Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTF1	4520	broad.mit.edu	37	1	38323150	38323150	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38323150C>A	uc001cce.1	-	2	322	c.181G>T	c.(181-183)GAA>TAA	p.E61*	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	61						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCGTCATCTTCATCCTCCAAA	0.483													45	74	---	---	---	---	PASS
SLC44A3	126969	broad.mit.edu	37	1	95310848	95310848	+	Silent	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95310848C>A	uc001dqv.3	+	9	1007	c.900C>A	c.(898-900)GTC>GTA	p.V300V	SLC44A3_uc001dqx.3_Silent_p.V300V|SLC44A3_uc010otq.1_Silent_p.V232V|SLC44A3_uc010otr.1_Silent_p.V264V|SLC44A3_uc001dqw.3_Silent_p.V252V|SLC44A3_uc010ots.1_Silent_p.V220V|SLC44A3_uc009wds.2_Silent_p.V203V|SLC44A3_uc010ott.1_Silent_p.V220V|SLC44A3_uc010otu.1_RNA	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	300	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TGCTGCTCGTCTTGATTTTTG	0.408													12	199	---	---	---	---	PASS
TXNIP	10628	broad.mit.edu	37	1	145438912	145438912	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145438912A>G	uc001enn.3	+	1	451	c.110A>G	c.(109-111)GAA>GGA	p.E37G	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_5'Flank	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	37					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGGTGTGTGAAGTTACTCGT	0.522													26	54	---	---	---	---	PASS
RORC	6097	broad.mit.edu	37	1	151779775	151779775	+	3'UTR	SNP	A	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151779775A>G	uc001ezh.2	-	11					RORC_uc001ezg.2_3'UTR|RORC_uc010pdo.1_3'UTR|RORC_uc010pdp.1_3'UTR|LINGO4_uc001ezf.1_5'Flank	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CGATTGTCCCACTGCCAGGCC	0.582													3	4	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155732098	155732098	+	Silent	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155732098C>A	uc001flz.2	-	23	4891	c.4794G>T	c.(4792-4794)CGG>CGT	p.R1598R	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Silent_p.R1598R|GON4L_uc009wrh.1_Silent_p.R1598R|GON4L_uc001fma.1_Silent_p.R1598R|GON4L_uc001fmb.3_Silent_p.R794R	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	1598					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGGCCCGAGCCCGACTTCCCC	0.547													11	24	---	---	---	---	PASS
OR2M4	26245	broad.mit.edu	37	1	248402861	248402861	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248402861G>A	uc010pzh.1	+	1	631	c.631G>A	c.(631-633)GTT>ATT	p.V211I		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	211	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AATCTTTCCAGTTTCAGTTAT	0.458													7	165	---	---	---	---	PASS
MTIF2	4528	broad.mit.edu	37	2	55489500	55489500	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55489500T>C	uc002ryn.2	-	6	1020	c.283A>G	c.(283-285)ATT>GTT	p.I95V	MTIF2_uc010yox.1_5'UTR|MTIF2_uc002ryo.2_Missense_Mutation_p.I95V	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	95					regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						GTCATTCCAATCCATACTTCT	0.363													13	391	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73680768	73680768	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73680768A>C	uc002sje.1	+	10	7228	c.7117A>C	c.(7117-7119)ATG>CTG	p.M2373L	ALMS1_uc002sjf.1_Missense_Mutation_p.M2329L|ALMS1_uc002sjg.2_Missense_Mutation_p.M1759L|ALMS1_uc002sjh.1_Missense_Mutation_p.M1759L	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2371					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CAAAGTCAGTATGGCATTAGA	0.393													49	96	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													3	29	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166731299	166731299	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166731299A>C	uc002udk.2	-	29	4050	c.3917T>G	c.(3916-3918)ATA>AGA	p.I1306R	TTC21B_uc002udj.1_RNA	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1306						cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						CTTATCAAGTATATCCTTTCT	0.328													5	141	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188245	10188245	+	Missense_Mutation	SNP	G	C	C	rs104893830		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188245G>C	uc003bvc.2	+	2	601	c.388G>C	c.(388-390)GTT>CTT	p.V130L	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	130	Involved in binding to CCT complex.		V -> L (in ECYT2 and VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V130L(7)|p.V130>F(1)|p.V130G(1)|p.V130fs*28(1)|p.V130fs*29(1)|p.V130D(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGGGCTTCTGGTTAACCAAAC	0.413		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				115	99	---	---	---	---	PASS
RPL14	9045	broad.mit.edu	37	3	40498846	40498846	+	5'UTR	SNP	G	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40498846G>T	uc003ckg.2	+	1					RPL14_uc003ckh.2_5'UTR|RPL14_uc003cki.2_5'Flank	NM_003973	NP_003964	P50914	RL14_HUMAN	ribosomal protein L14						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GCCTAACGCCGCCAACATGGT	0.642													4	8	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112998188	112998188	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112998188A>C	uc003dzx.2	+	12	2527	c.1906A>C	c.(1906-1908)ATC>CTC	p.I636L	BOC_uc003dzy.2_Missense_Mutation_p.I636L|BOC_uc003dzz.2_Missense_Mutation_p.I637L|BOC_uc003eab.2_Missense_Mutation_p.I337L|BOC_uc003eac.2_5'Flank	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	636	Fibronectin type-III 2.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			TGGGTTCCCAATCCAGTCCTT	0.602													42	68	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195410687	195410687	+	Missense_Mutation	SNP	T	A	A	rs6583274	by1000genomes	TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195410687T>A	uc003fuw.2	+	13	1778	c.584T>A	c.(583-585)GTG>GAG	p.V195E	SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						CCCTTTGAGGTGCACTGGAGG	0.567													5	20	---	---	---	---	PASS
TCTEX1D2	255758	broad.mit.edu	37	3	196022891	196022891	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196022891C>T	uc003fwi.2	-	4	503	c.367G>A	c.(367-369)GAT>AAT	p.D123N		NM_152773	NP_689986	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	123							protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		ATGAAAACATCATGAGTATAG	0.378													40	97	---	---	---	---	PASS
BMPR1B	658	broad.mit.edu	37	4	96035969	96035969	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96035969G>T	uc003htm.3	+	5	516	c.242G>T	c.(241-243)TGT>TTT	p.C81F	BMPR1B_uc010ilb.2_Missense_Mutation_p.C81F|BMPR1B_uc003htn.3_Missense_Mutation_p.C81F	NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	81	Extracellular (Potential).				BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		GATTTTCAGTGTCGGGTAAGG	0.428													100	221	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78407701	78407701	+	5'UTR	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78407701C>A	uc003kfu.3	+	1					BHMT_uc011cti.1_5'UTR	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase						protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	TGTCTGGACACCACGAAGATG	0.647													18	23	---	---	---	---	PASS
LNPEP	4012	broad.mit.edu	37	5	96315099	96315099	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96315099A>G	uc003kmv.1	+	2	791	c.277A>G	c.(277-279)ACT>GCT	p.T93A	LNPEP_uc003kmw.1_Missense_Mutation_p.T79A	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	93	Cytoplasmic (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GAACAGTGCAACTGGTTACAG	0.498													33	104	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32088498	32088498	+	Intron	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32088498G>A	uc003nzn.2	-						ATF6B_uc003nzm.1_5'Flank|ATF6B_uc003nzo.2_Intron|ATF6B_uc003nzp.1_5'Flank|ATF6B_uc011dpg.1_Silent_p.I228I|ATF6B_uc011dph.1_Silent_p.I294I	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform						response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						aaagtgctgggattaccggcg	0.209													24	41	---	---	---	---	PASS
C6orf162	57150	broad.mit.edu	37	6	88046871	88046871	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88046871T>C	uc003plp.1	+	3	211	c.122T>C	c.(121-123)CTC>CCC	p.L41P	C6orf164_uc003plr.2_RNA|C6orf162_uc003plq.1_Missense_Mutation_p.L41P	NM_001042493	NP_001035958	Q96KF7	CF162_HUMAN	hypothetical protein LOC57150	41						integral to membrane					0		all_cancers(76;3.81e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.3e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0164)		AATCCAGAGCTCTTCATTAAA	0.393													34	102	---	---	---	---	PASS
RSPH10B2	728194	broad.mit.edu	37	7	6006558	6006558	+	Missense_Mutation	SNP	C	T	T	rs150311566		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6006558C>T	uc003sph.1	-	3	461	c.190G>A	c.(190-192)GTT>ATT	p.V64I	RSPH10B2_uc010ktd.1_Missense_Mutation_p.V64I	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B	64										ovary(1)|pancreas(1)|skin(1)	3						TTCTGCTGAACGTTTTGGCGG	0.488													38	174	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92763473	92763473	+	Silent	SNP	T	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92763473T>C	uc003umh.1	-	5	3028	c.1812A>G	c.(1810-1812)CTA>CTG	p.L604L	SAMD9L_uc003umj.1_Silent_p.L604L|SAMD9L_uc003umi.1_Silent_p.L604L|SAMD9L_uc010lfb.1_Silent_p.L604L|SAMD9L_uc003umk.1_Silent_p.L604L|SAMD9L_uc010lfc.1_Silent_p.L604L|SAMD9L_uc010lfd.1_Silent_p.L604L|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	604										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TGTGGTTTGTTAGTTCATCTT	0.358													127	201	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	99590187	99590187	+	3'UTR	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99590187C>T	uc003usi.2	+	3										RecName: Full=Putative zinc-alpha-2-glycoprotein-like 2; Flags: Precursor;																		TGTGTCACACCCAGCAGCCGG	0.622													22	48	---	---	---	---	PASS
PRSS55	203074	broad.mit.edu	37	8	10396087	10396087	+	Silent	SNP	C	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10396087C>G	uc003wta.2	+	5	858	c.843C>G	c.(841-843)ACC>ACG	p.T281T	uc010lru.2_Intron|PRSS55_uc003wtb.2_Intron	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	281	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						AGAAGAACACCCCAGGGATAT	0.557													27	113	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51415372	51415372	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51415372C>T	uc010lxy.1	+	10	769	c.398C>T	c.(397-399)ACT>ATT	p.T133I	SNTG1_uc003xqs.1_Missense_Mutation_p.T133I|SNTG1_uc010lxz.1_Missense_Mutation_p.T133I|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	133	PDZ.				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GAAGAAGTGACTCTAACAGTG	0.333													34	115	---	---	---	---	PASS
SDR16C5	195814	broad.mit.edu	37	8	57228684	57228684	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57228684C>T	uc003xsy.1	-	2	861	c.223G>A	c.(223-225)GAG>AAG	p.E75K	SDR16C5_uc010lyk.1_Missense_Mutation_p.E75K|SDR16C5_uc010lyl.1_Missense_Mutation_p.E75K	NM_138969	NP_620419	Q8N3Y7	RDHE2_HUMAN	epidermal retinal dehydrogenase 2	75					detection of light stimulus involved in visual perception|keratinocyte proliferation|retinal metabolic process|retinol metabolic process	endoplasmic reticulum membrane|integral to membrane|integral to membrane of membrane fraction	binding|retinol dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TCATTCCCCTCCTTATTGATA	0.507													6	156	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101014479	101014479	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101014479T>G	uc003yjb.1	-	18	2936	c.2741A>C	c.(2740-2742)AAA>ACA	p.K914T	RGS22_uc003yja.1_Missense_Mutation_p.K733T|RGS22_uc003yjc.1_Missense_Mutation_p.K902T|RGS22_uc011lgz.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	914	RGS 1.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AAAGAAATATTTTTTATTAAG	0.343													53	100	---	---	---	---	PASS
PHF20L1	51105	broad.mit.edu	37	8	133850030	133850030	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133850030T>C	uc003ytt.2	+	17	2490	c.2165T>C	c.(2164-2166)ATC>ACC	p.I722T	PHF20L1_uc011lja.1_Missense_Mutation_p.I696T	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	722	PHD-type.						nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GAGCAGTACATCTGCTATATC	0.527													29	60	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20346391	20346391	+	3'UTR	SNP	A	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20346391A>C	uc003zoe.2	-	11					MLLT3_uc011lne.1_3'UTR|MLLT3_uc011lnf.1_3'UTR	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		aaaaaaaaaaaccaaaaaaaa	0.303			T	MLL	ALL								4	30	---	---	---	---	PASS
NOL6	65083	broad.mit.edu	37	9	33467191	33467191	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33467191C>A	uc003zsz.2	-	14	1896	c.1795G>T	c.(1795-1797)GAA>TAA	p.E599*	SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zsy.2_5'Flank|NOL6_uc003zta.2_Nonsense_Mutation_p.E599*|NOL6_uc010mjv.2_Nonsense_Mutation_p.E596*|NOL6_uc011lob.1_Nonsense_Mutation_p.E547*|NOL6_uc003ztb.1_Nonsense_Mutation_p.E599*	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform	599					rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		ACCACAGCTTCCCGAATGGCT	0.597											OREG0019137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	52	---	---	---	---	PASS
TUBB2C	10383	broad.mit.edu	37	9	140137408	140137408	+	Silent	SNP	C	A	A	rs151064868		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140137408C>A	uc004cmh.1	+	4	840	c.738C>A	c.(736-738)CTC>CTA	p.L246L	TUBB2C_uc004cmg.1_Silent_p.L100L	NM_006088	NP_006079	P68371	TBB2C_HUMAN	tubulin, beta, 2	246					'de novo' posttranslational protein folding|cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding|structural molecule activity|unfolded protein binding			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CAGGCCAGCTCAATGCTGACC	0.627													8	27	---	---	---	---	PASS
IDE	3416	broad.mit.edu	37	10	94239093	94239093	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94239093A>G	uc001kia.2	-	15	1901	c.1825T>C	c.(1825-1827)TAT>CAT	p.Y609H	IDE_uc010qnp.1_Missense_Mutation_p.Y54H|IDE_uc001khz.2_Intron	NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor	609					beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCTGCTGCATATGCATACTCG	0.448													70	103	---	---	---	---	PASS
PDHX	8050	broad.mit.edu	37	11	34938126	34938126	+	5'UTR	SNP	G	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34938126G>T	uc001mvt.2	+	1					PDHX_uc010rep.1_Intron|PDHX_uc010req.1_5'UTR|APIP_uc010reo.1_5'Flank|APIP_uc001mvs.2_5'Flank	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X						pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TGGGGGCGTGGCCAACCATGC	0.687													13	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	63998312	63998312	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63998312T>C	uc001nyr.1	-	1	449	c.17A>G	c.(16-18)CAG>CGG	p.Q6R	DNAJC4_uc001nys.2_5'UTR|DNAJC4_uc001nyt.2_5'UTR|DNAJC4_uc001nyu.2_5'UTR					Homo sapiens cDNA FLJ34477 fis, clone HLUNG2003833.																		CTTTCCCAGCTGCCCGCCCGC	0.711													4	10	---	---	---	---	PASS
ARCN1	372	broad.mit.edu	37	11	118454666	118454666	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118454666C>T	uc001ptq.2	+	4	751	c.590C>T	c.(589-591)GCT>GTT	p.A197V	ARCN1_uc009zah.2_Intron|ARCN1_uc010ryg.1_Missense_Mutation_p.A109V|ARCN1_uc009zag.2_Missense_Mutation_p.A238V	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1	197					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GGCAGCACAGCTGCCATGATC	0.488													55	43	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14804348	14804348	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14804348G>C	uc001rcd.2	-	15	1840	c.1703C>G	c.(1702-1704)TCC>TGC	p.S568C		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	568	Cytoplasmic (Potential).|Protein kinase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TACCCGGAGGGATCCTCTCTC	0.363													8	141	---	---	---	---	PASS
STK38L	23012	broad.mit.edu	37	12	27470675	27470675	+	Intron	SNP	T	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27470675T>A	uc001rhr.2	+						STK38L_uc001rhs.2_Intron|STK38L_uc010sjm.1_Intron|STK38L_uc010sjn.1_Intron|STK38L_uc010sjo.1_5'UTR	NM_015000	NP_055815	Q9Y2H1	ST38L_HUMAN	serine/threonine kinase 38 like						intracellular protein kinase cascade|regulation of cellular component organization	actin cytoskeleton|cytoplasm	actin binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|kidney(1)	5	Colorectal(261;0.0847)					ATTGACTTTATTAGCAACGTG	0.373													5	11	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98927778	98927778	+	Intron	SNP	G	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98927778G>T	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Missense_Mutation_p.Q581H	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						CAGCATTGCAGATTGCAACTC	0.493													18	54	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102493805	102493805	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102493805C>A	uc001yks.2	+	46	9136	c.8972C>A	c.(8971-8973)GCA>GAA	p.A2991E		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2991	AAA 4 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GAAAAGATAGCATTTATAATG	0.428													9	125	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105407539	105407539	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105407539G>A	uc010axc.1	-	7	14369	c.14249C>T	c.(14248-14250)TCG>TTG	p.S4750L	AHNAK2_uc001ypx.2_Missense_Mutation_p.S4650L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4750						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGAACAAGCCGAAACCTGTTG	0.438													4	56	---	---	---	---	PASS
DUOXA1	90527	broad.mit.edu	37	15	45411248	45411248	+	3'UTR	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45411248G>A	uc001zuq.1	-	6					DUOXA1_uc010uem.1_Intron|DUOXA1_uc001zup.2_Intron|DUOXA1_uc010bec.2_Intron|DUOXA1_uc001zur.1_3'UTR|DUOXA1_uc010bed.1_3'UTR	NM_144565	NP_653166	Q1HG43	DOXA1_HUMAN	Numb-interacting protein						protein transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		TTTATGGGGCGCCAATGAGGT	0.517													3	42	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3139570	3139570	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3139570G>A	uc002ctv.1	-	5	1788	c.1700C>T	c.(1699-1701)GCC>GTC	p.A567V	ZSCAN10_uc002cty.1_Missense_Mutation_p.A228V|ZSCAN10_uc002ctw.1_Missense_Mutation_p.A485V|ZSCAN10_uc002ctx.1_Missense_Mutation_p.A495V	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	567	C2H2-type 9.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CTGGTGGCGGGCCAGATCCTG	0.731													5	6	---	---	---	---	PASS
CDT1	81620	broad.mit.edu	37	16	88872184	88872184	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88872184T>G	uc002flu.2	+	5	793	c.739T>G	c.(739-741)TAC>GAC	p.Y247D		NM_030928	NP_112190	Q9H211	CDT1_HUMAN	chromatin licensing and DNA replication factor	247					DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of DNA-dependent DNA replication initiation|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CCCGGCCTCCTACCGCTTCCG	0.637													18	44	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7480257	7480257	+	Intron	SNP	T	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7480257T>A	uc002gho.1	+						EIF4A1_uc002ghr.1_Intron|EIF4A1_uc002ghq.1_Intron|EIF4A1_uc002ghp.1_Intron|SNORD10_uc002ght.2_RNA|SNORA67_uc010cml.1_5'Flank|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A						nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						GATCAGTCTTTGTACTCTGAG	0.507													21	50	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700112	17700112	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700112G>A	uc002grm.2	+	3	4319	c.3850G>A	c.(3850-3852)GGC>AGC	p.G1284S	RAI1_uc002grn.1_Missense_Mutation_p.G1284S	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1284						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GCCCACCAAGGGCAATGGCGA	0.637													11	156	---	---	---	---	PASS
SLC13A2	9058	broad.mit.edu	37	17	26820958	26820958	+	Intron	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26820958C>T	uc002hbh.2	+						SLC13A2_uc010wal.1_3'UTR|SLC13A2_uc010wam.1_Intron|SLC13A2_uc010wan.1_Intron|SLC13A2_uc010wao.1_Intron|SLC13A2_uc002hbi.2_Intron	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b							integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	AGGCTCATCTCCACCACCCTC	0.632													13	14	---	---	---	---	PASS
PHF12	57649	broad.mit.edu	37	17	27251182	27251182	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27251182C>T	uc002hdg.1	-	4	990	c.460G>A	c.(460-462)GCC>ACC	p.A154T	PHF12_uc010wbb.1_Missense_Mutation_p.A136T|PHF12_uc002hdi.1_Missense_Mutation_p.A150T|PHF12_uc002hdj.1_Missense_Mutation_p.A154T|PHF12_uc010crw.1_Intron|uc002hdl.2_5'Flank|PHF12_uc002hdh.1_5'UTR	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	154	Interaction with SIN3A.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			AGGATCCGGGCATGGGCAATG	0.557													23	64	---	---	---	---	PASS
KRT31	3881	broad.mit.edu	37	17	39553695	39553695	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39553695C>T	uc002hwn.2	-	1	150	c.97G>A	c.(97-99)GGG>AGG	p.G33R	KRT31_uc010cxn.2_Missense_Mutation_p.G33R	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	33	Head.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				TTGCAGGCCCCGGGCAGGGTG	0.637													32	77	---	---	---	---	PASS
VAT1	10493	broad.mit.edu	37	17	41169909	41169909	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41169909T>A	uc002icm.1	-	4	925	c.805A>T	c.(805-807)ACT>TCT	p.T269S	VAT1_uc010cyw.1_Missense_Mutation_p.T135S|VAT1_uc010whk.1_Missense_Mutation_p.T201S	NM_006373	NP_006364	Q99536	VAT1_HUMAN	vesicle amine transport protein 1	269						cytoplasm|integral to membrane	oxidoreductase activity|zinc ion binding				0		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCCTTGGCAGTATCTGACCCA	0.552													34	70	---	---	---	---	PASS
YPEL2	388403	broad.mit.edu	37	17	57430716	57430716	+	Translation_Start_Site	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57430716C>A	uc002ixm.1	+	2	274	c.-54C>A	c.(-56--52)TCCTG>TCATG		YPEL2_uc002ixl.1_Translation_Start_Site	NM_001005404	NP_001005404	Q96QA6	YPEL2_HUMAN	yippee-like 2							nucleolus					0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					GCGACCCATCCTGTGGGAGTG	0.587													20	36	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6980564	6980564	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6980564C>T	uc002knm.2	-	42	6057	c.5963G>A	c.(5962-5964)AGG>AAG	p.R1988K	LAMA1_uc010wzj.1_Missense_Mutation_p.R1464K	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1988	Domain II and I.|Potential.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATTGGTTTGCCTGGTAATTTC	0.343													12	69	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33734957	33734957	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33734957T>G	uc002kzk.1	+	12	1280	c.1270T>G	c.(1270-1272)TCA>GCA	p.S424A	ELP2_uc010xcg.1_Missense_Mutation_p.S489A|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Missense_Mutation_p.S398A|ELP2_uc010xch.1_Missense_Mutation_p.S419A|ELP2_uc002kzn.1_Missense_Mutation_p.S354A|ELP2_uc002kzo.1_Missense_Mutation_p.S354A	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	424	WD 8.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						AAAAGACCAATCACAGGTAAA	0.234													52	52	---	---	---	---	PASS
LONP1	9361	broad.mit.edu	37	19	5699087	5699087	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5699087G>C	uc002mcx.2	-	10	1669	c.1636C>G	c.(1636-1638)CGC>GGC	p.R546G	LONP1_uc002mcy.2_Missense_Mutation_p.R482G|LONP1_uc010duh.2_Missense_Mutation_p.R287G|LONP1_uc010dui.2_Missense_Mutation_p.R530G|LONP1_uc002mcz.2_Missense_Mutation_p.R350G	NM_004793	NP_004784	P36776	LONM_HUMAN	mitochondrial lon peptidase 1 precursor	546					cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding				0						ACGCTGAAGCGGAAGTACTCT	0.647													22	67	---	---	---	---	PASS
ADAMTS10	81794	broad.mit.edu	37	19	8651052	8651052	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8651052G>T	uc002mkj.1	-	22	2888	c.2614C>A	c.(2614-2616)CTG>ATG	p.L872M	ADAMTS10_uc002mki.1_Missense_Mutation_p.L359M|ADAMTS10_uc002mkk.1_Missense_Mutation_p.L504M	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	872	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						CTTTTGGGCAGCTTGCTGTGG	0.672											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	51	---	---	---	---	PASS
NDUFA13	51079	broad.mit.edu	37	19	19637065	19637065	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19637065C>T	uc010xqy.1	+	2	677	c.418C>T	c.(418-420)CGC>TGC	p.R140C	NDUFA13_uc002nms.2_Missense_Mutation_p.R140C|NDUFA13_uc010xqx.1_Missense_Mutation_p.R140C|YJEFN3_uc002nmt.1_5'Flank|YJEFN3_uc010ecf.1_5'Flank|YJEFN3_uc002nmu.1_5'Flank	NM_015965	NP_057049	Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	57					apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	GAACCGTGAGCGCAGGTAGGG	0.612													14	38	---	---	---	---	PASS
ADAM33	80332	broad.mit.edu	37	20	3653456	3653456	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3653456G>A	uc002wit.2	-	12	1310	c.1223C>T	c.(1222-1224)GCC>GTC	p.A408V	ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Missense_Mutation_p.A408V|ADAM33_uc002wis.2_5'UTR|ADAM33_uc002wiu.2_Missense_Mutation_p.A408V|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Intron|ADAM33_uc010zqg.1_3'UTR|ADAM33_uc010zqh.1_3'UTR	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33 isoform alpha	408	Extracellular (Potential).|Peptidase M12B.				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|ovary(1)|skin(1)	4						GGGGTCCGGGGCATTGGAGAG	0.726													6	13	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	C	C	rs145412486	by1000genomes	TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628236G>C	uc010ztl.1	+	3	180	c.148G>C	c.(148-150)GCT>CCT	p.A50P	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A2P					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGGGAAAATGGCTTTGTTGGC	0.333													11	200	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37150191	37150191	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37150191C>T	uc002xiw.2	+	10	1726	c.1469C>T	c.(1468-1470)TCC>TTC	p.S490F	RALGAPB_uc010zvz.1_Intron|RALGAPB_uc002xix.2_Missense_Mutation_p.S490F|RALGAPB_uc002xiy.1_Missense_Mutation_p.S490F|RALGAPB_uc002xiz.2_Missense_Mutation_p.S268F|RALGAPB_uc002xja.1_Missense_Mutation_p.S217F	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	490					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TCACAAATGTCCACAGACACC	0.438													77	149	---	---	---	---	PASS
C20orf135	140701	broad.mit.edu	37	20	62493290	62493290	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62493290C>A	uc002ygx.1	+	1	725	c.397C>A	c.(397-399)CGC>AGC	p.R133S		NM_080622	NP_542189	Q9H3Z7	ABHGB_HUMAN	hypothetical protein LOC140701	133							hydrolase activity				0	all_cancers(38;1.77e-12)|all_epithelial(29;3.12e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)					GGGCCAAGAGCGCCTCGTGGA	0.711													5	22	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35153771	35153771	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35153771C>A	uc002yta.1	+	15	1871	c.1603C>A	c.(1603-1605)CAG>AAG	p.Q535K	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.Q535K|ITSN1_uc010gmg.2_Missense_Mutation_p.Q498K|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.Q535K|ITSN1_uc010gmi.2_Missense_Mutation_p.Q498K|ITSN1_uc010gmj.2_Missense_Mutation_p.Q419K|ITSN1_uc002ysy.2_Missense_Mutation_p.Q535K|ITSN1_uc002ysx.2_Missense_Mutation_p.Q498K|ITSN1_uc002ytb.1_Missense_Mutation_p.Q535K|ITSN1_uc002ytc.1_Missense_Mutation_p.Q535K|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.Q498K|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.Q535K|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.Q469K	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	535	Potential.|KLERQ.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						CCAGGAATCTCAGCAAATGCT	0.383													9	102	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44928976	44928976	+	Silent	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44928976G>A	uc004dge.3	+	17	2451	c.2076G>A	c.(2074-2076)CAG>CAA	p.Q692Q	KDM6A_uc010nhk.2_Silent_p.Q658Q|KDM6A_uc011mkz.1_Silent_p.Q744Q|KDM6A_uc011mla.1_Silent_p.Q647Q|KDM6A_uc011mlb.1_Silent_p.Q699Q|KDM6A_uc011mlc.1_Silent_p.Q396Q|KDM6A_uc011mld.1_Silent_p.Q331Q	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	692					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						CAGTAACACAGGGGGCTGCTC	0.517			D|N|F|S		renal|oesophageal SCC|MM								23	8	---	---	---	---	PASS
MTMR1	8776	broad.mit.edu	37	X	149887167	149887167	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149887167C>A	uc004fei.2	+	3	458	c.323C>A	c.(322-324)GCC>GAC	p.A108D	MTMR1_uc011mya.1_Missense_Mutation_p.A14D|MTMR1_uc004feg.1_Missense_Mutation_p.A108D|MTMR1_uc004feh.1_Missense_Mutation_p.A116D|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	108	GRAM.					plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TCAATTAAAGCCATTGGTAAG	0.388													3	44	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13069	13069	+	RNA	SNP	G	A	A			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13069G>A	uc004cox.3	+	1		c.733G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CCCCAGTCTCAGCCCTACTCC	0.537													3	4	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16894081	16894082	+	Intron	DEL	AG	-	-	rs35523431		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16894081_16894082delAG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		acacacacacaGAGTGAGCTCA	0.347													8	5	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52627783	52627783	+	Intron	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52627783delA	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						ATCCAGAATTaaaaaaaaaaa	0.254													5	4	---	---	---	---	
KLHL12	59349	broad.mit.edu	37	1	202861464	202861466	+	3'UTR	DEL	CTG	-	-	rs35443455		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202861464_202861466delCTG	uc001gyo.1	-	12					KLHL12_uc001gym.1_3'UTR|KLHL12_uc001gyn.1_3'UTR|KLHL12_uc010pqc.1_3'UTR	NM_021633	NP_067646	Q53G59	KLH12_HUMAN	kelch-like 12						Wnt receptor signaling pathway		protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			CCTGGAATATCTGTTACCCACCC	0.473													4	2	---	---	---	---	
ITSN2	50618	broad.mit.edu	37	2	24521896	24521897	+	Intron	DEL	TT	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24521896_24521897delTT	uc002rfe.2	-						ITSN2_uc002rff.2_Intron|ITSN2_uc002rfg.2_Intron|ITSN2_uc010eyd.2_Intron	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1						endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACGAGATCtttttttttttt	0.183													4	2	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25639652	25639653	+	Intron	INS	-	GGAA	GGAA			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25639652_25639653insGGAA	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgp.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCAGAACCTggaaggaagga	0.243													4	2	---	---	---	---	
AAK1	22848	broad.mit.edu	37	2	69715282	69715283	+	Intron	DEL	GT	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69715282_69715283delGT	uc002sfp.2	-						AAK1_uc010fdk.2_Intron|AAK1_uc010yqm.1_Intron	NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1							coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0						gtgtgtggacgtgtgtgtgtgt	0.099													4	3	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091357	88091357	+	Intron	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091357delA	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						accctgtcttaaaaaaaaaaa	0.194													6	3	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91817251	91817256	+	Intron	DEL	CACACA	-	-	rs61307269		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91817251_91817256delCACACA	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						ctctctctctcacacacacacacaca	0.102													4	2	---	---	---	---	
GCC2	9648	broad.mit.edu	37	2	109123861	109123862	+	Intron	INS	-	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109123861_109123862insC	uc002tec.2	+						GCC2_uc002ted.2_Intron	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2						Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						aaaaaaaagaaCCCCCCCCCCC	0.149													4	2	---	---	---	---	
GPR17	2840	broad.mit.edu	37	2	128406741	128406748	+	Intron	DEL	AGGAAGGA	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128406741_128406748delAGGAAGGA	uc010yzn.1	+						LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Intron|GPR17_uc010yzo.1_Intron|GPR17_uc002tpd.2_Intron	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a							integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		agaggaaggtaggaaggaaggaaggaag	0.173													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129393430	129393437	+	IGR	DEL	CCTTCCTT	-	-	rs72091728		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129393430_129393437delCCTTCCTT								HS6ST1 (317259 upstream) : None (None downstream)																							tccctccctcccttccttccttccttcc	0.192													6	6	---	---	---	---	
UBE2E3	10477	broad.mit.edu	37	2	181886359	181886360	+	Intron	INS	-	TTCC	TTCC	rs56152201		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181886359_181886360insTTCC	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ccctcccttttttccttccttc	0.089													4	3	---	---	---	---	
ZC3H15	55854	broad.mit.edu	37	2	187369038	187369038	+	Intron	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187369038delA	uc002upo.2	+							NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response							cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TTATGAAAGGAAAAAAAAAAT	0.318													6	7	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	5	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52597340	52597340	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52597340delG	uc003des.2	-	24	4057	c.4045delC	c.(4045-4047)CTGfs	p.L1349fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.L1349fs|PBRM1_uc003der.2_Frame_Shift_Del_p.L1317fs|PBRM1_uc003det.2_Frame_Shift_Del_p.L1364fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.L1364fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.L1349fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.L1324fs|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Frame_Shift_Del_p.L1348fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1349				L -> P (in Ref. 4; AAI15010).	chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.L1349fs*35(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCACTGGCCAGGGGGGTCTGA	0.493			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								51	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133782795	133782806	+	IGR	DEL	GAAAGAAAGAAA	-	-	rs55842952		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133782795_133782806delGAAAGAAAGAAA								SLCO2A1 (33875 upstream) : RYK (93172 downstream)																							aggaaagaaggaaagaaagaaagaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42386085	42386086	+	IGR	INS	-	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42386085_42386086insC								BEND4 (231190 upstream) : SHISA3 (13770 downstream)																							cttccttccttccttccttcct	0.079													4	2	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869491	129869491	+	Intron	DEL	A	-	-	rs145196324		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869491delA	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						actccattgcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	178012595	178012596	+	Intron	INS	-	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178012595_178012596insG	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TGGATGGCGCTGGGGTAACACT	0.614													4	2	---	---	---	---	
NOL7	51406	broad.mit.edu	37	6	13621069	13621069	+	3'UTR	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13621069delA	uc003naz.2	+	8						NM_016167	NP_057251	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa							mitochondrion|nucleolus					0	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			AATCAATGCTAAATGAAGAAT	0.264													27	13	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29926345	29926346	+	Intron	INS	-	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29926345_29926346insG	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GGCTTGTAAAATGACAACTTAG	0.490													5	4	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32557588	32557589	+	5'Flank	INS	-	T	T	rs35683586		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557588_32557589insT	uc003obk.3	-						HLA-DRB1_uc003obp.3_5'Flank	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ACTATGAACCCCTCCACCCACA	0.520													6	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51923570	51923573	+	Intron	DEL	TCTA	-	-	rs66624918		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51923570_51923573delTCTA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTCCAGCTCtctatctatctatc	0.333													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140245809	140245812	+	IGR	DEL	CTTT	-	-	rs72297098		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140245809_140245812delCTTT								CITED2 (550024 upstream) : None (None downstream)																							tcctttcttcctttcttcctttct	0.000													1	5	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149274908	149274908	+	Intron	DEL	A	-	-	rs147617058		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149274908delA	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		actccatctcaaaaaaaaaaa	0.104													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	151546282	151546289	+	Intron	DEL	CTTCCTTT	-	-	rs72359904	by1000genomes	TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151546282_151546289delCTTCCTTT	uc003qod.2	-											Homo sapiens cDNA clone IMAGE:4838370.																		tccttccttccttcctttctttctttcc	0.000													5	3	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5364768	5364768	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5364768delT	uc003soi.3	-	20	6608	c.6259delA	c.(6259-6261)AGGfs	p.R2087fs		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2087							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCTTTGCTCCTTTTGGCAGCG	0.672													4	2	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	107801010	107801011	+	Intron	DEL	AA	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107801010_107801011delAA	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron|NRCAM_uc003vfa.2_5'UTR|NRCAM_uc011kmj.1_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						CTCTCAGAGTAAAAAATTGCCA	0.396													14	10	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147782787	147782790	+	Intron	DEL	CCTT	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147782787_147782790delCCTT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			tttctctttcccttccttccttcc	0.078										HNSCC(39;0.1)			4	2	---	---	---	---	
UNC5D	137970	broad.mit.edu	37	8	35646219	35646220	+	Intron	DEL	CA	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35646219_35646220delCA	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron|UNC5D_uc003xju.1_Intron	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		cacacacacgcacacacacaca	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81872441	81872444	+	IGR	DEL	CTTC	-	-	rs72018488		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81872441_81872444delCTTC								ZNF704 (85425 upstream) : PAG1 (7604 downstream)																							tttcttccttcttccttccttcct	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101799419	101799420	+	IGR	DEL	AC	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101799419_101799420delAC								PABPC1 (65104 upstream) : YWHAZ (131384 downstream)																							actaataAGTacacacacacac	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	21775678	21775681	+	IGR	DEL	GAAG	-	-	rs7466051		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21775678_21775681delGAAG								LOC554202 (215846 upstream) : MTAP (26954 downstream)																							aggaaggaaagaaggaaggaagga	0.010													4	3	---	---	---	---	
EXOSC2	23404	broad.mit.edu	37	9	133573185	133573186	+	Intron	INS	-	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133573185_133573186insT	uc004bzu.2	+						EXOSC2_uc011mbz.1_Intron|EXOSC2_uc011mca.1_Intron	NM_014285	NP_055100	Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|positive regulation of cell growth|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|7S RNA binding|protein binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		ACTGGTTCATGttttttttttt	0.198													5	3	---	---	---	---	
SARDH	1757	broad.mit.edu	37	9	136561200	136561200	+	Intron	DEL	G	-	-	rs35905090		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136561200delG	uc004cep.3	-						SARDH_uc004ceo.2_Intron|SARDH_uc011mdn.1_Intron|SARDH_uc011mdo.1_Intron|SARDH_uc004cen.2_Intron	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor						glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GGGGCCGGACGGGGGGGAGCT	0.463													3	6	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47141635	47141636	+	Intron	DEL	AC	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47141635_47141636delAC	uc001jed.3	-						uc001jef.2_Intron			P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ctctgtctttacacacacacac	0.000													4	2	---	---	---	---	
C10orf46	143384	broad.mit.edu	37	10	120445456	120445457	+	3'UTR	INS	-	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120445456_120445457insT	uc001lds.1	-	9					C10orf46_uc010qst.1_Intron	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		TAGCAGCAACGTTTTTTTTTTT	0.361													4	3	---	---	---	---	
METTL10	399818	broad.mit.edu	37	10	126480432	126480433	+	5'UTR	INS	-	C	C			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126480432_126480433insC	uc001lhy.1	-	1					FAM53B_uc001lhu.1_5'Flank|METTL10_uc001lhz.1_5'UTR|METTL10_uc001lia.1_5'UTR	NM_212554	NP_997719	Q5JPI9	MTL10_HUMAN	methyltransferase like 10								methyltransferase activity				0		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		GGCCGTTGGGGCCGCCATAGAG	0.757													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	37154077	37154078	+	IGR	INS	-	AGAC	AGAC	rs10651847		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37154077_37154078insAGAC								C11orf74 (457687 upstream) : None (None downstream)																							CTGAAacacatagcacacacac	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	100517164	100517187	+	IGR	DEL	GAAGGAAGGAAAGAAGGAAGGAAA	-	-	rs12281290		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100517164_100517187delGAAGGAAGGAAAGAAGGAAGGAAA								CNTN5 (289692 upstream) : ARHGAP42 (41220 downstream)																							aggaaggaaggaaggaaggaaagaaggaaggaaagaaggaagga	0.009													4	2	---	---	---	---	
ASAM	79827	broad.mit.edu	37	11	123021290	123021291	+	Intron	INS	-	AAGG	AAGG	rs12284315		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123021290_123021291insAAGG	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		ggaaggaaggaaaggaaggaag	0.094													4	2	---	---	---	---	
TWF1	5756	broad.mit.edu	37	12	44192424	44192425	+	Intron	INS	-	A	A	rs35482343		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44192424_44192425insA	uc001rob.2	-						TWF1_uc001rnz.2_Intron|TWF1_uc001roa.2_Intron|TWF1_uc001roc.2_Intron	NM_002822	NP_002813	Q12792	TWF1_HUMAN	twinfilin 1							actin cytoskeleton|cytoplasm	actin binding|protein tyrosine kinase activity			stomach(1)	1	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		ATCAAACTCGTAAAAAAAAAAA	0.277													4	2	---	---	---	---	
HCFC2	29915	broad.mit.edu	37	12	104476292	104476293	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104476292_104476293insT	uc001tkj.3	+	6	885_886	c.782_783insT	c.(781-783)GGTfs	p.G261fs	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	261	Kelch 4.				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						TACATTTTTGGTGGATGGGTCC	0.356													115	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	90498181	90498182	+	IGR	DEL	CA	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90498181_90498182delCA								None (None upstream) : MIR622 (385254 downstream)																							cacacacgagcacacacacacC	0.332													4	2	---	---	---	---	
NRG4	145957	broad.mit.edu	37	15	76243504	76243505	+	Intron	INS	-	TT	TT	rs143234115		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76243504_76243505insTT	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						tttcttttttcttttttttttt	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9127640	9127655	+	IGR	DEL	TCGGTCCCTCCCTCCC	-	-	rs7198349	by1000genomes	TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9127640_9127655delTCGGTCCCTCCCTCCC								USP7 (70299 upstream) : C16orf72 (57882 downstream)																							cttccttccttcggtccctccctccctccttccttc	0.102													3	4	---	---	---	---	
ACSM2B	348158	broad.mit.edu	37	16	20563775	20563776	+	Intron	INS	-	G	G			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20563775_20563776insG	uc002dhj.3	-						ACSM2B_uc002dhk.3_Intron|ACSM2B_uc010bwf.1_Intron	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						ATAAGTAGGAAGGGGGAAGAAA	0.460													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21536149	21536149	+	IGR	DEL	G	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21536149delG								C17orf51 (58418 upstream) : FAM27L (289221 downstream)																							AATTGCACGTGTTTTTTGTGT	0.368													4	2	---	---	---	---	
LRRC37A2	474170	broad.mit.edu	37	17	44625842	44625842	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44625842delG	uc002ikn.1	+	9	3340	c.3337delG	c.(3337-3339)GAGfs	p.E1113fs	ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Frame_Shift_Del_p.E74fs|LRRC37A2_uc010dax.1_Frame_Shift_Del_p.E43fs	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor	1113	Extracellular (Potential).					integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		CACCAATGACGAGAGTGATTT	0.453													4	2	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655757	47655757	+	Intron	DEL	G	-	-	rs36092852		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655757delG	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					AAAGGACAATGGGGGGGGGGG	0.532													4	2	---	---	---	---	
ABCC3	8714	broad.mit.edu	37	17	48755715	48755715	+	Intron	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48755715delA	uc002isl.2	+						ABCC3_uc002isn.2_5'Flank	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	GGACTGTGAGAAAAAAAAAAA	0.478													4	3	---	---	---	---	
PRSSL1	400668	broad.mit.edu	37	19	691213	691213	+	Intron	DEL	A	-	-	rs147436553		TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:691213delA	uc002lpl.1	-						PRSSL1_uc010xfs.1_Intron	NM_214710	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine-like 1 precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTAAGCCTGGAAAAAAAAAAT	0.234													4	2	---	---	---	---	
LTBP4	8425	broad.mit.edu	37	19	41108052	41108053	+	Intron	DEL	TG	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41108052_41108053delTG	uc002ooh.1	+						LTBP4_uc002oog.1_Intron|LTBP4_uc002ooi.1_Intron	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding						growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGACGGGGGTtgtgtgtgtgtg	0.495											OREG0025474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49407785	49407785	+	Intron	DEL	T	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49407785delT	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GACTGGtttcttttttttttt	0.323													6	4	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074688	62074690	+	Intron	DEL	CAC	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074688_62074690delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													6	3	---	---	---	---	
WDR4	10785	broad.mit.edu	37	21	44279838	44279838	+	Intron	DEL	A	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44279838delA	uc002zci.2	-						WDR4_uc002zck.1_Intron|WDR4_uc002zcl.1_Intron|WDR4_uc010gpg.1_Intron|WDR4_uc011aew.1_Intron|WDR4_uc010gph.1_Intron	NM_033661	NP_387510	P57081	WDR4_HUMAN	WD repeat domain 4 protein						tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		CAAACCTGTGAGGGCGAGAGA	0.642													4	2	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507745	36507745	+	IGR	DEL	T	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507745delT								CXorf30 (104312 upstream) : FAM47C (518725 downstream)																							ttcttTCGGGttttttttttt	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	129579481	129579484	+	IGR	DEL	TCCT	-	-			TCGA-BP-5201-01A-01D-1429-08	TCGA-BP-5201-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129579481_129579484delTCCT								RBMX2 (32165 upstream) : FAM45B (49431 downstream)																							cttccttccatccttccttccttc	0.098													4	2	---	---	---	---	
