Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16946438	16946438	+	RNA	SNP	G	A	A	rs28392876	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946438G>A	uc010ocf.1	-	3		c.460C>T			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						GCCTTCCGCCGGGCCAGCAGC	0.672													3	29	---	---	---	---	PASS
SCAMP3	10067	broad.mit.edu	37	1	155225979	155225979	+	3'UTR	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155225979A>G	uc001fjs.2	-	9					RAG1AP1_uc010pey.1_Intron|FAM189B_uc001fjm.2_5'Flank|FAM189B_uc001fjn.2_5'Flank|FAM189B_uc001fjo.2_5'Flank|FAM189B_uc001fjp.2_5'Flank|FAM189B_uc001fjq.1_5'Flank|SCAMP3_uc001fjr.2_3'UTR|SCAMP3_uc001fju.2_3'UTR|SCAMP3_uc001fjv.2_3'UTR|SCAMP3_uc001fjt.2_3'UTR	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCAGTTAGTGATGTCTCTCCA	0.597													11	44	---	---	---	---	PASS
NME7	29922	broad.mit.edu	37	1	169256604	169256604	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169256604C>T	uc001gfu.2	-	7	929	c.691G>A	c.(691-693)GCA>ACA	p.A231T	NME7_uc010plq.1_RNA|NME7_uc001gft.2_Missense_Mutation_p.A195T|NME7_uc001gfv.1_Missense_Mutation_p.A231T	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a	231					CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					GCAGTGTTTGCCGGCCCACAA	0.358													5	342	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207787753	207787753	+	Nonsense_Mutation	SNP	C	T	T	rs55749440		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207787753C>T	uc001hfy.2	+	32	5370	c.5230C>T	c.(5230-5232)CGA>TGA	p.R1744*	CR1_uc001hfx.2_Nonsense_Mutation_p.R2194*	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1744	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CTTTAGGTTCCGATTAAAAGG	0.423													3	52	---	---	---	---	PASS
LCLAT1	253558	broad.mit.edu	37	2	30756119	30756119	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30756119T>A	uc002rnj.2	+	4	626	c.417T>A	c.(415-417)TAT>TAA	p.Y139*	LCLAT1_uc010ymp.1_5'UTR|LCLAT1_uc002rnk.1_Nonsense_Mutation_p.Y139*|LCLAT1_uc002rnl.2_Nonsense_Mutation_p.Y101*|LCLAT1_uc010ymq.1_Nonsense_Mutation_p.Y101*	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	139					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						TGATGCGATATAGCTACCTCA	0.408													38	233	---	---	---	---	PASS
CCDC75	253635	broad.mit.edu	37	2	37315582	37315582	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37315582C>T	uc010ezz.2	+	2	191	c.46C>T	c.(46-48)CAA>TAA	p.Q16*	CCDC75_uc002rpr.3_Silent_p.S2S	NM_174931	NP_777591	Q8N954	CCD75_HUMAN	coiled-coil domain containing 75	16						intracellular	nucleic acid binding				0		all_hematologic(82;0.21)				CATTAATGTCCAGTAAGTAAA	0.259													6	24	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179614716	179614716	+	Silent	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179614716A>G	uc002unb.2	-	46	12635	c.12411T>C	c.(12409-12411)GAT>GAC	p.D4137D	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTAACTTGATCTTGAGGCA	0.378													15	85	---	---	---	---	PASS
XPC	7508	broad.mit.edu	37	3	14214467	14214467	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14214467C>A	uc011ave.1	-	2	303	c.199G>T	c.(199-201)GCA>TCA	p.A67S	XPC_uc011avf.1_5'UTR|XPC_uc011avg.1_Missense_Mutation_p.A67S	NM_004628	NP_004619	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	67	Glu-rich (acidic).				nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3						GGACCATCTGCTGAACCCCCA	0.473			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				5	21	---	---	---	---	PASS
RFTN1	23180	broad.mit.edu	37	3	16475443	16475443	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16475443G>A	uc003cay.2	-	3	529	c.247C>T	c.(247-249)CAC>TAC	p.H83Y	RFTN1_uc010hes.2_Missense_Mutation_p.H47Y	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein	83						plasma membrane				ovary(3)|central_nervous_system(1)	4						ACGAAGGGGTGCAGGGCCGCC	0.652													26	114	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109023409	109023409	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109023409C>T	uc003dxo.2	-	7	1014	c.767G>A	c.(766-768)AGG>AAG	p.R256K		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	256						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						AGAAATCATCCTCCTGTGAGT	0.512													3	99	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126707544T>G	uc003ejg.2	+	1	43	c.39T>G	c.(37-39)GGT>GGG	p.G13G		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.567													8	19	---	---	---	---	PASS
DZIP1L	199221	broad.mit.edu	37	3	137813726	137813726	+	Missense_Mutation	SNP	G	A	A	rs148594666	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137813726G>A	uc003erq.2	-	4	1049	c.686C>T	c.(685-687)GCG>GTG	p.A229V	DZIP1L_uc003err.1_Missense_Mutation_p.A229V	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	229	Potential.					intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						CTGCCTCTCCGCCTCCCTCTG	0.567													13	105	---	---	---	---	PASS
COPB2	9276	broad.mit.edu	37	3	139077639	139077639	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139077639T>G	uc003etf.3	-	20	2630	c.2500A>C	c.(2500-2502)AAT>CAT	p.N834H	COPB2_uc011bmv.1_Missense_Mutation_p.N805H|COPB2_uc010hui.2_Missense_Mutation_p.N805H	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta	834					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TCCATGACATTTCTCTCTTCA	0.383													19	77	---	---	---	---	PASS
HSD17B11	51170	broad.mit.edu	37	4	88312253	88312253	+	5'UTR	SNP	T	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88312253T>G	uc003hqp.2	-	1						NM_016245	NP_057329	Q8NBQ5	DHB11_HUMAN	estradiol 17-beta-dehydrogenase 11						androgen catabolic process|steroid biosynthetic process	cytoplasm|extracellular region	binding|estradiol 17-beta-dehydrogenase activity			ovary(2)	2		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		TTTGGTGTGTTTTTTTTTTTT	0.463													6	10	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184601356	184601356	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184601356A>T	uc003ivx.2	+	10	1225	c.1049A>T	c.(1048-1050)TAC>TTC	p.Y350F	C4orf41_uc003ivw.2_Missense_Mutation_p.Y350F|C4orf41_uc010isc.2_Intron	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	350											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		GGTTTCTATTACCAGCAGGCA	0.383													31	119	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576384	33576384	+	Silent	SNP	G	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576384G>A	uc003jia.1	-	19	3910	c.3747C>T	c.(3745-3747)CTC>CTT	p.L1249L	ADAMTS12_uc010iuq.1_Silent_p.L1164L	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1249	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTCCCAGAGGGAGCAGAGTGT	0.517										HNSCC(64;0.19)			26	146	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176562399	176562399	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176562399G>A	uc003mfr.3	+	2	433	c.295G>A	c.(295-297)GAC>AAC	p.D99N	NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Missense_Mutation_p.D99N|NSD1_uc011dfx.1_Intron|NSD1_uc003mfp.2_Missense_Mutation_p.D99N|NSD1_uc003mfq.2_Missense_Mutation_p.D99N	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	99					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATCCTTTCAAGACCCTGAAAA	0.448			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			32	101	---	---	---	---	PASS
HSPA1L	3305	broad.mit.edu	37	6	31779631	31779631	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31779631G>A	uc003nxh.2	-	2	302	c.119C>T	c.(118-120)ACC>ATC	p.T40I	HSPA1L_uc010jte.2_Missense_Mutation_p.T40I	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	40					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						GTAGCTGGGGGTGGTGCGGTT	0.582													26	103	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87966321	87966321	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87966321C>A	uc003plm.3	+	8	3015	c.2974C>A	c.(2974-2976)CAA>AAA	p.Q992K		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	992					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAGAAAAGAACAAGATTGCTT	0.393													3	97	---	---	---	---	PASS
AHI1	54806	broad.mit.edu	37	6	135787354	135787354	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135787354C>T	uc003qgi.2	-	7	731	c.347G>A	c.(346-348)AGT>AAT	p.S116N	AHI1_uc003qgh.2_Missense_Mutation_p.S116N|AHI1_uc003qgj.2_Missense_Mutation_p.S116N|AHI1_uc003qgk.3_RNA|AHI1_uc003qgl.3_Missense_Mutation_p.S116N	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a	116						adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TTCCTCTACACTAGCATCACC	0.418													14	278	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676909	100676909	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676909C>T	uc003uxp.1	+	3	2265	c.2212C>T	c.(2212-2214)CCA>TCA	p.P738S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	738	Extracellular (Potential).|Ser-rich.|10.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCCAGTATGCCAACCTCAAC	0.502													5	387	---	---	---	---	PASS
DLD	1738	broad.mit.edu	37	7	107542792	107542792	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107542792A>G	uc003vet.2	+	4	331	c.221A>G	c.(220-222)GAA>GGA	p.E74G	DLD_uc010ljm.1_RNA|DLD_uc011kmg.1_Missense_Mutation_p.E74G|DLD_uc011kmh.1_Intron|DLD_uc011kmi.1_Intron	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	74	FAD.				branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	GAGAAAAATGAAACACTTGGT	0.353													18	71	---	---	---	---	PASS
ST7	7982	broad.mit.edu	37	7	116869938	116869938	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116869938A>C	uc011knn.1	+	14	1470	c.1465A>C	c.(1465-1467)ACC>CCC	p.T489P	ST7_uc003vio.2_3'UTR|ST7_uc003viq.2_3'UTR|ST7_uc011knm.1_3'UTR|ST7_uc003vir.2_3'UTR	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b	Error:Variant_position_missing_in_Q9NRC1_after_alignment						integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACTCACCTCACCCGCCGCTG	0.507													6	42	---	---	---	---	PASS
RPL23AP53	644128	broad.mit.edu	37	8	163401	163401	+	RNA	SNP	G	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:163401G>C	uc010lra.2	-	4		c.732C>G			RPL23AP53_uc003woq.3_RNA|RPL23AP53_uc010lrb.2_RNA	NR_003572				Homo sapiens cDNA FLJ45055 fis, clone BRAWH3022900.												0						TCTGGTGCTTGTTGGCTTTAA	0.463													7	43	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	329235	329235	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:329235G>T	uc001ifp.2	-	35	4361	c.4271C>A	c.(4270-4272)ACT>AAT	p.T1424N		NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	1424						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGTGAGCTCAGTTCTCCGCAG	0.557													17	101	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121567483	121567483	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121567483C>T	uc001leo.2	+	13	1646	c.1480C>T	c.(1480-1482)CCT>TCT	p.P494S		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	494	SAC.						phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACAGCCATTACCTGTGAAATG	0.423													22	103	---	---	---	---	PASS
PGAP2	27315	broad.mit.edu	37	11	3846652	3846652	+	Silent	SNP	G	A	A	rs151115501	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3846652G>A	uc001lys.2	+	7	1038	c.912G>A	c.(910-912)CTG>CTA	p.L304L	PGAP2_uc001lyl.2_Silent_p.L261L|PGAP2_uc010qxw.1_Silent_p.L361L|PGAP2_uc010qxx.1_3'UTR|PGAP2_uc001lyp.3_3'UTR|PGAP2_uc010qxy.1_Silent_p.L296L|PGAP2_uc010qxz.1_Silent_p.L300L|PGAP2_uc001lyn.3_3'UTR|PGAP2_uc010qya.1_RNA|PGAP2_uc001lyr.2_3'UTR|PGAP2_uc010qyb.1_3'UTR|PGAP2_uc001lyt.2_Silent_p.L87L	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN	FGF receptor activating protein 1 isoform 1	304					GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity				0						ACAAGGAGCTGCTCATAACCT	0.522											OREG0020703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	24	---	---	---	---	PASS
HIPK3	10114	broad.mit.edu	37	11	33308096	33308096	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33308096A>C	uc001mul.1	+	2	406	c.136A>C	c.(136-138)AAT>CAT	p.N46H	HIPK3_uc001mum.1_Missense_Mutation_p.N46H|HIPK3_uc009yjv.1_Missense_Mutation_p.N46H	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	46					anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						GACCTATGTGAATGGTAGAAA	0.398													19	88	---	---	---	---	PASS
SIK2	23235	broad.mit.edu	37	11	111591208	111591208	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111591208T>A	uc001plt.2	+	11	1620	c.1502T>A	c.(1501-1503)ATT>AAT	p.I501N		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	501					intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						AAAGGGAAAATTTTCTCCATG	0.438													12	60	---	---	---	---	PASS
BIN2	51411	broad.mit.edu	37	12	51685607	51685607	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51685607G>T	uc001ryg.2	-	10	1335	c.1283C>A	c.(1282-1284)CCC>CAC	p.P428H	BIN2_uc009zlz.2_Missense_Mutation_p.P396H|BIN2_uc001ryh.2_Missense_Mutation_p.P304H|BIN2_uc010sng.1_Missense_Mutation_p.P402H	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2	428	Pro-rich.					cytoplasm	protein binding			ovary(1)	1						CCCTGAGGAGGGCCTGGGGCT	0.607													16	110	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547093	132547093	+	Silent	SNP	A	G	G	rs28513925	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547093A>G	uc001ujn.2	+	46	8216	c.8181A>G	c.(8179-8181)CAA>CAG	p.Q2727Q	EP400_uc001ujl.2_Silent_p.Q2726Q|EP400_uc001ujm.2_Silent_p.Q2646Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.294													3	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22386391	22386391	+	Intron	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22386391A>G	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aiy.2_RNA|uc001wch.2_5'UTR					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTATGGCTGGAGATTGCAGGT	0.418													8	93	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75583974	75583974	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75583974T>C	uc001xrl.2	-	6	840	c.686A>G	c.(685-687)AAT>AGT	p.N229S	NEK9_uc001xrk.2_5'UTR	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	229	Protein kinase.				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		AGACTTGAAATTGTACTTTAC	0.403													23	125	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102548486	102548486	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102548486T>C	uc001yku.3	-	10	2241	c.2051A>G	c.(2050-2052)CAT>CGT	p.H684R	HSP90AA1_uc001ykv.3_Missense_Mutation_p.H806R	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	684	Required for homodimerization.				axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	CCTGTTAGCATGTGTCTGGGG	0.418													14	52	---	---	---	---	PASS
WHAMML1	339005	broad.mit.edu	37	15	23205098	23205098	+	RNA	SNP	G	A	A	rs146035894	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23205098G>A	uc001yvg.2	-	2		c.697C>T			WHAMML1_uc010ayc.2_RNA|WHAMML1_uc010ayd.2_RNA|WHAMML1_uc010aye.1_RNA	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						CTGGAAGAACGTGGTTGCCAC	0.373													3	13	---	---	---	---	PASS
WHAMML1	339005	broad.mit.edu	37	15	23205108	23205108	+	RNA	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23205108C>T	uc001yvg.2	-	2		c.687G>A			WHAMML1_uc010ayc.2_RNA|WHAMML1_uc010ayd.2_RNA|WHAMML1_uc010aye.1_RNA	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						GTGGTTGCCACGGTAACTAAT	0.393													3	12	---	---	---	---	PASS
CHRNB4	1143	broad.mit.edu	37	15	78921969	78921969	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78921969G>T	uc002bed.1	-	5	790	c.678C>A	c.(676-678)TTC>TTA	p.F226L	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.F44L	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	226	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						GCTTGATGATGAAGTCGTAAG	0.552													28	116	---	---	---	---	PASS
RHBDF1	64285	broad.mit.edu	37	16	109479	109479	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:109479A>G	uc002cfl.3	-	18	1979	c.1831T>C	c.(1831-1833)TCC>CCC	p.S611P		NM_022450	NP_071895	Q96CC6	RHDF1_HUMAN	rhomboid family 1	611	Lumenal (Potential).				cell migration|cell proliferation|negative regulation of protein secretion|protein transport|proteolysis|regulation of epidermal growth factor receptor signaling pathway|regulation of proteasomal protein catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity			ovary(1)|pancreas(1)	2		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				TACTCCCGGGAGGTGATCTCA	0.612													8	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	16465314	16465314	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16465314A>G	uc002dey.2	+	1	318	c.31A>G	c.(31-33)ATC>GTC	p.I11V						SubName: Full=cDNA FLJ42525 fis, clone BRACE3001391, highly similar to Polycystin;																		CGGCGCCCAGATCCCCATCGA	0.632													6	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	29110458	29110458	+	Intron	SNP	T	C	C	rs151074589	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29110458T>C	uc010vct.1	-						RRN3P2_uc002dsf.3_RNA|RRN3P2_uc002dsg.3_RNA|RRN3P2_uc010vdn.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAATTTTGAGTGGATAGTGAT	0.328													4	73	---	---	---	---	PASS
MAZ	4150	broad.mit.edu	37	16	29819646	29819646	+	Intron	SNP	T	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29819646T>C	uc002dty.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAZ_uc002dtv.1_Intron|MAZ_uc010vdx.1_Intron|MAZ_uc002dtw.2_Intron|MAZ_uc002dtx.2_Intron|MAZ_uc010bzg.2_Intron|MAZ_uc002dtz.1_3'UTR|MAZ_uc002dua.2_Intron|MAZ_uc010vdy.1_Intron	NM_002383	NP_002374	P56270	MAZ_HUMAN	MYC-associated zinc finger protein isoform 1						regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription|transcription initiation from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1						GTCTTGGTTTTCATGATTTTG	0.493													11	42	---	---	---	---	PASS
MAF	4094	broad.mit.edu	37	16	79632954	79632954	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79632954G>T	uc002ffn.2	-	1	1669	c.846C>A	c.(844-846)AGC>AGA	p.S282R	MAF_uc002ffm.2_Missense_Mutation_p.S282R	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	282	Represses ARE-mediated transcription.				transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		CCTCCTCCTTGCTGACCCCGC	0.657			T	IGH@	MM								8	26	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60038405	60038405	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60038405G>A	uc002izo.2	-	23	5380	c.5303C>T	c.(5302-5304)CCA>CTA	p.P1768L		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1768					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						GTCCTTCACTGGAGCCAGAAT	0.338													3	75	---	---	---	---	PASS
METRNL	284207	broad.mit.edu	37	17	81043060	81043060	+	Silent	SNP	C	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81043060C>T	uc002kgh.2	+	2	542	c.417C>T	c.(415-417)GGC>GGT	p.G139G	METRNL_uc002kgi.2_Silent_p.G57G	NM_001004431	NP_001004431	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation	139						extracellular region					0	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GCAGGCCCGGCCGGGTGCAGT	0.617													3	69	---	---	---	---	PASS
MBP	4155	broad.mit.edu	37	18	74778271	74778271	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74778271T>A	uc010xfd.1	-	3	386	c.122A>T	c.(121-123)GAG>GTG	p.E41V	MBP_uc002lmr.2_Missense_Mutation_p.E41V	NM_001025101	NP_001020272	P02686	MBP_HUMAN	Golli-mbp isoform 1	41					central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)		TTCGTTGTCCTCTGAGGTTGT	0.463													25	86	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	51994812	51994812	+	3'UTR	SNP	T	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51994812T>A	uc002pwx.1	-	8					SIGLEC12_uc002pww.1_3'UTR|SIGLEC12_uc010eoy.1_3'UTR	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like						cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		catggAGGGCTGTTAATTCTA	0.269													3	44	---	---	---	---	PASS
DUSP15	128853	broad.mit.edu	37	20	30438442	30438442	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30438442T>C	uc002wwu.1	-	7	541	c.464A>G	c.(463-465)CAA>CGA	p.Q155R				Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;	155						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CGGAGGGCATTGGGCACCAGA	0.597													4	26	---	---	---	---	PASS
PTGIS	5740	broad.mit.edu	37	20	48130813	48130813	+	Silent	SNP	C	T	T	rs140787750	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48130813C>T	uc002xut.2	-	7	1029	c.975G>A	c.(973-975)TCG>TCA	p.S325S	PTGIS_uc010zyi.1_Silent_p.S186S	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	325					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	TGGTCGTCTGCGAGACAGGCT	0.567													17	84	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73960856	73960856	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73960856C>A	uc004eby.2	-	3	4153	c.3536G>T	c.(3535-3537)AGT>ATT	p.S1179I		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	1179					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GCTGGGTGAACTTTTCTTTCT	0.408													41	161	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106117008	106117008	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106117008G>T	uc004emo.2	+	21	3341	c.3176G>T	c.(3175-3177)GGG>GTG	p.G1059V	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1059						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GAAAAAACAGGGAGCCACTTG	0.458													36	134	---	---	---	---	PASS
EIF2B3	8891	broad.mit.edu	37	1	45323200	45323200	+	Intron	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45323200delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					tgaaactccgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ATP1A1	476	broad.mit.edu	37	1	116933158	116933158	+	Intron	DEL	G	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116933158delG	uc001ege.2	+						ATP1A1_uc010owv.1_Intron|ATP1A1_uc010oww.1_Intron|ATP1A1_uc010owx.1_Intron	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a						ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	tttcttttttgtttttttttt	0.294													4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131007	54131007	+	Intron	DEL	A	-	-	rs2692524		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131007delA	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			gaaatacattaaaaaaaagaa	0.075													5	4	---	---	---	---	
MTIF2	4528	broad.mit.edu	37	2	55489677	55489678	+	Intron	INS	-	T	T	rs66500251		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55489677_55489678insT	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						ctttttttttcttttttttttt	0.114													14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92260423	92260424	+	IGR	INS	-	C	C	rs111904852		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92260423_92260424insC								FKSG73 (129929 upstream) : None (None downstream)																							tagctgATAGATAACATCAAGT	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																							TGGGCGGGGTGGTGGGGGGTGC	0.530													5	3	---	---	---	---	
COL3A1	1281	broad.mit.edu	37	2	189861013	189861022	+	Intron	DEL	TATGTATATC	-	-	rs62181729		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189861013_189861022delTATGTATATC	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	tatatatgtatatgtatatctatatatata	0.195													3	4	---	---	---	---	
C3orf19	51244	broad.mit.edu	37	3	14706745	14706746	+	Intron	INS	-	ATTG	ATTG	rs142447115	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14706745_14706746insATTG	uc003byw.2	+						C3orf19_uc010hei.1_Intron|C3orf19_uc010hej.2_Intron	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244												0						AGTAAGGAGATattgattgatt	0.386													5	3	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69299441	69299442	+	Intron	INS	-	GT	GT	rs150662802	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69299441_69299442insGT	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Intron|FRMD4B_uc011bga.1_5'Flank	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ACtgtgtgtgcgtgtgtgtgtg	0.376													5	3	---	---	---	---	
CCDC80	151887	broad.mit.edu	37	3	112329034	112329035	+	Intron	DEL	AA	-	-	rs146699705		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112329034_112329035delAA	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						CTGTGCCCAGAAAAAAAAAAAG	0.361													4	2	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126202421	126202422	+	Intron	INS	-	C	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126202421_126202422insC	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		CAGGGTTGGGGCCGCCACACCG	0.609													4	2	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195538502	195538503	+	Intron	DEL	TC	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195538502_195538503delTC	uc011bto.1	-						MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzv.2_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		tttcccctattctctctctctc	0.317													7	5	---	---	---	---	
PIGX	54965	broad.mit.edu	37	3	196458053	196458053	+	Intron	DEL	T	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196458053delT	uc010iaj.2	+						PIGX_uc003fwx.3_Intron|PIGX_uc011btx.1_Intron	NM_017861	NP_060331	Q8TBF5	PIGX_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane					0	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;1.08e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00322)		GAGATTAGCAttttttttttt	0.154													7	4	---	---	---	---	
STIM2	57620	broad.mit.edu	37	4	27009063	27009063	+	Intron	DEL	T	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27009063delT	uc003gsh.3	+						STIM2_uc003gsg.3_Intron|STIM2_uc010iex.2_Intron|STIM2_uc010iey.2_Intron	NM_020860	NP_065911	Q9P246	STIM2_HUMAN	stromal interaction molecule 2						activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)				TTAAAATAGCTTTTTTTTTTT	0.169													4	4	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48537632	48537633	+	Intron	DEL	AT	-	-	rs78674320	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537632_48537633delAT	uc003gyh.1	-						FRYL_uc003gyg.1_Intron|FRYL_uc003gyi.1_Intron|FRYL_uc003gyj.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						acacacacacatatatatataG	0.213													5	6	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94834332	94834332	+	Intron	DEL	T	-	-	rs72354377		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94834332delT	uc003klb.2	-							NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						TTAGTTAGTCttttttttttt	0.199													17	8	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170336582	170336583	+	Intron	INS	-	T	T	rs150673529		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170336582_170336583insT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron|RANBP17_uc003maw.2_Intron|RANBP17_uc011dew.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGtttatttccttttttttttt	0.277			T	TRD@	ALL								10	7	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131179560	131179561	+	Intron	INS	-	A	A	rs111521624		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131179560_131179561insA	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						aaagaaaaaagaaaaaaaaaaa	0.173													4	3	---	---	---	---	
KIF24	347240	broad.mit.edu	37	9	34224145	34224145	+	Intron	DEL	T	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34224145delT	uc010mkb.2	-						UBAP1_uc010mka.1_Intron|UBAP1_uc003ztx.2_Intron|UBAP1_uc003zty.2_Intron|UBAP1_uc011loi.1_Intron|UBAP1_uc011loj.1_Intron|UBAP1_uc003ztz.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			GATTTTGGCCTTTTTTTTTCC	0.448													4	2	---	---	---	---	
TTC16	158248	broad.mit.edu	37	9	130485247	130485247	+	Intron	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130485247delA	uc004brq.1	+						PTRH1_uc011mah.1_Intron|TTC16_uc011mai.1_Intron|TTC16_uc004brr.1_Intron|TTC16_uc010mxn.1_Intron	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16								binding				0						aatccatctcaaaaaaaaaaa	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42530029	42530029	+	IGR	DEL	C	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42530029delC								None (None upstream) : LOC441666 (297286 downstream)																							acacacaacacaaagaagtta	0.000													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTTTTGGGTCtttttttttt	0.393													6	3	---	---	---	---	
C12orf11	55726	broad.mit.edu	37	12	27081488	27081488	+	Intron	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27081488delA	uc001rhk.3	-						C12orf11_uc010sjk.1_Intron	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN	hypothetical protein LOC55726						cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)					ATTAAAAGGCAAAAAAAAAAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269189	31269190	+	Intron	INS	-	ATCAT	ATCAT	rs25559		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269189_31269190insATCAT	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CATGAGAACTCATTACCATGAT	0.351													8	4	---	---	---	---	
ANKRD33	341405	broad.mit.edu	37	12	52285209	52285210	+	3'UTR	INS	-	TA	TA	rs147140141	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52285209_52285210insTA	uc001rzf.3	+	6					ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_3'UTR|ANKRD33_uc001rze.2_3'UTR|ANKRD33_uc001rzg.3_3'UTR|ANKRD33_uc001rzi.3_3'UTR	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		TGCTCTCAACCTatatatatac	0.302													3	3	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122820981	122820982	+	Intron	DEL	GT	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122820981_122820982delGT	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		aaaaaaaaaaGTAATACCTACC	0.337											OREG0022220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50283535	50283535	+	Intron	DEL	A	-	-	rs72094235		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50283535delA	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		actctgtctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22482640	22482642	+	IGR	DEL	TGT	-	-	rs140253182		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482640_22482642delTGT								OR4N3P (68255 upstream) : MIR1268 (30587 downstream)																							ACAGAATAAATGTTGTATGAAAA	0.128													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62534991	62534991	+	RNA	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62534991delA	uc002ain.1	-	11		c.2656delT			uc002air.1_5'Flank|uc002ais.2_5'Flank|uc002ait.2_5'Flank|uc002aiu.2_5'Flank|uc002aiv.2_5'Flank|uc002aix.1_5'Flank|uc002aiy.2_5'Flank|uc002aiz.1_5'Flank|uc002aja.2_5'Flank|uc002ajb.2_5'Flank|uc002ajc.2_5'Flank|uc002ajd.2_5'Flank|uc002aje.2_5'Flank|uc002ajf.2_5'Flank|uc010uhn.1_5'Flank|uc002ajg.1_5'Flank|uc002aji.2_5'Flank					Homo sapiens cDNA FLJ38723 fis, clone KIDNE2010137, weakly similar to GOLGIN-95.																		TGAGCTCAGTAAAAAATGGGG	0.562													4	2	---	---	---	---	
NOX5	79400	broad.mit.edu	37	15	69282951	69282951	+	Intron	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69282951delA	uc002arp.1	+						NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5						angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						ccttgctcttacccccaccct	0.000													4	2	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1396789	1396806	+	Intron	DEL	GCAGGTGGGGCCAGCGGG	-	-	rs3215518		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396789_1396806delGCAGGTGGGGCCAGCGGG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGGCCATTCTGCAGGTGGGGCCAGCGGGGCAGGTGGGG	0.716													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9250198	9250198	+	IGR	DEL	T	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9250198delT								C16orf72 (36653 upstream) : GRIN2A (597069 downstream)																							ACtttctttcttttttttttt	0.348													4	3	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597927	11597930	+	Intron	DEL	CTTT	-	-	rs12946303		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597927_11597930delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGctttcttgctttcttgctttct	0.245													4	3	---	---	---	---	
RICH2	9912	broad.mit.edu	37	17	12860184	12860189	+	Intron	DEL	ACACAC	-	-	rs71369354		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12860184_12860189delACACAC	uc002gnr.3	+						RICH2_uc010vvk.1_Intron|RICH2_uc010vvl.1_Intron|RICH2_uc002gns.3_Intron|RICH2_uc010vvm.1_Intron|RICH2_uc010vvn.1_Intron|RICH2_uc002gnt.1_Intron	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						TCCCCTATAAacacacacacacacac	0.345													5	3	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037277	58037277	+	Intron	DEL	A	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037277delA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			tctcaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71398046	71398047	+	Intron	INS	-	G	G	rs111577935		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71398046_71398047insG	uc010dfm.2	-						SDK2_uc002jjt.3_Intron|SDK2_uc010dfn.2_Intron	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						TGGCCTTGGGCGGGGGGGGGCA	0.683													5	4	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80152186	80152186	+	Intron	DEL	T	-	-	rs35785177		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80152186delT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			ACTCAATGACttttttttttt	0.189													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46005696	46005697	+	IGR	INS	-	T	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46005696_46005697insT								ZBTB7C (70033 upstream) : KIAA0427 (59730 downstream)																							AAGTATTTTTGTTTTTTTTTTT	0.277													4	2	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													6	3	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61471746	61471747	+	Intron	INS	-	CT	CT	rs140852150	by1000genomes	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61471746_61471747insCT	uc002ydm.2	+						COL9A3_uc002ydn.2_Intron	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CTTTGTGTGCCGTTCCCTCGGC	0.688													3	3	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													4	2	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36744885	36744886	+	Intron	INS	-	G	G	rs113389460		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36744885_36744886insG	uc003apg.2	-						MYH9_uc003api.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TGGGAAGACCCGCCCCCCCCCC	0.619			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	134328224	134328224	+	IGR	DEL	G	-	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134328224delG								CXorf48 (22473 upstream) : ZNF75D (54665 downstream)																							TCCTCATACCGGGGGTGAGGA	0.637													4	2	---	---	---	---	
