675	88149675	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88149675delA								MGAT4C (916994 upstream) : C12orf50 (224141 downstream)																							actacataccaaaaaaTAAgt	0.000													4	2	---	---	---	---	
KITLG	4254	broad.mit.edu	37	12	88944204	88944206	+	Intron	DEL	AGG	-	-	rs142895185		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88944204_88944206delAGG	uc001tav.2	-						KITLG_uc001taw.2_Intron	NM_000899	NP_000890	P21583	SCF_HUMAN	KIT ligand isoform b precursor						cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1						ggctttaaataggagtataggta	0.044									Testicular_Cancer_Familial_Clustering_of				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105873947	105873947	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105873947delA								C12orf75 (108652 upstream) : NUAK1 (583178 downstream)																							TAAATCTAGGAATCATTAAGC	0.234													4	2	---	---	---	---	
POLR3B	55703	broad.mit.edu	37	12	106814129	106814130	+	Intron	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106814129_106814130insA	uc001tlp.2	+						POLR3B_uc001tlq.2_Intron	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						cttcaccttccagctactcaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110141166	110141166	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110141166delA								MVK (106096 upstream) : C12orf34 (11024 downstream)																							ttaaggaaagaaaaaaaaaTC	0.234													4	2	---	---	---	---	
GLTP	51228	broad.mit.edu	37	12	110303751	110303751	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110303751delA	uc001tpm.2	-						GLTP_uc010sxt.1_Intron	NM_016433	NP_057517	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein							cytoplasm	glycolipid binding|glycolipid transporter activity				0		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		ATCTAATTATAAAAAACAGAA	0.383													4	2	---	---	---	---	
ARPC3	10094	broad.mit.edu	37	12	110875179	110875180	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110875179_110875180insT	uc001tqq.2	-							NM_005719	NP_005710	O15145	ARPC3_HUMAN	actin related protein 2/3 complex subunit 3						cellular component movement|regulation of actin filament polymerization	Arp2/3 protein complex|cytoplasm	actin binding|structural constituent of cytoskeleton			ovary(1)	1						TGTGCAGCTGCttttttttttt	0.272													4	3	---	---	---	---	
ACAD10	80724	broad.mit.edu	37	12	112194598	112194599	+	3'UTR	DEL	CT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112194598_112194599delCT	uc001tsq.2	+	21					ACAD10_uc009zvx.2_3'UTR|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						CTTTCAGTCCCTCTCTCTCTGC	0.604													4	2	---	---	---	---	
RASAL1	8437	broad.mit.edu	37	12	113563304	113563304	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113563304delA	uc001tum.1	-						RASAL1_uc010syp.1_Intron|RASAL1_uc001tul.2_Intron|RASAL1_uc001tun.1_Intron|RASAL1_uc010syq.1_Intron|RASAL1_uc001tuo.3_Intron|RASAL1_uc010syr.1_Intron	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						aactgtatataaaaaaggctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116813319	116813320	+	IGR	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116813319_116813320delTG								MED13L (98328 upstream) : NCRNA00173 (157907 downstream)																							tgagtatgcatgtgtgtgcgcg	0.000													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119462924	119462925	+	Intron	DEL	GT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119462924_119462925delGT	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						gtgcattagggtgtgtgtgtgt	0.000													5	3	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119481394	119481394	+	Intron	DEL	A	-	-	rs113018077		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119481394delA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						TGCATACAGCAAAAAGAAGTT	0.239													4	4	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119884398	119884398	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119884398delA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		ATACaggaagaaaaaaaggga	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120405646	120405646	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120405646delA								CIT (90554 upstream) : CCDC64 (22002 downstream)																							CAAAAGCAAGAAAAAAAAATG	0.338													4	2	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124408962	124408962	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124408962delC	uc001uft.3	+	66	11420	c.11395delC	c.(11395-11397)CAGfs	p.Q3799fs	DNAH10_uc001ufu.3_5'Flank	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3799					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGAGAATAATCAGACTGTCTG	0.473													77	41	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126150370	126150370	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126150370delA								TMEM132B (6781 upstream) : LOC100128554 (776657 downstream)																							AAATGGGGGGAAAAAAGAGTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126842898	126842898	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126842898delA								TMEM132B (699309 upstream) : LOC100128554 (84129 downstream)																							TTGCTTTTAGAAAAAAAATGT	0.428													4	2	---	---	---	---	
TMEM132C	92293	broad.mit.edu	37	12	128960833	128960833	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128960833delG	uc001uhs.3	+							NM_001136103	NP_001129575	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1						AATCCTTCCTGGCAACCTGAG	0.498													4	2	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	36170025	36170025	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36170025delT	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc010teg.1_Intron|NBEA_uc001uvd.2_Intron	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ttagtttgcatttttttttga	0.000													12	6	---	---	---	---	
RCBTB1	55213	broad.mit.edu	37	13	50126185	50126185	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50126185delA	uc001vde.1	-							NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and						cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		ATATAATATTAAATATGGAAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55774573	55774573	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55774573delT								MIR1297 (888390 upstream) : None (None downstream)																							gtggagggactccccaatagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	77272849	77272850	+	IGR	DEL	GT	-	-	rs111584566		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77272849_77272850delGT								LMO7 (838845 upstream) : KCTD12 (181454 downstream)																							TTCTTTCCTGgtgtgtgtgtgt	0.406													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79283254	79283254	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79283254delG								RNF219 (48554 upstream) : RBM26 (610846 downstream)																							GGGTTCACTTGGGTCTGATCA	0.383													4	2	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92137372	92137372	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92137372delT	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				aatatgcacatttttttgaga	0.124													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	95055616	95055616	+	3'UTR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95055616delT	uc001vlt.2	+	9						NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TCTGCCTCCCTTTTTGTTTTC	0.438													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99540310	99540310	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99540310delA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTGTCAATTAAAATGTGCTA	0.269													18	12	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101726694	101726695	+	Intron	INS	-	C	C	rs72517261		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101726694_101726695insC	uc001vox.1	-							NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GAATAACCTTTTCAACTGGAAA	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112584569	112584569	+	IGR	DEL	T	-	-	rs112901485		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112584569delT								C13orf16 (587976 upstream) : SOX1 (137344 downstream)																							tatttatttattttttttttg	0.109													4	2	---	---	---	---	
NYNRIN	57523	broad.mit.edu	37	14	24880072	24880073	+	Intron	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24880072_24880073delCA	uc001wpf.3	+							NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523						DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						caggtacatgcacacacacaca	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29540271	29540271	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29540271delT								C14orf23 (276272 upstream) : PRKD1 (505418 downstream)																							aagcagtccattttgtgagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34940044	34940044	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34940044delA								C14orf147 (8576 upstream) : EAPP (45091 downstream)																							TAAACGAAAGAAAACCCTCAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35209488	35209488	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35209488delT								CFL2 (25459 upstream) : BAZ1A (12451 downstream)																							tctctagttcttttTTTTTCA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52690282	52690282	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52690282delT								NID2 (154336 upstream) : PTGDR (44149 downstream)																							ATGTGGGCCCTGAATGAtccc	0.279													4	2	---	---	---	---	
DDHD1	80821	broad.mit.edu	37	14	53619480	53619481	+	In_Frame_Ins	INS	-	GCCGCC	GCCGCC	rs140904345	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53619480_53619481insGCCGCC	uc001xai.2	-	1	566_567	c.336_337insGGCGGC	c.(334-339)insGGCGGC	p.112_113insGG	DDHD1_uc001xaj.2_In_Frame_Ins_p.112_113insGG|DDHD1_uc001xah.2_In_Frame_Ins_p.112_113insGG	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	112_113					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					GACAAGGAGCTGCCGCCGCCGC	0.703													4	2	---	---	---	---	
SNAPC1	6617	broad.mit.edu	37	14	62251181	62251182	+	Intron	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62251181_62251182insA	uc001xft.2	+							NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		attcttgatttaaaaaaaaaaa	0.000													2	4	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69137027	69137027	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69137027delT	uc001xkg.1	+							NM_133510	NP_598194	O15315	RA51B_HUMAN	RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		AGATGGATGGTTTTTGAGTGA	0.567			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	74907459	74907459	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74907459delT								TMEM90A (14654 upstream) : NPC2 (39185 downstream)																							TATTACACTATTTTTTTTTAA	0.234													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78673204	78673204	+	Intron	DEL	T	-	-	rs113050769		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78673204delT	uc001xum.1	+									Q9Y4C0	NRX3A_HUMAN	Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCGGACAttcttttttttttg	0.055													4	2	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81302906	81302906	+	Intron	DEL	T	-	-	rs111834655		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81302906delT	uc001xux.2	-						C14orf145_uc010asz.1_5'Flank|C14orf145_uc001xuz.2_Intron|C14orf145_uc001xuy.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGTGACTAGATTTTTTTTTTC	0.328													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347468	+	Intron	DEL	ACAC	-	-	rs140834248	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347468delACAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacacac	0.201													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94269871	94269871	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94269871delT								PRIMA1 (15105 upstream) : C14orf86 (101205 downstream)																							actcctgCTCTTTTTGATGGG	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105568367	105568368	+	IGR	INS	-	A	A	rs149581930	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105568367_105568368insA								GPR132 (36613 upstream) : JAG2 (39709 downstream)																							cttccaattgcaaaaaaattaa	0.040													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23685749	23685751	+	IGR	DEL	CTC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23685749_23685751delCTC								GOLGA8E (237326 upstream) : MKRN3 (124703 downstream)																							ctcgcatcttctcctcctggtcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23978898	23978899	+	IGR	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23978898_23978899insT								NDN (46448 upstream) : PWRN2 (431027 downstream)																							TGCAGTGCCTGtttttctgttt	0.386													4	2	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	27122343	27122343	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27122343delT	uc001zbb.2	-						GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CCTGTCCATGTTTTCCACCTT	0.453													4	2	---	---	---	---	
OCA2	4948	broad.mit.edu	37	15	28188451	28188451	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28188451delC	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		gatcttcagaccgatagaata	0.000									Oculocutaneous_Albinism				4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32047264	32047267	+	Intron	DEL	GTGT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32047264_32047267delGTGT	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		ctctgtgttcgtgtgtgtgtgtgt	0.108													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39237282	39237282	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39237282delT								C15orf53 (245043 upstream) : C15orf54 (305603 downstream)																							AAATAGATGCTTTTTGAATCA	0.433													4	2	---	---	---	---	
SLC28A2	9153	broad.mit.edu	37	15	45545881	45545881	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45545881delA	uc001zva.2	+							NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		TAAACTCCATAAAAAAAAAGG	0.308													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60187595	60187595	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60187595delT								BNIP2 (205953 upstream) : FOXB1 (108826 downstream)																							ATAGGACATATTTTTAAAAGA	0.428													4	2	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61052810	61052810	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61052810delA	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						AAACAGCATTAAAATATAAAC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75348728	75348728	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75348728delC								PPCDC (5662 upstream) : C15orf39 (142505 downstream)																							TAGGAGGAAGCCAGGATGCTG	0.527													4	2	---	---	---	---	
RCN2	5955	broad.mit.edu	37	15	77225418	77225419	+	Intron	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77225418_77225419insA	uc002bcd.2	+						RCN2_uc002bce.2_Intron|RCN2_uc010bks.2_Intron	NM_002902	NP_002893	Q14257	RCN2_HUMAN	reticulocalbin 2 precursor							endoplasmic reticulum lumen	calcium ion binding				0						ATCCTTCAGTTAAAAAAAAAAA	0.173													4	2	---	---	---	---	
SH3GL3	6457	broad.mit.edu	37	15	84262571	84262571	+	Intron	DEL	T	-	-	rs112418681		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84262571delT	uc002bjw.2	+						SH3GL3_uc002bjx.2_Intron|SH3GL3_uc002bju.2_Intron|SH3GL3_uc002bjv.2_Intron	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						ttttcatagattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98885226	98885227	+	IGR	INS	-	G	G	rs149956358	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98885226_98885227insG								ARRDC4 (368159 upstream) : FAM169B (95164 downstream)																							AGGAGGGGTCTGGGGGGACCTC	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102135207	102135207	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102135207delT								PCSK6 (105020 upstream) : TM2D3 (37973 downstream)																							tctgtagttatttttttttgt	0.000													4	2	---	---	---	---	
NPRL3	8131	broad.mit.edu	37	16	160308	160308	+	Intron	DEL	A	-	-	rs11316789		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:160308delA	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1						AAAAATAAACAAAAAAAAACG	0.274													4	3	---	---	---	---	
E4F1	1877	broad.mit.edu	37	16	2280250	2280250	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2280250delT	uc002cpm.2	+						E4F1_uc010bsi.2_Intron|E4F1_uc010bsj.2_Intron	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F						cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						TGATGGCTACTTTTTAAGTGA	0.567													4	2	---	---	---	---	
ZNF213	7760	broad.mit.edu	37	16	3184227	3184227	+	5'Flank	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3184227delA	uc010uws.1	+						uc002cuc.2_5'Flank|ZNF213_uc002cud.2_5'Flank|ZNF213_uc010btf.2_5'Flank|ZNF213_uc010bth.2_5'Flank|ZNF213_uc010uwt.1_5'Flank	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AAAACAAACCAAAAAAACTCT	0.363													4	2	---	---	---	---	
ROGDI	79641	broad.mit.edu	37	16	4848808	4848809	+	Intron	DEL	AA	-	-	rs3214843		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4848808_4848809delAA	uc002cxv.2	-						ROGDI_uc002cxu.2_Intron|ROGDI_uc010bua.2_Intron|ROGDI_uc002cxw.2_Intron	NM_024589	NP_078865	Q9GZN7	ROGDI_HUMAN	leucine zipper domain protein							intracellular				ovary(1)|skin(1)	2						GGGACCTGTTAAAGACAGGTAG	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12039534	12039535	+	IGR	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12039534_12039535insA								GSPT1 (29015 upstream) : TNFRSF17 (19429 downstream)																							gactctgtcttaaaaaaaaaac	0.104													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26229209	26229209	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26229209delC								HS3ST4 (80201 upstream) : C16orf82 (849010 downstream)																							TCTCCAGTGTCCATCATGGGG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33051246	33051246	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33051246delA								SLC6A10P (154783 upstream) : MIR1826 (914262 downstream)																							ttctctttttaaaaaaagtca	0.030													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33968121	33968121	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33968121delG								MIR1826 (2529 upstream) : UBE2MP1 (435681 downstream)																							aatcaccttaggcaatgcatg	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33978202	33978203	+	IGR	INS	-	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33978202_33978203insG								MIR1826 (12610 upstream) : UBE2MP1 (425599 downstream)																							ctcacagagttgaacctttttt	0.000													4	2	---	---	---	---	
HEATR3	55027	broad.mit.edu	37	16	50101340	50101340	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50101340delA	uc002efw.2	+						HEATR3_uc002efx.2_Intron	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3								binding			ovary(1)|skin(1)	2						gaggcatgggaaaataggggg	0.000													4	2	---	---	---	---	
HEATR3	55027	broad.mit.edu	37	16	50105125	50105126	+	Intron	DEL	CT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50105125_50105126delCT	uc002efw.2	+						HEATR3_uc002efx.2_Intron	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3								binding			ovary(1)|skin(1)	2						TCTAGCAAGACTCTGTCACAGT	0.421													0	6	---	---	---	---	
NOD2	64127	broad.mit.edu	37	16	50726751	50726752	+	5'Flank	DEL	GT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50726751_50726752delGT	uc010cbk.1	+						NOD2_uc010cbj.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain						activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				TTGGAAAGTGgtgtgtgtgtgg	0.188													4	2	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53326731	53326733	+	Intron	DEL	TTA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53326731_53326733delTTA	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_Intron|CHD9_uc010cbw.2_Intron	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTACTATTACTTATTTAACTATA	0.335													102	49	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	65706188	65706188	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65706188delC								LOC283867 (95985 upstream) : CDH5 (694337 downstream)																							aaactcctagcccaaagaatt	0.000													4	2	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70572027	70572027	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70572027delT	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				ACTCTTTTGGTTACCCAGATT	0.398													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83569320	83569320	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83569320delT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ataatgttcattttttttgga	0.119													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83677710	83677710	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83677710delA	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CCTGCAGCCTAAGAACATAAA	0.473													4	2	---	---	---	---	
ITGAE	3682	broad.mit.edu	37	17	3654762	3654763	+	Intron	INS	-	G	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3654762_3654763insG	uc002fwo.3	-							NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CTGAAGGGGCTGAGGTGAGGCC	0.619													7	4	---	---	---	---	
PITPNM3	83394	broad.mit.edu	37	17	6445659	6445660	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6445659_6445660delTG	uc002gdd.3	-						PITPNM3_uc010cln.2_Intron	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1						phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCTTGGCTGTTGTGTGTGTGTC	0.470													4	2	---	---	---	---	
MYH4	4622	broad.mit.edu	37	17	10357574	10357574	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10357574delT	uc002gmn.2	-						uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						ATAACTTCTATTTTATGCACA	0.194													4	2	---	---	---	---	
COX10	1352	broad.mit.edu	37	17	14111361	14111362	+	3'UTR	DEL	CT	-	-	rs10603407		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14111361_14111362delCT	uc002gof.3	+	7					COX10_uc010vvs.1_3'UTR|COX10_uc010vvt.1_3'UTR	NM_001303	NP_001294	Q12887	COX10_HUMAN	heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GTCGCCACTCCTCTGCTACACA	0.540													7	5	---	---	---	---	
TNFRSF13B	23495	broad.mit.edu	37	17	16849431	16849433	+	Intron	DEL	GCA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16849431_16849433delGCA	uc002gqs.1	-						TNFRSF13B_uc010vwt.1_Intron|TNFRSF13B_uc002gqt.1_Intron|TNFRSF13B_uc010vwu.1_Intron	NM_012452	NP_036584	O14836	TR13B_HUMAN	tumor necrosis factor receptor 13B						cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity			kidney(2)	2						ggcttgttaggcagcagcagcta	0.261									IgA_Deficiency_Selective				4	2	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													3	3	---	---	---	---	
TMEM132E	124842	broad.mit.edu	37	17	32914122	32914122	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32914122delG	uc002hif.2	+							NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor							integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		CACTGGAGCTGGAGAATGAGG	0.498													4	2	---	---	---	---	
AP2B1	163	broad.mit.edu	37	17	34049624	34049625	+	Intron	INS	-	C	C	rs139820195	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34049624_34049625insC	uc002hjr.2	+						AP2B1_uc002hjq.2_Intron|AP2B1_uc010wci.1_Intron|AP2B1_uc002hjs.2_Intron|AP2B1_uc002hjt.2_Intron|AP2B1_uc010ctv.2_Intron|AP2B1_uc010wcj.1_Intron	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AGATAGTCTCACTTTTGCACTA	0.287													4	2	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	44054665	44054665	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44054665delG	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				GGCCAGCGGTGGGGATCCGGC	0.547													4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44270154	44270156	+	5'UTR	DEL	AGG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44270154_44270156delAGG	uc002ikc.2	-	1					KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron|uc002ike.2_5'Flank	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				aaagggcagcaggaggaggagga	0.310													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44486655	44486656	+	IGR	DEL	TT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44486655_44486656delTT								ARL17A (47492 upstream) : LRRC37A2 (103420 downstream)																							TACAGTCttctttttttttttt	0.134													4	2	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925053	47925054	+	Intron	DEL	AG	-	-	rs150685532	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925053_47925054delAG	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						acacacacacagacacacacac	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49547764	49547765	+	IGR	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49547764_49547765insT								UTP18 (172474 upstream) : CA10 (159910 downstream)																							GAGTTCAGGCGTTTTTTTTTTT	0.391													6	3	---	---	---	---	
HLF	3131	broad.mit.edu	37	17	53346099	53346099	+	Intron	DEL	T	-	-	rs75601852		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53346099delT	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_Intron|HLF_uc010wni.1_Intron	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TGTTCTTATCTTTTTTTTTTT	0.398			T	TCF3	ALL								2	4	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64387038	64387039	+	Intron	INS	-	CTCT	CTCT	rs149991943	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64387038_64387039insCTCT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	AAAGGAACCAAGTAGCAGAGGA	0.545													3	4	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71333645	71333646	+	3'UTR	INS	-	GC	GC			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71333645_71333646insGC	uc010dfm.2	-	45					SDK2_uc002jjt.3_3'UTR	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						ATGGGAGAtgtgtgtgtgtgtg	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72072364	72072366	+	IGR	DEL	TGG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72072364_72072366delTGG								C17orf54 (247688 upstream) : RPL38 (127429 downstream)																							atcatagtgatggtggtggtggt	0.000													4	2	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75205129	75205130	+	Intron	DEL	TA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75205129_75205130delTA	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron|SEC14L1_uc010wtj.1_Intron|SEC14L1_uc002jtr.2_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						CCCTAATGCTTATATGAGTCAG	0.371													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75778600	75778600	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75778600delA								SEPT9 (281924 upstream) : FLJ45079 (96509 downstream)																							CAGTTGCCTCAGGGTGTGCTT	0.552													4	2	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76067505	76067505	+	Intron	DEL	T	-	-	rs75702970		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76067505delT	uc002jud.2	+						TNRC6C_uc002juf.2_Intron|TNRC6C_uc002jue.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TAGAAAATGCttttttttttt	0.199													4	2	---	---	---	---	
TIMP2	7077	broad.mit.edu	37	17	76866068	76866068	+	Intron	DEL	T	-	-	rs149468901		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76866068delT	uc002jwf.2	-						TIMP2_uc002jwe.2_Intron|TIMP2_uc010wty.1_Intron	NM_003255	NP_003246	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2 precursor								metal ion binding|metalloendopeptidase inhibitor activity			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			aaaatggaggtgggccaaggc	0.000													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77216168	77216168	+	Intron	DEL	G	-	-	rs115935804	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77216168delG	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			GGCACGGGGTGGGGGGGTGGG	0.647													4	2	---	---	---	---	
CHMP6	79643	broad.mit.edu	37	17	78973435	78973435	+	3'UTR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78973435delG	uc002jyw.3	+	8						NM_024591	NP_078867	Q96FZ7	CHMP6_HUMAN	chromatin modifying protein 6						cellular membrane organization|endosome transport|protein transport	cytosol|endomembrane system|late endosome membrane	protein N-terminus binding			ovary(1)	1	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCCTGCTGGTGGGGGGATCCC	0.647													4	2	---	---	---	---	
EPB41L3	23136	broad.mit.edu	37	18	5498689	5498689	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5498689delA	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc010dks.1_Intron|EPB41L3_uc002kmv.1_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GGTTTTAAGCAAAAAAATCAA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5635513	5635513	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5635513delA								EPB41L3 (4871 upstream) : TMEM200C (254671 downstream)																							cccactcagtaaaatgacttt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8950772	8950772	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8950772delA								KIAA0802 (117997 upstream) : NDUFV2 (151903 downstream)																							tatgcagcataaaaaaatgga	0.030													4	2	---	---	---	---	
NDUFV2	4729	broad.mit.edu	37	18	9100444	9100444	+	5'Flank	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9100444delG	uc002knu.2	+							NM_021074	NP_066552	P19404	NDUV2_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 2						cardiac muscle tissue development|mitochondrial electron transport, NADH to ubiquinone|nervous system development|transport	mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			ovary(1)	1					NADH(DB00157)	aggaacatctgggacacttta	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18740717	18740718	+	IGR	DEL	TT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18740717_18740718delTT								ROCK1 (48905 upstream) : GREB1L (81485 downstream)																							attttgtctgtttttttttttt	0.015													0	6	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21430792	21430793	+	Intron	DEL	GT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21430792_21430793delGT	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTGTCAGACGTGAGGAAGCTG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	24827664	24827665	+	IGR	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24827664_24827665delCA								C18orf16 (57014 upstream) : CDH2 (703265 downstream)																							AGTTACTATCCATTGAGACATA	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	31902861	31902861	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31902861delT								NOL4 (99415 upstream) : DTNA (170393 downstream)																							TGGTGCAGTCTTTATGGACGC	0.383											OREG0024912	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	35075813	35075814	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35075813_35075814delTG	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						catgtgtgcttgtgtgtgtgtg	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39754327	39754327	+	IGR	DEL	T	-	-	rs114737466	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39754327delT								PIK3C3 (92883 upstream) : RIT2 (568866 downstream)																							TATGGTACCCTAAGTTATGGC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41700547	41700548	+	IGR	INS	-	A	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41700547_41700548insA								SYT4 (842932 upstream) : SETBP1 (559590 downstream)																							CAACACTATTGAAAAAAAATAT	0.312													4	2	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43468063	43468063	+	Intron	DEL	T	-	-	rs1075748		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43468063delT	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						ACTGAttttcttttttttttt	0.144													4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47526818	47526818	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47526818delC	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AAGACAACAACAAAGAGCTTT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53788370	53788370	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53788370delT	uc002lgf.1	-						uc010dpj.1_Intron					Homo sapiens cDNA FLJ32774 fis, clone TESTI2002002.																		TTTATAATCCTTTTAAATGTT	0.299													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59958877	59958877	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59958877delG	uc002lil.2	+						KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				GAGCCACTGTGATTACCAGTG	0.378													160	85	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69382678	69382678	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69382678delC								None (None upstream) : CBLN2 (821237 downstream)																							TCATTTCCTGCCATTTCTTAC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76191904	76191904	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76191904delT								None (None upstream) : SALL3 (548371 downstream)																							GAGGAGCTACTTTTCACTGGC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76398932	76398933	+	IGR	INS	-	CA	CA			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76398932_76398933insCA								None (None upstream) : SALL3 (341342 downstream)																							acaccacacaccacaccacaca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76398939	76398940	+	IGR	INS	-	CC	CC			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76398939_76398940insCC								None (None upstream) : SALL3 (341335 downstream)																							acaccacaccacacacaccaca	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76398955	76398956	+	IGR	INS	-	ACCA	ACCA			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76398955_76398956insACCA								None (None upstream) : SALL3 (341319 downstream)																							accacacacaccacacaccaca	0.074													4	2	---	---	---	---	
ODF3L2	284451	broad.mit.edu	37	19	465130	465131	+	Intron	INS	-	GTGG	GTGG	rs62636886		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:465130_465131insGTGG	uc002lor.2	-						ODF3L2_uc010drp.2_Intron	NM_182577	NP_872383	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2												0						tgggttgatgagtggatggatg	0.000													4	3	---	---	---	---	
PLIN4	729359	broad.mit.edu	37	19	4506635	4506635	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4506635delC	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0						CATCCCATTTCCCAGCCCAGC	0.338													4	2	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7183274	7183275	+	Intron	INS	-	GT	GT	rs141910839	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7183274_7183275insGT	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTTGTTTtgtggtgtgtgtgtg	0.287													4	2	---	---	---	---	
EVI5L	115704	broad.mit.edu	37	19	7926435	7926435	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7926435delG	uc002min.2	+						EVI5L_uc010xjz.1_Intron	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						TGTTTCTGCTGGGGCAGGTCC	0.552													4	2	---	---	---	---	
ZNF44	51710	broad.mit.edu	37	19	12404815	12404816	+	Intron	DEL	AA	-	-	rs59549715		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12404815_12404816delAA	uc010xmj.1	-						ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_Intron|ZNF44_uc002mtn.3_Intron|ZNF44_uc010dys.2_Intron|ZNF44_uc002mto.2_Intron	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		gcttcacaggaagccgcctccc	0.000													5	4	---	---	---	---	
TNPO2	30000	broad.mit.edu	37	19	12813987	12813987	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12813987delA	uc002muo.2	-						TNPO2_uc002mup.2_Intron|TNPO2_uc002muq.2_Intron|TNPO2_uc002mur.2_Intron	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)						intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						AAGTCAAAGGAAAAAAAAAGC	0.502													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17717855	17717855	+	Intron	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17717855delC	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						CTCCGGCCCACCCTGGCTGAC	0.587													4	2	---	---	---	---	
GATAD2A	54815	broad.mit.edu	37	19	19579161	19579161	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19579161delG	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron|GATAD2A_uc010xqv.1_Intron|GATAD2A_uc010xqw.1_Intron	NM_017660	NP_060130	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATGGGCAAGTGGGGAGACACA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22486065	22486065	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22486065delT								ZNF676 (106312 upstream) : ZNF98 (87834 downstream)																							CAAAAGATTCTTTTTtgggcc	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31670239	31670239	+	IGR	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31670239delG								DKFZp566F0947 (28930 upstream) : TSHZ3 (95614 downstream)																							tgtccatggtggcccagaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32635695	32635696	+	IGR	INS	-	A	A	rs150631009	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32635695_32635696insA								TSHZ3 (795505 upstream) : ZNF507 (200818 downstream)																							ACACAGCCATGAAAAAAAAAGA	0.277													4	2	---	---	---	---	
MAG	4099	broad.mit.edu	37	19	35819647	35819648	+	Intron	INS	-	G	G	rs143856980	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35819647_35819648insG	uc002nyz.1	+						CD22_uc010edt.2_5'Flank|CD22_uc010xst.1_5'Flank|CD22_uc010edu.2_5'Flank|CD22_uc010edv.2_5'Flank	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCTCAACCCTTGGGGGCTTCAG	0.317													2	4	---	---	---	---	
SHKBP1	92799	broad.mit.edu	37	19	41088648	41088648	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41088648delG	uc002oob.2	+						SHKBP1_uc002ooc.2_Intron|SHKBP1_uc002ood.2_Intron|SHKBP1_uc010xvl.1_Intron|SHKBP1_uc002ooe.2_Intron|SHKBP1_uc002oof.2_Intron|SHKBP1_uc010xvm.1_Intron|SHKBP1_uc010xvn.1_Intron	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGCAGGTTAGGGGGGATGCT	0.169													4	2	---	---	---	---	
PVRL2	5819	broad.mit.edu	37	19	45379234	45379234	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45379234delT	uc002ozw.1	+						PVRL2_uc002ozv.2_Intron	NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta						adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		GCAAAACTAATCCAGGACAGC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45707273	45707273	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45707273delT								BLOC1S3 (22216 upstream) : EXOC3L2 (8606 downstream)																							CAGTCGAttcttttttttttg	0.035													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47931247	47931248	+	IGR	DEL	AC	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47931247_47931248delAC								MEIS3 (8462 upstream) : SLC8A2 (32 downstream)																							CTTTGGCACAACACACACACAC	0.426													4	2	---	---	---	---	
ELSPBP1	64100	broad.mit.edu	37	19	48514704	48514705	+	Intron	INS	-	TGA	TGA	rs138126081	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48514704_48514705insTGA	uc002pht.2	+							NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1 precursor						single fertilization	extracellular region					0		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		cacgatgacagtgatgatgatg	0.000													3	3	---	---	---	---	
PPP2R1A	5518	broad.mit.edu	37	19	52729587	52729587	+	3'UTR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52729587delT	uc002pyp.2	+	15					PPP2R1A_uc010ydk.1_3'UTR|PPP2R1A_uc002pyq.2_3'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein						ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CCATCATTGGTTTTTTTTTGT	0.468			Mis		clear cell ovarian carcinoma								4	2	---	---	---	---	
CDS2	8760	broad.mit.edu	37	20	5134543	5134544	+	Intron	INS	-	T	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5134543_5134544insT	uc002wls.2	+						CDS2_uc002wlr.1_Intron|CDS2_uc010zqt.1_Intron|CDS2_uc002wlu.2_Intron|CDS2_uc010zqu.1_Intron	NM_003818	NP_003809	O95674	CDS2_HUMAN	phosphatidate cytidylyltransferase 2						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphatidate cytidylyltransferase activity				0						AGGTTTGTGGCTTGGAAACTTT	0.421													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10137030	10137030	+	Intron	DEL	T	-	-	rs113082610		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10137030delT	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																		caaggagttatttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11231390	11231390	+	IGR	DEL	A	-	-	rs5840417		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11231390delA								JAG1 (576696 upstream) : BTBD3 (640087 downstream)																							ACATAACTTTAAAAAAAAAAC	0.303													4	2	---	---	---	---	
ESF1	51575	broad.mit.edu	37	20	13717020	13717020	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13717020delA	uc002woj.2	-							NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						AATCATTTCTAAAAAAAAGGG	0.189													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16199501	16199501	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16199501delA								MACROD2 (165662 upstream) : KIF16B (53248 downstream)																							agtgagggggaaaaaagcaac	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17056806	17056806	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17056806delC								OTOR (323998 upstream) : PCSK2 (149946 downstream)																							tgtagctgggccatgaggagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22322818	22322819	+	IGR	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22322818_22322819delCA								PAX1 (626198 upstream) : LOC284788 (58152 downstream)																							tgcacacgcgcacacacacaca	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25937358	25937358	+	Intron	DEL	C	-	-	rs111987729		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25937358delC	uc002wvf.2	+											Homo sapiens cDNA clone IMAGE:5298175.																		ttggctgagacagaaagaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29593423	29593424	+	IGR	DEL	AT	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29593423_29593424delAT								None (None upstream) : FRG1B (18455 downstream)																							ACAAATAGAAATAGAGAGATGG	0.312													4	2	---	---	---	---	
PDRG1	81572	broad.mit.edu	37	20	30537841	30537841	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30537841delT	uc002wxd.2	-							NM_030815	NP_110442	Q9NUG6	PDRG1_HUMAN	p53 and DNA damage-regulated protein						protein folding	prefoldin complex	unfolded protein binding				0			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GAACCATCAGTTTTATACACC	0.463													4	3	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35747894	35747896	+	Intron	DEL	AAG	-	-	rs6093961		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35747894_35747896delAAG	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				aaaaaaaagaaagaaagaaggaa	0.000													4	4	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35747911	35747914	+	Intron	DEL	GGAG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35747911_35747914delGGAG	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				aaggaaggaaggagagaaaagaaa	0.000													2	7	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41532827	41532827	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41532827delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCTACGCACATTTTTTTTTAA	0.453													4	2	---	---	---	---	
ZFP64	55734	broad.mit.edu	37	20	50709683	50709683	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50709683delT	uc002xwk.2	-						ZFP64_uc002xwj.2_Intron	NM_199427	NP_955459	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						AAAAAAAAAAttttttttttt	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55623707	55623707	+	IGR	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55623707delA								TFAP2C (409371 upstream) : BMP7 (120102 downstream)																							GCACATACTGAAAAAAAAAAA	0.383													3	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59951104	59951105	+	Intron	INS	-	TGG	TGG			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59951104_59951105insTGG	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			tgtgatggtcttggtggtgatg	0.010													5	3	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190811	62190811	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190811delT	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			caggtgggagtcagtcagggt	0.199													5	3	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10984603	10984605	+	Intron	DEL	CTC	-	-	rs71277400		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10984603_10984605delCTC	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATCTTTGCTTCTCCTCAAATAGG	0.458													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11076698	11076699	+	Intron	DEL	CA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11076698_11076699delCA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gtgtggtgcccacacacacaca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11179612	11179613	+	IGR	INS	-	T	T	rs71639665		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11179612_11179613insT								BAGE (80675 upstream) : None (None downstream)																							GAATAGTTGGAttttttttttc	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14615648	14615648	+	IGR	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14615648delT								C21orf99 (125079 upstream) : POTED (366850 downstream)																							ATTTGAAAGATTTTTTTTTTG	0.313													4	2	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19698542	19698542	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19698542delA	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AGGTCTGCTTAAAAACTTTTG	0.373													4	2	---	---	---	---	
ADAMTS1	9510	broad.mit.edu	37	21	28215013	28215013	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28215013delA	uc002ymf.2	-							NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1						integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		TCCTGTAAAGAAAAAAAAAAG	0.408													8	5	---	---	---	---	
USP16	10600	broad.mit.edu	37	21	30409426	30409426	+	Intron	DEL	T	-	-	rs71723731		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30409426delT	uc002ymy.2	+						USP16_uc002ymx.2_Intron|USP16_uc002ymw.2_Intron|USP16_uc011acm.1_Intron|USP16_uc011acn.1_Intron|USP16_uc011aco.1_5'Flank	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a						cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						GGGTTTTGTGTTTTTTTTCTG	0.333													4	2	---	---	---	---	
KRTAP19-3	337970	broad.mit.edu	37	21	31863890	31863891	+	3'UTR	DEL	AA	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31863890_31863891delAA	uc002yog.1	-	1						NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3							intermediate filament					0						GTATACAGAGAAAAAAAATTGC	0.322													13	6	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37574129	37574130	+	Intron	DEL	TG	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37574129_37574130delTG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						CATGTAGCTTtgtgtgtgtgtg	0.297													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47378243	47378243	+	IGR	DEL	A	-	-	rs75346890		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47378243delA								PCBP3 (15876 upstream) : COL6A1 (23420 downstream)																							TTTCACAAGCAAAAAAAAAAG	0.244													4	2	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18480707	18480707	+	Intron	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18480707delG	uc002zng.3	-						MICAL3_uc002znh.2_Intron|MICAL3_uc002znl.1_Intron|MICAL3_uc010grf.2_Intron|MICAL3_uc011agm.1_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		aaaaaaaaaagaaaagaaaaa	0.234													4	2	---	---	---	---	
DGCR6	8214	broad.mit.edu	37	22	18891143	18891143	+	5'Flank	DEL	G	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18891143delG	uc002zoh.3	+						DGCR6_uc002zog.2_5'Flank|DGCR6_uc002zoi.3_5'Flank	NM_005675	NP_005666	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region protein 6						cell adhesion|organ morphogenesis	nucleus|proteinaceous extracellular matrix				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GGTTGGAGAAGGGGCCTTCCT	0.547													4	2	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22435962	22435963	+	Intron	INS	-	T	T	rs149873729	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22435962_22435963insT	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						AATTCACCTGCTGCAACATAAA	0.475													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25091296	25091296	+	IGR	DEL	C	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25091296delC								POM121L10P (36182 upstream) : PIWIL3 (23705 downstream)																							GCATGGAAGTCCCCACAACCC	0.642													4	2	---	---	---	---	
CRYBB1	1414	broad.mit.edu	37	22	27006021	27006022	+	Intron	INS	-	T	T	rs67122266		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27006021_27006022insT	uc003acy.1	-							NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1						visual perception		structural constituent of eye lens			ovary(1)	1						CCATGCCCAAGTCCCCCTAAAA	0.302													2	5	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29757790	29757790	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29757790delT	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						ACCTTGAATGttttttttttt	0.065													2	4	---	---	---	---	
YWHAH	7533	broad.mit.edu	37	22	32346674	32346674	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32346674delT	uc003alz.2	+						YWHAH_uc010gwl.2_Intron|YWHAH_uc003ama.2_Intron|YWHAH_uc010gwm.2_Intron	NM_003405	NP_003396	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan						glucocorticoid catabolic process|glucocorticoid receptor signaling pathway|intracellular protein transport|negative regulation of dendrite morphogenesis|positive regulation of transcription, DNA-dependent|regulation of synaptic plasticity	cytoplasm	enzyme binding|glucocorticoid receptor binding|insulin-like growth factor receptor binding|protein domain specific binding			central_nervous_system(1)	1						GAGCTTGAAGTTTAGCCTATT	0.463													4	2	---	---	---	---	
GRAP2	9402	broad.mit.edu	37	22	40365202	40365202	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40365202delA	uc003ayh.1	+						GRAP2_uc003ayi.2_Intron|GRAP2_uc011aom.1_Intron|GRAP2_uc011aon.1_Intron|GRAP2_uc010gya.1_Intron|GRAP2_uc011aoo.1_Intron|GRAP2_uc011aop.1_Intron|GRAP2_uc011aoq.1_Intron|GRAP2_uc003ayj.1_Intron	NM_004810	NP_004801	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2						cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						ttcttgactgaataaatAAAA	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48477442	48477443	+	IGR	INS	-	G	G	rs147876879	by1000genomes	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48477442_48477443insG								TBC1D22A (907720 upstream) : FAM19A5 (407845 downstream)																							ctccgcgtcccgggggaatgcc	0.243													6	3	---	---	---	---	
FAM120C	54954	broad.mit.edu	37	X	54099867	54099867	+	Intron	DEL	T	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54099867delT	uc004dsz.3	-						FAM120C_uc011moh.1_Intron	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954											ovary(1)|central_nervous_system(1)	2						TAGTACAATCttttttttttt	0.224													5	3	---	---	---	---	
CUL4B	8450	broad.mit.edu	37	X	119680631	119680631	+	Intron	DEL	A	-	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119680631delA	uc004esw.2	-						CUL4B_uc010nqq.2_5'Flank|CUL4B_uc004esv.2_Intron	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1						cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						TTTGTAAAAGAAAAAAAAAAC	0.299													4	2	---	---	---	---	
