Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SPEN	23013	broad.mit.edu	37	1	16260915	16260915	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16260915C>T	uc001axk.1	+	11	8384	c.8180C>T	c.(8179-8181)GCC>GTC	p.A2727V	SPEN_uc010obp.1_Missense_Mutation_p.A2686V	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2727	Interaction with RBPSUH (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACAGTCAATGCCGCTGCGAGT	0.592													4	101	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36932864	36932864	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36932864G>A	uc001caw.1	-	16	2185	c.2007C>T	c.(2005-2007)AGC>AGT	p.S669S	MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_Silent_p.S231S|CSF3R_uc009vvc.1_Silent_p.S198S|CSF3R_uc001cau.1_Silent_p.S69S|CSF3R_uc001cav.1_Silent_p.S669S|CSF3R_uc001cax.1_Silent_p.S669S|CSF3R_uc001cay.1_Missense_Mutation_p.A638V	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	669	Cytoplasmic (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	AGGAGCCCAGGCTGCTGTGAG	0.607													6	229	---	---	---	---	PASS
ELOVL1	64834	broad.mit.edu	37	1	43829743	43829743	+	Silent	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43829743C>T	uc001ciz.2	-	9	927	c.684G>A	c.(682-684)CAG>CAA	p.Q228Q	ELOVL1_uc001cja.2_Silent_p.Q228Q|ELOVL1_uc001cjb.2_Silent_p.Q228Q|ELOVL1_uc001cjc.2_RNA|ELOVL1_uc010okh.1_Silent_p.Q201Q	NM_022821	NP_073732	Q9BW60	ELOV1_HUMAN	elongation of very long chain fatty acids-like	228					fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|sphingolipid biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	fatty acid elongase activity|protein binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGACTGGGTACTGGTAGTTAC	0.473													28	92	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65117974	65117974	+	Silent	SNP	T	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65117974T>C	uc001dbo.1	+	10	1473	c.1368T>C	c.(1366-1368)ACT>ACC	p.T456T	CACHD1_uc001dbp.1_Silent_p.T211T|CACHD1_uc001dbq.1_Silent_p.T211T	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	507	Extracellular (Potential).|Cache 1.				calcium ion transport	integral to membrane				ovary(2)	2						CTTCCTATACTTTTCTCATAG	0.343													42	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	143403563	143403563	+	5'Flank	SNP	C	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143403563C>A	uc001ejl.1	-						uc002zkn.1_RNA					DQ587539																		TTTCTTTGGCCACTTTGGCTG	0.453													3	30	---	---	---	---	PASS
PMVK	10654	broad.mit.edu	37	1	154904889	154904889	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154904889A>T	uc001ffq.2	-	2	421	c.98T>A	c.(97-99)CTT>CAT	p.L33H		NM_006556	NP_006547	Q15126	PMVK_HUMAN	phosphomevalonate kinase	33					cholesterol biosynthetic process|protein phosphorylation	cytosol|peroxisome	ATP binding|phosphomevalonate kinase activity|protein binding				0	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATCAGCTCCAAGTCTGCAGGA	0.463													5	43	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													8	37	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109347262	109347262	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109347262G>A	uc002tem.3	+	3	299	c.173G>A	c.(172-174)AGG>AAG	p.R58K		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	58					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GTGCAAGAGAGGGATCCCAAA	0.323													7	435	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163253263	163253263	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163253263T>G	uc002uch.1	-	11	2812	c.2600A>C	c.(2599-2601)CAT>CCT	p.H867P		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	867	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TGCGCTCTCATGCCTTAGGTT	0.338													27	70	---	---	---	---	PASS
IQCF1	132141	broad.mit.edu	37	3	51937017	51937017	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51937017G>C	uc003dbv.2	-	2	190	c.92C>G	c.(91-93)GCA>GGA	p.A31G	IQCF1_uc003dbq.3_RNA	NM_152397	NP_689610	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	31										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTTTGACTCTGCTCCTAAGGA	0.483													5	360	---	---	---	---	PASS
THAP9	79725	broad.mit.edu	37	4	83839957	83839957	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83839957T>A	uc003hnt.2	+	5	2711	c.2592T>A	c.(2590-2592)GAT>GAA	p.D864E	THAP9_uc003hns.1_Missense_Mutation_p.D720E|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_Missense_Mutation_p.D581E	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	864							DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				AGAGAACTGATATGAAAACTT	0.313													58	155	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89425491	89425491	+	Silent	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89425491C>T	uc003hrt.2	+	21	2844	c.2691C>T	c.(2689-2691)ATC>ATT	p.I897I	HERC5_uc011cdm.1_Silent_p.I535I	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	897	HECT.				innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		AAGACATTATCAAATTATTCC	0.328													12	165	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572275	1572275	+	Intron	SNP	A	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572275A>G	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						GGACACATGCATGAGCTATTA	0.507													4	40	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572289	1572289	+	Intron	SNP	A	G	G	rs147001297	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572289A>G	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						GCTATTATACATAATTACAAA	0.483													4	55	---	---	---	---	PASS
CWC27	10283	broad.mit.edu	37	5	64314204	64314204	+	3'UTR	SNP	A	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64314204A>C	uc003jtn.1	+	14					CWC27_uc010iwt.1_3'UTR	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						TGGCCTTGTAACAGCCATTGT	0.353													7	22	---	---	---	---	PASS
NRG2	9542	broad.mit.edu	37	5	139232130	139232130	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139232130G>A	uc003lex.1	-	8	1656	c.1431C>T	c.(1429-1431)AAC>AAT	p.N477N	NRG2_uc003lev.1_Silent_p.N485N|NRG2_uc003lew.1_Silent_p.N479N|NRG2_uc003ley.1_Silent_p.N471N	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1	477	Cytoplasmic (Potential).				embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCTGGCACGTTCTTGGAAA	0.527													30	80	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559583	140559583	+	Silent	SNP	C	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559583C>G	uc011dai.1	+	1	2154	c.1968C>G	c.(1966-1968)ACC>ACG	p.T656T	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	656	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCGGCCACCGCCACGCTGC	0.706													3	60	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671861	112671861	+	3'UTR	SNP	T	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671861T>A	uc003pvx.1	+	3						NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B								zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		AATTTTCGGATTTTTGGGGTA	0.224													5	5	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	145103091	145103091	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145103091T>A	uc003qkt.2	+	60	8758	c.8666T>A	c.(8665-8667)ATT>AAT	p.I2889N		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2889	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ACAAATGAAATTTTCAAACAG	0.338													30	80	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167721380	167721380	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167721380T>C	uc003qvq.2	+	7	1265	c.1090T>C	c.(1090-1092)TGG>CGG	p.W364R	UNC93A_uc003qvr.2_Missense_Mutation_p.W322R	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	364	Helical; (Potential).					integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGATGCCGTCTGGCAGACACA	0.607													17	61	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87183102	87183102	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87183102T>C	uc003uiz.1	-	10	1392	c.974A>G	c.(973-975)GAA>GGA	p.E325G	ABCB1_uc011khc.1_Missense_Mutation_p.E261G	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	325	ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AATAGAATATTCCCCTGAGAG	0.398													65	162	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68007701	68007701	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68007701A>T	uc003xxi.2	+	8	820	c.789A>T	c.(787-789)CAA>CAT	p.Q263H	CSPP1_uc003xxg.1_Missense_Mutation_p.Q255H|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.Q228H|CSPP1_uc003xxk.2_5'UTR	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	263	Potential.					centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GATACCGACAACTAGATGATG	0.378													43	119	---	---	---	---	PASS
EBAG9	9166	broad.mit.edu	37	8	110567065	110567065	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110567065G>A	uc003ynf.2	+	4	505	c.270G>A	c.(268-270)CTG>CTA	p.L90L	EBAG9_uc010mcn.1_RNA|EBAG9_uc003yng.2_Silent_p.L90L	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated	90	Cytoplasmic (Potential).				apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			TGGAACAACTGGAACCTGACT	0.383													24	228	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143412303	143412303	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143412303G>A	uc003ywk.2	-	6	970	c.852C>T	c.(850-852)TCC>TCT	p.S284S	TSNARE1_uc011lju.1_Silent_p.S284S|TSNARE1_uc003ywj.2_Silent_p.S284S|TSNARE1_uc003ywl.3_Silent_p.S65S	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	284					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTGTCCCTAAGGACTGAAGGC	0.627													15	57	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38651232	38651232	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38651232A>C	uc010qex.1	+	3	379	c.304A>C	c.(304-306)AAT>CAT	p.N102H	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N100H					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCCACAACTAAATATCAAAGC	0.358													4	217	---	---	---	---	PASS
PDE6C	5146	broad.mit.edu	37	10	95372838	95372838	+	Missense_Mutation	SNP	C	A	A	rs142772345		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95372838C>A	uc001kiu.3	+	1	494	c.356C>A	c.(355-357)CCC>CAC	p.P119H		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	119	GAF 1.				visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				GATGTCACCCCCACCTCCAAG	0.577													4	95	---	---	---	---	PASS
PIPSL	266971	broad.mit.edu	37	10	95719506	95719506	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95719506T>G	uc009xuj.2	-	1	2167	c.1648A>C	c.(1648-1650)ACC>CCC	p.T550P		NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						GTGTCTGGGGTGAGTGTGGTC	0.527													6	27	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112341762	112341762	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112341762T>C	uc001kze.2	+	9	755	c.629T>C	c.(628-630)CTA>CCA	p.L210P		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	210	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAGGAAGAACTAGCTCAGTAT	0.378													6	255	---	---	---	---	PASS
HBB	3043	broad.mit.edu	37	11	5247899	5247899	+	Missense_Mutation	SNP	C	A	A	rs63750968		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5247899C>A	uc001mae.1	-	2	273	c.223G>T	c.(223-225)GGC>TGC	p.G75C		NM_000518	NP_000509	P68871	HBB_HUMAN	beta globin	75			G -> R (in Aalborg; unstable).|G -> V (in Bushwick; unstable).		blood coagulation|hydrogen peroxide catabolic process|nitric oxide transport|positive regulation of cell death|positive regulation of nitric oxide biosynthetic process|protein heterooligomerization|regulation of blood pressure|regulation of blood vessel size	haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|hemoglobin binding|oxygen binding|oxygen transporter activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	TGAGCCAGGCCATCACTAAAG	0.537									Sickle_Cell_Trait				48	126	---	---	---	---	PASS
C11orf2	738	broad.mit.edu	37	11	64875906	64875906	+	Silent	SNP	C	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64875906C>A	uc001ocr.1	+	5	1003	c.963C>A	c.(961-963)GCC>GCA	p.A321A	C11orf2_uc001ocs.1_Silent_p.A197A	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	321					lipid transport|protein transport	Golgi apparatus|integral to membrane					0						TGGCGGCGGCCTACCAGGAGC	0.706													10	21	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82877723	82877723	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82877723A>G	uc001ozx.3	+	5	2129	c.1784A>G	c.(1783-1785)AAA>AGA	p.K595R	PCF11_uc010rsu.1_Missense_Mutation_p.K595R	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	595					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						AAGTCTGCCAAAAGATGGAAA	0.353													43	125	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105842733	105842733	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105842733G>A	uc001pix.2	+	15	2833	c.2387G>A	c.(2386-2388)GGA>GAA	p.G796E	GRIA4_uc001piw.2_Intron|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	796	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	GGTGAATGTGGACCCAAGGAC	0.468													23	50	---	---	---	---	PASS
FDXACB1	91893	broad.mit.edu	37	11	111749783	111749783	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111749783T>C	uc001pmc.3	-	1	371	c.74A>G	c.(73-75)GAT>GGT	p.D25G	ALG9_uc010rwo.1_5'UTR|FDXACB1_uc009yyi.2_5'UTR|C11orf1_uc001pmd.2_5'Flank|C11orf1_uc001pme.2_5'Flank	NM_138378	NP_612387	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain	25					phenylalanyl-tRNA aminoacylation|tRNA processing		ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0						AGTGCTCTGATCCAGGGTTTC	0.667											OREG0021330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	32	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134062791	134062791	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134062791C>T	uc001qhd.1	-	16	2444	c.1838G>A	c.(1837-1839)TGC>TAC	p.C613Y	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	613					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GATCTGCACGCATCTAGGCTG	0.498													48	101	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49446841	49446841	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49446841G>A	uc001rta.3	-	8	969	c.969C>T	c.(967-969)TGC>TGT	p.C323C		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	323	PHD-type 2.|Cys-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CACAGGCCCGGCACACCCGGC	0.547			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	175	---	---	---	---	PASS
TRPV4	59341	broad.mit.edu	37	12	110226511	110226511	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110226511G>A	uc001tpj.1	-	12	1997	c.1902C>T	c.(1900-1902)TCC>TCT	p.S634S	TRPV4_uc001tpg.1_Silent_p.S600S|TRPV4_uc001tph.1_Silent_p.S587S|TRPV4_uc001tpi.1_Silent_p.S527S|TRPV4_uc001tpk.1_Silent_p.S634S|TRPV4_uc001tpl.1_Silent_p.S574S	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	634	Helical; (Potential).				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GGTTCAGGAGGGAGACCAGGG	0.473													27	84	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46584527	46584527	+	Silent	SNP	A	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46584527A>G	uc010tfw.1	-	6	708	c.702T>C	c.(700-702)GAT>GAC	p.D234D	ZC3H13_uc001vas.1_Silent_p.D234D|ZC3H13_uc001vat.1_Silent_p.D234D	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	234	Ser-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ATGTCTTCCTATCTTTCTTGC	0.423													20	219	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30066775	30066775	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066775C>A	uc001wqh.2	-	16	2537	c.2356G>T	c.(2356-2358)GAT>TAT	p.D786Y		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	786	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		ATGTCTTCATCTTCATTAAAT	0.413													76	184	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65263343	65263343	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65263343G>A	uc001xht.2	-	10	1327	c.1273C>T	c.(1273-1275)CGG>TGG	p.R425W	SPTB_uc001xhr.2_Missense_Mutation_p.R425W|SPTB_uc001xhs.2_Missense_Mutation_p.R425W|SPTB_uc001xhu.2_Missense_Mutation_p.R425W	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	425	Spectrin 2.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TCAAAGCGCCGGGCCAGTTGC	0.592													4	121	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40627240	40627240	+	3'UTR	SNP	A	G	G			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40627240A>G	uc001zlh.3	-	11					C15orf52_uc010ucn.1_3'UTR	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115											large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		AGTTTGCCACACTGCTCAGTG	0.597													13	45	---	---	---	---	PASS
ZWILCH	55055	broad.mit.edu	37	15	66797698	66797698	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66797698G>T	uc002aqb.2	+	1	268	c.22G>T	c.(22-24)GCA>TCA	p.A8S	RPL4_uc002apv.2_5'Flank|RPL4_uc010bhr.2_5'Flank|RPL4_uc002apw.2_5'Flank|RPL4_uc002apx.2_5'UTR|RPL4_uc010ujq.1_5'Flank|SNORD16_uc010bht.2_5'Flank|SNORD18A_uc002apz.1_5'Flank|ZWILCH_uc010bhu.1_5'UTR|ZWILCH_uc002aqa.2_5'UTR|ZWILCH_uc010bhv.2_5'UTR	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN	Zwilch	8					cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding			ovary(1)	1						GCTGAACTGCGCAGCAGAGGA	0.607													7	198	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	C	C	rs1062001		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056021T>C	uc002bkm.2	-	6		c.539A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GTAGCTGCTCTACCTTAGATG	0.502													4	13	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326331	85326331	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326331G>T	uc002bld.2	+	4	761	c.425G>T	c.(424-426)AGT>ATT	p.S142I	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	142					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AACCAGTTCAGTCCAATCTCC	0.483													79	246	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52484404	52484404	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52484404G>A	uc002egw.2	-	4	634	c.463C>T	c.(463-465)CGG>TGG	p.R155W	TOX3_uc010vgt.1_Missense_Mutation_p.R150W|TOX3_uc010vgu.1_Missense_Mutation_p.R155W	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	155					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						ACGATGGACCGCATGATCAGG	0.562													4	153	---	---	---	---	PASS
ZNF319	57567	broad.mit.edu	37	16	58032227	58032227	+	5'UTR	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58032227G>A	uc002emx.1	-	2						NM_020807	NP_065858	Q9P2F9	ZN319_HUMAN	zinc finger protein 319						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGCTTCACGTGACCCAATCCA	0.557													16	45	---	---	---	---	PASS
GPR172B	55065	broad.mit.edu	37	17	4937887	4937887	+	Silent	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4937887C>T	uc002gap.3	-	2	728	c.15G>A	c.(13-15)ACG>ACA	p.T5T	GPR172B_uc002gao.3_Silent_p.T5T|GPR172B_uc010ckw.2_5'UTR|GPR172B_uc010ckx.2_Silent_p.T5T	NM_001104577	NP_001098047	Q9NWF4	RFT_HUMAN	G protein-coupled receptor 172B precursor	5						integral to plasma membrane	receptor activity|riboflavin transporter activity				0						GACGGCCCAGCGTGGGTGCTG	0.607													4	72	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60837249	60837249	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60837249C>A	uc010ddr.2	-	4	567	c.329G>T	c.(328-330)AGT>ATT	p.S110I	MARCH10_uc002jag.3_Missense_Mutation_p.S110I|MARCH10_uc010dds.2_Missense_Mutation_p.S110I|MARCH10_uc002jah.2_Missense_Mutation_p.S110I	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	110							ligase activity|zinc ion binding				0						AGTCATGGTACTTTTATGTTT	0.428													14	180	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77082460	77082460	+	3'UTR	SNP	G	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77082460G>T	uc002jwv.2	+	14					ENGASE_uc002jww.2_3'UTR	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase							cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						TGGTCTCCTGGCCTCGGGCTG	0.682													12	30	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19996485	19996485	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19996485A>T	uc002ktv.1	-	1	1394	c.1290T>A	c.(1288-1290)CAT>CAA	p.H430Q		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	430				H -> R (in Ref. 1; AAK63198).		integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					ACCAATTATCATGTGCTTTTT	0.338													5	178	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56205081	56205081	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56205081C>T	uc002lhj.3	-	5	2552	c.2338G>A	c.(2338-2340)GAA>AAA	p.E780K	ALPK2_uc002lhk.1_Missense_Mutation_p.E111K	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	780							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TCTGTGGGTTCAGGGGAAGCA	0.537													44	119	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533022	41533022	+	Intron	SNP	G	C	C			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533022G>C	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTTTGAAGAGCCAGTCGAAG	0.662													3	54	---	---	---	---	PASS
KCNN4	3783	broad.mit.edu	37	19	44273604	44273604	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44273604C>T	uc002oxl.2	-	6	1435	c.1039G>A	c.(1039-1041)GCC>ACC	p.A347T	KCNN4_uc010eiz.2_Missense_Mutation_p.R239H	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated	347	Calmodulin-binding.				defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	GCGTTGATGGCGGCCAGCAGC	0.587													20	69	---	---	---	---	PASS
C20orf160	140706	broad.mit.edu	37	20	30610277	30610277	+	Intron	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30610277C>T	uc002wxf.2	+						C20orf160_uc002wxg.2_5'UTR	NM_080625	NP_542192	Q9NUG4	CT160_HUMAN	hypothetical protein LOC140706											central_nervous_system(3)|ovary(1)	4						TCACTGAATTCTATAAAGGGG	0.313													9	34	---	---	---	---	PASS
CDK5RAP1	51654	broad.mit.edu	37	20	31946924	31946924	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31946924G>A	uc010gek.2	-	15	1855	c.1731C>T	c.(1729-1731)ACC>ACT	p.T577T	CDK5RAP1_uc002wyy.2_Silent_p.T473T|CDK5RAP1_uc002wyz.2_Silent_p.T563T|CDK5RAP1_uc002wza.2_Silent_p.T562T|CDK5RAP1_uc010gel.2_Silent_p.T472T|CDK5RAP1_uc010gem.2_Silent_p.T486T|CDK5RAP1_uc002wzc.1_3'UTR|CDK5RAP1_uc002wzb.1_3'UTR	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	577	CDK5R1-binding.|TRAM.				brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						AACTGGCTGAGGTGATCTGAA	0.502													18	109	---	---	---	---	PASS
GGT3P	2679	broad.mit.edu	37	22	18769145	18769145	+	Intron	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18769145G>A	uc010gri.1	-						GGT3P_uc011ago.1_Intron|GGT3P_uc011agp.1_RNA|GGT3P_uc002zob.1_RNA					Homo sapiens cDNA clone IMAGE:5761295, **** WARNING: chimeric clone ****.												0						TGAGGCTGCCGTTGTAGAAGG	0.612													4	21	---	---	---	---	PASS
PGRMC1	10857	broad.mit.edu	37	X	118370278	118370278	+	5'UTR	SNP	C	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118370278C>T	uc004erb.2	+	1					PGRMC1_uc011mts.1_5'UTR	NM_006667	NP_006658	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1							cell surface|endoplasmic reticulum membrane|integral to membrane|microsome|nucleolus	heme binding|protein binding|receptor activity|steroid binding				0						GAGAAAGTGGCGAGTTCCGGA	0.682													10	11	---	---	---	---	PASS
FGF13	2258	broad.mit.edu	37	X	137715047	137715047	+	Silent	SNP	G	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137715047G>A	uc004fam.2	-	5	1364	c.702C>T	c.(700-702)AAC>AAT	p.N234N	FGF13_uc004fan.2_Silent_p.N181N|FGF13_uc011mwi.1_Silent_p.N215N|FGF13_uc004faq.2_Silent_p.N244N|FGF13_uc004far.2_Silent_p.N215N|FGF13_uc011mwj.1_Silent_p.N244N|FGF13_uc011mwk.1_Silent_p.N188N	NM_004114	NP_004105	Q92913	FGF13_HUMAN	fibroblast growth factor 13 isoform 1	234					cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					ATTTGCCTCCGTTCAGCACGC	0.527													76	68	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3861	3861	+	RNA	SNP	A	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3861A>T	uc004cos.3	+	2		c.2154A>T			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		GCCATAATATGATTTATCTCC	0.488													5	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	25380784	25380787	+	IGR	DEL	CCTT	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25380784_25380787delCCTT								RUNX3 (89172 upstream) : SYF2 (167980 downstream)																							tccctccctcccttcctccctccc	0.000													5	3	---	---	---	---	
STX12	23673	broad.mit.edu	37	1	28148531	28148532	+	Intron	INS	-	A	A	rs76417902		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28148531_28148532insA	uc001bou.3	+							NM_177424	NP_803173	Q86Y82	STX12_HUMAN	syntaxin 12						cholesterol efflux|intracellular protein transport|protein stabilization|vesicle-mediated transport	Golgi apparatus|integral to membrane|membrane raft|phagocytic vesicle	SNAP receptor activity			breast(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		tctgtctcaagaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35538976	35538977	+	IGR	INS	-	AGG	AGG	rs71571790		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35538976_35538977insAGG								ZMYM6 (41407 upstream) : ZMYM1 (5995 downstream)																							ggaaggaaggaaagaaaggaaa	0.000													4	2	---	---	---	---	
DPYD	1806	broad.mit.edu	37	1	98060470	98060470	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98060470delT	uc001drv.2	-							NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	ATACCCGGCCTTTTTTTTTTT	0.323													3	4	---	---	---	---	
RAP1A	5906	broad.mit.edu	37	1	112190797	112190804	+	Intron	DEL	GTGTGTGT	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112190797_112190804delGTGTGTGT	uc001ebi.2	+						RAP1A_uc001ebk.2_Intron|RAP1A_uc001ebl.2_Intron|RAP1A_uc001ebm.2_Intron	NM_002884	NP_002875	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family precursor						activation of MAPKK activity|blood coagulation|energy reserve metabolic process|nerve growth factor receptor signaling pathway|regulation of insulin secretion	cytosol|plasma membrane	GTP binding|GTPase activity				0		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		ggttcaaacAgtgtgtgtgtgtgtgtgt	0.154													7	4	---	---	---	---	
ECM1	1893	broad.mit.edu	37	1	150482765	150482769	+	Intron	DEL	TAACC	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150482765_150482769delTAACC	uc001eus.2	+						ECM1_uc010pce.1_Intron|ECM1_uc010pcf.1_Intron|ECM1_uc001eut.2_Intron|ECM1_uc001euu.2_Intron|ECM1_uc001euv.2_Intron|ECM1_uc009wlu.2_5'UTR	NM_004425	NP_004416	Q16610	ECM1_HUMAN	extracellular matrix protein 1 isoform 1						angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity			ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			accagttgtataaccttgggtaagt	0.137													22	12	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173490617	173490622	+	Intron	DEL	TATATA	-	-	rs146332693		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173490617_173490622delTATATA	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						AAATATTTTCtatatatatatatata	0.218													3	6	---	---	---	---	
NENF	29937	broad.mit.edu	37	1	212617908	212617911	+	Intron	DEL	TGTA	-	-	rs10590281		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212617908_212617911delTGTA	uc001hjd.2	+						NENF_uc010ptf.1_Intron	NM_013349	NP_037481	Q9UMX5	NENF_HUMAN	neuron derived neurotrophic factor precursor							extracellular space	heme binding				0				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		tgtgtgtgtgtgtATCTGGGCAAG	0.162													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																		actccatctcaaaaaaaaaaa	0.179													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8603839	8603840	+	IGR	INS	-	AAGGAAGG	AAGGAAGG	rs143957923	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8603839_8603840insAAGGAAGG								LOC339788 (486862 upstream) : ID2 (215500 downstream)																							agaaagaaagaaaggaaggaag	0.203													4	2	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45709753	45709756	+	Intron	DEL	ACAC	-	-	rs148303692		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45709753_45709756delACAC	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			ACAACGTTAAacacacacacacac	0.172													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61527958	61527959	+	Intron	INS	-	A	A	rs75802951		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61527958_61527959insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			aaaaaaTGAACAAAAAAAAAAA	0.114													7	4	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113138302	113138302	+	Intron	DEL	G	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113138302delG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						CGTTATAGATGCATCTGCAAT	0.313													11	5	---	---	---	---	
PIKFYVE	200576	broad.mit.edu	37	2	209188679	209188682	+	Intron	DEL	TTGT	-	-	rs72292607		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209188679_209188682delTTGT	uc002vcz.2	+						PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Intron	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						tttgatggggttgtttgttttttt	0.000													5	3	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													3	4	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						CATTTCTCTTtttatttatttatttatttatt	0.151													5	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52702800	52702800	+	Intron	DEL	A	-	-	rs148931770		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52702800delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAGCTTACTTaaaaaaaaaaa	0.234			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105797972	105797975	+	IGR	DEL	CCTC	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105797972_105797975delCCTC								CBLB (209706 upstream) : LOC100302640 (757685 downstream)																							ttctttccttcctccctccctccc	0.005													4	2	---	---	---	---	
MBNL1	4154	broad.mit.edu	37	3	152165233	152165233	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152165233delT	uc003ezm.2	+						MBNL1_uc003ezh.2_Intron|MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Intron|MBNL1_uc003ezn.2_Intron|MBNL1_uc003ezo.2_Intron|MBNL1_uc010hvp.2_Intron	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTTATCTTGCTTTTTTTTTTT	0.328													8	4	---	---	---	---	
FYTTD1	84248	broad.mit.edu	37	3	197505076	197505077	+	Intron	INS	-	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197505076_197505077insT	uc003fyi.2	+						FYTTD1_uc011bui.1_Intron|FYTTD1_uc011buj.1_Intron|FYTTD1_uc011buk.1_Intron	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1						mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		GCCAGTGAAACTTTTTTTTTGA	0.287													4	2	---	---	---	---	
HERC5	51191	broad.mit.edu	37	4	89425218	89425218	+	Intron	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89425218delA	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		actccgtctcaaaaaaaaaaa	0.015													6	3	---	---	---	---	
FAM149A	25854	broad.mit.edu	37	4	187077514	187077515	+	Intron	INS	-	T	T	rs149797115	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187077514_187077515insT	uc003iyt.3	+						FAM149A_uc011cla.1_Intron|FAM149A_uc010isj.2_Intron|FAM149A_uc010isk.2_Intron|FAM149A_uc003iyu.3_Intron|FAM149A_uc010isl.2_Intron|FAM149A_uc011clb.1_Intron	NM_015398	NP_056213	A5PLN7	F149A_HUMAN	hypothetical protein LOC25854											breast(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GGACGCTATTGTTTTTTGTGTT	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190558519	190558526	+	IGR	DEL	AGGAAGGA	-	-	rs36214844		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190558519_190558526delAGGAAGGA								None (None upstream) : FRG1 (303448 downstream)																							gaaggaagggaggaaggaaggaaggaag	0.111													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131368633	131368636	+	IGR	DEL	GGAG	-	-	rs59143826		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131368633_131368636delGGAG								ACSL6 (20763 upstream) : IL3 (27711 downstream)																							agagagagaaggagggagggaggg	0.000													4	4	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32497712	32497713	+	Intron	INS	-	A	A	rs146725750	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32497712_32497713insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GCCCCTTACACAGTCTCATGGA	0.411													5	3	---	---	---	---	
PPIL4	85313	broad.mit.edu	37	6	149847587	149847588	+	Intron	DEL	TG	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149847587_149847588delTG	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		ATTATTTATCtgtgtgtgtgtg	0.262													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152786898	152786901	+	Intron	DEL	ACAT	-	-	rs144596263		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152786898_152786901delACAT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Intron|SYNE1_uc003qoz.2_Intron|SYNE1_uc003qoy.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTAGAAGAacacatacacacacac	0.289										HNSCC(10;0.0054)			5	4	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7413336	7413337	+	Intron	INS	-	T	T	rs35277875		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7413336_7413337insT	uc003src.1	-						COL28A1_uc011jxe.1_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ATTCTGGtttcttttttttttt	0.208													6	5	---	---	---	---	
MACC1	346389	broad.mit.edu	37	7	20229372	20229373	+	Intron	DEL	AA	-	-	rs72309121		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20229372_20229373delAA	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						acaaacacataaacacacacac	0.163													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68223724	68223727	+	IGR	DEL	GAAG	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68223724_68223727delGAAG								None (None upstream) : AUTS2 (840178 downstream)																							aggaaggaatgaaggaaggaagga	0.015													3	3	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83720616	83720617	+	Intron	INS	-	AAAG	AAAG	rs141527267	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83720616_83720617insAAAG	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						aagaaaaagaaaaagaaaggaa	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	115823620	115823621	+	IGR	DEL	GT	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115823620_115823621delGT								TFEC (23670 upstream) : TES (26960 downstream)																							tagtatttcagtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8262984	8262985	+	IGR	INS	-	ACAC	ACAC	rs140666107	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8262984_8262985insACAC								SGK223 (23727 upstream) : CLDN23 (296681 downstream)																							TAGAGTTCTTTacacacacaca	0.332													3	3	---	---	---	---	
TMEM55A	55529	broad.mit.edu	37	8	92052646	92052647	+	Intron	INS	-	CAC	CAC	rs139914574	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92052646_92052647insCAC	uc003yes.2	-							NM_018710	NP_061180	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A							integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)			accaccaccatcaccaccacca	0.347													3	3	---	---	---	---	
RFX3	5991	broad.mit.edu	37	9	3271242	3271243	+	Intron	DEL	GA	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3271242_3271243delGA	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TTAACATGGTGAAACTACACTA	0.347													6	6	---	---	---	---	
GOLGA1	2800	broad.mit.edu	37	9	127700668	127700669	+	Intron	DEL	AT	-	-	rs112259308		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127700668_127700669delAT	uc004bpc.2	-						GOLGA1_uc010mwt.1_Intron	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97							Golgi cisterna membrane				ovary(1)	1						AAGGAAAAAAATATAGAGTACC	0.337													5	3	---	---	---	---	
REXO4	57109	broad.mit.edu	37	9	136272788	136272788	+	Intron	DEL	T	-	-	rs35694504		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136272788delT	uc004cdm.2	-						REXO4_uc011mde.1_Intron|REXO4_uc011mdf.1_Intron|REXO4_uc004cdn.2_Intron|REXO4_uc004cdo.2_Intron	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog							nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		cgctctaccattttttttttt	0.189											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138606581	138606582	+	Intron	INS	-	GG	GG	rs141291153	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138606581_138606582insGG	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGACCGGGCGCGGGGTGGGGGC	0.614													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11696232	11696233	+	IGR	INS	-	AGGA	AGGA			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11696232_11696233insAGGA								USP6NL (42553 upstream) : ECHDC3 (88123 downstream)																							AGGaggaggagaggaaggaagg	0.035													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50420821	50420822	+	IGR	DEL	AG	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50420821_50420822delAG								C10orf128 (24414 upstream) : C10orf71 (86365 downstream)																							aaagaaagaaagaaagaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467358	52467359	+	IGR	DEL	TC	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467358_52467359delTC								SGMS1 (82435 upstream) : ASAH2B (32337 downstream)																							AAAGCTGATATCcacacacaca	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111000355	111000358	+	IGR	DEL	GAAG	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111000355_111000358delGAAG								None (None upstream) : XPNPEP1 (624166 downstream)																							agggaggaaagaaggaaggaagga	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112293766	112293767	+	IGR	INS	-	AAGGAAGGAAGGAAGGAAGGAAGG	AAGGAAGGAAGGAAGGAAGGAAGG	rs147658304	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112293766_112293767insAAGGAAGGAAGGAAGGAAGGAAGG								DUSP5 (22466 upstream) : SMC3 (33682 downstream)																							tctcaaaaagaaaggaagaaag	0.000													3	3	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114710870	114710870	+	Intron	DEL	C	-	-	rs72101402		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114710870delC	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_5'Flank|TCF7L2_uc010qrs.1_5'Flank|TCF7L2_uc010qrt.1_5'Flank	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTTTTTTCTACCCCCCCCTCG	0.502													6	5	---	---	---	---	
C10orf84	63877	broad.mit.edu	37	10	120095475	120095476	+	Intron	INS	-	T	T			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120095475_120095476insT	uc001ldo.2	-						C10orf84_uc010qss.1_Intron	NM_022063	NP_071346	Q9H8W3	F204A_HUMAN	hypothetical protein LOC63877												0		Colorectal(252;0.101)		all cancers(201;0.0244)		AGTGGTTTGGGTTTTTTTTTTT	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	5079715	5079715	+	IGR	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5079715delA								OR52J3 (11033 upstream) : OR52E2 (166 downstream)																							actctgtctcaaaaaaaaaaa	0.144													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9628187	9628188	+	IGR	INS	-	AT	AT	rs10770046	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9628187_9628188insAT								WEE1 (16876 upstream) : SWAP70 (57440 downstream)																							TCTAAATATACATATATATATC	0.218													12	6	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14498309	14498309	+	Intron	DEL	T	-	-	rs11337817		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14498309delT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						CTACTGCttcttttttttttt	0.284													5	4	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14746856	14746859	+	Intron	DEL	TCTT	-	-	rs10534250		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14746856_14746859delTCTT	uc001mln.2	+						PDE3B_uc001mlm.2_Intron|PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						tctttctttctctttctttctttc	0.078													4	4	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16043877	16043878	+	Intron	INS	-	TTCC	TTCC			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16043877_16043878insTTCC	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						tccttccttctttccttccttc	0.129													5	4	---	---	---	---	
OR9G9	504191	broad.mit.edu	37	11	56467698	56467701	+	5'Flank	DEL	TGAT	-	-	rs33975577		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56467698_56467701delTGAT	uc010rjn.1	+							NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTGCAAAGCCTGATTGTTGCAAAA	0.279													3	3	---	---	---	---	
FADS1	3992	broad.mit.edu	37	11	61580507	61580508	+	Intron	INS	-	G	G	rs143226787	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61580507_61580508insG	uc010rlm.1	-						FADS1_uc001nsh.2_Intron|FADS1_uc010rln.1_Intron	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1						cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGGTAGTGGCAGCCTTGGGGGA	0.401													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113769072	113769073	+	IGR	INS	-	CTTC	CTTC	rs144460106	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113769072_113769073insCTTC								USP28 (22816 upstream) : HTR3B (6516 downstream)																							tttcttcctttcttccttcctt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123154895	123154896	+	IGR	DEL	TC	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123154895_123154896delTC								ASAM (88888 upstream) : GRAMD1B (241632 downstream)																							cttccttccttctctctctctc	0.015													4	2	---	---	---	---	
A2ML1	144568	broad.mit.edu	37	12	8993503	8993503	+	Intron	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8993503delA	uc001quz.3	+						A2ML1_uc001qva.1_5'Flank	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						actccatctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
MANSC1	54682	broad.mit.edu	37	12	12482820	12482821	+	3'UTR	INS	-	A	A	rs118108016	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12482820_12482821insA	uc001rai.1	-	4					MANSC1_uc010shm.1_3'UTR|MANSC1_uc001raj.1_3'UTR|MANSC1_uc009zht.1_3'UTR	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor							integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		actctgtctccaaaaaaaaaaa	0.188													5	3	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463357	49463374	+	Intron	DEL	CCAATCCTCCACTCTTCC	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463357_49463374delCCAATCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						ACCAACTCTTCCAATCCTCCACTCTTCCATTCCTCCAC	0.569													4	4	---	---	---	---	
MYL2	4633	broad.mit.edu	37	12	111358113	111358113	+	Intron	DEL	T	-	-	rs3216816		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111358113delT	uc001try.3	-						MYL2_uc001trx.3_5'Flank	NM_000432	NP_000423	P10916	MLRV_HUMAN	slow cardiac myosin regulatory light chain 2						cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1						AACTCTCTTATTTTGTGTTTG	0.463													5	9	---	---	---	---	
GCN1L1	10985	broad.mit.edu	37	12	120602670	120602670	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120602670delT	uc001txo.2	-							NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttacagcttgttttttttttt	0.000													4	2	---	---	---	---	
HIP1R	9026	broad.mit.edu	37	12	123338888	123338888	+	Intron	DEL	A	-	-	rs34386328		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123338888delA	uc001udj.1	+						HIP1R_uc001udg.1_Intron|HIP1R_uc001udi.1_Intron|HIP1R_uc001udk.1_5'Flank	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related						receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		atattttatgaaaaaaaaaaa	0.045													4	4	---	---	---	---	
ZMYM5	9205	broad.mit.edu	37	13	20409967	20409967	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20409967delT	uc010tcn.1	-						ZMYM5_uc001umm.1_Intron	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3							nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		AGGGAAAAGAttttttttttt	0.189													6	3	---	---	---	---	
RNF219	79596	broad.mit.edu	37	13	79216106	79216107	+	Intron	INS	-	A	A	rs141070590	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79216106_79216107insA	uc001vkw.1	-						RNF219_uc010afb.1_Intron|RNF219_uc010afc.2_Intron	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219								zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AAGGAAAAAAGAAAAAAGAATT	0.282													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	96725037	96725038	+	IGR	INS	-	GTGT	GTGT	rs141736833	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96725037_96725038insGTGT								UGGT2 (19301 upstream) : HS6ST3 (18055 downstream)																							GGTCAGATtgcgtgtgtgtgtg	0.342													4	2	---	---	---	---	
TMTC4	84899	broad.mit.edu	37	13	101264909	101264914	+	Intron	DEL	ACACAC	-	-	rs74114800		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101264909_101264914delACACAC	uc001vou.2	-						TMTC4_uc001vot.2_Intron|TMTC4_uc010tja.1_Intron	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ATCATGTAATacacacacacacacac	0.296													4	2	---	---	---	---	
C14orf21	161424	broad.mit.edu	37	14	24772593	24772594	+	Intron	DEL	TT	-	-	rs112529240		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772593_24772594delTT	uc001wol.1	+						C14orf21_uc001wom.1_Intron	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424								RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		ACCCAGCTAAtttttttttttt	0.312													5	3	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53150837	53150838	+	Intron	DEL	AC	-	-	rs72081523		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53150837_53150838delAC	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					AGAGCTCATGacacacacacac	0.302													4	2	---	---	---	---	
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CTCTCTCTCTCTTTTTTTTTGT	0.411													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69151658	69151659	+	Intron	INS	-	CCTTCCTTCCTT	CCTTCCTTCCTT	rs35395138		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69151658_69151659insCCTTCCTTCCTT	uc001xkg.1	+							NM_133510	NP_598194	O15315	RA51B_HUMAN	RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		GACAACCTTTCccttccttcct	0.317			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86538163	86538164	+	IGR	INS	-	GAGAGAGAGAAA	GAGAGAGAGAAA	rs140881841	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86538163_86538164insGAGAGAGAGAAA								FLRT2 (443894 upstream) : None (None downstream)																							aggaagaaagggagagagagaa	0.084													4	2	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176041	92176042	+	Intron	INS	-	A	A	rs12882622		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176041_92176042insA	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ctcaaaaaaacaaaaaaaaaga	0.149													6	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106094606	106094607	+	Intron	INS	-	C	C	rs151095596	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106094606_106094607insC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0						TGCTCCTCCTGCCCCCCCTCCC	0.703													1	5	---	---	---	---	
POTEB	339010	broad.mit.edu	37	15	22077299	22077299	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22077299delT	uc010tzr.1	-						POTEB_uc010tzq.1_Intron	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,												0						AAATTCAGTGTTTTTTTTTTT	0.259													6	3	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	27047805	27047806	+	Intron	DEL	TG	-	-	rs149912494		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27047805_27047806delTG	uc001zbb.2	-							NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	tgtgtgcttttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
GOLGA6B	55889	broad.mit.edu	37	15	72954508	72954509	+	Intron	INS	-	T	T	rs79734124		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72954508_72954509insT	uc010uks.1	+							NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B												0						TCAAGAGGAGGttttttttttt	0.485													9	4	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99459491	99459491	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99459491delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron|IGF1R_uc010urr.1_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TATCTTCTGGttttttttttt	0.224													7	4	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600733	600734	+	Intron	INS	-	T	T	rs145905062	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600733_600734insT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TGAGGGTCCCCGTCGGTGAGGG	0.738													4	5	---	---	---	---	
XPO6	23214	broad.mit.edu	37	16	28167920	28167921	+	Intron	INS	-	AA	AA	rs150507094	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28167920_28167921insAA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						AATTCTCCTTCAAAAAAatata	0.252													11	6	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31004014	31004015	+	3'UTR	INS	-	GGGGTGGAGGA	GGGGTGGAGGA	rs143292802	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31004014_31004015insGGGGTGGAGGA	uc010cad.2	-	10						NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						GGTCTGCCGTGGGGGTGGGGCT	0.653													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49511613	49511615	+	IGR	DEL	GAA	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49511613_49511615delGAA								C16orf78 (78296 upstream) : ZNF423 (12907 downstream)																							ggaagaacaggaagaagaagaag	0.000													3	3	---	---	---	---	
MBTPS1	8720	broad.mit.edu	37	16	84094451	84094451	+	Intron	DEL	T	-	-	rs71920773		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84094451delT	uc002fhi.2	-						MBTPS1_uc002fhh.2_Intron	NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TAGGAAttccttttttttttt	0.254													4	2	---	---	---	---	
MRM1	79922	broad.mit.edu	37	17	34964977	34964977	+	3'UTR	DEL	A	-	-	rs4796229	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34964977delA	uc002hne.2	+	5					MRM1_uc002hnf.2_3'UTR	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog						RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCACAGTCTGAGGGGGGGGGA	0.592											OREG0024339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
QRICH2	84074	broad.mit.edu	37	17	74272212	74272213	+	Intron	INS	-	ACCCACCCA	ACCCACCCA	rs149188388	by1000genomes	TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74272212_74272213insACCCACCCA	uc002jrd.1	-						QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						TTCTCGTGGCCACCCACCCACT	0.609													4	2	---	---	---	---	
NARS	4677	broad.mit.edu	37	18	55287644	55287645	+	Intron	DEL	TT	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55287644_55287645delTT	uc002lgs.2	-						NARS_uc002lgt.2_Intron|NARS_uc010xea.1_Intron|NARS_uc010xeb.1_Intron|NARS_uc010xec.1_Intron|NARS_uc010xed.1_Intron	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase						asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)	TCTAACAATCTTAAAGTCACAT	0.322													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74869063	74869064	+	IGR	INS	-	TT	TT	rs60810324		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74869063_74869064insTT								MBP (24289 upstream) : GALR1 (92944 downstream)																							ttctttctttctctctctttct	0.059													6	3	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2418276	2418276	+	Intron	DEL	T	-	-	rs112073170		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418276delT	uc010xgx.1	+							NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ccttccctccttttcctttcc	0.124													5	5	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4182963	4182964	+	5'Flank	DEL	TG	-	-	rs67518034		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4182963_4182964delTG	uc010dtt.1	+						SIRT6_uc002lzn.2_5'Flank|SIRT6_uc002lzo.2_5'Flank|SIRT6_uc002lzp.2_5'Flank|SIRT6_uc010xid.1_5'Flank|SIRT6_uc002lzq.2_5'Flank|SIRT6_uc002lzr.2_5'Flank	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		ATATCTCATTtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
CNN1	1264	broad.mit.edu	37	19	11660002	11660003	+	Intron	INS	-	A	A			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11660002_11660003insA	uc002msc.1	+						CNN1_uc010xmb.1_Intron|CNN1_uc010xmc.1_Intron	NM_001299	NP_001290	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle						actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0						gactccgtctcaaaaaaaaata	0.173													4	2	---	---	---	---	
ZNF793	390927	broad.mit.edu	37	19	38028814	38028814	+	3'UTR	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38028814delT	uc010efm.2	+	8					ZNF793_uc010xts.1_3'UTR|ZNF793_uc010efo.2_Intron	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGTAGGGAAttttttttttt	0.174													6	3	---	---	---	---	
BCKDHA	593	broad.mit.edu	37	19	41903574	41903574	+	5'Flank	DEL	T	-	-	rs16980932		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41903574delT	uc002oqq.2	+						CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|EXOSC5_uc002oqo.2_5'Flank|BCKDHA_uc002oqp.1_5'Flank|BCKDHA_uc002oqr.2_5'Flank|BCKDHA_uc010xvz.1_5'Flank	NM_000709	NP_000700	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0						GGTAGATAGATTTTTTTTTCT	0.453													3	4	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332921	1332921	+	Intron	DEL	T	-	-	rs6041626		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332921delT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	ccttccttcctttccttcctt	0.005													4	2	---	---	---	---	
HMGB3L1	128872	broad.mit.edu	37	20	33421797	33421797	+	RNA	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33421797delT	uc002xax.2	-	1		c.469delA				NR_002165				Homo sapiens high-mobility group (nonhistone chromosomal) protein 4-like, mRNA (cDNA clone IMAGE:40002762).												0						TCTCTCTCTCttttttttttt	0.214													3	3	---	---	---	---	
CDH22	64405	broad.mit.edu	37	20	44809566	44809567	+	Intron	DEL	TG	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44809566_44809567delTG	uc002xrm.2	-						CDH22_uc010ghk.1_Intron	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				aagtttgttttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42720076	42720077	+	IGR	INS	-	TGG	TGG			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42720076_42720077insTGG								TCF20 (108631 upstream) : NFAM1 (56338 downstream)																							gatggaggttatggtggtggtg	0.000													5	3	---	---	---	---	
ARSD	414	broad.mit.edu	37	X	2827725	2827727	+	Intron	DEL	AAA	-	-	rs66586698		TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2827725_2827727delAAA	uc004cqy.2	-						ARSD_uc004cqz.1_Intron	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor							lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				actctgtctcaaaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6340076	6340076	+	IGR	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6340076delT								NLGN4X (193370 upstream) : VCX3A (111584 downstream)																							tcttttattattttttttttG	0.254													4	2	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118759508	118759508	+	Intron	DEL	T	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118759508delT	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						ACTGATACTCttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150162649	150162649	+	IGR	DEL	A	-	-			TCGA-BP-5184-01A-01D-1429-08	TCGA-BP-5184-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150162649delA								HMGB3 (3403 upstream) : GPR50 (182410 downstream)																							TCTGCTTGCCAAAAAAAAAAA	0.204													3	3	---	---	---	---	
