Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RERE	473	broad.mit.edu	37	1	8420609	8420609	+	Silent	SNP	T	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8420609T>G	uc001ape.2	-	19	3768	c.2958A>C	c.(2956-2958)CCA>CCC	p.P986P	RERE_uc001apf.2_Silent_p.P986P|RERE_uc010nzx.1_Silent_p.P718P|RERE_uc001apd.2_Silent_p.P432P	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	986	Pro-rich.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTTGCAGGGGTGGGGGGTGAG	0.706													11	49	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959803	16959803	+	5'Flank	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959803G>A	uc009vov.1	-						CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azf.2_RNA|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						TTCCCAGGCCGGCCTCCTGGA	0.642													2	2	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	20998503	20998503	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20998503A>G	uc001bdr.3	-	12	2768	c.2650T>C	c.(2650-2652)TCC>CCC	p.S884P	KIF17_uc001bdp.3_Missense_Mutation_p.S162P|KIF17_uc001bdq.3_Missense_Mutation_p.S162P|KIF17_uc009vpx.2_Missense_Mutation_p.S254P|KIF17_uc001bds.3_Missense_Mutation_p.S884P	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	884					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCCCAGCAGGACTCACGCAGA	0.577													50	83	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	20998504	20998504	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20998504C>T	uc001bdr.3	-	12	2767	c.2649G>A	c.(2647-2649)GAG>GAA	p.E883E	KIF17_uc001bdp.3_Silent_p.E161E|KIF17_uc001bdq.3_Silent_p.E161E|KIF17_uc009vpx.2_Silent_p.E253E|KIF17_uc001bds.3_Silent_p.E883E	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	883					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCCAGCAGGACTCACGCAGAA	0.572													50	82	---	---	---	---	PASS
RUNX3	864	broad.mit.edu	37	1	25256188	25256188	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25256188C>G	uc001bjq.2	-	1	583	c.172G>C	c.(172-174)GTG>CTG	p.V58L	RUNX3_uc010oen.1_Missense_Mutation_p.V58L|RUNX3_uc009vrj.2_Missense_Mutation_p.V72L|RUNX3_uc001bjr.2_Missense_Mutation_p.V72L|RUNX3_uc009vrk.2_Missense_Mutation_p.V72L|RUNX3_uc009vrl.1_Missense_Mutation_p.V72L	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	58	Runt.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		TCCGCCAGCACGTCCACCATC	0.582													4	10	---	---	---	---	PASS
RPA2	6118	broad.mit.edu	37	1	28220534	28220534	+	Silent	SNP	T	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28220534T>C	uc001bpe.1	-	8	999	c.717A>G	c.(715-717)GTA>GTG	p.V239V	RPA2_uc001bpd.1_Silent_p.V247V|RPA2_uc010ofp.1_Silent_p.V143V	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa	239	Interaction with TIPIN (By similarity).				cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TGATTGAGGATACAGACATGT	0.403								Direct_reversal_of_damage|NER					5	124	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112319724	112319724	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112319724C>T	uc001ebu.1	-	7	2170	c.1690G>A	c.(1690-1692)GCT>ACT	p.A564T	KCND3_uc001ebv.1_Missense_Mutation_p.A545T	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	564	Cytoplasmic (Potential).			A -> D (in Ref. 2; AAF01044/AAF01045).		sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		AGGCGAGTAGCTGGCAGGTTA	0.597													52	89	---	---	---	---	PASS
PIAS3	10401	broad.mit.edu	37	1	145581555	145581555	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145581555T>C	uc001eoc.1	+	9	1227	c.1136T>C	c.(1135-1137)ATC>ACC	p.I379T	NBPF10_uc001emp.3_Intron|PIAS3_uc001eod.1_Missense_Mutation_p.I48T	NM_006099	NP_006090	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	379	SP-RING-type.				positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAATCTCTTATCATTGATGGG	0.383													4	194	---	---	---	---	PASS
NOS1AP	9722	broad.mit.edu	37	1	162313643	162313643	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162313643G>T	uc001gbv.2	+	6	859	c.472G>T	c.(472-474)GTT>TTT	p.V158F	NOS1AP_uc010pkr.1_Missense_Mutation_p.V153F|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_Missense_Mutation_p.V153F	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	158	PID.				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			TATGAGAATCGTTCGGACGGT	0.552													6	178	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204230552	204230552	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204230552A>C	uc001hau.2	-	7	723	c.406T>G	c.(406-408)TAC>GAC	p.Y136D		NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	136	PH.									ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTGAAGAAGTAGGTGCGGACC	0.642													29	46	---	---	---	---	PASS
TMEM81	388730	broad.mit.edu	37	1	205053016	205053016	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205053016C>A	uc001hbt.2	-	1	573	c.433G>T	c.(433-435)GTG>TTG	p.V145L		NM_203376	NP_976310	Q6P7N7	TMM81_HUMAN	transmembrane protein 81 precursor	145	Ig-like.|Extracellular (Potential).					integral to membrane					0	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			TTAAACTTCACAAAGTGGGAG	0.468													52	131	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25505226	25505226	+	Intron	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25505226G>A	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron|DNMT3A_uc002rge.2_3'UTR|DNMT3A_uc002rgf.2_3'UTR	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCCTTCCTGGGACCTGCTG	0.502			Mis|F|N|S		AML								4	6	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68882677	68882677	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68882677C>A	uc010yqj.1	+	2	1151	c.1151C>A	c.(1150-1152)ACC>AAC	p.T384N	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	384	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						ATGCCTGCCACCGAAGAGGTG	0.483													4	86	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136402959	136402959	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136402959C>T	uc002tuo.2	+	16	1855	c.1485C>T	c.(1483-1485)TTC>TTT	p.F495F	R3HDM1_uc010fni.2_Silent_p.F493F|R3HDM1_uc002tup.2_Silent_p.F439F|R3HDM1_uc010zbh.1_Silent_p.F242F	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	495							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		GTCAGCCCTTCATAAACCCAG	0.423													61	126	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179474659	179474659	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179474659A>C	uc010zfg.1	-	221	44011	c.43787T>G	c.(43786-43788)ATG>AGG	p.M14596R	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M8291R|TTN_uc010zfi.1_Missense_Mutation_p.M8224R|TTN_uc010zfj.1_Missense_Mutation_p.M8099R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15523							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAATAGTCATTGCCTCCGC	0.428													6	430	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179599470	179599470	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179599470C>T	uc010zfg.1	-	48	11673	c.11449G>A	c.(11449-11451)GGC>AGC	p.G3817S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G478S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4744							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTATCACTGCCGACGTCATTC	0.358													6	312	---	---	---	---	PASS
DUSP19	142679	broad.mit.edu	37	2	183960371	183960371	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183960371G>A	uc002upd.2	+	4	1014	c.639G>A	c.(637-639)CAG>CAA	p.Q213Q	DUSP19_uc010frp.2_Silent_p.Q162Q|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_3'UTR	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1	213					JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						ACAGAATACAGGAGAACAGTT	0.398													42	85	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224462129	224462129	+	3'UTR	SNP	G	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224462129G>C	uc002vnm.2	-	2						NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor						angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGAAAGTAGGGTAATTAATGA	0.388													71	136	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228883287	228883287	+	Silent	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228883287A>G	uc002vpq.2	-	7	2330	c.2283T>C	c.(2281-2283)GCT>GCC	p.A761A	SPHKAP_uc002vpp.2_Silent_p.A761A|SPHKAP_uc010zlx.1_Silent_p.A761A	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	761						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTTTGTCCAAGCTTGACTAG	0.488													117	207	---	---	---	---	PASS
C2orf52	151477	broad.mit.edu	37	2	232373743	232373743	+	3'UTR	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232373743A>G	uc002vrx.1	-	3						NR_024079				RecName: Full=Uncharacterized protein C2orf52;												0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;5.72e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		TTGCCAAGGCAGTTTTCAGAG	0.498													55	91	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9788979	9788979	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788979G>T	uc003bse.2	+	14	3990	c.3591G>T	c.(3589-3591)CAG>CAT	p.Q1197H	BRPF1_uc003bsf.2_Missense_Mutation_p.Q1203H|BRPF1_uc003bsg.2_Missense_Mutation_p.Q1196H|BRPF1_uc011ati.1_Missense_Mutation_p.Q1102H|OGG1_uc003bsh.2_5'Flank|OGG1_uc003bsi.2_5'Flank|OGG1_uc003bsj.2_5'Flank|OGG1_uc003bsk.2_5'Flank|OGG1_uc003bsl.2_5'Flank|OGG1_uc003bsm.2_5'Flank|OGG1_uc003bsn.2_5'Flank|OGG1_uc003bso.2_5'Flank	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1197					histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					GGGCTCTGCAGCACCGCAGCA	0.562													4	133	---	---	---	---	PASS
PRSS50	29122	broad.mit.edu	37	3	46754550	46754550	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46754550C>T	uc003cqe.1	-	5	821	c.762G>A	c.(760-762)TGG>TGA	p.W254*	PRSS50_uc003cqf.1_Nonsense_Mutation_p.W168*	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN	testes-specific protease 50 precursor	254	Peptidase S1.				proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity				0						GGAACTGAGGCCACATGCCTG	0.557													43	178	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121206899	121206899	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121206899G>A	uc003eee.3	-	16	5008	c.4879C>T	c.(4879-4881)CAT>TAT	p.H1627Y	POLQ_uc003eed.2_Missense_Mutation_p.H799Y	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1627					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		ATGAATGAATGATTTTGCCTG	0.393								DNA_polymerases_(catalytic_subunits)					6	509	---	---	---	---	PASS
ITGB5	3693	broad.mit.edu	37	3	124487961	124487961	+	Splice_Site	SNP	C	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124487961C>G	uc003eho.2	-	12	2214	c.1917_splice	c.e12-1	p.R639_splice	ITGB5_uc010hrx.2_Splice_Site	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		GACGCAATCTCTTTGGAAAAG	0.537													4	90	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186299170	186299170	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299170A>C	uc003fqi.2	+	5	687	c.467A>C	c.(466-468)AAC>ACC	p.N156T		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	156					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		GTAGTTAGAAACAAACCTGTG	0.512													57	99	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39308288	39308288	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39308288C>A	uc003gty.1	-	14	2056	c.1922G>T	c.(1921-1923)GGC>GTC	p.G641V	RFC1_uc003gtx.1_Missense_Mutation_p.G640V	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	641				G -> N (in Ref. 2, 3 and 4).	DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						AAAACTAGAGCCATCATCTTT	0.473													18	31	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39308289	39308289	+	Missense_Mutation	SNP	C	A	A	rs1135544		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39308289C>A	uc003gty.1	-	14	2055	c.1921G>T	c.(1921-1923)GGC>TGC	p.G641C	RFC1_uc003gtx.1_Missense_Mutation_p.G640C	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	641				G -> N (in Ref. 2, 3 and 4).	DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						AAACTAGAGCCATCATCTTTG	0.473													18	32	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	74005971	74005971	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74005971A>T	uc003hgp.2	-	15	2479	c.2362T>A	c.(2362-2364)TTG>ATG	p.L788M	ANKRD17_uc003hgo.2_Missense_Mutation_p.L675M|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Missense_Mutation_p.L788M|ANKRD17_uc011cbd.1_Missense_Mutation_p.L353M	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	788					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTGCTGGCAAATGGCTGCTG	0.468													55	116	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126411497	126411497	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126411497C>T	uc003ifj.3	+	17	13520	c.13520C>T	c.(13519-13521)GCC>GTC	p.A4507V	FAT4_uc011cgp.1_Missense_Mutation_p.A2748V|FAT4_uc003ifi.1_Missense_Mutation_p.A1984V	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4507	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GCTGTGCCTGCCATCGTGGGC	0.587													48	83	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14755993	14755993	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14755993A>G	uc003jfm.3	-	4	824	c.493T>C	c.(493-495)TCA>CCA	p.S165P		NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	165	Helical; (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						TCTGAGATTGAGGCACATCCC	0.438													3	149	---	---	---	---	PASS
CDC25C	995	broad.mit.edu	37	5	137665253	137665253	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137665253A>T	uc003lcp.1	-	3	549	c.278T>A	c.(277-279)CTT>CAT	p.L93H	CDC25C_uc003lcq.1_Intron|CDC25C_uc003lcr.1_Missense_Mutation_p.L93H|CDC25C_uc011cyp.1_Missense_Mutation_p.L110H|CDC25C_uc003lcs.1_Missense_Mutation_p.L171H|CDC25C_uc010jet.1_Missense_Mutation_p.L93H|CDC25C_uc003lct.1_Missense_Mutation_p.L93H|CDC25C_uc003lcu.1_Intron	NM_001790	NP_001781	P30307	MPIP3_HUMAN	cell division cycle 25C isoform a	93					cell cycle checkpoint|cell division|cell proliferation|DNA replication|G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm	protein tyrosine phosphatase activity|WW domain binding			lung(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AGTTTCATCAAGGTCTGCAGA	0.463													217	219	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139193067	139193067	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139193067C>T	uc003leu.1	+	3	750	c.545C>T	c.(544-546)CCC>CTC	p.P182L		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	182					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCTCACACCCCTCATCCAG	0.672													31	112	---	---	---	---	PASS
PCDHA5	56143	broad.mit.edu	37	5	140201497	140201497	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140201497G>A	uc003lhl.2	+	1	137	c.137G>A	c.(136-138)CGC>CAC	p.R46H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.R46H|PCDHA5_uc003lhj.1_Missense_Mutation_p.R46H	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	46	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGTTGGCCGCATCGCGCAG	0.657													4	222	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140255065	140255065	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140255065T>A	uc003lic.2	+	1	135	c.8T>A	c.(7-9)ATT>AAT	p.I3N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.I3N	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	3					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAATGGTGATTATCGGACCA	0.542													13	53	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149216300	149216300	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149216300G>A	uc003lrc.2	+	8	2324	c.2282G>A	c.(2281-2283)CGT>CAT	p.R761H	PPARGC1B_uc003lrb.1_Missense_Mutation_p.R761H|PPARGC1B_uc003lrd.2_Missense_Mutation_p.R722H|PPARGC1B_uc003lrf.2_Missense_Mutation_p.R740H|PPARGC1B_uc003lre.1_Missense_Mutation_p.R740H	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	761					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CATGAGATCCGTGCCAGCCTC	0.612													101	253	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168310291	168310291	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168310291C>T	uc003mab.2	-	5	884	c.464G>A	c.(463-465)GGC>GAC	p.G155D	SLIT3_uc010jjg.2_Missense_Mutation_p.G155D|SLIT3_uc010jji.2_Missense_Mutation_p.G155D	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	155	LRR 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCGGTGATGCCGCGGAACGC	0.507													4	193	---	---	---	---	PASS
KCNIP1	30820	broad.mit.edu	37	5	170162829	170162829	+	3'UTR	SNP	T	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170162829T>A	uc003mas.2	+	9					KCNIP1_uc003map.2_3'UTR|KCNIP1_uc003mat.2_3'UTR|KCNIP1_uc010jjp.2_3'UTR|KCNIP1_uc010jjq.2_3'UTR	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTCAGCCATTCAGCTCTCAG	0.448													27	157	---	---	---	---	PASS
KCNIP1	30820	broad.mit.edu	37	5	170162830	170162830	+	3'UTR	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170162830C>A	uc003mas.2	+	9					KCNIP1_uc003map.2_3'UTR|KCNIP1_uc003mat.2_3'UTR|KCNIP1_uc010jjp.2_3'UTR|KCNIP1_uc010jjq.2_3'UTR	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCAGCCATTCAGCTCTCAGA	0.448													27	156	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	13283726	13283726	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13283726G>C	uc010jpc.2	+	13	1914	c.1582G>C	c.(1582-1584)GTG>CTG	p.V528L	PHACTR1_uc003nah.1_Missense_Mutation_p.V528L|TBC1D7_uc003naj.2_Intron|TBC1D7_uc011dis.1_Intron|uc003nak.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	528						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CTACGTGGAGGTGGCTGACGC	0.597													58	117	---	---	---	---	PASS
MRPL14	64928	broad.mit.edu	37	6	44081767	44081767	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44081767G>A	uc003owp.2	-	3	380	c.251C>T	c.(250-252)GCG>GTG	p.A84V		NM_032111	NP_115487	Q6P1L8	RM14_HUMAN	mitochondrial ribosomal protein L14 precursor	84					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)			CACAATGAGCGCCTTTTTCTT	0.562													165	323	---	---	---	---	PASS
WIPI2	26100	broad.mit.edu	37	7	5257505	5257505	+	Intron	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5257505G>A	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron|WIPI2_uc003snz.2_3'UTR|WIPI2_uc003soa.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		CCTGGGGCGTGGGCGGTCACT	0.532													52	87	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82784471	82784471	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784471A>G	uc003uhx.2	-	2	1775	c.1486T>C	c.(1486-1488)TCA>CCA	p.S496P	PCLO_uc003uhv.2_Missense_Mutation_p.S496P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGCTTTGCTGAGCCAGGCTGT	0.607													6	243	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3566004	3566004	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3566004G>A	uc011kwk.1	-	7	1331	c.941C>T	c.(940-942)GCG>GTG	p.A314V		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	314	Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAACTCAATCGCCTTTTTCAC	0.433													19	45	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32453385	32453385	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32453385C>T	uc003xiv.2	+	2	657	c.140C>T	c.(139-141)TCG>TTG	p.S47L	NRG1_uc003xip.2_Missense_Mutation_p.S262L|NRG1_uc003xir.2_Missense_Mutation_p.S47L|NRG1_uc010lvl.2_Missense_Mutation_p.S47L|NRG1_uc010lvm.2_Missense_Mutation_p.S47L|NRG1_uc010lvn.2_Missense_Mutation_p.S47L|NRG1_uc003xis.2_Missense_Mutation_p.S47L|NRG1_uc011lbf.1_Missense_Mutation_p.S47L|NRG1_uc010lvo.2_Missense_Mutation_p.S47L|NRG1_uc003xiu.2_Missense_Mutation_p.S47L|NRG1_uc003xiw.2_Missense_Mutation_p.S47L|NRG1_uc003xit.2_Missense_Mutation_p.S47L|NRG1_uc010lvr.2_5'UTR|NRG1_uc010lvs.2_5'UTR|NRG1_uc010lvp.2_Missense_Mutation_p.S13L|NRG1_uc010lvq.2_Missense_Mutation_p.S13L	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha	47	Extracellular (Potential).|Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AGCCAGGAATCGGCTGCAGGT	0.413													4	209	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73480522	73480522	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480522A>G	uc003xzb.2	+	2	1141	c.553A>G	c.(553-555)AAA>GAA	p.K185E		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	185	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CTTGCTGGAGAAACCTAACTC	0.458													58	145	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113347652	113347652	+	Silent	SNP	G	T	T	rs113449703		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113347652G>T	uc003ynu.2	-	45	7230	c.7071C>A	c.(7069-7071)ACC>ACA	p.T2357T	CSMD3_uc003yns.2_Silent_p.T1559T|CSMD3_uc003ynt.2_Silent_p.T2317T|CSMD3_uc011lhx.1_Silent_p.T2253T|CSMD3_uc003ynw.1_Silent_p.T68T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2357	Extracellular (Potential).|CUB 13.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATTCCAAAGCGGTATTGCCAC	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			35	83	---	---	---	---	PASS
LRRC24	441381	broad.mit.edu	37	8	145748563	145748563	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145748563C>G	uc003zdm.2	-	5	970	c.838G>C	c.(838-840)GCC>CCC	p.A280P	LRRC24_uc003zdn.2_Missense_Mutation_p.A277P|LRRC14_uc003zdk.1_3'UTR|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_RNA	NM_001024678	NP_001019849	Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24 precursor	280	Ig-like C2-type.					integral to membrane					0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCTTGGCAGGCAACCCGCAGG	0.677													8	14	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79325231	79325231	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79325231G>A	uc010mpk.2	-	8	2083	c.1959C>T	c.(1957-1959)TGC>TGT	p.C653C		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	653					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						ACCAGCTGCTGCACCGTGCAT	0.502													5	168	---	---	---	---	PASS
BICD2	23299	broad.mit.edu	37	9	95491475	95491475	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95491475T>A	uc004aso.1	-	2	341	c.284A>T	c.(283-285)GAC>GTC	p.D95V	BICD2_uc004asp.1_Missense_Mutation_p.D95V	NM_015250	NP_056065	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 isoform 2	95	Potential.				microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1						GCTCTCTCCGTCAGCAGCCAC	0.597													32	75	---	---	---	---	PASS
ALG2	85365	broad.mit.edu	37	9	101980488	101980488	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101980488A>C	uc004azf.2	-	2	1049	c.979T>G	c.(979-981)TTT>GTT	p.F327V	ALG2_uc004azg.2_Missense_Mutation_p.F234V	NM_033087	NP_149078	Q9H553	ALG2_HUMAN	alpha-1,3-mannosyltransferase ALG2	327					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in endoplasmic reticulum|protein N-linked glycosylation via asparagine|response to calcium ion	endoplasmic reticulum membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	alpha-1,3-mannosyltransferase activity|calcium-dependent protein binding|glycolipid 3-alpha-mannosyltransferase activity|protein anchor|protein heterodimerization activity|protein N-terminus binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.0559)				ACAATGCCAAAGTGCTCATTG	0.502													5	145	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109746495	109746495	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109746495C>T	uc004bcz.2	+	10	7150	c.6861C>T	c.(6859-6861)TGC>TGT	p.C2287C	ZNF462_uc010mto.2_Silent_p.C2196C|ZNF462_uc004bda.2_Silent_p.C2195C|ZNF462_uc011lvz.1_Silent_p.C244C|uc004bdc.1_Intron	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	2287					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TTGAAGTTTGCCGGTCCAAAC	0.423													4	143	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128064318	128064318	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128064318A>G	uc010mwx.2	+	5	568	c.242A>G	c.(241-243)CAA>CGA	p.Q81R	GAPVD1_uc004bpo.2_Missense_Mutation_p.Q81R|GAPVD1_uc011lzs.1_Missense_Mutation_p.Q81R|GAPVD1_uc004bpp.2_Missense_Mutation_p.Q81R|GAPVD1_uc004bpq.2_Missense_Mutation_p.Q81R|GAPVD1_uc004bpr.2_Missense_Mutation_p.Q81R|GAPVD1_uc004bps.2_Missense_Mutation_p.Q81R|GAPVD1_uc010mwy.1_5'UTR	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	81					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GAAGATACACAATTTGTTGAT	0.368													6	268	---	---	---	---	PASS
STXBP1	6812	broad.mit.edu	37	9	130413898	130413898	+	Silent	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130413898G>T	uc004brl.2	+	2	251	c.54G>T	c.(52-54)GTG>GTT	p.V18V	STXBP1_uc004brk.2_Silent_p.V18V	NM_001032221	NP_001027392	P61764	STXB1_HUMAN	syntaxin binding protein 1 isoform b	18					axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1						TGCATGATGTGATAAAGAAGG	0.383													26	36	---	---	---	---	PASS
FCN1	2219	broad.mit.edu	37	9	137801702	137801702	+	Missense_Mutation	SNP	G	A	A	rs143541199		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137801702G>A	uc004cfi.2	-	9	1015	c.923C>T	c.(922-924)GCG>GTG	p.A308V		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	308	Fibrinogen C-terminal.				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CCCCTTCGCCGCACTCCAGTT	0.572													5	205	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138713812	138713812	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138713812T>G	uc004cgr.3	-	11	2695	c.2695A>C	c.(2695-2697)ATG>CTG	p.M899L	CAMSAP1_uc004cgq.3_Missense_Mutation_p.M789L|CAMSAP1_uc010nbg.2_Missense_Mutation_p.M621L	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	899						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		AGCGCCTCCATCTTCTTCTTC	0.642													32	112	---	---	---	---	PASS
CELF2	10659	broad.mit.edu	37	10	11047307	11047307	+	5'UTR	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11047307C>A	uc001iki.3	+	1					CELF2_uc010qbi.1_5'UTR|CELF2_uc010qbj.1_5'UTR	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GATGTTTGAGCATACTTCTGA	0.313													18	238	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61830794	61830794	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61830794A>G	uc001jky.2	-	37	10037	c.9845T>C	c.(9844-9846)ATT>ACT	p.I3282T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3282					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ATTGACTTCAATCATGTCAAC	0.488													136	249	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64136626	64136626	+	Missense_Mutation	SNP	C	T	T	rs61863383		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64136626C>T	uc001jmc.2	+	2	989	c.674C>T	c.(673-675)GCC>GTC	p.A225V	ZNF365_uc001jly.3_Missense_Mutation_p.A240V|ZNF365_uc001jmb.3_Missense_Mutation_p.A225V|ZNF365_uc001jlz.3_Missense_Mutation_p.A225V|ZNF365_uc001jma.3_Intron	NM_199451	NP_955523	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform C	Error:Variant_position_missing_in_Q70YC4_after_alignment										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GTGGACGTGGCCGTGGAAATG	0.527													4	182	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114046095	114046095	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114046095G>A	uc001kzr.1	+	4	429	c.429G>A	c.(427-429)GTG>GTA	p.V143V		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	143	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CTGTTCACGTGAAGAACGGGA	0.498													37	96	---	---	---	---	PASS
GPR26	2849	broad.mit.edu	37	10	125426346	125426346	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125426346G>A	uc001lhh.2	+	1	476	c.423G>A	c.(421-423)GCG>GCA	p.A141A		NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	141	Helical; Name=4; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CAGCCGCCGCGCTCGCCCTGT	0.711													10	8	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135106185	135106185	+	Silent	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135106185C>A	uc001lmg.1	-	8	1389	c.1032G>T	c.(1030-1032)TCG>TCT	p.S344S	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Silent_p.S372S|TUBGCP2_uc009ybk.1_Silent_p.S344S|TUBGCP2_uc010qvd.1_Silent_p.S214S|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	344					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CTTTGTCCACCGAGGTGGCTG	0.627													3	35	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													7	87	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48152101	48152101	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48152101A>G	uc001ngp.3	+	8	1803	c.1448A>G	c.(1447-1449)CAG>CGG	p.Q483R	PTPRJ_uc001ngo.3_Missense_Mutation_p.Q483R	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	483	Extracellular (Potential).|Fibronectin type-III 5.				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GAATCATTTCAGATGCATATC	0.488													39	57	---	---	---	---	PASS
OR5T3	390154	broad.mit.edu	37	11	56019933	56019933	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56019933C>A	uc010rjd.1	+	1	258	c.258C>A	c.(256-258)CAC>CAA	p.H86Q		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	86	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					CCTGGCTCCACAACCCCATGT	0.363													6	235	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61070127	61070127	+	Silent	SNP	T	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61070127T>C	uc001nrc.3	-	24	3265	c.3039A>G	c.(3037-3039)GTA>GTG	p.V1013V	DDB1_uc010rle.1_Silent_p.V324V|DDB1_uc010rlf.1_Silent_p.V1013V	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	1013	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						GATTCTGCATTACCAGAGAGC	0.592								NER					105	207	---	---	---	---	PASS
RCE1	9986	broad.mit.edu	37	11	66612345	66612345	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66612345C>T	uc001ojk.1	+	5	501	c.457C>T	c.(457-459)CGC>TGC	p.R153C	RCE1_uc001ojl.1_Missense_Mutation_p.R49C	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN	prenyl protein peptidase RCE1 isoform 1	153					proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity			ovary(1)|breast(1)	2						TGCAGCCCCCCGCTCCTGGGC	0.627													3	42	---	---	---	---	PASS
KRTAP5-7	440050	broad.mit.edu	37	11	71238436	71238436	+	Silent	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71238436A>C	uc001oqq.1	+	1	124	c.90A>C	c.(88-90)GGA>GGC	p.G30G		NM_001012503	NP_001012521	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	30						keratin filament					0						GCTGTGGGGGATGTGGCTCCA	0.677													6	166	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384525	8384525	+	RNA	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384525G>T	uc010sgk.1	-	5		c.1263C>A				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						AAGCTGTGGTGGGCCCTGATT	0.562													3	24	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32140106	32140106	+	Intron	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32140106C>T	uc001rks.2	+						C12orf35_uc001rkt.2_RNA	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196											ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			ACATGATTTTCCTTTGTTATA	0.284													18	24	---	---	---	---	PASS
RACGAP1	29127	broad.mit.edu	37	12	50384068	50384068	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50384068A>G	uc001rvt.2	-	19	2192	c.1882T>C	c.(1882-1884)TCT>CCT	p.S628P	RACGAP1_uc009zlm.1_Missense_Mutation_p.S628P|RACGAP1_uc001rvs.2_Missense_Mutation_p.S628P|RACGAP1_uc001rvu.2_Missense_Mutation_p.S628P	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	628					blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						AGCATTGGAGAAGCAAAAAAG	0.408													38	94	---	---	---	---	PASS
BAZ2A	11176	broad.mit.edu	37	12	56994801	56994801	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56994801C>A	uc001slq.1	-	22	4576	c.4382G>T	c.(4381-4383)CGG>CTG	p.R1461L	BAZ2A_uc001slp.1_Missense_Mutation_p.R1459L|BAZ2A_uc001slo.1_Missense_Mutation_p.R267L|BAZ2A_uc009zov.1_Missense_Mutation_p.R427L|BAZ2A_uc009zow.1_Missense_Mutation_p.R1429L	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1461					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						TGCCTTCTCCCGGATACCTCG	0.532													3	37	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133201151	133201151	+	3'UTR	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133201151C>T	uc001uks.1	-	49					POLE_uc001ukq.1_3'UTR|POLE_uc001ukr.1_3'UTR|POLE_uc010tbq.1_RNA	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GTTTCCTCCCCGTTCCCTGGC	0.612								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					8	18	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415677	19415677	+	RNA	SNP	A	T	T	rs142136612	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415677A>T	uc010tcj.1	-	1		c.30433T>A				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AACACACTGCAATAGGCTTAC	0.239													4	110	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31626196	31626196	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31626196C>T	uc001wrc.1	-	12	2271	c.1782G>A	c.(1780-1782)TTG>TTA	p.L594L	HECTD1_uc001wrd.1_Silent_p.L109L	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	594	ANK 4.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GCAAAGCCAGCAAGTGGCCAT	0.358													4	116	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88693788	88693788	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88693788C>T	uc001xwo.2	-	4	1054	c.597G>A	c.(595-597)TTG>TTA	p.L199L	KCNK10_uc001xwm.2_Silent_p.L204L|KCNK10_uc001xwn.2_Silent_p.L204L	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	199	Helical; (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CAATTCCAGCCAATAAGAAAC	0.408													9	243	---	---	---	---	PASS
DISP2	85455	broad.mit.edu	37	15	40660395	40660395	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40660395G>A	uc001zlk.1	+	8	2171	c.2082G>A	c.(2080-2082)CTG>CTA	p.L694L		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	694					smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TCCAGCGCCTGCTGCCCTGCG	0.642													13	8	---	---	---	---	PASS
ZNF280D	54816	broad.mit.edu	37	15	56993407	56993407	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56993407A>G	uc002adu.2	-	5	422	c.205T>C	c.(205-207)TAT>CAT	p.Y69H	ZNF280D_uc002adv.2_Missense_Mutation_p.Y56H|ZNF280D_uc010bfq.2_Missense_Mutation_p.Y69H|ZNF280D_uc002adw.1_Missense_Mutation_p.Y97H|ZNF280D_uc010bfr.1_RNA|ZNF280D_uc002ady.2_Missense_Mutation_p.Y69H|ZNF280D_uc002adx.2_Missense_Mutation_p.Y69H	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1	69					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		CCCCTTGAATATGAGCTGGGG	0.244													10	25	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	823128	823128	+	Splice_Site	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:823128C>T	uc002cjz.1	-	10	2139	c.2139_splice	c.e10+1	p.Q713_splice		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion	integral to membrane				breast(3)|ovary(1)	4						CAGCCGTGCACCTGTGCGAGC	0.657													7	74	---	---	---	---	PASS
NQO1	1728	broad.mit.edu	37	16	69744750	69744750	+	3'UTR	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69744750C>T	uc002exp.2	-	6					NQO1_uc010cfm.2_3'UTR|NQO1_uc002exq.2_3'UTR|NQO1_uc002exr.2_3'UTR|NQO1_uc010vll.1_3'UTR	NM_000903	NP_000894	P15559	NQO1_HUMAN	NAD(P)H menadione oxidoreductase 1,						nitric oxide biosynthetic process|regulation of cellular amino acid metabolic process|response to toxin|synaptic transmission, cholinergic|xenobiotic metabolic process	cytosol	coenzyme binding|cytochrome-b5 reductase activity|electron carrier activity|NAD(P)H dehydrogenase (quinone) activity				0					Dicumarol(DB00266)|Menadione(DB00170)	CGAATACAGTCGATTCCCTCT	0.368													15	33	---	---	---	---	PASS
LRRC50	123872	broad.mit.edu	37	16	84211446	84211446	+	Nonstop_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84211446A>G	uc002fhl.3	+	12	2358	c.2177A>G	c.(2176-2178)TAG>TGG	p.*726W	LRRC50_uc010vnw.1_Nonstop_Mutation_p.*490W	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	726					axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						AAAGCATCATAGTTTTCCCCA	0.507									Kartagener_syndrome				70	113	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9801384	9801384	+	3'UTR	SNP	T	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9801384T>G	uc002gme.1	-	3						NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin						visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						GAGTGGTAGGTGGAGGGAGGA	0.398													25	121	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26966765	26966765	+	Intron	SNP	A	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26966765A>C	uc002hbu.2	-						KIAA0100_uc002hbv.2_Intron|KIAA0100_uc010crr.1_3'UTR	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CTGTCATCAAAACTTGTGAGC	0.498													31	65	---	---	---	---	PASS
C17orf37	84299	broad.mit.edu	37	17	37885842	37885842	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37885842C>A	uc002hsq.2	-	4	321	c.281G>T	c.(280-282)CGA>CTA	p.R94L		NM_032339	NP_115715	Q9BRT3	CQ037_HUMAN	hypothetical protein LOC84299	94					cell redox homeostasis	cytosol|membrane	selenium binding				0	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;3.72e-63)|all cancers(3;1.87e-56)|BRCA - Breast invasive adenocarcinoma(8;6.8e-45)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACTGGCTCTTCGGATGGCCTC	0.522													5	309	---	---	---	---	PASS
ASB16	92591	broad.mit.edu	37	17	42249555	42249555	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42249555A>G	uc002ifl.1	+	2	527	c.443A>G	c.(442-444)CAT>CGT	p.H148R	ASB16_uc002ifm.1_RNA	NM_080863	NP_543139	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box-containing protein	148	ANK 3.				intracellular signal transduction		protein binding			kidney(2)	2		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTGCCTTGCATGAGGCCTGT	0.637													41	85	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75208126	75208126	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75208126G>A	uc002jto.2	+	15	1973	c.1706G>A	c.(1705-1707)AGG>AAG	p.R569K	SEC14L1_uc010dhc.2_Missense_Mutation_p.R569K|SEC14L1_uc010wth.1_Missense_Mutation_p.R569K|SEC14L1_uc002jtm.2_Missense_Mutation_p.R569K|SEC14L1_uc010wti.1_Missense_Mutation_p.R535K|SEC14L1_uc010wtj.1_Intron|SEC14L1_uc002jtr.2_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	569	GOLD.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						CACTCCAAGAGGTCGCCACAA	0.512													6	541	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3089566	3089566	+	Silent	SNP	T	C	C			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3089566T>C	uc002klp.2	-	28	4372	c.4038A>G	c.(4036-4038)GAA>GAG	p.E1346E	MYOM1_uc002klq.2_Silent_p.E1250E	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1346						striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GCCGCTGGAATTCAGCTTCTT	0.313													33	33	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59919898	59919898	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59919898C>A	uc002lil.2	+	12	1950	c.1735C>A	c.(1735-1737)CAA>AAA	p.Q579K	KIAA1468_uc002lik.1_Missense_Mutation_p.Q579K|KIAA1468_uc010xel.1_Missense_Mutation_p.Q579K|KIAA1468_uc002lim.2_Missense_Mutation_p.Q223K	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	579							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				ATTTTTCAGGCAAATGATACT	0.383													9	119	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1073241	1073241	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1073241A>G	uc002lqz.1	+	3	746	c.515A>G	c.(514-516)AAC>AGC	p.N172S	HMHA1_uc010xgd.1_Missense_Mutation_p.N188S|HMHA1_uc010xge.1_Missense_Mutation_p.N12S|HMHA1_uc002lra.1_Missense_Mutation_p.N12S|HMHA1_uc002lrb.1_Missense_Mutation_p.N55S	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	172					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCTGCTGAACACCGTGGAG	0.617													28	103	---	---	---	---	PASS
TMPRSS9	360200	broad.mit.edu	37	19	2418067	2418067	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418067C>T	uc010xgx.1	+	12	1983	c.1983C>T	c.(1981-1983)CTC>CTT	p.L661L		NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	661	Extracellular (Potential).|Peptidase S1 2.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTAGTGTGCTCTACAACTTCT	0.562													141	249	---	---	---	---	PASS
SYCE2	256126	broad.mit.edu	37	19	13015422	13015422	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13015422C>A	uc002mvr.2	-	3	205	c.190G>T	c.(190-192)GAC>TAC	p.D64Y		NM_001105578	NP_001099048	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	64	Potential.				cell division	central element					0						ATGCTTGAGTCCAGAGAGGAG	0.532													8	378	---	---	---	---	PASS
WDR62	284403	broad.mit.edu	37	19	36583618	36583618	+	Silent	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36583618G>T	uc002odc.2	+	19	2329	c.2238G>T	c.(2236-2238)CCG>CCT	p.P746P	WDR62_uc002odd.2_Silent_p.P746P	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	746	WD 12.				cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ACCTGGGCCCGGAGATCACCA	0.597													4	260	---	---	---	---	PASS
HSPA12B	116835	broad.mit.edu	37	20	3726646	3726646	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3726646G>T	uc002wjd.2	+	7	746	c.643G>T	c.(643-645)GCC>TCC	p.A215S	HSPA12B_uc010zqi.1_Missense_Mutation_p.A214S|HSPA12B_uc002wje.2_Missense_Mutation_p.A128S|HSPA12B_uc010zqj.1_Missense_Mutation_p.A49S	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	215							ATP binding				0						GAAACAGCCAGCCAAGCAGTT	0.642													7	101	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57429540	57429540	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57429540C>G	uc002xzw.2	+	1	1505	c.1220C>G	c.(1219-1221)ACC>AGC	p.T407S	GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCCGGGGCAACCCCAGAAGAT	0.726			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			2	7	---	---	---	---	PASS
TMPRSS3	64699	broad.mit.edu	37	21	43816224	43816224	+	5'Flank	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43816224G>A	uc002zbb.2	-						TMPRSS3_uc002zbc.2_5'Flank|TMPRSS3_uc002zbd.2_5'Flank	NM_024022	NP_076927	P57727	TMPS3_HUMAN	transmembrane protease, serine 3 isoform 1						cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity			ovary(2)|breast(1)	3						AGCAAAGTGGGGAGTGGCTTT	0.532													21	25	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011517	46011517	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011517G>T	uc002zfm.2	-	1	870	c.849C>A	c.(847-849)TGC>TGA	p.C283*	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	283	29 X 5 AA repeats of C-C-X(3).|25.					keratin filament					0						TAGACTGCTGGCAGCATGATG	0.662													4	171	---	---	---	---	PASS
ARFGAP3	26286	broad.mit.edu	37	22	43218376	43218376	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43218376C>T	uc003bdd.2	-	9	932	c.712G>A	c.(712-714)GCA>ACA	p.A238T	ARFGAP3_uc010gzf.2_Missense_Mutation_p.A194T|ARFGAP3_uc011apu.1_Missense_Mutation_p.A166T	NM_014570	NP_055385	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating	238					intracellular protein transport|protein secretion|regulation of ARF GTPase activity|vesicle-mediated transport	cytosol|Golgi membrane	ARF GTPase activator activity|protein transporter activity|zinc ion binding			breast(1)	1						CATGTGTTTGCCAGTTTCTGA	0.393													6	351	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23018849	23018849	+	Silent	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23018849C>T	uc004daj.2	+	1	763	c.675C>T	c.(673-675)GAC>GAT	p.D225D		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	225	Q motif.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						GGTTTAAAGACGCTTTTCAGC	0.398													4	119	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48664966	48664966	+	Intron	SNP	A	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48664966A>G	uc011mmi.1	+						HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc004dku.3_3'UTR|HDAC6_uc011mmj.1_Intron|HDAC6_uc011mmk.1_Intron	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	CTGAGTGGATAGGGCTGTTCT	0.602													21	9	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50341293	50341293	+	Silent	SNP	G	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50341293G>A	uc004dpe.2	-	8	4211	c.4185C>T	c.(4183-4185)AGC>AGT	p.S1395S	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	1395	Potential.|ASD2.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					CTGAATCGATGCTGTTCAGAG	0.517													27	15	---	---	---	---	PASS
MAGT1	84061	broad.mit.edu	37	X	77096799	77096799	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77096799C>G	uc004fof.2	-	8	1003	c.941G>C	c.(940-942)GGA>GCA	p.G314A	MAGT1_uc004fog.3_RNA	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	282	Helical; (Potential).				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						AAGCACCATTCCTAAGGTAAC	0.368													96	35	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107849993	107849993	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107849993C>T	uc004enz.1	+	29	2468	c.2266C>T	c.(2266-2268)CCT>TCT	p.P756S	COL4A5_uc011mso.1_Missense_Mutation_p.P756S|COL4A5_uc004eob.1_Missense_Mutation_p.P364S	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	756	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						ATTTGCATTACCTGGGCCACC	0.493									Alport_syndrome_with_Diffuse_Leiomyomatosis				93	32	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22333210	22333215	+	Intron	DEL	AATAAT	-	-	rs34545472		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22333210_22333215delAATAAT	uc001bfl.2	+							NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein						cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						actctgtctcaataataataataata	0.180													1	5	---	---	---	---	
RCAN3	11123	broad.mit.edu	37	1	24859466	24859466	+	Intron	DEL	G	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24859466delG	uc001bjj.2	+						RCAN3_uc009vrd.2_Intron|RCAN3_uc009vre.2_Intron|RCAN3_uc009vrf.2_Intron|RCAN3_uc009vrg.2_Intron	NM_013441	NP_038469	Q9UKA8	RCAN3_HUMAN	Down syndrome critical region gene 1-like 2						anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		aaaaaaaaaagaaATGTTTAA	0.189													7	5	---	---	---	---	
DLGAP3	58512	broad.mit.edu	37	1	35332385	35332386	+	Intron	INS	-	C	C	rs138792284	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35332385_35332386insC	uc001byc.2	-							NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated						cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				AGCCGCCGCCACCCCCCCAACC	0.653											OREG0013353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
HOOK1	51361	broad.mit.edu	37	1	60299362	60299363	+	Intron	INS	-	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60299362_60299363insA	uc009wad.2	+						HOOK1_uc001czo.2_Intron|HOOK1_uc001czp.2_Intron|HOOK1_uc010oor.1_Intron	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1						early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					ctctgtcgttgaaaagtggcat	0.153													9	6	---	---	---	---	
CLCA3P	9629	broad.mit.edu	37	1	87102269	87102270	+	Intron	DEL	TG	-	-	rs72286520		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87102269_87102270delTG	uc010osh.1	+							NR_024604				Synthetic construct DNA, clone: pF1KB7225, Homo sapiens CLCA3 gene for chloride channel, calcium activated, family member 3, without stop codon, in Flexi system.												0						TATATTTCTCtgtgtgtgtgtg	0.193													2	6	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149936397	149936397	+	Intron	DEL	C	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149936397delC	uc001etn.2	-						OTUD7B_uc001eto.2_Intron	NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			cctcaagtgacccccctgcct	0.080													11	8	---	---	---	---	
CACNA1S	779	broad.mit.edu	37	1	201081047	201081049	+	Intron	DEL	TCC	-	-	rs71843679		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201081047_201081049delTCC	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	ctcttcctcttcctcctcctcct	0.256													3	3	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235652776	235652776	+	Intron	DEL	T	-	-	rs11299116		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235652776delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GCATGAGTCCTTTATTGCAAT	0.338													3	3	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236707828	236707829	+	Intron	INS	-	G	G	rs144740089	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236707828_236707829insG	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTGATTTTAAAGGGTTTTTTTT	0.411													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57947592	57947593	+	IGR	INS	-	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57947592_57947593insG								None (None upstream) : VRK2 (187193 downstream)																							gaaggaaggaagaaggaaggaa	0.084													3	5	---	---	---	---	
REL	5966	broad.mit.edu	37	2	61144816	61144817	+	Intron	DEL	TG	-	-	rs138205697		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61144816_61144817delTG	uc002sam.1	+						REL_uc002san.1_Intron	NM_002908	NP_002899	Q04864	REL_HUMAN	v-rel reticuloendotheliosis viral oncogene						positive regulation of I-kappaB kinase/NF-kappaB cascade	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			CCCAAAATACtgtgtgtgtgtg	0.208			A		Hodgkin Lymphoma								4	2	---	---	---	---	
VWA3B	200403	broad.mit.edu	37	2	98779625	98779626	+	Intron	DEL	TG	-	-	rs112049891		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98779625_98779626delTG	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6						TGCATGGACATGTGTGTGTGTG	0.550													8	4	---	---	---	---	
ACMSD	130013	broad.mit.edu	37	2	135620825	135620827	+	Intron	DEL	AAT	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135620825_135620827delAAT	uc002ttz.2	+						ACMSD_uc002tua.2_Intron	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		CACCTTTCCCAATCTGTGCCTCT	0.409													34	16	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196764884	196764886	+	Intron	DEL	TAA	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196764884_196764886delTAA	uc002utj.3	-							NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATTTTTGGTTTAATAATTGATTT	0.261													31	26	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													6	6	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191508	10191511	+	Frame_Shift_Del	DEL	GAGC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191508_10191511delGAGC	uc003bvc.2	+	3	714_717	c.501_504delGAGC	c.(499-504)CGGAGCfs	p.R167fs	VHL_uc003bvd.2_Frame_Shift_Del_p.R126fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	167_168					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.R167W(6)|p.S168fs*2(4)|p.R167Q(4)|p.R167fs*3(2)|p.R167G(1)|p.S168fs*3(1)|p.L169_V170del(1)|p.R167fs*1(1)|p.V166fs*6(1)|p.R167fs*6(1)|p.V170fs*31(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGGTTGTCCGGAGCCTAGTCAAGC	0.515		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				29	20	---	---	---	---	
C3orf20	84077	broad.mit.edu	37	3	14731412	14731414	+	Intron	DEL	TAC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14731412_14731414delTAC	uc003byy.2	+						C3orf20_uc003byz.2_Intron|C3orf20_uc003bza.2_Intron|C3orf20_uc003byx.1_Intron	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077							cytoplasm|integral to membrane				ovary(3)|skin(1)	4						TGACCCACCGTACTACTAGAACA	0.394													22	13	---	---	---	---	
GPD1L	23171	broad.mit.edu	37	3	32200958	32200958	+	Intron	DEL	A	-	-	rs35234737		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32200958delA	uc003cew.2	+							NM_015141	NP_055956	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like						glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity				0						cccattctctaaaaaaaaaaa	0.070													4	2	---	---	---	---	
XCR1	2829	broad.mit.edu	37	3	46065707	46065707	+	Intron	DEL	A	-	-	rs35174940		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46065707delA	uc003cpe.2	-						XCR1_uc003cpf.2_Intron	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1						chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TTAATCCAGCAAAAAAAAAAA	0.388													9	4	---	---	---	---	
RABL3	285282	broad.mit.edu	37	3	120428430	120428431	+	Intron	INS	-	AGACAAAGCAC	AGACAAAGCAC	rs141684205	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120428430_120428431insAGACAAAGCAC	uc003edx.2	-							NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AGAAACACTTAATGTTTAATGT	0.272													4	2	---	---	---	---	
MYLK	4638	broad.mit.edu	37	3	123454354	123454354	+	Intron	DEL	C	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123454354delC	uc003ego.2	-						MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCACCGTGGTCCCACCCTGCT	0.527													29	31	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494429	195494434	+	Intron	DEL	CCATTG	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494429_195494434delCCATTG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		atcaccattaccattgccaccaccat	0.000													4	2	---	---	---	---	
STK32B	55351	broad.mit.edu	37	4	5104164	5104179	+	Intron	DEL	CTTCCTTCCTTCCTTC	-	-	rs112396534	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5104164_5104179delCTTCCTTCCTTCCTTC	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						tccttccttgcttccttccttccttccttccttcct	0.106													3	3	---	---	---	---	
LCORL	254251	broad.mit.edu	37	4	17847182	17847182	+	3'UTR	DEL	A	-	-	rs3214284		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17847182delA	uc003gpq.2	-	7					LCORL_uc011bxk.1_3'UTR	NM_153686	NP_710153	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						TAAAACATGTAAAAAAAACAT	0.239													3	4	---	---	---	---	
KDR	3791	broad.mit.edu	37	4	55979581	55979581	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55979581delA	uc003has.2	-	7	1168	c.866delT	c.(865-867)TTGfs	p.L289fs	KDR_uc003hat.1_Frame_Shift_Del_p.L289fs|KDR_uc011bzx.1_Frame_Shift_Del_p.L289fs	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	289	Ig-like C2-type 3.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TAAGGTGCTCAAAAATTTCTT	0.433			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			122	69	---	---	---	---	
CSN1S1	1446	broad.mit.edu	37	4	70801630	70801630	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70801630delT	uc003hep.1	+						CSN1S1_uc003heq.1_Intron|CSN1S1_uc003her.1_Intron	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						TTAACATAACTTTTTTTTTTG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185006960	185006963	+	IGR	DEL	TTCC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185006960_185006963delTTCC								STOX2 (68085 upstream) : ENPP6 (2897 downstream)																							ccttccttctttccttccttcctt	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10317288	10317289	+	IGR	INS	-	TTCC	TTCC	rs141320741		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10317288_10317289insTTCC								CMBL (9120 upstream) : MARCH6 (36539 downstream)																							ccttcctttctttccttccttc	0.035													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123556070	123556070	+	IGR	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123556070delA								CSNK1G3 (603608 upstream) : ZNF608 (416540 downstream)																							TTAACTATACAAAAAAAAAAA	0.363													7	5	---	---	---	---	
ARAP3	64411	broad.mit.edu	37	5	141034750	141034751	+	Intron	DEL	AC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141034750_141034751delAC	uc003llm.2	-						ARAP3_uc003lll.2_Intron|ARAP3_uc011dbe.1_Intron|ARAP3_uc003lln.2_Intron	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						CTGATGGCCTacacacacacac	0.168													4	2	---	---	---	---	
GM2A	2760	broad.mit.edu	37	5	150800814	150800814	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150800814delT	uc011dcs.1	+							NM_000405		P17900	SAP3_HUMAN	GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ctctttcttcttttttttttt	0.000													4	2	---	---	---	---	
MIR1303	100302284	broad.mit.edu	37	5	154065299	154065300	+	5'Flank	INS	-	G	G	rs142523787	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154065299_154065300insG	hsa-mir-1303|MI0006370	+																							0						tgggaggccaagtgggagaaac	0.015													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166471034	166471041	+	IGR	DEL	TAAGGACA	-	-	rs2910053		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166471034_166471041delTAAGGACA								None (None upstream) : ODZ2 (240802 downstream)																							aaataaaTAGTaaggacagaaggaagga	0.115													5	3	---	---	---	---	
HLA-DRA	3122	broad.mit.edu	37	6	32410977	32410978	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32410977_32410978delCT	uc003obh.2	+	3	425_426	c.344_345delCT	c.(343-345)ACTfs	p.T115fs	HLA-DRA_uc003obi.2_Intron	NM_019111	NP_061984	P01903	DRA_HUMAN	major histocompatibility complex, class II, DR	115	Ig-like C1-type.|Extracellular (Potential).|Alpha-2.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to plasma membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			ovary(1)|skin(1)	2						CCAGAGGTAACTGTGCTCACAA	0.520									T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Kaposi_Sarcoma_Familial_Clustering_of				50	42	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32521545	32521546	+	Intron	INS	-	AAGG	AAGG	rs70993877		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521545_32521546insAAGG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TTGGGGAAAGACTTTATCCAGG	0.436													6	3	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39513599	39513599	+	Intron	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39513599delA	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						ATTTGAGTATAAAAATTAAGG	0.289													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42467818	42467818	+	IGR	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42467818delA								TRERF1 (47953 upstream) : UBR2 (64240 downstream)																							AGTTTATGTTAAAAAAAAAAA	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113987881	113987882	+	IGR	INS	-	G	G	rs35429846		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113987881_113987882insG								None (None upstream) : MARCKS (190645 downstream)																							aaagaaagaaagaaagaaagga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114210338	114210339	+	IGR	DEL	AC	-	-	rs144760477		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114210338_114210339delAC								MARCKS (25688 upstream) : FLJ34503 (15212 downstream)																							CTTAAACGCAacacacacacac	0.302													4	4	---	---	---	---	
STK31	56164	broad.mit.edu	37	7	23940354	23940355	+	Intron	INS	-	CCTT	CCTT	rs72083241		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23940354_23940355insCCTT	uc003swv.1	+									Q9BXU1	STK31_HUMAN	SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTCAGTAATTCccttccttcct	0.158													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31404676	31404676	+	IGR	DEL	A	-	-	rs35317967		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31404676delA								NEUROD6 (24138 upstream) : CCDC129 (149009 downstream)																							actctgtctcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	34979749	34979749	+	Intron	DEL	T	-	-	rs72287078		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34979749delT	uc003tem.3	-						DPY19L1_uc003tel.1_5'Flank	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						tttttttttcttttttttttt	0.318													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67991336	67991353	+	IGR	DEL	AAGGAAGGAAGGGAGAGA	-	-	rs62456279		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67991336_67991353delAAGGAAGGAAGGGAGAGA								None (None upstream) : None (None downstream)																							ggaaggaaggaaggaaggaagggagagagagagagaga	0.000													3	3	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122269208	122269208	+	Intron	DEL	T	-	-	rs78099125		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122269208delT	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						ATGCTGGCTCTTTTTTTTTTA	0.303													6	3	---	---	---	---	
FLNC	2318	broad.mit.edu	37	7	128471160	128471161	+	Intron	INS	-	T	T	rs72576914		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128471160_128471161insT	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GGGCACCCCCCGGTATAGAGAG	0.723													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152144400	152144400	+	IGR	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152144400delT								FABP5L3 (4302 upstream) : LOC100128822 (16809 downstream)																							AGTTCTCGAAttttttttttt	0.149													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33662182	33662193	+	IGR	DEL	CTGTAGCCCCAA	-	-	rs113011049		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33662182_33662193delCTGTAGCCCCAA								ANXA2P2 (36652 upstream) : PTENP1 (11314 downstream)																							GAGACATCCTCTGTAGCCCCAACTGTGCCATG	0.505													3	4	---	---	---	---	
NPR2	4882	broad.mit.edu	37	9	35808676	35808678	+	In_Frame_Del	DEL	TAC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35808676_35808678delTAC	uc003zyd.2	+	19	2883_2885	c.2883_2885delTAC	c.(2881-2886)CATACT>CAT	p.T962del	NPR2_uc010mlb.2_In_Frame_Del_p.T938del|SPAG8_uc003zye.2_Intron	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	962	Guanylate cyclase.|Cytoplasmic (Potential).				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TAGGGGTCCATACTGGTAAGGCT	0.547													112	53	---	---	---	---	
RPSAP9	653162	broad.mit.edu	37	9	79014569	79014570	+	3'UTR	INS	-	A	A			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79014569_79014570insA	uc011lsj.1	+	1						NR_026890				SubName: Full=Laminin receptor-like protein LAMRL5;												0						ATCAGTTTCTTAAAAAAAAAAA	0.342													4	3	---	---	---	---	
KIAA0368	23392	broad.mit.edu	37	9	114126060	114126061	+	Intron	INS	-	T	T			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114126060_114126061insT	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0						GGTATATCTGATTTTTTTTTTT	0.351													13	8	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27421036	27421036	+	Intron	DEL	T	-	-	rs113682414		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27421036delT	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						tctgGAtttctttttttttct	0.005													3	6	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112340975	112340975	+	Intron	DEL	T	-	-	rs67616631		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112340975delT	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCACACTGACttttttttttt	0.149													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													3	4	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90673971	90673978	+	IGR	DEL	AAAAAGAA	-	-	rs141485156	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90673971_90673978delAAAAAGAA								MIR1261 (71601 upstream) : None (None downstream)																							agaaagaaagaaaaagaaagaaagaaag	0.000													6	5	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072082	99072083	+	Intron	INS	-	TCC	TCC	rs151051937	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072082_99072083insTCC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		cttcctttcctttccttccttc	0.000													6	3	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11218796	11218796	+	Intron	DEL	G	-	-	rs11291284		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11218796delG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						CCCTATCCGTGAGTATAGTTT	0.348										HNSCC(22;0.051)			2	4	---	---	---	---	
BCL2L14	79370	broad.mit.edu	37	12	12243579	12243580	+	Intron	DEL	AT	-	-	rs71913876		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12243579_12243580delAT	uc001rac.2	+						ETV6_uc001raa.1_Intron|BCL2L14_uc001raf.1_Intron|BCL2L14_uc001rad.2_Intron|BCL2L14_uc001rae.2_Intron	NM_138723	NP_620049	Q9BZR8	B2L14_HUMAN	BCL2-like 14 isoform 1						apoptosis|regulation of apoptosis	cytosol|endomembrane system|intracellular organelle|membrane	protein binding			skin(1)	1		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		aaaataaaaaataaaaaaaaaa	0.173													8	4	---	---	---	---	
MANSC1	54682	broad.mit.edu	37	12	12482819	12482819	+	3'UTR	DEL	C	-	-	rs61922021		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12482819delC	uc001rai.1	-	4					MANSC1_uc010shm.1_3'UTR|MANSC1_uc001raj.1_3'UTR|MANSC1_uc009zht.1_3'UTR	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor							integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		gactctgtctccaaaaaaaaa	0.189													4	2	---	---	---	---	
PPFIBP1	8496	broad.mit.edu	37	12	27800899	27800899	+	Intron	DEL	A	-	-	rs112008008		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27800899delA	uc001ric.1	+						PPFIBP1_uc010sjr.1_Intron|PPFIBP1_uc001rib.1_Intron|PPFIBP1_uc001ria.2_Intron|PPFIBP1_uc001rid.1_Intron	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					CCAGCACATTAAAAAAAAAAA	0.348													9	4	---	---	---	---	
CNTN1	1272	broad.mit.edu	37	12	41298159	41298160	+	Intron	INS	-	TTCCTTCCT	TTCCTTCCT	rs144902477	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41298159_41298160insTTCCTTCCT	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron|CNTN1_uc001rmo.2_Intron	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				tttttccttccttccttccttt	0.000													6	4	---	---	---	---	
C12orf54	121273	broad.mit.edu	37	12	48882265	48882265	+	Intron	DEL	A	-	-	rs71439447		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48882265delA	uc001rrr.2	+						C12orf54_uc009zky.1_Intron	NM_152319	NP_689532	Q6X4T0	CL054_HUMAN	hypothetical protein LOC121273												0						ACTTACAGCCAAAAAAAAAAA	0.234													4	2	---	---	---	---	
TROAP	10024	broad.mit.edu	37	12	49719150	49719150	+	Intron	DEL	A	-	-	rs111795391		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49719150delA	uc001rtx.3	+						TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						tctatttcttaaaaaaaaaaa	0.199													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54206263	54206265	+	IGR	DEL	TTT	-	-	rs72464431		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54206263_54206265delTTT								CALCOCO1 (84956 upstream) : HOXC13 (126311 downstream)																							tcctttcttctttctttctttct	0.000													5	3	---	---	---	---	
ERBB3	2065	broad.mit.edu	37	12	56490757	56490757	+	Intron	DEL	G	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56490757delG	uc001sjh.2	+						ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Intron|ERBB3_uc009zok.2_Intron|ERBB3_uc001sjk.2_Intron	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor						cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GGGGGGGCCTGGGCTGGCTGT	0.498													42	26	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													2	4	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50283535	50283535	+	Intron	DEL	A	-	-	rs72094235		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50283535delA	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		actctgtctcaaaaaaaaaaa	0.139													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	83421151	83421154	+	IGR	DEL	AAGG	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83421151_83421154delAAGG								None (None upstream) : None (None downstream)																							ggaagaaacaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
IPO5	3843	broad.mit.edu	37	13	98641120	98641120	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98641120delT	uc001vnf.1	+						IPO5_uc001vne.2_Intron|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Intron	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						TTGTTTGGTCTTTTTTTTTTT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106297174	106297177	+	IGR	DEL	TTCC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106297174_106297177delTTCC								DAOA (153792 upstream) : EFNB2 (844921 downstream)																							ccttccttcattccttccttcctt	0.078													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	26721515	26721518	+	IGR	DEL	AGGA	-	-	rs112254355		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26721515_26721518delAGGA								None (None upstream) : NOVA1 (193572 downstream)																							gaaggaaggtaggaaggaaggaag	0.074													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29231228	29231229	+	IGR	DEL	TG	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29231228_29231229delTG								None (None upstream) : FOXG1 (5058 downstream)																							GTTTTAGTGCtgtgtgtgtgtg	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36463290	36463291	+	IGR	INS	-	TCCT	TCCT	rs66569553		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36463290_36463291insTCCT								BRMS1L (122122 upstream) : MBIP (304473 downstream)																							GACCATATTTAtccttccttcc	0.158													6	4	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89647259	89647260	+	Intron	INS	-	GCAGAGAACATGCATGGA	GCAGAGAACATGCATGGA	rs140257053	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647259_89647260insGCAGAGAACATGCATGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						agagacagagggcagagacaga	0.173													4	2	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104123884	104123884	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104123884delT	uc001yno.2	+	3	571	c.263delT	c.(262-264)GTTfs	p.V88fs	KLC1_uc010tyd.1_Frame_Shift_Del_p.V247fs|KLC1_uc010tye.1_Frame_Shift_Del_p.V84fs|KLC1_uc001ynm.1_Frame_Shift_Del_p.V88fs|KLC1_uc001ynn.1_Frame_Shift_Del_p.V84fs|KLC1_uc010tyf.1_Frame_Shift_Del_p.V88fs	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2	88					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				TCTGCTCAGGTTATGATGGCT	0.552													61	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																							GATGTGGAATATGATGAAGGAGA	0.369													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89502614	89502615	+	IGR	DEL	CA	-	-	rs140567764		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89502614_89502615delCA								MFGE8 (45951 upstream) : ABHD2 (128766 downstream)																							aaaatctgtccacacacacaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102299886	102299887	+	5'Flank	INS	-	G	G			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102299886_102299887insG	uc002bzh.1	-						uc002bzk.2_5'Flank|uc002bzn.2_5'Flank|uc010uso.1_5'Flank|uc002bzs.2_5'Flank|uc010usv.1_5'Flank|uc002cal.2_5'Flank|uc002cam.2_5'Flank|uc010usx.1_5'Flank|uc002cao.2_5'Flank|uc002cap.2_5'Flank|uc002caq.2_5'Flank|uc010usz.1_5'Flank|uc010uta.1_5'Flank|uc002cas.2_5'Flank|uc002cat.1_5'Flank|uc002cau.2_5'Flank|uc010utb.1_5'Flank|uc002cav.2_5'Flank|uc002caw.2_5'Flank|uc002cax.2_5'Flank|uc010utc.1_5'Flank|uc002cay.2_5'Flank|uc002cbb.2_5'Flank|uc002cbc.1_5'Flank|uc002cbd.2_5'Flank|uc002cbe.2_5'Flank|uc002cbg.2_5'Flank|uc002cbh.2_5'Flank|uc002cbi.2_5'Flank|uc002cbk.2_5'Flank|uc002cbl.2_5'Flank|uc010utd.1_5'Flank					DQ575740																		AACCTGTACTCGCGTCGGAACC	0.589													9	4	---	---	---	---	
RAB11FIP3	9727	broad.mit.edu	37	16	538712	538712	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:538712delT	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				tccagccCACTTTTTTTTTTT	0.274													6	3	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21712045	21712046	+	Intron	INS	-	AA	AA	rs3054189		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21712045_21712046insAA	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		gactccatctcaaaaaaaaaaa	0.188													11	10	---	---	---	---	
KATNB1	10300	broad.mit.edu	37	16	57778630	57778631	+	Intron	INS	-	GT	GT	rs145456395	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57778630_57778631insGT	uc002eml.1	+							NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1						cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				GGGAtgtgcgggtgtgtgtgtg	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20746999	20746999	+	Intron	DEL	G	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20746999delG	uc010crb.1	+											Homo sapiens cDNA clone IMAGE:6269068, partial cds.																		AGCTGGGCCCGGGGACGCCCG	0.726													5	3	---	---	---	---	
KAT2A	2648	broad.mit.edu	37	17	40270120	40270123	+	Intron	DEL	GAGA	-	-	rs150172215		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40270120_40270123delGAGA	uc002hyx.2	-							NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like						chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						TGAAGCTGAGGAGAGAGAGAGTCA	0.623													13	6	---	---	---	---	
NBR1	4077	broad.mit.edu	37	17	41361882	41361882	+	Intron	DEL	T	-	-	rs35534808		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41361882delT	uc010czd.2	+						NBR1_uc010diz.2_Intron|NBR1_uc010whv.1_Intron|NBR1_uc010whw.1_Intron|TMEM106A_uc002idn.1_5'Flank|TMEM106A_uc010why.1_5'Flank|TMEM106A_uc010cze.1_5'Flank|TMEM106A_uc010whz.1_5'Flank	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1						macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ttatacagaattttttttttt	0.303													4	3	---	---	---	---	
PNPO	55163	broad.mit.edu	37	17	46021566	46021567	+	Intron	INS	-	GT	GT	rs144711217	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46021566_46021567insGT	uc002imo.2	+						PNPO_uc010wkz.1_Intron|PNPO_uc010wla.1_Intron|PNPO_uc010wlb.1_Intron	NM_018129	NP_060599	Q9NVS9	PNPO_HUMAN	pyridoxine 5'-phosphate oxidase						pyridoxine biosynthetic process	cytosol	FMN binding|pyridoxamine-phosphate oxidase activity				0					Pyridoxal Phosphate(DB00114)	cactgcctttcgtgtgtgtgtg	0.000													4	2	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037277	58037277	+	Intron	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037277delA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			tctcaaaaagaaaaaaaaaaa	0.000													10	5	---	---	---	---	
LOC146880	146880	broad.mit.edu	37	17	62750914	62750914	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62750914delT	uc010wqc.1	-							NR_026899				Homo sapiens cDNA FLJ30780 fis, clone FEBRA2000856.												0						CTGATTATGCttttttttttg	0.179													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75068201	75068204	+	IGR	DEL	TTCC	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75068201_75068204delTTCC								MGAT5B (121731 upstream) : C17orf86 (16521 downstream)																							tccttcttctttccttccttcctt	0.000													4	4	---	---	---	---	
AZI1	22994	broad.mit.edu	37	17	79175900	79175901	+	Intron	INS	-	AA	AA	rs35581087		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79175900_79175901insAA	uc002jzp.1	-						AZI1_uc002jzn.1_Intron|AZI1_uc002jzo.1_Intron|AZI1_uc010wum.1_Intron	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			gactctgtctcaaaaaaaaaaa	0.183													4	3	---	---	---	---	
C19orf6	91304	broad.mit.edu	37	19	1014538	1014547	+	Intron	DEL	CGTGATGGGG	-	-	rs143052245		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1014538_1014547delCGTGATGGGG	uc002lqr.1	-						C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Intron	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1							cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGGCCTACGTGATGGGGCGTGATGGGG	0.681													5	6	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8136735	8136735	+	Intron	DEL	C	-	-	rs112155120		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8136735delC	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCCCCAGAGACCCCCCCCAAG	0.587													4	7	---	---	---	---	
ICAM5	7087	broad.mit.edu	37	19	10403104	10403105	+	Intron	INS	-	G	G	rs145394131	by1000genomes	TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10403104_10403105insG	uc002mnu.3	+						ICAM5_uc002mnv.3_Intron	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor						cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GCGTGGCCCGAGGGGCGGGGCA	0.703													4	5	---	---	---	---	
MAN2B1	4125	broad.mit.edu	37	19	12767171	12767171	+	Intron	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12767171delA	uc002mub.2	-						MAN2B1_uc010dyv.1_Intron	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1						protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						actccgtctcaaaaaaaaaaa	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21148062	21148062	+	IGR	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21148062delA								ZNF85 (14561 upstream) : ZNF430 (55435 downstream)																							TTCAAAGGTCAAAAAAAAAAA	0.224													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31882616	31882619	+	IGR	DEL	ACAC	-	-	rs28690862		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31882616_31882619delACAC								TSHZ3 (42426 upstream) : ZNF507 (953895 downstream)																							cacacacacaacacacacacacac	0.431													4	3	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49407785	49407785	+	Intron	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49407785delT	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GACTGGtttcttttttttttt	0.323													5	3	---	---	---	---	
MIR1283-1	100302265	broad.mit.edu	37	19	54191516	54191536	+	5'Flank	DEL	GTTTGAGAACAAAACTCGGGA	-	-	rs11274495		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54191516_54191536delGTTTGAGAACAAAACTCGGGA	hsa-mir-1283-1|MI0003832	+						MIR520A_hsa-mir-520a|MI0003149_5'Flank																	0						TGCTTTTTCTGTTTGAGAACAAAACTCGGGAGGATTGTCCC	0.416													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42095545	42095548	+	IGR	DEL	GTGT	-	-	rs138315822		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42095545_42095548delGTGT								SFRS6 (3303 upstream) : L3MBTL (40802 downstream)																							gagAAAGCGGgtgtgtgtgtgtgt	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47115306	47115307	+	IGR	DEL	GA	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47115306_47115307delGA								LOC284749 (115925 upstream) : PREX1 (125486 downstream)																							GGGTGTTGGGgagagagagaga	0.079													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62045114	62045115	+	Intron	DEL	AC	-	-	rs72300056		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62045114_62045115delAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	TCTGCCCGGGACAGGTGGGGCT	0.653													8	7	---	---	---	---	
RNF160	26046	broad.mit.edu	37	21	30357368	30357368	+	Intron	DEL	A	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30357368delA	uc002ymr.2	-						RNF160_uc010gll.1_Intron	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294								ligase activity|zinc ion binding				0						AACTGAAATCATTTTTTTTAA	0.289													3	5	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136597	46136598	+	Intron	INS	-	AT	AT	rs67765053		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136597_46136598insAT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		cacacacacacacatatatata	0.114													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47847873	47847874	+	IGR	DEL	AC	-	-	rs112757189		TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47847873_47847874delAC								TBC1D22A (278151 upstream) : None (None downstream)																							ctctctctctacacacacacac	0.223													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507745	36507745	+	IGR	DEL	T	-	-			TCGA-BP-5192-01A-01D-1429-08	TCGA-BP-5192-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507745delT								CXorf30 (104312 upstream) : FAM47C (518725 downstream)																							ttcttTCGGGttttttttttt	0.020													6	4	---	---	---	---	
