Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TAS1R3	83756	broad.mit.edu	37	1	1268364	1268364	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1268364A>G	uc010nyk.1	+	4	1339	c.1339A>G	c.(1339-1341)AGC>GGC	p.S447G		NM_152228	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3 precursor	447	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste|sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)	Aspartame(DB00168)	GTTCGACAGCAGCGGAAACGT	0.667													8	22	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19480421	19480421	+	Silent	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19480421G>T	uc001bbi.2	-	45	6475	c.6471C>A	c.(6469-6471)GGC>GGA	p.G2157G	UBR4_uc001bbk.1_5'Flank|UBR4_uc001bbl.1_Silent_p.G94G|UBR4_uc001bbm.1_Silent_p.G1369G	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2157					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAGTCTTACTGCCACCATTGG	0.483													11	105	---	---	---	---	PASS
OTUD3	23252	broad.mit.edu	37	1	20224088	20224088	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20224088G>T	uc001bcs.3	+	4	658	c.539G>T	c.(538-540)GGA>GTA	p.G180V		NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN	OTU domain containing 3	180	OTU.										0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TATCGGTATGGAGAGCACTAC	0.512													38	63	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36230877	36230877	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36230877A>C	uc001bzi.2	-	2	155	c.75T>G	c.(73-75)GAT>GAG	p.D25E	CLSPN_uc009vux.2_Missense_Mutation_p.D25E	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	25					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGAAGGACTATCTGCTTCCT	0.408													34	105	---	---	---	---	PASS
NDUFS5	4725	broad.mit.edu	37	1	39494463	39494463	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39494463G>T	uc001ccx.2	+	2	138	c.67G>T	c.(67-69)GGT>TGT	p.G23C	NDUFS5_uc001ccy.2_Missense_Mutation_p.G23C	NM_004552	NP_004543	O43920	NDUS5_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 5,	23					mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.93e-18)		NADH(DB00157)	AATCCAGAGTGGTGAACAGCC	0.418													39	99	---	---	---	---	PASS
HECTD3	79654	broad.mit.edu	37	1	45476654	45476654	+	Silent	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45476654G>C	uc009vxk.2	-	1	374	c.276C>G	c.(274-276)GCC>GCG	p.A92A	HECTD3_uc001cmy.3_5'Flank|HECTD3_uc010olh.1_5'UTR|UROD_uc010oli.1_5'Flank|UROD_uc001cna.1_5'Flank|UROD_uc001cnb.1_5'Flank|UROD_uc010olj.1_5'Flank|UROD_uc001cnc.1_5'Flank	NM_024602	NP_078878	Q5T447	HECD3_HUMAN	HECT domain containing 3	92					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	ubiquitin-protein ligase activity				0	Acute lymphoblastic leukemia(166;0.155)					TGCTGTCGCGGGCGGCGCGGA	0.751													6	10	---	---	---	---	PASS
DHCR24	1718	broad.mit.edu	37	1	55317854	55317854	+	3'UTR	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55317854G>C	uc001cyc.1	-	9					DHCR24_uc010ooi.1_3'UTR|DHCR24_uc010ooj.1_3'UTR|DHCR24_uc010ook.1_3'UTR	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor						anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1						CTTGAGTGAAGGGAAGATGCC	0.582													17	27	---	---	---	---	PASS
RAVER2	55225	broad.mit.edu	37	1	65296679	65296679	+	3'UTR	SNP	C	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65296679C>G	uc001dbs.1	+	12					RAVER2_uc001dbt.1_3'UTR|RAVER2_uc010opb.1_3'UTR	NM_018211	NP_060681	Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2							cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)	1						GTTAAGCTCTCTCCTAATAAC	0.413													65	130	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76343914	76343914	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76343914C>A	uc001dhd.1	+	11	1492	c.1451C>A	c.(1450-1452)ACT>AAT	p.T484N		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	484					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						AACATGAGGACTCAGAAGTGC	0.333								MMR					7	96	---	---	---	---	PASS
ZNF326	284695	broad.mit.edu	37	1	90475839	90475839	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90475839T>G	uc001dnq.2	+	6	947	c.808T>G	c.(808-810)TCA>GCA	p.S270A	ZNF326_uc009wda.1_Missense_Mutation_p.S181A|ZNF326_uc001dnr.2_Missense_Mutation_p.S64A	NM_182976	NP_892021	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326 isoform 1	270					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	DNA binding			ovary(1)	1		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		CCTCAGCAAATCACCCAGTAA	0.303													32	74	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113661929	113661929	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113661929T>C	uc001edf.1	+	17	2953	c.2755T>C	c.(2755-2757)TGT>CGT	p.C919R	LRIG2_uc009wgn.1_Missense_Mutation_p.C816R	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	919	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CCGAGAATACTGTCCATACAC	0.438													14	195	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161039395	161039395	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161039395C>T	uc001fxl.2	-	1	366	c.20G>A	c.(19-21)GGA>GAA	p.G7E	ARHGAP30_uc001fxk.2_Missense_Mutation_p.G7E|ARHGAP30_uc001fxm.2_5'UTR|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_5'UTR	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	7					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTTCTTCTTTCCTTTCTGCCG	0.627													16	82	---	---	---	---	PASS
RALGPS2	55103	broad.mit.edu	37	1	178852665	178852665	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178852665G>T	uc001glz.2	+	11	1239	c.901G>T	c.(901-903)GTA>TTA	p.V301L	RALGPS2_uc010pnb.1_Missense_Mutation_p.V301L	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	301					small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						AGAAGATTTAGTAGGTCAGTA	0.323													10	100	---	---	---	---	PASS
PTGS2	5743	broad.mit.edu	37	1	186645102	186645102	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186645102G>T	uc001gsb.2	-	8	1322	c.1185C>A	c.(1183-1185)TAC>TAA	p.Y395*	PTGS2_uc009wyo.2_Nonsense_Mutation_p.Y242*	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor	395					cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	TAGAGTTGTTGTAGATAAACT	0.388													17	166	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3727534	3727534	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3727534C>T	uc010ewt.2	+	5	409	c.248C>T	c.(247-249)ACG>ATG	p.T83M		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	102							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCTTACTTCACGGGAGATTAC	0.532										HNSCC(21;0.051)			6	111	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24524884	24524884	+	Silent	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24524884T>G	uc002rfe.2	-	10	1203	c.945A>C	c.(943-945)GGA>GGC	p.G315G	ITSN2_uc002rff.2_Silent_p.G315G|ITSN2_uc002rfg.2_Silent_p.G315G|ITSN2_uc010eyd.2_Silent_p.G340G	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	315	EH 2.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTAATGGCTGTCCAGCTTTGG	0.458													6	25	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74907017	74907017	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74907017G>T	uc002sna.1	+	14	2105	c.1994G>T	c.(1993-1995)GGC>GTC	p.G665V	SEMA4F_uc010ffr.1_Missense_Mutation_p.G277V|SEMA4F_uc002snb.1_Missense_Mutation_p.G277V|SEMA4F_uc002snc.1_Missense_Mutation_p.G510V	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	665	Helical; (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GGACTGGCTGGCTTCTTCTTG	0.622													4	49	---	---	---	---	PASS
CHN1	1123	broad.mit.edu	37	2	175742574	175742574	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175742574C>A	uc002uji.2	-	6	1073	c.543G>T	c.(541-543)GAG>GAT	p.E181D	CHN1_uc010zeq.1_Missense_Mutation_p.E181D|CHN1_uc002ujj.2_Intron	NM_001822	NP_001813	P15882	CHIN_HUMAN	chimerin (chimaerin) 1 isoform a	181					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TTACCCTTTTCTCTGACACCC	0.408			T	TAF15	extraskeletal myxoid chondrosarcoma								9	99	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179572409	179572409	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179572409C>G	uc010zfg.1	-	97	25377	c.25153G>C	c.(25153-25155)GAA>CAA	p.E8385Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E5046Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9312							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCTTTATTTCCCTGCCAGCC	0.498													7	89	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191897638	191897638	+	Intron	SNP	C	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191897638C>G	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc010zgk.1_Intron|STAT4_uc002uso.2_3'UTR	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GGTTATTTTCCAAAATCTTAA	0.378													29	54	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	202003449	202003449	+	Intron	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202003449T>G	uc002uxb.3	+						CFLAR_uc002uwy.2_3'UTR|CFLAR_uc002uwz.2_Intron|CFLAR_uc002uxa.3_Intron|CFLAR_uc010zhk.1_Intron|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc010fsw.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxe.2_Intron|CFLAR_uc002uxf.2_Intron|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_Intron|CFLAR_uc010fsz.2_Intron|CFLAR_uc002uxg.2_5'Flank	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						AAAGCCCGGTTCAAACTTCTT	0.562													17	16	---	---	---	---	PASS
CPO	130749	broad.mit.edu	37	2	207820279	207820279	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207820279T>A	uc002vby.2	+	3	304	c.258T>A	c.(256-258)TAT>TAA	p.Y86*		NM_173077	NP_775100	Q8IVL8	CBPO_HUMAN	carboxypeptidase O precursor	86					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		ACCCCATGTATTATCTGAAGG	0.433													10	101	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225339013	225339013	+	Silent	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225339013T>C	uc002vny.2	-	16	2640	c.2256A>G	c.(2254-2256)GAA>GAG	p.E752E	CUL3_uc010zls.1_Silent_p.E686E|CUL3_uc010fwy.1_Silent_p.E758E	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	752					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GTGCCAAATATTCTCTCTCAA	0.373													11	128	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238277415	238277415	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277415C>T	uc002vwl.2	-	10	4976	c.4691G>A	c.(4690-4692)CGT>CAT	p.R1564H	COL6A3_uc002vwo.2_Missense_Mutation_p.R1358H|COL6A3_uc010znj.1_Missense_Mutation_p.R957H	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1564	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCGAGGAACGGATCACCTG	0.582													23	226	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183763	10183763	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183763A>G	uc003bvc.2	+	1	445	c.232A>G	c.(232-234)AAT>GAT	p.N78D	VHL_uc003bvd.2_Missense_Mutation_p.N78D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	78			N -> H (in VHLD; type I).|N -> T (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.N78K(6)|p.N78I(3)|p.F76fs*80(2)|p.F76fs*81(2)|p.N78H(2)|p.N78S(2)|p.N78T(1)|p.S72_V87>L(1)|p.C77_N78>Y(1)|p.R60fs*35(1)|p.V74fs*51(1)|p.N78_R79insN(1)|p.C77fs*53(1)|p.N78Y(1)|p.N78fs*81(1)|p.V74fs*77(1)|p.N78D(1)|p.N78fs*54(1)|p.C77_R79del(1)|p.N78fs*80(1)|p.C77*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CATCTTCTGCAATCGCAGTCC	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	4	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35770849	35770849	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35770849C>T	uc003cgb.2	+	15	1544	c.1280C>T	c.(1279-1281)CCA>CTA	p.P427L	ARPP21_uc003cga.2_Missense_Mutation_p.P373L|ARPP21_uc011axy.1_Missense_Mutation_p.P393L|ARPP21_uc003cgf.2_Missense_Mutation_p.P228L|ARPP21_uc003cgg.2_5'UTR	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	427						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						CGCACCCATCCACCTCTCCAG	0.562													5	59	---	---	---	---	PASS
ENTPD3	956	broad.mit.edu	37	3	40433646	40433646	+	Intron	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40433646G>C	uc003ckd.3	+						ENTPD3_uc010hhy.2_Intron|uc003cke.3_RNA	NM_001248	NP_001239	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase							integral to membrane	ATP binding|hydrolase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		CTGAAGGTAAGTGTGAAGGGA	0.453													29	35	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52651293	52651293	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651293A>C	uc003des.2	-	14	1815	c.1803T>G	c.(1801-1803)AAT>AAG	p.N601K	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.N601K|PBRM1_uc003der.2_Missense_Mutation_p.N569K|PBRM1_uc003det.2_Missense_Mutation_p.N616K|PBRM1_uc003deu.2_Missense_Mutation_p.N616K|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.N601K|PBRM1_uc010hmk.1_Missense_Mutation_p.N601K|PBRM1_uc003dey.2_Missense_Mutation_p.N601K|PBRM1_uc003dez.1_Missense_Mutation_p.N601K|PBRM1_uc003dfb.1_Missense_Mutation_p.N514K|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	601	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.N601fs*8(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGCCCTCCTCATTATAGTGCC	0.463			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								9	25	---	---	---	---	PASS
MSL2	55167	broad.mit.edu	37	3	135913893	135913893	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135913893G>A	uc003eqx.1	-	1	796	c.63C>T	c.(61-63)GAC>GAT	p.D21D	MSL2_uc011bmb.1_5'Flank	NM_018133	NP_060603	Q9HCI7	MSL2_HUMAN	ring finger protein 184 isoform 1	21					histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1						GGTCTCCGGGGTCGTAGTTGA	0.522													80	227	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169496987	169496987	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169496987C>T	uc003fft.2	+	3	1127	c.698C>T	c.(697-699)TCA>TTA	p.S233L	MYNN_uc011bpm.1_Missense_Mutation_p.S119L|MYNN_uc003ffu.2_Missense_Mutation_p.S233L|MYNN_uc003ffv.2_5'UTR|MYNN_uc010hwo.2_Missense_Mutation_p.S233L|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	233						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AATGATAATTCAGAACTCGAG	0.388													9	61	---	---	---	---	PASS
SKIL	6498	broad.mit.edu	37	3	170078221	170078221	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170078221G>A	uc003fgu.2	+	2	814	c.102G>A	c.(100-102)ACG>ACA	p.T34T	SKIL_uc011bps.1_Silent_p.T14T|SKIL_uc003fgv.2_Silent_p.T34T|SKIL_uc003fgw.2_Silent_p.T34T	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	34					cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AAATGATAACGGACATTCATG	0.443													24	127	---	---	---	---	PASS
CCDC50	152137	broad.mit.edu	37	3	191087771	191087771	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191087771C>T	uc003fsw.2	+	5	984	c.394C>T	c.(394-396)CCA>TCA	p.P132S	CCDC50_uc003fsv.2_Missense_Mutation_p.P132S	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform	132						cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		GAAACACTTTCCAGAGTTCCC	0.403													103	271	---	---	---	---	PASS
LMLN	89782	broad.mit.edu	37	3	197707203	197707203	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197707203C>T	uc011buo.1	+	6	578	c.556C>T	c.(556-558)CGG>TGG	p.R186W	LMLN_uc003fyt.2_Missense_Mutation_p.R134W|LMLN_uc010iar.2_Missense_Mutation_p.R186W|LMLN_uc010ias.2_Missense_Mutation_p.R134W|LMLN_uc003fyu.2_5'UTR	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	186					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		GCAGCAATGCCGGGTCTACCG	0.488													44	167	---	---	---	---	PASS
ZNF721	170960	broad.mit.edu	37	4	436954	436954	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:436954T>G	uc003gag.2	-	3	1993	c.1302A>C	c.(1300-1302)GAA>GAC	p.E434D	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Missense_Mutation_p.E466D|ZNF721_uc010ibe.2_Missense_Mutation_p.E422D	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	434						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TTTTCTTATATTCATTCAGGT	0.373													44	89	---	---	---	---	PASS
CRIPAK	285464	broad.mit.edu	37	4	1389122	1389122	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1389122C>T	uc003gdf.2	+	1	3783	c.823C>T	c.(823-825)CGA>TGA	p.R275*		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	275	8.				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCTCACGTGCCGATGTGGGGT	0.682													15	105	---	---	---	---	PASS
UBE2K	3093	broad.mit.edu	37	4	39780131	39780131	+	3'UTR	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39780131C>A	uc003guu.3	+	7					UBE2K_uc003gus.3_3'UTR|UBE2K_uc003gut.3_3'UTR|UBE2K_uc010ifn.2_RNA|UBE2K_uc011byq.1_3'UTR|UBE2K_uc003guq.3_3'UTR	NM_005339	NP_005330	P61086	UBE2K_HUMAN	ubiquitin-conjugating enzyme E2K isoform 1						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|ubiquitin protein ligase binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						TAGGATTCTGCATAGATTTCT	0.373													9	15	---	---	---	---	PASS
MRPL1	65008	broad.mit.edu	37	4	78792972	78792972	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78792972A>T	uc003hku.2	+	2	304	c.106A>T	c.(106-108)ATC>TTC	p.I36F		NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor	36							RNA binding				0						TTCTGTAAACATCCGAGTGCC	0.308													11	135	---	---	---	---	PASS
RANBP3L	202151	broad.mit.edu	37	5	36257042	36257042	+	Splice_Site	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36257042C>T	uc003jkh.2	-	10	1396	c.903_splice	c.e10+1	p.K301_splice	RANBP3L_uc011cow.1_Splice_Site_p.K326_splice	NM_145000	NP_659437	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like isoform 2						intracellular transport					ovary(1)	1	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			GATATACAGACCTTTAACACA	0.353													43	113	---	---	---	---	PASS
F2RL1	2150	broad.mit.edu	37	5	76128711	76128711	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76128711C>T	uc003keo.2	+	2	454	c.279C>T	c.(277-279)AAC>AAT	p.N93N		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	93	Helical; Name=1; (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		TGCCAAGTAACGGCATGGCCC	0.483													36	260	---	---	---	---	PASS
NBPF22P	285622	broad.mit.edu	37	5	85578601	85578601	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85578601C>A	uc003kiq.2	+	1	340	c.78C>A	c.(76-78)GAC>GAA	p.D26E		NR_003719				SubName: Full=Putative uncharacterized protein NBPF22P;												0						TATCTGCCGACCCTTTGTCCA	0.512													43	71	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128351731	128351731	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128351731G>T	uc003kuy.2	+	6	1519	c.1123G>T	c.(1123-1125)GGG>TGG	p.G375W	SLC27A6_uc003kuz.2_Missense_Mutation_p.G375W	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	375					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GAACTACACTGGGAGAATTGG	0.299													36	257	---	---	---	---	PASS
PPP2CA	5515	broad.mit.edu	37	5	133536031	133536031	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133536031T>A	uc003kze.2	-	5	1131	c.733A>T	c.(733-735)ATG>TTG	p.M245L		NM_002715	NP_002706	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha	245					ceramide metabolic process|inactivation of MAPK activity|induction of apoptosis|meiosis|negative regulation of cell growth|negative regulation of epithelial to mesenchymal transition|negative regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of protein serine/threonine kinase activity|protein dephosphorylation|regulation of cell adhesion|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction|spindle pole	metal ion binding|phosphoprotein phosphatase activity			ovary(2)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	CATACCTCCATCACTAGCTGG	0.383													5	70	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24569057	24569057	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24569057G>T	uc011djo.1	-	13	2329	c.2092C>A	c.(2092-2094)CAG>AAG	p.Q698K	KIAA0319_uc011djp.1_Missense_Mutation_p.Q653K|KIAA0319_uc003neh.1_Missense_Mutation_p.Q698K|KIAA0319_uc011djq.1_Missense_Mutation_p.Q689K|KIAA0319_uc011djr.1_Missense_Mutation_p.Q698K|KIAA0319_uc010jpt.1_Missense_Mutation_p.Q109K	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	698	PKD 4.|Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						AGTCCCTGCTGGTCTTTCACT	0.567													30	70	---	---	---	---	PASS
TDP2	51567	broad.mit.edu	37	6	24650952	24650952	+	3'UTR	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24650952C>T	uc003nej.2	-	7					TDP2_uc003nei.2_3'UTR	NM_016614	NP_057698	O95551	TYDP2_HUMAN	TRAF and TNF receptor-associated protein						cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity			ovary(1)|lung(1)	2						AGCAAACCTACCTTTCCAGAA	0.348								Direct_reversal_of_damage|Editing_and_processing_nucleases					16	21	---	---	---	---	PASS
ZNF322A	79692	broad.mit.edu	37	6	26638479	26638479	+	Silent	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26638479A>G	uc003nil.3	-	4	932	c.303T>C	c.(301-303)TGT>TGC	p.C101C	ZNF322A_uc003nij.2_5'Flank	NM_024639	NP_078915	Q6U7Q0	Z322A_HUMAN	zinc finger protein 322A	101	C2H2-type 3.			C -> R (in Ref. 1; AAQ85127).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0						CACATTTGCTACATTTATAAG	0.378													117	275	---	---	---	---	PASS
GTF2H5	404672	broad.mit.edu	37	6	158618278	158618278	+	3'UTR	SNP	A	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158618278A>C	uc003qrd.2	+	3						NM_207118	NP_997001	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5						nucleotide-excision repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		AAACCAACCCACTAACACACA	0.368								Direct_reversal_of_damage|NER					3	16	---	---	---	---	PASS
HUS1	3364	broad.mit.edu	37	7	48015247	48015247	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48015247C>T	uc003tod.1	-	5	633	c.503G>A	c.(502-504)AGT>AAT	p.S168N	HUS1_uc003toe.1_Missense_Mutation_p.S168N|HUS1_uc011kce.1_RNA	NM_004507	NP_004498	O60921	HUS1_HUMAN	HUS1 checkpoint protein	168					DNA damage checkpoint|DNA replication	Golgi apparatus|nucleolus|nucleoplasm	protein binding			ovary(2)|lung(2)|kidney(1)	5		Breast(660;0.00139)				TTCCACAACACTCTTCATAGT	0.333								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					19	45	---	---	---	---	PASS
C7orf51	222950	broad.mit.edu	37	7	100085830	100085830	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100085830G>A	uc003uvd.1	+	4	645	c.486G>A	c.(484-486)CAG>CAA	p.Q162Q	C7orf51_uc003uve.1_5'UTR	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	162										skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCCTCCGCAGAAGCCCAGGC	0.597													89	213	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	132193205	132193205	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132193205G>A	uc003vra.3	-	2	477	c.248C>T	c.(247-249)ACG>ATG	p.T83M	PLXNA4_uc003vrc.2_Missense_Mutation_p.T83M|PLXNA4_uc003vrb.2_Missense_Mutation_p.T83M	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	83	Extracellular (Potential).|Sema.					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGTCTCATGCGTCACCAAGAC	0.557													7	69	---	---	---	---	PASS
TMEM140	55281	broad.mit.edu	37	7	134849219	134849219	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849219G>A	uc003vsi.2	+	2	307	c.26G>A	c.(25-27)CGC>CAC	p.R9H	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	9	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)	1						CCTCGGTGGCGCGACCAGCTG	0.592													15	120	---	---	---	---	PASS
TMEM213	155006	broad.mit.edu	37	7	138487680	138487680	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138487680C>T	uc010lna.2	+	3	301	c.190C>T	c.(190-192)CGC>TGC	p.R64C	TMEM213_uc010lnb.2_Missense_Mutation_p.R63C	NM_001085429	NP_001078898	A2RRL7	TM213_HUMAN	transmembrane protein 213	64	Extracellular (Potential).					integral to membrane					0						CCGGTGCTGCCGCACAGGAGT	0.622													7	25	---	---	---	---	PASS
LOXL2	4017	broad.mit.edu	37	8	23167334	23167334	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23167334T>G	uc003xdh.1	-	10	2066	c.1727A>C	c.(1726-1728)GAG>GCG	p.E576A	LOXL2_uc010lty.1_Missense_Mutation_p.E115A	NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor	576	Lysyl-oxidase like.				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GCAGTTCTCCTCCATGGCACA	0.657													7	47	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25158135	25158135	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25158135G>T	uc003xeg.2	+	9	945	c.808G>T	c.(808-810)GAA>TAA	p.E270*	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xef.2_Nonsense_Mutation_p.E270*	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	270						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GATGCCCAAGGAAATAGAGAA	0.403													4	27	---	---	---	---	PASS
EPHX2	2053	broad.mit.edu	37	8	27362496	27362496	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27362496A>T	uc003xfu.2	+	4	451	c.370A>T	c.(370-372)AAC>TAC	p.N124Y	EPHX2_uc010lut.1_Missense_Mutation_p.N124Y|EPHX2_uc010luu.2_Missense_Mutation_p.N124Y|EPHX2_uc010luv.2_Missense_Mutation_p.N58Y|EPHX2_uc003xfv.2_Missense_Mutation_p.N71Y|EPHX2_uc010luw.2_Missense_Mutation_p.N58Y|EPHX2_uc011lam.1_5'UTR	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	124	Phosphatase.|Phosphate binding.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)	CATCCTCACCAACACCTGGCT	0.542													8	42	---	---	---	---	PASS
C8orf80	389643	broad.mit.edu	37	8	27931901	27931901	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27931901G>A	uc003xgm.3	-	2	170	c.27C>T	c.(25-27)GGC>GGT	p.G9G		NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center	9						nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)		GCGGTTCCTGGCCAAAAACAT	0.433													3	38	---	---	---	---	PASS
ZNF572	137209	broad.mit.edu	37	8	125989480	125989480	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125989480G>A	uc003yrr.2	+	3	1125	c.970G>A	c.(970-972)GGA>AGA	p.G324R		NM_152412	NP_689625	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	324					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AATACATACAGGAGAAAAGCC	0.388										HNSCC(60;0.17)			27	66	---	---	---	---	PASS
EIF2C2	27161	broad.mit.edu	37	8	141549418	141549418	+	Splice_Site	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141549418C>T	uc003yvn.2	-	16	2209	c.2169_splice	c.e16+1	p.R723_splice	EIF2C2_uc010men.2_Splice_Site_p.R646_splice|EIF2C2_uc010meo.2_Splice_Site_p.R723_splice	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			CAGAAACTCACCCGCTCGTTC	0.592													40	85	---	---	---	---	PASS
EIF2C2	27161	broad.mit.edu	37	8	141566069	141566069	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141566069T>C	uc003yvn.2	-	10	1235	c.1195A>G	c.(1195-1197)ATC>GTC	p.I399V	EIF2C2_uc010men.2_Missense_Mutation_p.I322V|EIF2C2_uc010meo.2_Missense_Mutation_p.I399V	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	399					mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			TTGACCATGATTCCAAATTCA	0.577													16	120	---	---	---	---	PASS
CNTLN	54875	broad.mit.edu	37	9	17298453	17298453	+	Intron	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17298453C>A	uc003zmz.2	+						CNTLN_uc003zmx.3_3'UTR|CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		ATTTTTACTTCCTTTTACATG	0.234													4	9	---	---	---	---	PASS
TUSC1	286319	broad.mit.edu	37	9	25677810	25677810	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25677810C>T	uc003zpx.2	-	1	1047	c.510G>A	c.(508-510)CGG>CGA	p.R170R		NM_001004125	NP_001004125	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	170	Potential.										0	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		GCAGCAGGGCCCGGCGGTACA	0.711													2	1	---	---	---	---	PASS
FAM120A	23196	broad.mit.edu	37	9	96214409	96214409	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96214409G>T	uc004atw.2	+	1	237	c.212G>T	c.(211-213)TGG>TTG	p.W71L	FAM120AOS_uc004atm.2_5'Flank|FAM120AOS_uc004atn.3_5'Flank|FAM120AOS_uc004ato.3_5'Flank|FAM120AOS_uc004atp.3_5'Flank|FAM120AOS_uc004atq.3_5'Flank|FAM120AOS_uc004atr.3_5'Flank|FAM120AOS_uc004ats.3_Intron|FAM120AOS_uc004att.3_Intron|FAM120AOS_uc004atu.3_Intron|FAM120A_uc004atv.2_Missense_Mutation_p.W71L	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	71						cytoplasm|plasma membrane	RNA binding				0						GGCGGCCAGTGGAACCACATG	0.692													3	6	---	---	---	---	PASS
ALG2	85365	broad.mit.edu	37	9	101983421	101983421	+	Intron	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101983421T>C	uc004azf.2	-						ALG2_uc004azg.2_Splice_Site|SEC61B_uc004azh.2_5'Flank	NM_033087	NP_149078	Q9H553	ALG2_HUMAN	alpha-1,3-mannosyltransferase ALG2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in endoplasmic reticulum|protein N-linked glycosylation via asparagine|response to calcium ion	endoplasmic reticulum membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	alpha-1,3-mannosyltransferase activity|calcium-dependent protein binding|glycolipid 3-alpha-mannosyltransferase activity|protein anchor|protein heterodimerization activity|protein N-terminus binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.0559)				GCAAATGGCCTGAAAGGAGAG	0.443													21	47	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130207059	130207059	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130207059C>T	uc004bqw.3	+	5	1494	c.1080C>T	c.(1078-1080)CCC>CCT	p.P360P	ZNF79_uc011maf.1_Silent_p.P336P|ZNF79_uc011mag.1_Silent_p.P336P	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	360					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GGGAGAAGCCCTACAGATGTG	0.572													27	71	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130207060	130207060	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130207060T>C	uc004bqw.3	+	5	1495	c.1081T>C	c.(1081-1083)TAC>CAC	p.Y361H	ZNF79_uc011maf.1_Missense_Mutation_p.Y337H|ZNF79_uc011mag.1_Missense_Mutation_p.Y337H	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	361	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GGAGAAGCCCTACAGATGTGC	0.577													27	71	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7605315	7605315	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7605315C>T	uc001ijq.2	-	14	2639	c.2560G>A	c.(2560-2562)GAA>AAA	p.E854K	ITIH5_uc001ijp.2_Missense_Mutation_p.E640K	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	854					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GCAGGGTCTTCTGTGAGTCTG	0.567													5	60	---	---	---	---	PASS
FRMD4A	55691	broad.mit.edu	37	10	13702514	13702514	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13702514G>A	uc001ims.2	-	20	2052	c.1700C>T	c.(1699-1701)TCT>TTT	p.S567F	FRMD4A_uc009xjf.1_Missense_Mutation_p.S567F	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	567						cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						CTTGTGAGGAGAATGTAGGGG	0.587											OREG0020030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	63	---	---	---	---	PASS
PARVA	55742	broad.mit.edu	37	11	12518075	12518075	+	Silent	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12518075G>T	uc001mki.2	+	5	520	c.471G>T	c.(469-471)CTG>CTT	p.L157L	PARVA_uc010rck.1_Silent_p.L104L	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha	157	CH 1.				cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		AGCAAAAACTGCAGACTGTCC	0.473													9	14	---	---	---	---	PASS
FANCF	2188	broad.mit.edu	37	11	22646152	22646152	+	3'UTR	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22646152A>G	uc001mql.1	-	1						NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F						DNA repair	nucleoplasm	protein binding			skin(1)	1						GGACACACGAAGGCATATATT	0.303			N|F			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	23	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61897891	61897891	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61897891A>T	uc001nsw.1	+	4	1094	c.892A>T	c.(892-894)ACG>TCG	p.T298S	INCENP_uc009ynv.2_Missense_Mutation_p.T298S|INCENP_uc009ynw.1_Missense_Mutation_p.T298S|INCENP_uc001nsx.1_Missense_Mutation_p.T298S	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	298					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GGGCTCTCGCACGGACTCTCA	0.632													35	98	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61897892	61897892	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61897892C>T	uc001nsw.1	+	4	1095	c.893C>T	c.(892-894)ACG>ATG	p.T298M	INCENP_uc009ynv.2_Missense_Mutation_p.T298M|INCENP_uc009ynw.1_Missense_Mutation_p.T298M|INCENP_uc001nsx.1_Missense_Mutation_p.T298M	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	298					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GGCTCTCGCACGGACTCTCAA	0.632													36	100	---	---	---	---	PASS
PAK1	5058	broad.mit.edu	37	11	77066800	77066800	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77066800T>C	uc001oyh.3	-	7	1218	c.685A>G	c.(685-687)ACC>GCC	p.T229A	PAK1_uc010rso.1_Missense_Mutation_p.T131A|PAK1_uc001oyg.3_Missense_Mutation_p.T229A|PAK1_uc001oyi.1_Missense_Mutation_p.T229A|PAK1_uc010rsn.1_Intron	NM_002576	NP_002567	Q13153	PAK1_HUMAN	p21-activated kinase 1 isoform 2	229	Interaction with CRIPAK.				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)					GGTGGAGTGGTGTTATTTTCA	0.438													12	238	---	---	---	---	PASS
ME3	10873	broad.mit.edu	37	11	86159278	86159278	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86159278T>C	uc001pbz.2	-	10	1405	c.1151A>G	c.(1150-1152)CAT>CGT	p.H384R	ME3_uc001pca.2_Missense_Mutation_p.H384R|ME3_uc009yvk.2_Missense_Mutation_p.H384R	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor	384					aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	CTCCTTTTCATGGTTCAGGTG	0.532													15	136	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780709	88780709	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780709T>G	uc001pcq.2	-	1	532	c.332A>C	c.(331-333)GAG>GCG	p.E111A	GRM5_uc009yvm.2_Missense_Mutation_p.E111A|GRM5_uc009yvn.1_Missense_Mutation_p.E111A	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	111	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TCTTATGAACTCAATGCTCTG	0.517													10	63	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94554897	94554897	+	Silent	SNP	C	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94554897C>G	uc001pfb.2	+	4	1493	c.1323C>G	c.(1321-1323)GCC>GCG	p.A441A	AMOTL1_uc001pfc.2_Silent_p.A391A	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	441	Potential.					cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TGGAGCGAGCCCAGCAAATGG	0.602													19	66	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108236074	108236074	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108236074A>G	uc001pkb.1	+	63	9395	c.9010A>G	c.(9010-9012)AAA>GAA	p.K3004E	ATM_uc009yxr.1_Missense_Mutation_p.K3004E|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.K1656E	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	3004					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GAGTTTCAACAAAGTAGCTGA	0.398			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			16	114	---	---	---	---	PASS
WNT5B	81029	broad.mit.edu	37	12	1748873	1748873	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1748873C>T	uc009zdq.2	+	4	594	c.352C>T	c.(352-354)CAC>TAC	p.H118Y	WNT5B_uc001qjj.2_Missense_Mutation_p.H118Y|WNT5B_uc001qjk.2_Missense_Mutation_p.H118Y|WNT5B_uc001qjl.2_Missense_Mutation_p.H118Y	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,	118					angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CGCCTTCACCCACGCGGTGAG	0.736													4	4	---	---	---	---	PASS
MRPL51	51258	broad.mit.edu	37	12	6602132	6602132	+	Missense_Mutation	SNP	G	C	C	rs11559083		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6602132G>C	uc001qom.2	-	2	255	c.86C>G	c.(85-87)CCT>CGT	p.P29R	MRPL51_uc001qon.1_RNA|NCAPD2_uc009zen.1_5'Flank|NCAPD2_uc001qoo.2_5'Flank|NCAPD2_uc010sfd.1_5'Flank	NM_016497	NP_057581	Q4U2R6	RM51_HUMAN	mitochondrial ribosomal protein L51 precursor	29					translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome				0						GATCAATCTAGGCACACCTGG	0.517													22	101	---	---	---	---	PASS
MRPL51	51258	broad.mit.edu	37	12	6602137	6602137	+	Silent	SNP	A	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6602137A>C	uc001qom.2	-	2	250	c.81T>G	c.(79-81)GGT>GGG	p.G27G	MRPL51_uc001qon.1_RNA|NCAPD2_uc009zen.1_5'Flank|NCAPD2_uc001qoo.2_5'Flank|NCAPD2_uc010sfd.1_5'Flank	NM_016497	NP_057581	Q4U2R6	RM51_HUMAN	mitochondrial ribosomal protein L51 precursor	27					translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome				0						ATCTAGGCACACCTGGGGATG	0.512													23	97	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49443747	49443747	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49443747G>A	uc001rta.3	-	11	3624	c.3624C>T	c.(3622-3624)ATC>ATT	p.I1208I		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1208					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCAGATTAGAGATCTCGTTAA	0.607			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			25	82	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57588284	57588284	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57588284C>A	uc001snd.2	+	49	8532	c.8066C>A	c.(8065-8067)CCA>CAA	p.P2689Q	MIR1228_hsa-mir-1228|MI0006318_5'Flank	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2689	LDL-receptor class A 14.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGCGACTGCCCAGGTGGGCGG	0.672													10	173	---	---	---	---	PASS
AVIL	10677	broad.mit.edu	37	12	58204236	58204236	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58204236C>T	uc001sqj.1	-	6	686	c.657G>A	c.(655-657)CTG>CTA	p.L219L	AVIL_uc009zqe.1_Silent_p.L212L|AVIL_uc001sqk.1_5'Flank|AVIL_uc001sql.3_Silent_p.L196L	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	219	Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GGACCTTCATCAGCTCTGGGC	0.517													14	156	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67686419	67686419	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67686419G>A	uc001stn.2	+	3	667	c.230G>A	c.(229-231)AGT>AAT	p.S77N		NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	77	HEAT 2.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CCTTTAGTGAGTAAAGTGAAA	0.318													8	116	---	---	---	---	PASS
DRAM1	55332	broad.mit.edu	37	12	102315190	102315190	+	3'UTR	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102315190G>A	uc001tix.2	+	7					DRAM1_uc010svv.1_3'UTR	NM_018370	NP_060840	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1						apoptosis|autophagy	integral to membrane|lysosomal membrane				ovary(1)	1						CCTAATAGTTGTATTTCTAAA	0.358													3	19	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106820975	106820975	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820975C>T	uc001tlp.2	+	13	1324	c.1102C>T	c.(1102-1104)CTT>TTT	p.L368F	POLR3B_uc001tlq.2_Missense_Mutation_p.L310F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	368					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TTTTTTTTAGCTTTTATCTCT	0.274													5	14	---	---	---	---	PASS
RAD9B	144715	broad.mit.edu	37	12	110969525	110969525	+	3'UTR	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110969525A>G	uc001trf.3	+	12					RAD9B_uc001trg.3_3'UTR|RAD9B_uc010sya.1_3'UTR|RAD9B_uc001tre.3_3'UTR|RAD9B_uc001trd.3_3'UTR	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN	RAD9 homolog B						cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding			pancreas(1)|skin(1)	2						GCCCTTTAAGAGTTAGCTTTT	0.408													3	20	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117710301	117710301	+	Silent	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117710301G>C	uc001twm.1	-	10	2414	c.1728C>G	c.(1726-1728)CTC>CTG	p.L576L		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	576					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CAATCTCTAGGAGCATGTTGG	0.612													10	22	---	---	---	---	PASS
TSSK4	283629	broad.mit.edu	37	14	24675911	24675911	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24675911G>T	uc001wng.2	+	2	590	c.422G>T	c.(421-423)AGC>ATC	p.S141I	TM9SF1_uc010tob.1_Intron|TSSK4_uc001wne.2_Missense_Mutation_p.S65I|TSSK4_uc001wnf.2_5'UTR|TSSK4_uc001wnh.2_Missense_Mutation_p.S141I	NM_174944	NP_777604	Q6SA08	TSSK4_HUMAN	testis-specific serine kinase 4	141	Protein kinase.				cell differentiation|multicellular organismal development|positive regulation of CREB transcription factor activity|spermatogenesis		ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity				0				GBM - Glioblastoma multiforme(265;0.018)		TACCTGCACAGCAAGAGCATC	0.592													21	41	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997428	54997428	+	Intron	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997428T>C	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						TAAGCACTCCTCAAGCATTAG	0.343													3	39	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68038960	68038960	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68038960C>A	uc001xjl.1	+	11	1836	c.1694C>A	c.(1693-1695)TCA>TAA	p.S565*	PLEKHH1_uc010tsw.1_Nonsense_Mutation_p.S133*|PLEKHH1_uc001xjm.1_Nonsense_Mutation_p.S80*|PLEKHH1_uc001xjn.1_Nonsense_Mutation_p.S80*	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	565						cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CAGCGCACCTCATCCTACTCC	0.662													4	10	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088745	94088745	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088745C>T	uc001ybv.1	+	28	4784	c.4701C>T	c.(4699-4701)GAC>GAT	p.D1567D	KIAA1409_uc001ybs.1_Silent_p.D1545D	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1722						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ACCCTATGGACGCCGAAGGAT	0.512													30	136	---	---	---	---	PASS
C15orf41	84529	broad.mit.edu	37	15	36984363	36984363	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36984363G>T	uc001zje.3	+	7	713	c.463G>T	c.(463-465)GAC>TAC	p.D155Y	C15orf41_uc001zjd.2_Missense_Mutation_p.D155Y|C15orf41_uc010bbb.1_Missense_Mutation_p.D57Y|C15orf41_uc001zjf.2_Missense_Mutation_p.D57Y|C15orf41_uc010uci.1_Missense_Mutation_p.D57Y	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1	155							protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ACCACTAGTGGACTGCATCAA	0.438													13	49	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	65957783	65957783	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65957783C>T	uc002aph.2	-	29	5505	c.5127G>A	c.(5125-5127)ATG>ATA	p.M1709I	DENND4A_uc002api.2_Missense_Mutation_p.M1752I	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1709					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						TATCTTCAGACATACAGTGGC	0.294													31	92	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	C	C	rs1062001		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056021T>C	uc002bkm.2	-	6		c.539A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GTAGCTGCTCTACCTTAGATG	0.502													7	12	---	---	---	---	PASS
BRD7	29117	broad.mit.edu	37	16	50402667	50402667	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50402667T>C	uc002egf.1	-	2	86	c.19A>G	c.(19-21)AAG>GAG	p.K7E	BRD7_uc002ege.1_Missense_Mutation_p.K7E	NM_013263	NP_037395	Q9NPI1	BRD7_HUMAN	bromodomain containing 7	7	Lys-rich.				cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding				0		all_cancers(37;0.0127)				GACTTGTGCTTCTTGTGCTTC	0.254													10	35	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67290903	67290903	+	Missense_Mutation	SNP	C	T	T	rs35182421		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67290903C>T	uc002esm.2	+	7	1285	c.1222C>T	c.(1222-1224)CGG>TGG	p.R408W	SLC9A5_uc010cee.2_Missense_Mutation_p.R113W|SLC9A5_uc010vji.1_5'UTR	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	408	Helical; (Potential).				regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TGGGGGCCTGCGGGGGGCTGT	0.562													17	173	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76481968	76481968	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76481968T>C	uc002feu.1	+	7	983	c.598T>C	c.(598-600)TCC>CCC	p.S200P	CNTNAP4_uc002fev.1_Missense_Mutation_p.S112P|CNTNAP4_uc010chb.1_Missense_Mutation_p.S175P|CNTNAP4_uc002fex.1_Missense_Mutation_p.S203P|CNTNAP4_uc002few.2_Missense_Mutation_p.S175P	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	200	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TGATCAAAAATCCCTGAGCCC	0.378													31	82	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3921211	3921211	+	Silent	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3921211C>T	uc002fxe.2	-	47	7624	c.7560G>A	c.(7558-7560)CGG>CGA	p.R2520R	ZZEF1_uc002fxg.1_5'Flank	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2520							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TGGGCTGCCACCGCTGAGCCA	0.537													11	71	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	4005690	4005690	+	Silent	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4005690A>G	uc002fxe.2	-	9	1657	c.1593T>C	c.(1591-1593)ACT>ACC	p.T531T	ZZEF1_uc002fxk.1_Silent_p.T531T	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	531							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ATGCCTGAAGAGTCAACTGGA	0.448													61	133	---	---	---	---	PASS
CYTSB	92521	broad.mit.edu	37	17	20150580	20150580	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20150580T>A	uc002gwq.2	+	9	2691	c.2546T>A	c.(2545-2547)CTA>CAA	p.L849Q	CYTSB_uc002gws.2_Missense_Mutation_p.L849Q|CYTSB_uc002gwv.2_Missense_Mutation_p.L768Q|CYTSB_uc010vzf.1_Missense_Mutation_p.L189Q|CYTSB_uc002gww.2_Missense_Mutation_p.L625Q	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	849						nucleus					0						AGAAGTCCCCTAAGTGGGATA	0.383													9	46	---	---	---	---	PASS
UTP6	55813	broad.mit.edu	37	17	30213014	30213014	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30213014C>G	uc002hgr.2	-	9	771	c.688G>C	c.(688-690)GTA>CTA	p.V230L	UTP6_uc002hgq.2_Missense_Mutation_p.V46L|UTP6_uc010cst.2_Missense_Mutation_p.V79L|UTP6_uc010wbw.1_Missense_Mutation_p.V230L	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66	230					rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				ATTATGCTTACAGAATTTTTG	0.313													52	142	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066807	9066807	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066807A>T	uc002mkp.2	-	3	20843	c.20639T>A	c.(20638-20640)ATG>AAG	p.M6880K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6882	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGAAGGATGCATGGCTTCTAT	0.488													64	159	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11144146	11144146	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11144146C>T	uc002mqf.3	+	26	4011	c.3727C>T	c.(3727-3729)CGG>TGG	p.R1243W	SMARCA4_uc010dxp.2_Missense_Mutation_p.R1243W|SMARCA4_uc010dxo.2_Missense_Mutation_p.R1243W|SMARCA4_uc010dxq.2_Missense_Mutation_p.R1243W|SMARCA4_uc010dxr.2_Missense_Mutation_p.R1243W|SMARCA4_uc002mqj.3_Missense_Mutation_p.R1243W|SMARCA4_uc010dxs.2_Missense_Mutation_p.R1243W|SMARCA4_uc010dxt.1_Missense_Mutation_p.R463W|SMARCA4_uc002mqh.3_Missense_Mutation_p.R366W|SMARCA4_uc002mqi.1_Missense_Mutation_p.R446W	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	1243	Helicase C-terminal.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CAGCCATGAGCGGCGCGCCTT	0.637			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				8	57	---	---	---	---	PASS
ZNF878	729747	broad.mit.edu	37	19	12155240	12155240	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12155240A>T	uc002mta.1	-	5	1117	c.1117T>A	c.(1117-1119)TTT>ATT	p.F373I		NM_001080404	NP_001073873	C9JN71	ZN878_HUMAN	zinc finger protein 878	326	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						TGATAGCGAAAGGAAGTGGAA	0.388													52	139	---	---	---	---	PASS
ZNF574	64763	broad.mit.edu	37	19	42582777	42582777	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42582777G>C	uc002osm.3	+	2	188	c.19G>C	c.(19-21)GAG>CAG	p.E7Q	ZNF574_uc002osk.3_Missense_Mutation_p.E97Q	NM_022752	NP_073589	Q6ZN55	ZN574_HUMAN	zinc finger protein 574	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.059)				GGAATCAGAGGAGACAGTCCT	0.547													34	184	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32344965	32344965	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32344965G>C	uc002wzy.2	+	6	773	c.753G>C	c.(751-753)CAG>CAC	p.Q251H	ZNF341_uc002wzx.2_Missense_Mutation_p.Q251H|ZNF341_uc010geq.2_Missense_Mutation_p.Q161H|ZNF341_uc010ger.2_RNA	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	251					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TGCCAAACCAGTGTGTGGAGC	0.602													16	286	---	---	---	---	PASS
SEMG1	6406	broad.mit.edu	37	20	43837138	43837138	+	Silent	SNP	T	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43837138T>C	uc002xni.2	+	2	1257	c.1200T>C	c.(1198-1200)GGT>GGC	p.G400G	SEMG1_uc002xnj.2_Silent_p.G340G|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Silent_p.G340G	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	400					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				CATGGCATGGTGAAAATGCAA	0.438													11	82	---	---	---	---	PASS
KRTAP10-5	386680	broad.mit.edu	37	21	46000020	46000020	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46000020A>G	uc002zfl.1	-	1	462	c.436T>C	c.(436-438)TCT>CCT	p.S146P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	146	22 X 5 AA repeats of C-C-X(3).					keratin filament					0						GAATCCTCAGAACAGGTGGGC	0.602													79	144	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47841950	47841950	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47841950G>C	uc002zji.3	+	32	7198	c.7091G>C	c.(7090-7092)GGT>GCT	p.G2364A	PCNT_uc002zjj.2_Missense_Mutation_p.G2246A	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2364					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CAAACTGCTGGTCCTGTGACC	0.597													15	48	---	---	---	---	PASS
MTP18	51537	broad.mit.edu	37	22	30805428	30805428	+	Translation_Start_Site	SNP	T	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30805428T>A	uc010gvx.1	+	2	110	c.-141T>A	c.(-143--139)GTTTG>GTATG		SEC14L2_uc003ahq.2_Missense_Mutation_p.F178Y|SEC14L2_uc003ahr.2_Missense_Mutation_p.F178Y|SEC14L2_uc011akx.1_Missense_Mutation_p.F124Y|SEC14L2_uc003ahs.2_Missense_Mutation_p.F104Y|SEC14L2_uc011aky.1_Missense_Mutation_p.F95Y|SEC14L2_uc003aht.2_RNA|SEC14L2_uc003ahu.3_Missense_Mutation_p.F2Y|SEC14L2_uc010gvv.2_RNA|SEC14L2_uc010gvw.1_RNA|MTP18_uc003ahv.1_Missense_Mutation_p.F2Y|MTP18_uc010gvy.1_Missense_Mutation_p.F2Y			Q9UDX5	MTFP1_HUMAN	Homo sapiens mRNA for KIAA1186 protein, partial cds.						apoptosis|carbon utilization	integral to membrane|mitochondrial inner membrane	carbonate dehydratase activity|zinc ion binding				0						CTCTGCATGTTTGAGGAAAAT	0.448													74	139	---	---	---	---	PASS
SMCR7L	54471	broad.mit.edu	37	22	39909685	39909685	+	Missense_Mutation	SNP	G	A	A	rs138315984		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39909685G>A	uc003axx.2	+	6	1247	c.749G>A	c.(748-750)CGC>CAC	p.R250H	SMCR7L_uc003axw.2_Missense_Mutation_p.R250H|SMCR7L_uc010gxz.1_Missense_Mutation_p.R72H|SMCR7L_uc003axy.2_Missense_Mutation_p.R72H	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN	hypothetical protein LOC54471	250						integral to membrane|mitochondrion				central_nervous_system(1)	1	Melanoma(58;0.04)					TACTGGGACCGCTGTGTAGTA	0.527													4	50	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998267	27998267	+	Silent	SNP	G	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998267G>A	uc004dbx.1	-	1	1300	c.1185C>T	c.(1183-1185)TGC>TGT	p.C395C		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	395	WD 5.									ovary(3)|skin(1)	4						TGTACACAACGCAGGTGATGT	0.418													17	172	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73063111	73063111	+	RNA	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73063111A>G	uc004ebm.1	-	1		c.9478T>C				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						TCACATTAACAGTACAAGGGG	0.428													53	131	---	---	---	---	PASS
RAB40A	142684	broad.mit.edu	37	X	102755009	102755009	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102755009A>G	uc004ekk.2	-	3	1018	c.676T>C	c.(676-678)TCC>CCC	p.S226P		NM_080879	NP_543155	Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	226	SOCS box.				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0						TTAGCCATGGAGAAGGACTTG	0.582													12	197	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105450813	105450813	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105450813G>T	uc004emf.1	+	4	2037	c.1388G>T	c.(1387-1389)AGT>ATT	p.S463I	MUM1L1_uc004emg.1_Missense_Mutation_p.S463I	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	463										ovary(2)|pancreas(1)|skin(1)	4						GAGGATTATAGTGAGAGTATT	0.363													18	147	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140984220	140984220	+	Intron	SNP	C	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140984220C>A	uc011mwp.1	+						MAGEC3_uc004fbs.2_Translation_Start_Site|MAGEC3_uc010nsj.2_Intron	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1											skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCTACAGGTTCTGAGGGAGCA	0.567													3	32	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16926036	16926039	+	Intron	DEL	ACGT	-	-	rs59869826		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16926036_16926039delACGT	uc009vos.1	-							NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		acacacacacacGTGAGCCACCGG	0.127													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61509502	61509505	+	IGR	DEL	ACAC	-	-	rs71830791		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61509502_61509505delACAC								C1orf87 (970076 upstream) : NFIA (33441 downstream)																							TTTCCCCCCAacacacacacacac	0.466													4	2	---	---	---	---	
DNAJC6	9829	broad.mit.edu	37	1	65719035	65719036	+	5'Flank	INS	-	TG	TG	rs138371865	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65719035_65719036insTG	uc001dcc.1	+						uc001dcb.1_5'Flank	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6						cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						taatttgtgtctgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110663163	110663164	+	IGR	INS	-	CAA	CAA	rs59697253		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110663163_110663164insCAA								UBL4B (6595 upstream) : SLC6A17 (29968 downstream)																							accatcactaccaccaccatca	0.050													5	3	---	---	---	---	
ASH1L	55870	broad.mit.edu	37	1	155319035	155319037	+	Intron	DEL	GAG	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155319035_155319037delGAG	uc009wqq.2	-						RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Intron|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATGGCTGATAGAGGAGGGTAAAA	0.345													27	15	---	---	---	---	
FMO2	2327	broad.mit.edu	37	1	171178336	171178336	+	3'UTR	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171178336delA	uc001ghk.1	+	9					FMO2_uc010pmd.1_3'UTR	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2						drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTCCTAAAGAAAAAAAAAAA	0.348													4	2	---	---	---	---	
SNRPE	6635	broad.mit.edu	37	1	203832612	203832613	+	Intron	INS	-	T	T			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203832612_203832613insT	uc001hai.2	+						SNRPE_uc010pqn.1_Intron	NM_003094	NP_003085	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|RNA binding				0	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			cgcccagctaattttttttgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211708431	211708438	+	IGR	DEL	CCTTCCTT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211708431_211708438delCCTTCCTT								RD3 (42172 upstream) : SLC30A1 (39943 downstream)																							TCTCTACTCCccttccttccttccttcc	0.303													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060847	11060848	+	IGR	DEL	TG	-	-	rs33928142		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060847_11060848delTG								KCNF1 (6497 upstream) : C2orf50 (212331 downstream)																							tgcgtgtgcctgtgtgtgtgtg	0.391													8	4	---	---	---	---	
TMEM131	23505	broad.mit.edu	37	2	98451037	98451037	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98451037delA	uc002syh.3	-						TMEM131_uc010yvg.1_Intron	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6						TACAGGGGTTAAAAAAAAAAA	0.313													4	4	---	---	---	---	
ZC3H6	376940	broad.mit.edu	37	2	113043538	113043538	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113043538delA	uc002thq.1	+							NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6								nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4						tctccgtctcaaaaaaaaaaa	0.119													9	5	---	---	---	---	
GPR17	2840	broad.mit.edu	37	2	128406741	128406748	+	Intron	DEL	AGGAAGGA	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128406741_128406748delAGGAAGGA	uc010yzn.1	+						LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Intron|GPR17_uc010yzo.1_Intron|GPR17_uc002tpd.2_Intron	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a							integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		agaggaaggtaggaaggaaggaaggaag	0.173													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153797842	153797845	+	IGR	DEL	CTTT	-	-	rs150476417		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153797842_153797845delCTTT								ARL6IP6 (180075 upstream) : RPRM (536007 downstream)																							tccttccttcctttgtctcgctcc	0.000													1	5	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197081725	197081725	+	Intron	DEL	A	-	-	rs147561204	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197081725delA	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						AAATAATGGCATCTCACCTGT	0.328													100	47	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	205042229	205042230	+	IGR	INS	-	TCCC	TCCC	rs78125796	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205042229_205042230insTCCC								ICOS (215933 upstream) : PARD3B (368286 downstream)																							ccttccttccttccctccctcc	0.030													3	3	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238636499	238636502	+	Intron	DEL	TCTT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238636499_238636502delTCTT	uc002vxe.2	+						LRRFIP1_uc002vxc.2_Intron|LRRFIP1_uc010znm.1_Intron|LRRFIP1_uc002vxd.2_Intron|LRRFIP1_uc002vxf.2_Intron	NM_001137552	NP_001131024	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TCAGTTTTTCTCTTTTCTTCATTG	0.407													96	47	---	---	---	---	
SEPT2	4735	broad.mit.edu	37	2	242276633	242276633	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242276633delA	uc002wbc.2	+						SEPT2_uc002wbd.2_Intron|SEPT2_uc002wbf.2_Intron|SEPT2_uc002wbg.2_Intron|SEPT2_uc002wbh.2_Intron|SEPT2_uc010zop.1_Intron	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN	septin 2						cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding			central_nervous_system(1)	1		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		catagtttccaaaaacttcca	0.085													8	7	---	---	---	---	
ROBO1	6091	broad.mit.edu	37	3	78760476	78760479	+	Intron	DEL	TCCT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78760476_78760479delTCCT	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron|ROBO1_uc003dqf.1_Intron	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		tctctctctctccttccttccttc	0.074													3	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171759149	171759150	+	Intron	INS	-	TTTC	TTTC	rs141385729	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171759149_171759150insTTTC	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TTAAAAATCGTtttctttcttt	0.168													2	6	---	---	---	---	
NOP14	8602	broad.mit.edu	37	4	2953837	2953837	+	Intron	DEL	A	-	-	rs34128991		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2953837delA	uc003ggj.1	-						C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron|NOP14_uc010icq.1_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						tgtctcaaagaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4147375	4147376	+	IGR	INS	-	G	G			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4147375_4147376insG								LOC348926 (190227 upstream) : OTOP1 (43154 downstream)																							CAGTGGTAGATGTGAAGATGAA	0.604													4	2	---	---	---	---	
C4orf29	80167	broad.mit.edu	37	4	128949558	128949558	+	Intron	DEL	T	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128949558delT	uc003ifr.2	+						C4orf29_uc003ifs.2_Intron|C4orf29_uc003ift.2_Intron|C4orf29_uc003ifu.2_Intron|C4orf29_uc010inz.2_Intron|C4orf29_uc003ifv.2_Intron	NM_001039717	NP_001034806	Q0P651	CD029_HUMAN	hypothetical protein LOC80167 precursor							extracellular region				ovary(1)	1						gTCTTTTCTCTTTTTTTTTTG	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149676384	149676385	+	IGR	INS	-	TC	TC	rs144863566	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149676384_149676385insTC								NR3C2 (312741 upstream) : None (None downstream)																							cctcctccctttctctctctct	0.000													6	4	---	---	---	---	
CBR4	84869	broad.mit.edu	37	4	169931341	169931341	+	5'UTR	DEL	G	-	-	rs67009551		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169931341delG	uc003iry.2	-	1					CBR4_uc011cjy.1_RNA|CBR4_uc003irz.1_5'UTR	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		aaaaaaaaaagaaaaaaaaaG	0.483											OREG0016397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2681739	2681740	+	IGR	INS	-	AAGG	AAGG	rs139363319	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681739_2681740insAAGG								IRX4 (798859 upstream) : IRX2 (64541 downstream)																							aaagagagagaaaggaaggaag	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4119829	4119834	+	IGR	DEL	CTTTCC	-	-	rs143387872	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4119829_4119834delCTTTCC								IRX1 (518313 upstream) : LOC340094 (914638 downstream)																							ctttctttctctttccttctttcttt	0.189													4	2	---	---	---	---	
RAD17	5884	broad.mit.edu	37	5	68669513	68669514	+	Intron	DEL	AT	-	-	rs60134751		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68669513_68669514delAT	uc003jwo.2	+						RAD17_uc003jwg.2_Intron|RAD17_uc003jwh.2_Intron|RAD17_uc003jwi.2_Intron|RAD17_uc003jwj.2_Intron|RAD17_uc003jwk.2_Intron|RAD17_uc003jwl.2_Intron|RAD17_uc003jwm.2_Intron|RAD17_uc003jwn.2_Intron	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2						cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		tctcaaaaaaattttttttttt	0.104								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84897570	84897573	+	IGR	DEL	CTTC	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84897570_84897573delCTTC								None (None upstream) : NBPF22P (680689 downstream)																							tccttcccttcttccttccttcct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116024079	116024082	+	IGR	DEL	CTAC	-	-	rs2933613		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116024079_116024082delCTAC								SEMA6A (113528 upstream) : None (None downstream)																							atgtatctatctacctatctatct	0.083													5	7	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34059962	34059962	+	Intron	DEL	T	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34059962delT	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc010jvk.1_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CCAACCTCCCTTTGGTCCCCA	0.667													6	3	---	---	---	---	
GNMT	27232	broad.mit.edu	37	6	42930305	42930305	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42930305delA	uc003otd.2	+						uc003ote.1_5'Flank	NM_018960	NP_061833	Q14749	GNMT_HUMAN	glycine N-methyltransferase						protein homotetramerization|protein modification process|S-adenosylmethionine metabolic process		folic acid binding|glycine binding|glycine N-methyltransferase activity				0	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	CCCCTCAAAGAAAAACCCATA	0.493													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87780283	87780283	+	IGR	DEL	C	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87780283delC								HTR1E (53893 upstream) : CGA (14939 downstream)																							CCATtccatgcccttgtacat	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747327	134747330	+	IGR	DEL	TCTT	-	-	rs146292536	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747327_134747330delTCTT								SGK1 (108131 upstream) : ALDH8A1 (491199 downstream)																							tttctctctctctttctttctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41223067	41223068	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs149692509	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41223067_41223068insTTCCTTCT								C7orf10 (322710 upstream) : INHBA (505535 downstream)																							tccttccttccttccttccttc	0.050													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975077	64975078	+	IGR	INS	-	AGAC	AGAC			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975077_64975078insAGAC								ZNF92 (109080 upstream) : INTS4L2 (137699 downstream)																							AGTGCACCCGAAAACAAAGATG	0.455													4	2	---	---	---	---	
AGFG2	3268	broad.mit.edu	37	7	100137100	100137101	+	Frame_Shift_Ins	INS	-	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100137100_100137101insC	uc003uvf.2	+	1	267_268	c.131_132insC	c.(130-132)AACfs	p.N44fs	AGFG2_uc003uvg.1_Frame_Shift_Ins_p.N44fs	NM_006076	NP_006067	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	44	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			central_nervous_system(1)	1						CAGGCCGGGAACCGCCACTGCT	0.411													4	2	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101084648	101084648	+	Intron	DEL	T	-	-	rs34914779		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101084648delT	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_5'Flank|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CCCTGGTACGTTtttaattct	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127580026	127580029	+	IGR	DEL	CTTT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127580026_127580029delCTTT								FAM84B (9560 upstream) : LOC727677 (722033 downstream)																							ttcttgttccctttctttctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134982814	134982815	+	IGR	DEL	GA	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134982814_134982815delGA								ST3GAL1 (398631 upstream) : ZFAT (507218 downstream)																							aggagagaaggagagagagaga	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138676603	138676604	+	IGR	DEL	TC	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138676603_138676604delTC								None (None upstream) : FAM135B (465664 downstream)																							tttctttctttctctctctctc	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	83063954	83063977	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGGAAGA	-	-	rs148606659	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83063954_83063977delAAGGAAGGAAGGAAGGAAGGAAGA								TLE4 (722297 upstream) : None (None downstream)																							ggaaggaaggaaggaaggaaggaaggaaggaagaaaggaaggaa	0.134													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99258675	99258676	+	IGR	INS	-	ACC	ACC	rs142356622	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99258675_99258676insACC								HABP4 (5058 upstream) : CDC14B (3721 downstream)																							GCGCTGTACTTaccaccaccac	0.515													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102150544	102150546	+	IGR	DEL	TCC	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102150544_102150546delTCC								SEC61B (157644 upstream) : NR4A3 (433591 downstream)																							cttccttccttccttcctttcct	0.049													3	6	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113168633	113168633	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113168633delC	uc010mtz.2	-	38	9584	c.9247delG	c.(9247-9249)GAAfs	p.E3083fs	SVEP1_uc010mty.2_Frame_Shift_Del_p.E1009fs	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	3083	Sushi 28.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ATCACATTTTCCTTCCAAGAG	0.473													181	101	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126897634	126897635	+	IGR	INS	-	TTCC	TTCC	rs139362827	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126897634_126897635insTTCC								LHX2 (102192 upstream) : NEK6 (122251 downstream)																							tcttttcttttttccttccttc	0.198													4	3	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24679397	24679398	+	Intron	INS	-	GAGA	GAGA	rs72016476		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24679397_24679398insGAGA	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						aaggagggagggagggagggaa	0.144													3	3	---	---	---	---	
CUL2	8453	broad.mit.edu	37	10	35343197	35343198	+	Intron	INS	-	CT	CT	rs142208207	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35343197_35343198insCT	uc001ixv.2	-						CUL2_uc009xma.2_Intron|CUL2_uc010qer.1_Intron|CUL2_uc001ixw.2_Intron|CUL2_uc010qes.1_Intron	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2						cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						CTTTTTCGTTCCTGAGGATTCT	0.297													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45145608	45145611	+	IGR	DEL	TCCT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45145608_45145611delTCCT								CXCL12 (265066 upstream) : TMEM72 (261153 downstream)																							cttccttccatccttccttccttc	0.216													7	4	---	---	---	---	
FAM149B1	317662	broad.mit.edu	37	10	74948492	74948492	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74948492delA	uc009xqz.2	+						FAM149B1_uc010qkf.1_Intron|FAM149B1_uc001jtq.2_Intron	NM_173348	NP_775483	Q96BN6	F149B_HUMAN	hypothetical protein LOC317662												0						cagaaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81632875	81632877	+	IGR	DEL	TCC	-	-	rs4039338		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81632875_81632877delTCC								LOC650623 (184227 upstream) : MBL1P (31777 downstream)																							CATCTTCACGTCCTTCTCTCACA	0.389													6	3	---	---	---	---	
LIPN	643418	broad.mit.edu	37	10	90528460	90528460	+	Intron	DEL	A	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90528460delA	uc010qmw.1	+							NM_001102469	NP_001095939	Q5VXI9	LIPN_HUMAN	lipase-like, ab-hydrolase domain containing 4						lipid catabolic process	extracellular region	hydrolase activity				0		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		CGATAGAAGGAAAAAATGACT	0.373													9	9	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104134959	104134960	+	Intron	INS	-	A	A			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104134959_104134960insA	uc001kux.1	+						GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		atttctatttgaaaaaaaaaaa	0.208													4	2	---	---	---	---	
ACTR1A	10121	broad.mit.edu	37	10	104242537	104242538	+	Intron	INS	-	A	A	rs113812056		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104242537_104242538insA	uc001kvv.2	-						ACTR1A_uc010qqn.1_Intron|ACTR1A_uc010qqo.1_Intron	NM_005736	NP_005727	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A,						G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding			central_nervous_system(1)	1		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		gctgctgagctaaaaaaaaaaa	0.010													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132770030	132770031	+	IGR	DEL	CT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132770030_132770031delCT								GLRX3 (787246 upstream) : TCERG1L (120625 downstream)																							ccctctctccctctctctctct	0.000													4	2	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													12	6	---	---	---	---	
MRVI1	10335	broad.mit.edu	37	11	10701940	10701941	+	Intron	INS	-	A	A	rs148524669	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10701940_10701941insA	uc010rcc.1	-						MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		aggaaggaaggaaggaaggaag	0.025													5	4	---	---	---	---	
WT1	7490	broad.mit.edu	37	11	32450244	32450245	+	Intron	INS	-	G	G	rs146557559	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32450244_32450245insG	uc001mtn.1	-						WT1_uc001mtl.1_Intron|WT1_uc001mtm.1_Intron|WT1_uc001mto.1_Intron|WT1_uc001mtp.1_Intron|WT1_uc001mtq.1_Intron|WT1_uc009yjs.1_Intron	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D						adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CAGCCACGGGCGGGGGGGGTGT	0.663			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42010502	42010503	+	IGR	INS	-	AAG	AAG			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010502_42010503insAAG								LRRC4C (529179 upstream) : None (None downstream)																							aaagaaagaaagaaagaaagaa	0.149													4	2	---	---	---	---	
GAL	51083	broad.mit.edu	37	11	68458593	68458593	+	3'UTR	DEL	T	-	-	rs75147512		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68458593delT	uc001oob.2	+	6						NM_015973	NP_057057	P22466	GALA_HUMAN	galanin preproprotein						growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		TCATTTAAGATTTTTTTTTTT	0.358													5	3	---	---	---	---	
HYOU1	10525	broad.mit.edu	37	11	118916978	118916978	+	Intron	DEL	T	-	-	rs144229837		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118916978delT	uc001puu.2	-						HYOU1_uc001put.2_Intron|HYOU1_uc010ryu.1_Intron|HYOU1_uc010ryv.1_Intron|HYOU1_uc001pux.3_Intron	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor							endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		gtgcctggccttttttttttt	0.000													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123231473	123231476	+	IGR	DEL	TTCT	-	-	rs61904700		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123231473_123231476delTTCT								ASAM (165466 upstream) : GRAMD1B (165052 downstream)																							ccttccttccttctttccttcctt	0.142													6	3	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48389338	48389338	+	Intron	DEL	T	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48389338delT	uc001rqu.2	-						COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TCTGTCAGAGTTCCTCCACAG	0.602													57	42	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72271279	72271280	+	Intron	DEL	CC	-	-	rs11178976	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72271279_72271280delCC	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						tcctgtttttccttccttcctt	0.000													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTTTTTTCTTAAAAAAAAAAAA	0.485													4	2	---	---	---	---	
HEATR4	399671	broad.mit.edu	37	14	74004640	74004641	+	Intron	DEL	TG	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74004640_74004641delTG	uc010tua.1	-						ACOT1_uc001xol.1_Intron|ACOT1_uc010tuc.1_Intron	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CGCTTTCCACTGTGTGTGTGTG	0.624													6	3	---	---	---	---	
TUBGCP5	114791	broad.mit.edu	37	15	22870169	22870170	+	Intron	INS	-	AA	AA	rs11377608		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22870169_22870170insAA	uc001yur.3	+						TUBGCP5_uc001yuq.2_Intron	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		acccagtctttaaaaaaaaaaa	0.144													5	3	---	---	---	---	
TEX9	374618	broad.mit.edu	37	15	56704372	56704373	+	Intron	DEL	GT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56704372_56704373delGT	uc002adp.2	+						TEX9_uc010ugl.1_Intron	NM_198524	NP_940926	Q8N6V9	TEX9_HUMAN	testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		ACCCCCAAGCgtgtgtgtgtgt	0.307													6	3	---	---	---	---	
PRC1	9055	broad.mit.edu	37	15	91523763	91523764	+	Intron	INS	-	G	G	rs28584391		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91523763_91523764insG	uc002bqm.2	-						PRC1_uc002bqn.2_Intron|PRC1_uc002bqo.2_Intron|PRC1_uc010uqs.1_Intron	NM_003981	NP_003972	O43663	PRC1_HUMAN	protein regulator of cytokinesis 1 isoform 1						cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					ttttttttttttttgagacagg	0.134													5	4	---	---	---	---	
LRRC28	123355	broad.mit.edu	37	15	99925951	99925952	+	Intron	INS	-	T	T	rs66964237		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99925951_99925952insT	uc002bva.1	+						LRRC28_uc002bvb.1_Intron|LRRC28_uc010urt.1_Intron|LRRC28_uc002bvc.1_Intron|LRRC28_uc010uru.1_Intron|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28												0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			AAAGGCATTTGTTTTTTTTTTT	0.277													4	2	---	---	---	---	
ACE	1636	broad.mit.edu	37	17	61590616	61590623	+	Intron	DEL	GGAAGGAA	-	-	rs12452052	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61590616_61590623delGGAAGGAA	uc002jaw.1	+							NM_152830		P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 2						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	agggagggagggaaggaaggaaggaagg	0.120													3	3	---	---	---	---	
TTYH2	94015	broad.mit.edu	37	17	72218928	72218928	+	Intron	DEL	T	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72218928delT	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						ATGTTGTCCCTTTTTTTTTTT	0.522													4	2	---	---	---	---	
QRICH2	84074	broad.mit.edu	37	17	74283125	74283126	+	Intron	DEL	AC	-	-	rs71848911		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74283125_74283126delAC	uc002jrd.1	-						QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						acaccacataacacacacacac	0.426													5	3	---	---	---	---	
SLC26A11	284129	broad.mit.edu	37	17	78224945	78224945	+	Intron	DEL	A	-	-	rs11868423	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78224945delA	uc002jyb.1	+						SLC26A11_uc002jyc.1_Intron|SLC26A11_uc002jyd.1_Intron|SLC26A11_uc010dhv.1_Intron	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			acaaaaaattaaaaaaaaaaa	0.239													9	4	---	---	---	---	
RNF125	54941	broad.mit.edu	37	18	29613947	29613947	+	Intron	DEL	G	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29613947delG	uc002kxf.1	+							NM_017831	NP_060301	Q96EQ8	RN125_HUMAN	ring finger protein 125						negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0						AAAAAAAAAAGAAAACCAAAT	0.323													3	6	---	---	---	---	
ZCCHC2	54877	broad.mit.edu	37	18	60212014	60212015	+	Intron	DEL	TG	-	-	rs150177822		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60212014_60212015delTG	uc002lip.3	+						ZCCHC2_uc002lio.2_Intron	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2						cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						CCATATAATATGTGTGTTTTTT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393599	77393604	+	IGR	DEL	GTGATA	-	-	rs137906533		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393599_77393604delGTGATA								NFATC1 (104277 upstream) : CTDP1 (46197 downstream)																							gatggtggtggtgataatggtggtgg	0.000													4	2	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2594445	2594446	+	Intron	INS	-	AAGGA	AAGGA	rs145510070	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2594445_2594446insAAGGA	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggaaggaaggaggaagaaaga	0.188													2	5	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17286634	17286638	+	Intron	DEL	TTTTT	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17286634_17286638delTTTTT	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						TGCTACAttcttttttttttttttt	0.205													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35864933	35864948	+	IGR	DEL	GAAGGAAGGAAGGAAG	-	-	rs147849213		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35864933_35864948delGAAGGAAGGAAGGAAG								FFAR3 (13546 upstream) : FFAR2 (74255 downstream)																							tcaaaaaacagaaggaaggaaggaaggaaggaagga	0.000													4	2	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46125006	46125006	+	Intron	DEL	A	-	-	rs60420267	by1000genomes	TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46125006delA	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		ccacttttccacctttttttt	0.214													8	4	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49337709	49337709	+	Intron	DEL	G	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49337709delG	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		aggaggtgctgggggcctgga	0.000													5	4	---	---	---	---	
SDC4	6385	broad.mit.edu	37	20	43977067	43977067	+	5'Flank	DEL	C	-	-	rs17173360		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43977067delC	uc002xnu.2	-						SDC4_uc010zws.1_5'Flank	NM_002999	NP_002990	P31431	SDC4_HUMAN	syndecan 4 precursor							extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity				0		Myeloproliferative disorder(115;0.0122)				CGGCGAGTGGCCCCGGGCGGG	0.552													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61680494	61680495	+	Intron	INS	-	TCT	TCT	rs138404858		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61680494_61680495insTCT	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																		cctcttcctcctcctcctcctc	0.064													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085553	11085554	+	Intron	INS	-	CAT	CAT			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085553_11085554insCAT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		accaccaccaccaccactacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1895506	1895509	+	IGR	DEL	CTTC	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1895506_1895509delCTTC								ASMT (133533 upstream) : DHRSX (242048 downstream)																							ttctttctttcttccttccttcct	0.000													4	2	---	---	---	---	
CLCN5	1184	broad.mit.edu	37	X	49857053	49857053	+	3'UTR	DEL	T	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49857053delT	uc004dos.1	+	12					CLCN5_uc004dor.1_3'UTR|CLCN5_uc004doq.1_3'UTR|CLCN5_uc004dot.1_3'UTR	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TAATTTTCTCTTTAGGAGAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	78221254	78221255	+	IGR	INS	-	C	C			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78221254_78221255insC								P2RY10 (3817 upstream) : GPR174 (205214 downstream)																							ttcctttctttctttctttctt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	102453266	102453267	+	IGR	DEL	TC	-	-			TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102453266_102453267delTC								NXF3 (105244 upstream) : BEX4 (16753 downstream)																							tccttccttTTCTCTCTCTCTC	0.050													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	152871884	152871904	+	IGR	DEL	GTAAAGGGATTTTGTTCACCA	-	-	rs139494223		TCGA-BP-4964-01A-01D-1462-08	TCGA-BP-4964-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152871884_152871904delGTAAAGGGATTTTGTTCACCA								FAM58A (7252 upstream) : DUSP9 (35993 downstream)																							ttaaaattaggtaaagggatttTGTTCACCAGTAAAGGGAT	0.271													4	2	---	---	---	---	
