Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11169375	11169375	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11169375A>C	uc001asd.2	-	56	7621	c.7500T>G	c.(7498-7500)ATT>ATG	p.I2500M	MTOR_uc001asc.2_Missense_Mutation_p.I705M	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	2500	PI3K/PI4K.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CCCTGTTAATAATCTGGATAG	0.408													27	99	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11294267	11294267	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11294267C>T	uc001asd.2	-	14	2385	c.2264G>A	c.(2263-2265)CGC>CAC	p.R755H		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	755					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CCCCAGCATGCGGGCACTCTG	0.517													4	141	---	---	---	---	PASS
SYNC	81493	broad.mit.edu	37	1	33149611	33149611	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33149611C>T	uc001bvt.2	-	4	1538	c.1438G>A	c.(1438-1440)GGG>AGG	p.G480R	SYNC_uc010ohl.1_Intron|RBBP4_uc001bvr.2_3'UTR|RBBP4_uc001bvs.2_3'UTR|RBBP4_uc010ohj.1_3'UTR|RBBP4_uc010ohk.1_3'UTR	NM_030786	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament 1 isoform 1	480	Tail.					intermediate filament|perinuclear region of cytoplasm	structural molecule activity			ovary(1)	1						CAAAGATCACCTTGAGACTGT	0.383													137	362	---	---	---	---	PASS
RIMKLA	284716	broad.mit.edu	37	1	42880337	42880337	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880337G>A	uc001chi.2	+	5	1006	c.868G>A	c.(868-870)GAT>AAT	p.D290N		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	290	ATP-grasp.				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						ATGCAACTTAGATGTGGGTGG	0.502													61	140	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78195568	78195568	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78195568T>C	uc001dht.2	-	10	1134	c.787A>G	c.(787-789)ACA>GCA	p.T263A	USP33_uc001dhs.2_5'Flank|USP33_uc001dhu.2_Missense_Mutation_p.T232A|USP33_uc001dhv.2_Missense_Mutation_p.T68A|USP33_uc001dhw.2_Missense_Mutation_p.T263A	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	263					axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						CCCCGAAATGTTGGATTTACA	0.303													55	103	---	---	---	---	PASS
ST7L	54879	broad.mit.edu	37	1	113098583	113098583	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113098583C>T	uc001ecd.2	-	12	1608	c.1303G>A	c.(1303-1305)GAT>AAT	p.D435N	ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Missense_Mutation_p.D252N|ST7L_uc010owg.1_Missense_Mutation_p.D370N|ST7L_uc010owh.1_Missense_Mutation_p.D229N|ST7L_uc001ece.2_Missense_Mutation_p.D435N|ST7L_uc001ecf.2_Missense_Mutation_p.D418N|ST7L_uc001ecg.2_RNA|ST7L_uc010owi.1_Missense_Mutation_p.D370N|ST7L_uc001ech.2_Missense_Mutation_p.D418N|ST7L_uc001eci.2_Missense_Mutation_p.D435N|ST7L_uc009wgi.1_RNA|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1	435					negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTCACTATCACCCCGTTTC	0.368													37	82	---	---	---	---	PASS
LOC647121	647121	broad.mit.edu	37	1	121298440	121298440	+	RNA	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121298440T>C	uc001eiu.1	+	2		c.481T>C				NR_003955				Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						AGTGAACAACTTGAGAATAAT	0.373													37	85	---	---	---	---	PASS
TTC24	164118	broad.mit.edu	37	1	156553240	156553240	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156553240C>T	uc009wsc.1	+	3	450	c.310C>T	c.(310-312)CAG>TAG	p.Q104*		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	384	TPR 8.						binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCCAGTGTCAGGTGAGACC	0.577											OREG0013875	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	13	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160310032	160310032	+	Silent	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160310032C>A	uc009wti.2	-	2	487	c.93G>T	c.(91-93)GGG>GGT	p.G31G	COPA_uc001fvv.3_Silent_p.G31G|COPA_uc009wtj.1_Missense_Mutation_p.G2V	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	31	WD 1.				COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACTGGATGACCCCATTATGTA	0.398													24	56	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178427409	178427409	+	Silent	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178427409A>G	uc001glr.2	+	12	2684	c.2559A>G	c.(2557-2559)AGA>AGG	p.R853R	RASAL2_uc001glq.2_Silent_p.R994R|RASAL2_uc009wxc.2_Silent_p.R367R	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	853					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						TGCCAGATAGACACATACCTC	0.537													4	69	---	---	---	---	PASS
KLHL12	59349	broad.mit.edu	37	1	202861658	202861658	+	3'UTR	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202861658T>G	uc001gyo.1	-	12					KLHL12_uc001gym.1_3'UTR|KLHL12_uc001gyn.1_3'UTR|KLHL12_uc010pqc.1_3'UTR	NM_021633	NP_067646	Q53G59	KLH12_HUMAN	kelch-like 12						Wnt receptor signaling pathway		protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCTCCAACAATGGTCACTTCT	0.493													10	76	---	---	---	---	PASS
CPSF3	51692	broad.mit.edu	37	2	9580730	9580730	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9580730G>A	uc002qzo.1	+	8	906	c.871G>A	c.(871-873)GAC>AAC	p.D291N	CPSF3_uc010ewx.1_Missense_Mutation_p.D291N|CPSF3_uc002qzp.1_Missense_Mutation_p.D254N	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,	291					histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TGCCATGAATGACAAAATCCG	0.388													38	103	---	---	---	---	PASS
SUPT7L	9913	broad.mit.edu	37	2	27876614	27876614	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27876614C>G	uc002rlh.1	-	6	1326	c.983G>C	c.(982-984)AGT>ACT	p.S328T	SUPT7L_uc002rli.1_Missense_Mutation_p.S328T|SUPT7L_uc010ymf.1_Missense_Mutation_p.S193T|SUPT7L_uc002rlj.1_Missense_Mutation_p.S326T|SUPT7L_uc010ezh.1_Missense_Mutation_p.S326T	NM_014860	NP_055675	O94864	ST65G_HUMAN	SPTF-associated factor 65 gamma	328					histone H3 acetylation|maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					TACCTCTGCACCTAGAAACAG	0.433													19	142	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31598321	31598321	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31598321G>A	uc002rnv.1	-	15	1606	c.1527C>T	c.(1525-1527)TGC>TGT	p.C509C		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	509					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GGGTGAGGGTGCACCGGAAGT	0.612													46	80	---	---	---	---	PASS
PELI1	57162	broad.mit.edu	37	2	64321726	64321726	+	3'UTR	SNP	T	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64321726T>A	uc002scs.3	-	6					PELI1_uc002sct.3_3'UTR|PELI1_uc002scr.3_3'UTR	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein						innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						AAATTCTTCATCTTAATGCAA	0.333													3	4	---	---	---	---	PASS
FAHD2A	51011	broad.mit.edu	37	2	96072813	96072813	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96072813G>T	uc002sur.2	+	3	549	c.370G>T	c.(370-372)GTG>TTG	p.V124L	FAHD2A_uc002sus.2_Missense_Mutation_p.V124L	NM_016044	NP_057128	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing	124							hydrolase activity|metal ion binding			ovary(1)	1						AGAACAGAACGTGCCCGTGCC	0.567													5	107	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122168512	122168512	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122168512G>A	uc002tnc.2	-	24	2744	c.2354C>T	c.(2353-2355)CCT>CTT	p.P785L	CLASP1_uc010yyv.1_5'Flank|CLASP1_uc002tmz.2_5'UTR|CLASP1_uc002tna.2_5'UTR|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.P757L|CLASP1_uc010yza.1_Missense_Mutation_p.P749L|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Missense_Mutation_p.P756L	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	785	Interaction with microtubules, MAPRE1 and MAPRE3.				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CACAGAACCAGGTATTCTTCC	0.408													11	24	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165952091	165952091	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165952091A>G	uc002ucx.2	-	25	4853	c.4361T>C	c.(4360-4362)TTT>TCT	p.F1454S	SCN3A_uc010zcy.1_5'Flank|SCN3A_uc002ucy.2_Missense_Mutation_p.F1405S|SCN3A_uc002ucz.2_Missense_Mutation_p.F1405S	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1454	Helical; Name=S6 of repeat III; (Potential).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	GAATGACCCAAAGATGATAAA	0.284													19	51	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179416718	179416718	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179416718G>T	uc010zfg.1	-	284	83429	c.83205C>A	c.(83203-83205)AAC>AAA	p.N27735K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.N21430K|TTN_uc010zfi.1_Missense_Mutation_p.N21363K|TTN_uc010zfj.1_Missense_Mutation_p.N21238K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28662							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCGTATCTGTTTTCTGCTC	0.438													12	123	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179606370	179606370	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179606370C>A	uc010zfh.1	-	46	11301	c.11077G>T	c.(11077-11079)GCT>TCT	p.A3693S	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.A3626S|TTN_uc010zfj.1_Missense_Mutation_p.A3501S|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.P3693P(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTAGTCAGCAGAAGGGGTT	0.418													9	120	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179615115	179615115	+	Silent	SNP	T	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179615115T>A	uc002unb.2	-	46	12236	c.12012A>T	c.(12010-12012)TCA>TCT	p.S4004S	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGAACAGATGAAAGAGTTA	0.328													4	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	190789085	190789085	+	3'UTR	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190789085A>T	uc002uro.2	+	1										SubName: Full=cDNA FLJ54127, highly similar to Heterogeneous nuclear ribonucleoproteins C;																		TCCCATGTTCATTAATTAATT	0.413													4	6	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224462769	224462769	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224462769G>T	uc002vnm.2	-	2	1365	c.1232C>A	c.(1231-1233)TCC>TAC	p.S411Y		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	411					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCCACTCTTGGAGAGCATCCT	0.507													27	68	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241496637	241496637	+	Intron	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241496637G>A	uc002vyz.1	-						ANKMY1_uc002vza.1_Missense_Mutation_p.S39F|ANKMY1_uc010fzd.1_Missense_Mutation_p.S39F|ANKMY1_uc002vzb.1_Missense_Mutation_p.S39F|ANKMY1_uc002vzc.1_Missense_Mutation_p.S39F|ANKMY1_uc002vzd.1_Missense_Mutation_p.S39F|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron|ANKMY1_uc002vzf.2_Intron|DUSP28_uc002vzg.2_5'Flank|DUSP28_uc002vzh.2_5'Flank	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GTTCTTCAGGGACCCCGGCTC	0.677											OREG0015353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	105	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188245	10188245	+	Missense_Mutation	SNP	G	T	T	rs104893830		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188245G>T	uc003bvc.2	+	2	601	c.388G>T	c.(388-390)GTT>TTT	p.V130F	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	130	Involved in binding to CCT complex.		V -> L (in ECYT2 and VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V130L(7)|p.V130>F(1)|p.V130G(1)|p.V130fs*28(1)|p.V130fs*29(1)|p.V130D(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGGGCTTCTGGTTAACCAAAC	0.413		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				71	72	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19295207	19295207	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19295207C>T	uc003cbk.1	+	2	333	c.138C>T	c.(136-138)TCC>TCT	p.S46S	KCNH8_uc011awe.1_Silent_p.S46S|KCNH8_uc010hex.1_5'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	46	Cytoplasmic (Potential).|PAS.					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						TCTACTGTTCCGATGGCTTCT	0.453													5	168	---	---	---	---	PASS
RARB	5915	broad.mit.edu	37	3	25215897	25215897	+	Silent	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25215897C>A	uc011awl.1	+	1	75	c.9C>A	c.(7-9)ACC>ACA	p.T3T		NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2	3	Modulating.				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)	ACATGACCACCAGCGGCCACG	0.547													35	44	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47162024	47162024	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47162024G>A	uc003cqs.2	-	3	4155	c.4102C>T	c.(4102-4104)CAA>TAA	p.Q1368*	SETD2_uc003cqv.2_Nonsense_Mutation_p.Q1357*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1368					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCAGGTGCTTGCACTGACCCC	0.368			N|F|S|Mis		clear cell renal carcinoma								10	49	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52443747	52443747	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52443747A>G	uc003ddx.2	-	2	165	c.50T>C	c.(49-51)CTG>CCG	p.L17P	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	17					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.?(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TTCCACGAGCAGGGTGAAGAG	0.697			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								4	21	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128204803	128204803	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128204803T>A	uc003ekm.3	-	4	1073	c.638A>T	c.(637-639)TAC>TTC	p.Y213F	GATA2_uc003ekn.3_Missense_Mutation_p.Y213F|GATA2_uc003eko.2_Missense_Mutation_p.Y213F	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	213					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		TGACACCTGGTACTTGACGCC	0.627			Mis		AML(CML blast transformation)								22	49	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129286540	129286540	+	Splice_Site	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129286540C>T	uc003emx.2	-	21	4073	c.3973_splice	c.e21+1	p.G1325_splice	PLXND1_uc011blb.1_5'Flank	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						CCGCCCACTACCTTTGCGGAT	0.612													17	27	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154146980	154146980	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154146980G>T	uc003faa.2	-	1	525	c.425C>A	c.(424-426)ACA>AAA	p.T142K		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	142	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCTGGAGGCTGTCTGGCTCCC	0.597													20	41	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170198277	170198277	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170198277G>A	uc003fgz.2	-	7	2110	c.1794C>T	c.(1792-1794)ATC>ATT	p.I598I	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	598	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CAACCAGAAGGATGGCCCACC	0.537													35	63	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184070571	184070571	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184070571A>G	uc003foi.2	-	19	2295	c.2171T>C	c.(2170-2172)CTC>CCC	p.L724P	CLCN2_uc003foh.2_Missense_Mutation_p.L248P|CLCN2_uc010hya.1_Missense_Mutation_p.L707P|CLCN2_uc011brl.1_Missense_Mutation_p.L724P|CLCN2_uc011brm.1_Missense_Mutation_p.L680P	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	724	Cytoplasmic (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	GAGGCTCCGGAGGGCGATGCC	0.602													5	31	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195538680	195538680	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195538680C>T	uc011bto.1	-	1	469	c.9G>A	c.(7-9)GGG>GGA	p.G3G	MUC4_uc003fvo.2_Silent_p.G3G|MUC4_uc003fvp.2_Silent_p.G3G|MUC4_uc010hzv.2_RNA	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	3					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCCAGCGTGCCCCCTTCATGG	0.657													23	45	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197557694	197557694	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197557694A>G	uc011bul.1	+	7	946	c.941A>G	c.(940-942)AAT>AGT	p.N314S	LRCH3_uc003fyj.1_Missense_Mutation_p.N314S|LRCH3_uc011bum.1_Missense_Mutation_p.N314S|LRCH3_uc011bun.1_Missense_Mutation_p.N188S|LRCH3_uc003fyk.2_5'UTR	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	314						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TCAGGCTTCAATAGTGTGGAC	0.393													12	99	---	---	---	---	PASS
ZNF721	170960	broad.mit.edu	37	4	436881	436881	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:436881G>T	uc003gag.2	-	3	2066	c.1375C>A	c.(1375-1377)CAC>AAC	p.H459N	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Missense_Mutation_p.H491N|ZNF721_uc010ibe.2_Missense_Mutation_p.H447N	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	459						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TTATTCAGGTGCAAGGAATGT	0.348													3	46	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47944154	47944154	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47944154T>A	uc003gxt.3	-	9	727	c.461A>T	c.(460-462)GAA>GTA	p.E154V	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.E223V	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	154	Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						AACCACAACTTCTTTCTTCTC	0.383													18	50	---	---	---	---	PASS
MUC7	4589	broad.mit.edu	37	4	71346978	71346978	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71346978T>C	uc011cat.1	+	4	805	c.517T>C	c.(517-519)TCT>CCT	p.S173P	MUC7_uc011cau.1_Missense_Mutation_p.S173P|MUC7_uc003hfj.2_Missense_Mutation_p.S173P|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	173	1.|Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			ACCCACACCTTCTGCAACTAC	0.522													4	127	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73148927	73148927	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73148927C>T	uc003hgk.1	-	22	3581	c.3544G>A	c.(3544-3546)GCA>ACA	p.A1182T		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1182					collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGGTTCTTGCCTGAGAAGAA	0.463													4	156	---	---	---	---	PASS
FAM134B	54463	broad.mit.edu	37	5	16474802	16474802	+	3'UTR	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16474802G>T	uc003jfs.2	-	9					FAM134B_uc003jfr.2_3'UTR	NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						tttcttgtttGAAATTTTTTT	0.279													9	97	---	---	---	---	PASS
ARSB	411	broad.mit.edu	37	5	78264880	78264880	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78264880T>A	uc003kfq.2	-	2	1734	c.448A>T	c.(448-450)ATG>TTG	p.M150L	ARSB_uc003kfr.3_Missense_Mutation_p.M150L	NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor	150					lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TTCCGGTACATTCCCAGGTGC	0.468													10	250	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118560454	118560454	+	Silent	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118560454T>C	uc003ksd.2	+	37	8446	c.8265T>C	c.(8263-8265)ACT>ACC	p.T2755T	DMXL1_uc010jcl.1_Silent_p.T2776T|DMXL1_uc010jcm.1_RNA	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2755	WD 11.									ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CTCATCCAACTCTTCCTTACT	0.249													35	77	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153149881	153149881	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153149881A>T	uc003lva.3	+	13	2541	c.2176A>T	c.(2176-2178)ATT>TTT	p.I726F	GRIA1_uc003luy.3_Missense_Mutation_p.I726F|GRIA1_uc003luz.3_Missense_Mutation_p.I631F|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.I646F|GRIA1_uc011dcx.1_Missense_Mutation_p.I657F|GRIA1_uc011dcy.1_Missense_Mutation_p.I736F|GRIA1_uc011dcz.1_Missense_Mutation_p.I736F	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	726	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GAATGAGTACATTGAGCAGCG	0.512													15	47	---	---	---	---	PASS
RARS	5917	broad.mit.edu	37	5	167927655	167927655	+	Silent	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167927655A>T	uc003lzx.2	+	8	923	c.882A>T	c.(880-882)GTA>GTT	p.V294V	RARS_uc011deo.1_Silent_p.V88V	NM_002887	NP_002878	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	294					arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		ATCAGTGTGTAGTTCTGCTCC	0.388													15	43	---	---	---	---	PASS
ZNF354B	117608	broad.mit.edu	37	5	178293302	178293302	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178293302C>T	uc003mjl.2	+	3	317	c.91C>T	c.(91-93)CTG>TTG	p.L31L	ZNF354B_uc003mjm.2_Silent_p.L31L	NM_058230	NP_478137	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	31	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGGAGAAAGCTGGCTCCTTC	0.507													34	82	---	---	---	---	PASS
SLC35B3	51000	broad.mit.edu	37	6	8422803	8422803	+	Silent	SNP	C	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8422803C>G	uc010joe.2	-	5	640	c.474G>C	c.(472-474)GGG>GGC	p.G158G	SLC35B3_uc003mya.2_Silent_p.G126G|SLC35B3_uc003myc.2_Intron|SLC35B3_uc003myb.2_Silent_p.G158G|SLC35B3_uc011did.1_Silent_p.G158G|SLC35B3_uc003myd.2_RNA	NM_001142541	NP_001136013	Q9H1N7	S35B3_HUMAN	solute carrier family 35, member B3	158	Helical; (Potential).				transmembrane transport	Golgi membrane|integral to membrane					0	Ovarian(93;0.0569)					TGTTTGATAACCCCATAGTAC	0.373													7	94	---	---	---	---	PASS
BTN2A3	54718	broad.mit.edu	37	6	26431309	26431309	+	Silent	SNP	C	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26431309C>G	uc011dkl.1	+	6	1257	c.1227C>G	c.(1225-1227)CTC>CTG	p.L409L	BTN2A3_uc011dkm.1_Intron					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						AGTGGATTCTCTCTCTGGAGG	0.507													7	84	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38903367	38903367	+	Splice_Site	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38903367G>A	uc003ooe.1	+	75	11407	c.10807_splice	c.e75-1	p.E3603_splice	DNAH8_uc003oog.1_Splice_Site_p.E52_splice|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTTAATGACAGGAGTTAGAGG	0.303													15	331	---	---	---	---	PASS
CUL7	9820	broad.mit.edu	37	6	43020004	43020004	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43020004A>C	uc003otq.2	-	2	826	c.523T>G	c.(523-525)TAT>GAT	p.Y175D	CUL7_uc011dvb.1_Missense_Mutation_p.Y227D|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	175					interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CGAATCTGATAATCAGGACTA	0.572													18	41	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102503283	102503283	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102503283A>G	uc003pqp.3	+	15	2639	c.2390A>G	c.(2389-2391)AAA>AGA	p.K797R	GRIK2_uc003pqo.3_Missense_Mutation_p.K797R|GRIK2_uc010kcw.2_Missense_Mutation_p.K797R	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	797	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	ATGAAGGAGAAATGGTGGAGG	0.483													32	107	---	---	---	---	PASS
EIF3B	8662	broad.mit.edu	37	7	2404084	2404084	+	Silent	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2404084A>G	uc003slx.2	+	6	1160	c.1077A>G	c.(1075-1077)CTA>CTG	p.L359L	EIF3B_uc003sly.2_Silent_p.L359L|EIF3B_uc003slz.1_Silent_p.L320L|EIF3B_uc003sma.2_Silent_p.L87L	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	359	Sufficient for interaction with EIF3E.|WD 1.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GCATTGCTCTATGGGGGGGAG	0.478													33	106	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71177037	71177037	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71177037G>A	uc003tvy.2	+	11	1703	c.1703G>A	c.(1702-1704)TGC>TAC	p.C568Y	WBSCR17_uc003tvz.2_Missense_Mutation_p.C267Y	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	568	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ACGGGACGCTGCCTGGAGGTG	0.453													47	98	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71177038	71177038	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71177038C>T	uc003tvy.2	+	11	1704	c.1704C>T	c.(1702-1704)TGC>TGT	p.C568C	WBSCR17_uc003tvz.2_Silent_p.C267C	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	568	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CGGGACGCTGCCTGGAGGTGG	0.458													47	95	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92734091	92734091	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92734091C>A	uc003umf.2	-	3	1576	c.1320G>T	c.(1318-1320)TTG>TTT	p.L440F	SAMD9_uc003umg.2_Missense_Mutation_p.L440F	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	440						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GATCAAACTCCAATACAGCAA	0.353													3	59	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100486204	100486204	+	3'UTR	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100486204T>C	uc003uwy.2	+	21					SRRT_uc010lhl.1_3'UTR|SRRT_uc003uxa.2_3'UTR|SRRT_uc003uwz.2_3'UTR|uc010lhm.1_5'Flank	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a						cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						GTATCATCCATACTTGTACTA	0.483													18	27	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142568355	142568355	+	Silent	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142568355A>T	uc011kst.1	+	19	3661	c.2874A>T	c.(2872-2874)TCA>TCT	p.S958S	EPHB6_uc011ksu.1_Silent_p.S958S|EPHB6_uc003wbs.2_Silent_p.S666S|EPHB6_uc003wbt.2_Silent_p.S432S|EPHB6_uc003wbu.2_Silent_p.S666S|EPHB6_uc003wbv.2_Silent_p.S342S	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	958	SAM.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					CCTGGCTTTCAGCCATTGGAC	0.582													6	129	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150697631	150697631	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150697631C>T	uc003wif.2	+	10	1473	c.1177C>T	c.(1177-1179)CTG>TTG	p.L393L	NOS3_uc011kuy.1_Silent_p.L187L|NOS3_uc011kuz.1_Silent_p.L393L|NOS3_uc011kva.1_Silent_p.L393L|NOS3_uc011kvb.1_Silent_p.L393L	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	393	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CACCTCGTCCCTGTGGAAAGA	0.602													4	45	---	---	---	---	PASS
ABCB8	11194	broad.mit.edu	37	7	150730799	150730799	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150730799C>A	uc003wil.3	+	3	347	c.254C>A	c.(253-255)CCC>CAC	p.P85H	ABCB8_uc003wii.2_Missense_Mutation_p.P105H|ABCB8_uc003wij.3_Missense_Mutation_p.P68H|ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Missense_Mutation_p.P68H|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Missense_Mutation_p.P68H	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	85						ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGATGGAGCCCCTCTGCCTGG	0.687													6	86	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151684336	151684336	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151684336G>A	uc003wkp.2	+	5	851	c.628G>A	c.(628-630)GCA>ACA	p.A210T	GALNTL5_uc003wkq.2_Intron|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Missense_Mutation_p.A99T	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	210	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GCTGATTCGAGCAAGGCTGAT	0.453													11	46	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10465375	10465375	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10465375G>T	uc003wtc.2	-	4	6462	c.6233C>A	c.(6232-6234)GCC>GAC	p.A2078D		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2078					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CTCTGGGTGGGCCTCCCCTTC	0.642													7	146	---	---	---	---	PASS
VPS37A	137492	broad.mit.edu	37	8	17125809	17125809	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17125809T>G	uc003wxj.2	+	3	596	c.243T>G	c.(241-243)AGT>AGG	p.S81R	VPS37A_uc003wxk.2_Missense_Mutation_p.S56R	NM_152415	NP_689628	Q8NEZ2	VP37A_HUMAN	hepatocellular carcinoma related protein 1	81					cellular membrane organization|endosome transport|protein transport	centrosome|late endosome membrane|nucleus					0				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		CAGTGATCAGTGTTTATCCAC	0.348													14	119	---	---	---	---	PASS
CNTLN	54875	broad.mit.edu	37	9	17236496	17236496	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17236496C>T	uc003zmz.2	+	5	785	c.759C>T	c.(757-759)CGC>CGT	p.R253R	CNTLN_uc003zmx.3_Silent_p.R253R|CNTLN_uc003zmy.2_Silent_p.R253R|CNTLN_uc010mio.2_5'UTR	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	253						centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		TAAGTACCCGCTGCACTGACC	0.373													4	93	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500808	66500808	+	RNA	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500808T>G	uc004aed.1	+	3		c.901T>G								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						CCACCTACGGTCGGTTGTGTG	0.632													9	25	---	---	---	---	PASS
PTAR1	375743	broad.mit.edu	37	9	72338543	72338543	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72338543G>A	uc004ahj.3	-	6	668	c.646C>T	c.(646-648)CTT>TTT	p.L216F	PTAR1_uc004ahi.2_Missense_Mutation_p.L137F	NM_001099666	NP_001093136	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat	216					protein prenylation		protein prenyltransferase activity			central_nervous_system(1)	1						TCATCAAGAAGAATCTTTTAA	0.358													28	45	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104341505	104341505	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104341505C>T	uc004bbp.1	-	7	3505	c.2904G>A	c.(2902-2904)AAG>AAA	p.K968K	GRIN3A_uc004bbo.1_Silent_p.K43K|GRIN3A_uc004bbq.1_Silent_p.K968K	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	968	Cytoplasmic (Potential).|PPP2CB binding site (By similarity).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	AGTATTGCAGCTTGGATTTGT	0.483													10	75	---	---	---	---	PASS
LPAR1	1902	broad.mit.edu	37	9	113704047	113704047	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113704047C>T	uc004bfa.2	-	4	702	c.447G>A	c.(445-447)ACG>ACA	p.T149T	LPAR1_uc011lwm.1_Silent_p.T150T|LPAR1_uc004bfb.2_Silent_p.T149T|LPAR1_uc004bfc.2_Silent_p.T149T|LPAR1_uc011lwn.1_Silent_p.T131T|LPAR1_uc011lwo.1_Silent_p.T150T|LPAR1_uc010mub.2_Silent_p.T149T	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	149	Cytoplasmic (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						TGCGGAAAACCGTAATGTGCC	0.542													7	108	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123900914	123900914	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123900914A>T	uc004bkx.1	+	14	2325	c.2294A>T	c.(2293-2295)GAG>GTG	p.E765V	CEP110_uc004bky.1_Missense_Mutation_p.E369V|CEP110_uc004bkz.1_Missense_Mutation_p.E213V|CEP110_uc004bla.1_Missense_Mutation_p.E213V	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	765	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						GAAGAAAAGGAGCAAGAGAAC	0.418													8	56	---	---	---	---	PASS
METTL11A	28989	broad.mit.edu	37	9	132394938	132394938	+	5'UTR	SNP	G	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132394938G>C	uc004byd.1	+	2					METTL11A_uc010myw.1_RNA|METTL11A_uc011mbs.1_5'UTR	NM_014064	NP_054783	Q9BV86	NTM1A_HUMAN	methyltransferase like 11A						chromosome segregation|N-terminal peptidyl-proline dimethylation|N-terminal peptidyl-serine dimethylation|N-terminal peptidyl-serine trimethylation|spindle organization	nucleus	protein binding|protein methyltransferase activity				0						GGAGAGTCGCGGTTGCTGATC	0.587													14	21	---	---	---	---	PASS
DDX31	64794	broad.mit.edu	37	9	135537865	135537865	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135537865G>A	uc004cbq.1	-	2	760	c.608C>T	c.(607-609)TCA>TTA	p.S203L	DDX31_uc010mzu.1_Missense_Mutation_p.S203L|DDX31_uc004cbr.1_Missense_Mutation_p.S203L|DDX31_uc004cbs.1_Missense_Mutation_p.S203L	NM_022779	NP_073616	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	203						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		TTTAAACAGTGATGAAGTCTT	0.418													5	119	---	---	---	---	PASS
PFKFB3	5209	broad.mit.edu	37	10	6265943	6265943	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6265943C>T	uc001ije.2	+	12	1620	c.1236C>T	c.(1234-1236)TGC>TGT	p.C412C	PFKFB3_uc001ijd.2_Silent_p.C392C|PFKFB3_uc009xii.2_RNA|PFKFB3_uc010qaw.1_Silent_p.C426C|PFKFB3_uc001ijf.2_Silent_p.C412C|PFKFB3_uc001ijg.2_5'Flank|PFKFB3_uc009xij.2_5'Flank|PFKFB3_uc009xik.2_5'Flank|PFKFB3_uc009xil.2_5'Flank	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,	412	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						ACCTGAAATGCCCTCTTCACA	0.423													4	137	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8100407	8100407	+	Silent	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100407G>T	uc001ika.2	+	3	938	c.381G>T	c.(379-381)CCG>CCT	p.P127P	GATA3_uc001ijz.2_Silent_p.P127P	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	127					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						ACGGCTCCCCGGGGCCCCTCT	0.716			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						4	115	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52566613	52566613	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52566613G>A	uc001jjj.2	-	13	1849	c.1661C>T	c.(1660-1662)CCC>CTC	p.P554L	A1CF_uc010qhn.1_Missense_Mutation_p.P554L|A1CF_uc001jji.2_Missense_Mutation_p.P546L|A1CF_uc001jjh.2_Missense_Mutation_p.P554L|A1CF_uc010qho.1_Missense_Mutation_p.P562L|A1CF_uc009xov.2_Missense_Mutation_p.P546L	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	554					cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TGCAGACACGGGTGCAGTTGC	0.473													24	92	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72629616	72629616	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72629616C>T	uc001jrm.2	+	9	994	c.772C>T	c.(772-774)CGG>TGG	p.R258W	SGPL1_uc009xqk.2_RNA	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	258	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	GAAGATTGTGCGGGTCCCATT	0.537													4	103	---	---	---	---	PASS
SYNPO2L	79933	broad.mit.edu	37	10	75406857	75406857	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75406857C>T	uc001jut.3	-	4	2705	c.2553G>A	c.(2551-2553)CGG>CGA	p.R851R	SYNPO2L_uc001jus.3_Silent_p.R627R	NM_001114133	NP_001107605	Q9H987	SYP2L_HUMAN	synaptopodin 2-like isoform a	851	Pro-rich.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)					AGGGCTGATGCCGCATAAAAT	0.582													4	164	---	---	---	---	PASS
ACTR1A	10121	broad.mit.edu	37	10	104245491	104245491	+	Splice_Site	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104245491C>T	uc001kvv.2	-	5	424	c.316_splice	c.e5-1	p.H106_splice	ACTR1A_uc010qqn.1_Splice_Site_p.H32_splice|ACTR1A_uc010qqo.1_Splice_Site_p.H59_splice	NM_005736	NP_005727	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A,						G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding			central_nervous_system(1)	1		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GCACAGGATGCTGGTGAAAGG	0.542													4	231	---	---	---	---	PASS
ECHS1	1892	broad.mit.edu	37	10	135184121	135184121	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135184121C>T	uc001lmu.2	-	2	300	c.229G>A	c.(229-231)GAG>AAG	p.E77K		NM_004092	NP_004083	P30084	ECHM_HUMAN	mitochondrial short-chain enoyl-coenzyme A	77					fatty acid beta-oxidation	mitochondrial matrix	enoyl-CoA hydratase activity|protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		GGGTCCTCCTCGAAGGTCTTC	0.617													7	25	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17191040	17191040	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17191040G>A	uc001mmq.3	-	1	315	c.249C>T	c.(247-249)TCC>TCT	p.S83S	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Silent_p.S83S|PIK3C2A_uc009ygv.1_Silent_p.S83S	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	83	Interaction with clathrin.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	CTCTTTTTTGGGAATCTGATT	0.383													5	285	---	---	---	---	PASS
EHD1	10938	broad.mit.edu	37	11	64645859	64645859	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64645859C>T	uc001obu.1	-	1	333	c.78G>A	c.(76-78)CGG>CGA	p.R26R	EHD1_uc001obv.1_Silent_p.R26R|EHD1_uc010rnq.1_Silent_p.R40R	NM_006795	NP_006786	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	26					blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding				0						CGTACAGCTGCCGCAGCCCCT	0.597													13	31	---	---	---	---	PASS
FOLR2	2350	broad.mit.edu	37	11	71927885	71927885	+	5'UTR	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71927885C>T	uc009ytd.2	+	1					FOLR2_uc009yte.2_5'UTR|FOLR2_uc001ose.3_5'UTR|FOLR2_uc009ytf.2_5'UTR	NM_001113534	NP_001107006	P14207	FOLR2_HUMAN	folate receptor 2 precursor						folic acid transport	anchored to membrane|extracellular region|membrane fraction|plasma membrane	folic acid binding|receptor activity			breast(2)|ovary(1)	3					Folic Acid(DB00158)	GTGGGGACAGCCTAGGGGCCT	0.547													6	18	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059909	119059909	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059909G>C	uc001pwb.2	+	8	2205	c.1681G>C	c.(1681-1683)GCA>CCA	p.A561P	PDZD3_uc001pvy.2_Missense_Mutation_p.A481P|PDZD3_uc001pvz.2_Missense_Mutation_p.A495P|PDZD3_uc010rzd.1_Missense_Mutation_p.A482P|PDZD3_uc001pwa.2_Missense_Mutation_p.A191P			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	561					cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CCCTGGGGCTGCAGAGGTGAG	0.612													7	12	---	---	---	---	PASS
PPFIBP1	8496	broad.mit.edu	37	12	27824429	27824429	+	Silent	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27824429T>C	uc001ric.1	+	14	1640	c.1263T>C	c.(1261-1263)ACT>ACC	p.T421T	PPFIBP1_uc010sjr.1_Silent_p.T252T|PPFIBP1_uc001rib.1_Silent_p.T404T|PPFIBP1_uc001ria.2_Silent_p.T390T|PPFIBP1_uc001rid.1_Silent_p.T268T	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1	421					cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					GCATGGAAACTTCTGAAAAAT	0.323													45	62	---	---	---	---	PASS
IKBIP	121457	broad.mit.edu	37	12	99007278	99007278	+	3'UTR	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99007278A>T	uc001tfv.2	-	3					IKBIP_uc001tfw.2_3'UTR	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2						induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						TTTTGCTCCAAAATATCATTA	0.244													3	25	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104071251	104071251	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104071251C>T	uc001tjw.2	+	25	2853	c.2667C>T	c.(2665-2667)GGC>GGT	p.G889G		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	889	Extracellular (Potential).|EGF-like 8.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TCAAAACTGGCACGGGCACCC	0.537													55	126	---	---	---	---	PASS
FICD	11153	broad.mit.edu	37	12	108912598	108912598	+	Silent	SNP	G	T	T	rs142218882	byFrequency	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108912598G>T	uc001tmx.1	+	3	869	c.723G>T	c.(721-723)TCG>TCT	p.S241S		NM_007076	NP_009007	Q9BVA6	FICD_HUMAN	Huntingtin interacting protein E	241					negative regulation of Rho GTPase activity	integral to membrane	binding|protein adenylyltransferase activity				0						TCACCCTCTCGGAAATCAGGC	0.587													3	44	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125438720	125438720	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125438720T>C	uc001ugy.2	-	19	2590	c.2491A>G	c.(2491-2493)AGC>GGC	p.S831G	DHX37_uc001ugz.1_5'Flank	NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	831							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCCCGCTTGCTCTTCAGCCTG	0.662													15	32	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547093	132547093	+	Silent	SNP	A	G	G	rs28513925	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547093A>G	uc001ujn.2	+	46	8216	c.8181A>G	c.(8179-8181)CAA>CAG	p.Q2727Q	EP400_uc001ujl.2_Silent_p.Q2726Q|EP400_uc001ujm.2_Silent_p.Q2646Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.294													5	33	---	---	---	---	PASS
NOC4L	79050	broad.mit.edu	37	12	132636049	132636049	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132636049T>C	uc001ujz.1	+	12	1135	c.1094T>C	c.(1093-1095)GTG>GCG	p.V365A		NM_024078	NP_076983	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog	365	Helical; (Potential).				rRNA processing	integral to membrane|nuclear membrane|nucleolus	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		GCCTACCTGGTGGCCGCCTTC	0.716													6	12	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19409453	19409453	+	RNA	SNP	T	C	C	rs138555198	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19409453T>C	uc010tcj.1	-	1		c.36657A>G				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						TCAACATGTATCCAGAACCAA	0.209													8	13	---	---	---	---	PASS
NUPL1	9818	broad.mit.edu	37	13	25899186	25899186	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25899186T>G	uc001uqi.2	+	10	1257	c.1011T>G	c.(1009-1011)CAT>CAG	p.H337Q	NUPL1_uc001uqg.1_Missense_Mutation_p.H337Q|NUPL1_uc001uqj.2_Missense_Mutation_p.H325Q	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	337	14 X 2 AA repeats of F-G.|Potential.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		GACTTCAACATGAATATGCAG	0.328													37	115	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103528030	103528030	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103528030T>C	uc001vpw.2	+	15	3781	c.3338T>C	c.(3337-3339)GTA>GCA	p.V1113A		NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	1113					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TTAATGAATGTACAAAGGAGA	0.468			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				19	52	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23549554	23549554	+	Silent	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23549554G>T	uc001wit.3	-	6	1492	c.1164C>A	c.(1162-1164)TCC>TCA	p.S388S	ACIN1_uc001wis.3_Silent_p.S70S|ACIN1_uc010akg.2_Silent_p.S388S|ACIN1_uc010tnj.1_Silent_p.S348S	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	388	Glu-rich.				apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GTCGAGGAGGGGAAGGAGACT	0.473													4	43	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65241143	65241143	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65241143C>T	uc001xht.2	-	23	4999	c.4945G>A	c.(4945-4947)GGC>AGC	p.G1649S	SPTB_uc001xhr.2_Missense_Mutation_p.G1649S|SPTB_uc001xhs.2_Missense_Mutation_p.G1649S|SPTB_uc001xhu.2_Missense_Mutation_p.G1649S|SPTB_uc010aqi.2_Missense_Mutation_p.G310S	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1649	Spectrin 13.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GACAGCAGGCCCTGGGCCCGG	0.667													2	1	---	---	---	---	PASS
RDH11	51109	broad.mit.edu	37	14	68151823	68151823	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68151823A>G	uc001xjv.3	-	6	853	c.763T>C	c.(763-765)TTT>CTT	p.F255L	RDH11_uc001xjw.3_Missense_Mutation_p.F242L|RDH11_uc001xjx.3_Missense_Mutation_p.F185L	NM_016026	NP_057110	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11	255	Cytoplasmic (Potential).				retinol metabolic process|steroid metabolic process	endoplasmic reticulum membrane|integral to membrane	binding|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(1)	1				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	TTGATGAAAAAGGAGAAAAGC	0.488													25	39	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75248501	75248501	+	Silent	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75248501A>T	uc001xqj.3	+	4	1879	c.1755A>T	c.(1753-1755)GCA>GCT	p.A585A	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	386	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TCTCTTCTGCAGGGCCACCAC	0.597													34	77	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92499570	92499570	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92499570T>G	uc001xzy.2	-	2	955	c.167A>C	c.(166-168)GAA>GCA	p.E56A	TRIP11_uc001xzz.3_RNA	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	56	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		GGCTTCAATTTCCTTTGTCCT	0.284			T	PDGFRB	AML								20	88	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25959134	25959134	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25959134C>T	uc010ayu.2	-	10	2137	c.2031G>A	c.(2029-2031)TGG>TGA	p.W677*		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	677	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCTCCGAGGCCCAGTTGTCCG	0.682													7	36	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40917367	40917367	+	Silent	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40917367A>G	uc010bbs.1	+	11	5144	c.4983A>G	c.(4981-4983)CTA>CTG	p.L1661L	CASC5_uc010ucq.1_Silent_p.L1485L|CASC5_uc001zme.2_Silent_p.L1635L|CASC5_uc010bbt.1_Silent_p.L1635L	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1661					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		CCACCTCTCTACCGCCAAAGA	0.353													3	166	---	---	---	---	PASS
LCMT2	9836	broad.mit.edu	37	15	43621597	43621597	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43621597A>G	uc001zrg.2	-	1	1295	c.1091T>C	c.(1090-1092)TTC>TCC	p.F364S	LCMT2_uc010udn.1_5'UTR|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	364					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	TGGGCTCAAGAAGACAGAGGC	0.562													6	48	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49293222	49293222	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49293222G>T	uc001zxe.1	-	15	2234	c.2100C>A	c.(2098-2100)TTC>TTA	p.F700L	SECISBP2L_uc001zxd.1_Missense_Mutation_p.F655L|SECISBP2L_uc010bep.1_Missense_Mutation_p.F462L	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	700										breast(1)|skin(1)	2						TGCGTTCCTGGAAACTGACAA	0.373													32	65	---	---	---	---	PASS
MAN2A2	4122	broad.mit.edu	37	15	91449980	91449980	+	Silent	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91449980C>A	uc010bnz.2	+	7	961	c.846C>A	c.(844-846)CCC>CCA	p.P282P	MAN2A2_uc010boa.2_Silent_p.P324P|MAN2A2_uc002bqc.2_Silent_p.P282P|MAN2A2_uc010uql.1_5'UTR|MAN2A2_uc010uqm.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	282	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GTGCAACCCCCCGCTCTGGCT	0.647													7	34	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1570643	1570643	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1570643A>T	uc002cmb.2	-	27	3982	c.3620T>A	c.(3619-3621)CTG>CAG	p.L1207Q	IFT140_uc002clz.2_Missense_Mutation_p.L820Q	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1207	TPR 8.									ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				CTTGGTGGCCAGGTGGTAGCT	0.672													4	6	---	---	---	---	PASS
ATF7IP2	80063	broad.mit.edu	37	16	10524764	10524764	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10524764T>G	uc002czu.2	+	3	514	c.287T>G	c.(286-288)ATA>AGA	p.I96R	ATF7IP2_uc002czv.2_Missense_Mutation_p.I96R|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.I96R|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	96					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						CAGAATTGCATAAAACCAGTA	0.353													33	49	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31374291	31374291	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31374291G>A	uc002ebu.1	+	13	1462	c.1395G>A	c.(1393-1395)GTG>GTA	p.V465V	ITGAX_uc002ebt.2_Silent_p.V465V|ITGAX_uc010vfk.1_Silent_p.V115V	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	465	FG-GAP 5.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TCTGCTCCGTGGACGTAGACA	0.672													11	138	---	---	---	---	PASS
C16orf78	123970	broad.mit.edu	37	16	49407979	49407979	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49407979G>A	uc002efr.2	+	1	172	c.129G>A	c.(127-129)GGG>GGA	p.G43G		NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970	43										central_nervous_system(1)	1						GGAGGCAGGGGAAGAAGAAAC	0.368													9	89	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195481	3195481	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195481G>A	uc002fvh.1	-	1	396	c.396C>T	c.(394-396)CCC>CCT	p.P132P		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	132	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						TGTAGGTGAGGGGCCGGCAGA	0.592													30	87	---	---	---	---	PASS
GSG2	83903	broad.mit.edu	37	17	3629541	3629541	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3629541A>G	uc002fwp.2	+	1	2345	c.2312A>G	c.(2311-2313)AAG>AGG	p.K771R	ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin	771	Protein kinase.				cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						AAGCAAATTAAGAGAAAAATC	0.408													19	37	---	---	---	---	PASS
ACADVL	37	broad.mit.edu	37	17	7125374	7125374	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7125374C>T	uc002gev.2	+	8	877	c.726C>T	c.(724-726)ACC>ACT	p.T242T	DLG4_uc002get.3_5'Flank|DLG4_uc010vto.1_5'Flank|ACADVL_uc010vtp.1_Silent_p.T252T|ACADVL_uc010vtq.1_Silent_p.T288T|ACADVL_uc002gew.2_Silent_p.T220T|ACADVL_uc002gex.2_Silent_p.T166T	NM_000018	NP_000009	P49748	ACADV_HUMAN	acyl-Coenzyme A dehydrogenase, very long chain	242	Catalytic.				energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial inner membrane|mitochondrial nucleoid	long-chain-acyl-CoA dehydrogenase activity			ovary(3)	3						AATACTATACCCTCAATGGAA	0.592													36	85	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7696461	7696461	+	Missense_Mutation	SNP	C	A	A	rs139846922		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7696461C>A	uc002giu.1	+	47	7521	c.7507C>A	c.(7507-7509)CGC>AGC	p.R2503S		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2503	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GGAGCTGATCCGCCTCTGGAT	0.522													4	82	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11701032	11701032	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11701032T>C	uc002gne.2	+	43	8410	c.8342T>C	c.(8341-8343)CTG>CCG	p.L2781P	DNAH9_uc010coo.2_Missense_Mutation_p.L2075P	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2781					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACCCAGACTCTGGTGGAGGCC	0.498													28	49	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11835416	11835416	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11835416G>A	uc002gne.2	+	64	12259	c.12191G>A	c.(12190-12192)AGA>AAA	p.R4064K	DNAH9_uc010coo.2_Missense_Mutation_p.R3282K|DNAH9_uc002gnf.2_Missense_Mutation_p.R376K	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4064	AAA 6 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTGGCAGAAAGACGAAAATTT	0.493													70	186	---	---	---	---	PASS
HNF1B	6928	broad.mit.edu	37	17	36091725	36091725	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36091725G>C	uc002hok.3	-	4	1127	c.906C>G	c.(904-906)AAC>AAG	p.N302K	HNF1B_uc010wdi.1_Missense_Mutation_p.N276K|HNF1B_uc010cve.1_Missense_Mutation_p.N110K	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	302	Homeobox; HNF1-type.				endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CCTTCCTGCGGTTTGCAAACC	0.612									Hereditary_Prostate_Cancer				40	74	---	---	---	---	PASS
LASP1	3927	broad.mit.edu	37	17	37026398	37026398	+	5'UTR	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37026398A>T	uc002hra.2	+	1					LASP1_uc010wdy.1_5'UTR|LASP1_uc010cvq.2_5'UTR|LASP1_uc010wdz.1_5'UTR	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1							cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						GGGGAACAGGACGCGCGTGAG	0.692			T	MLL	AML								7	20	---	---	---	---	PASS
CA4	762	broad.mit.edu	37	17	58234007	58234007	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58234007C>T	uc002iym.3	+	3	293	c.199C>T	c.(199-201)CTG>TTG	p.L67L	CA4_uc010wou.1_RNA	NM_000717	NP_000708	P22748	CAH4_HUMAN	carbonic anhydrase IV precursor	67					bicarbonate transport|one-carbon metabolic process	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	GGACAAAAAACTGGGACGCTT	0.567													26	62	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73736440	73736440	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73736440G>A	uc002jpg.2	+	21	2635	c.2448G>A	c.(2446-2448)GTG>GTA	p.V816V	ITGB4_uc002jph.2_Silent_p.V816V|ITGB4_uc010dgo.2_Silent_p.V816V|ITGB4_uc002jpi.3_Silent_p.V816V|ITGB4_uc010dgp.1_Silent_p.V816V|ITGB4_uc002jpj.2_Silent_p.V816V	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	816	Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTTCCTTAGTGCCCTACGGGC	0.647													16	31	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5406847	5406847	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5406847A>T	uc002kmt.1	-	16	2364	c.2278T>A	c.(2278-2280)TCC>ACC	p.S760T	EPB41L3_uc010wzh.1_Missense_Mutation_p.S591T|EPB41L3_uc002kmu.1_Missense_Mutation_p.S579T|EPB41L3_uc010dkq.1_Missense_Mutation_p.S470T|EPB41L3_uc002kms.1_Missense_Mutation_p.S32T|EPB41L3_uc010wze.1_Missense_Mutation_p.S32T|EPB41L3_uc010wzf.1_Missense_Mutation_p.S32T|EPB41L3_uc010wzg.1_Missense_Mutation_p.S32T|EPB41L3_uc010dkr.2_Missense_Mutation_p.S152T	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	760	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GGGGAGGTGGAAAGCCTCTTC	0.522													53	97	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14542921	14542921	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14542921G>A	uc010dln.2	-	1	679	c.225C>T	c.(223-225)AGC>AGT	p.S75S	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	75										skin(3)	3						TGCTCGTGCCGCTCCCCCTGC	0.567													13	489	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43492338	43492338	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43492338G>A	uc002lbm.2	-	22	4000	c.3900C>T	c.(3898-3900)GTC>GTT	p.V1300V	KIAA1632_uc002lbo.1_Silent_p.V1300V|KIAA1632_uc010xcq.1_5'UTR|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Silent_p.V175V	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1300					autophagy						0						CAGAAGGTGTGACCAGAGCCT	0.547													31	61	---	---	---	---	PASS
SERPINB7	8710	broad.mit.edu	37	18	61449743	61449743	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61449743C>A	uc002ljl.2	+	2	233	c.137C>A	c.(136-138)GCT>GAT	p.A46D	SERPINB7_uc002ljm.2_Missense_Mutation_p.A46D|SERPINB7_uc010xet.1_Missense_Mutation_p.A46D|SERPINB7_uc010dqg.2_Missense_Mutation_p.A46D	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	46					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				CGCTTGGGCGCTCAAGATGAC	0.468													5	99	---	---	---	---	PASS
SERPINB7	8710	broad.mit.edu	37	18	61449744	61449744	+	Silent	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61449744T>C	uc002ljl.2	+	2	234	c.138T>C	c.(136-138)GCT>GCC	p.A46A	SERPINB7_uc002ljm.2_Silent_p.A46A|SERPINB7_uc010xet.1_Silent_p.A46A|SERPINB7_uc010dqg.2_Silent_p.A46A	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	46					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				GCTTGGGCGCTCAAGATGACT	0.473													4	97	---	---	---	---	PASS
OR7A5	26659	broad.mit.edu	37	19	14938974	14938974	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938974A>G	uc002mzw.2	-	1	303	c.80T>C	c.(79-81)CTC>CCC	p.L27P	OR7A5_uc010xoa.1_Missense_Mutation_p.L27P	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2						CAGCCCAAAGAGGAAGGGTTG	0.478													27	41	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41937131	41937131	+	Intron	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41937131C>A	uc010xvw.1	+						B3GNT8_uc002oqs.2_5'Flank			P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CAAACCAATCCTGGAATCCTA	0.398													21	51	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49897747	49897747	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49897747C>T	uc002pnm.1	+	3	232	c.58C>T	c.(58-60)CGG>TGG	p.R20W	CCDC155_uc002pnl.1_Missense_Mutation_p.R20W|CCDC155_uc010emx.1_5'UTR	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	20						integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						CCTCCGGGAGCGGCCTGAGGA	0.607													12	105	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760026	54760026	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760026G>A	uc002qex.2	-	4	646	c.535C>T	c.(535-537)CTG>TTG	p.L179L	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.L170L|LILRB5_uc002qey.2_Silent_p.L179L|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Intron|LILRB5_uc010yes.1_Intron	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	179	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACAGGGAACAGGGCCTGGGAT	0.552													36	62	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55451068	55451068	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55451068C>T	uc002qih.3	-	4	1195	c.1119G>A	c.(1117-1119)CTG>CTA	p.L373L	NLRP7_uc002qig.3_Silent_p.L373L|NLRP7_uc002qii.3_Silent_p.L373L|NLRP7_uc010esk.2_Silent_p.L373L|NLRP7_uc010esl.2_Silent_p.L401L	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	373	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TCTGCAGCTTCAGAGTCGTGC	0.662													4	46	---	---	---	---	PASS
ZNF419	79744	broad.mit.edu	37	19	58005254	58005254	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58005254G>A	uc002qov.2	+	5	1569	c.1329G>A	c.(1327-1329)ATG>ATA	p.M443I	ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Missense_Mutation_p.M444I|ZNF419_uc010etz.1_Missense_Mutation_p.M431I|ZNF419_uc010eua.1_Missense_Mutation_p.M430I|ZNF419_uc002qow.2_Missense_Mutation_p.M411I|ZNF419_uc010eub.1_Missense_Mutation_p.M398I|ZNF419_uc010euc.1_Missense_Mutation_p.M397I	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2	443	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		CAACCCTCATGCAACATCGAA	0.423													38	122	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58601733	58601733	+	5'UTR	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58601733G>T	uc002qri.2	-	2					ZSCAN18_uc002qrj.3_5'UTR|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_5'UTR|ZSCAN18_uc010yht.1_Missense_Mutation_p.P24T|ZSCAN18_uc002qrk.1_5'UTR|ZSCAN18_uc002qrl.2_5'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GTGGGCTCAGGTGGTGCCAGA	0.582													7	14	---	---	---	---	PASS
C20orf4	25980	broad.mit.edu	37	20	34828159	34828159	+	Silent	SNP	G	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34828159G>C	uc002xfc.1	+	2	462	c.369G>C	c.(367-369)GGG>GGC	p.G123G	C20orf4_uc002xfd.1_Silent_p.G123G|C20orf4_uc002xfe.1_Silent_p.G123G	NM_015511	NP_056326	Q9Y312	CT004_HUMAN	hypothetical protein LOC25980	123											0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)				AGTTCCTGGGGCCTTACCCAT	0.582													32	97	---	---	---	---	PASS
RPN2	6185	broad.mit.edu	37	20	35842239	35842239	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35842239G>T	uc002xgp.2	+	9	1367	c.1063G>T	c.(1063-1065)GAC>TAC	p.D355Y	RPN2_uc002xgo.3_Missense_Mutation_p.D355Y|RPN2_uc010gfw.2_Missense_Mutation_p.D198Y|RPN2_uc002xgq.2_Missense_Mutation_p.D323Y	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	355	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AGTTGAAGGTGACAACCGGTA	0.373													26	74	---	---	---	---	PASS
MC3R	4159	broad.mit.edu	37	20	54824370	54824370	+	Silent	SNP	C	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54824370C>A	uc002xxb.2	+	1	583	c.471C>A	c.(469-471)ACC>ACA	p.T157T		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	194	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			GCATCATGACCGTGAGGAAGG	0.582													45	99	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31740473	31740473	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31740473C>T	uc003akq.2	-	1	1777	c.1116G>A	c.(1114-1116)CGG>CGA	p.R372R	PATZ1_uc003akp.2_Silent_p.R372R|PATZ1_uc003akr.2_Silent_p.R372R|PATZ1_uc003aks.2_Silent_p.R372R|uc003akt.2_5'Flank	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	372	C2H2-type 2.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						ACAGCTTGTGCCGGTTAAGAT	0.582													6	169	---	---	---	---	PASS
WWC3	55841	broad.mit.edu	37	X	10085338	10085338	+	Silent	SNP	C	T	T	rs148094144		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10085338C>T	uc004csx.3	+	11	1437	c.1239C>T	c.(1237-1239)TTC>TTT	p.F413F	WWC3_uc010nds.2_Silent_p.F77F|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	413	Ser-rich.									ovary(4)	4						TTCTACGCTTCGACCTCATTC	0.662													19	142	---	---	---	---	PASS
HCCS	3052	broad.mit.edu	37	X	11139773	11139773	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11139773G>A	uc004cuk.2	+	7	916	c.650G>A	c.(649-651)CGT>CAT	p.R217H	HCCS_uc004cuj.2_Missense_Mutation_p.R217H|HCCS_uc004cul.1_Missense_Mutation_p.R217H	NM_005333	NP_005324	P53701	CCHL_HUMAN	holocytochrome c synthase	217			R -> C (in MCOPS7).		organ morphogenesis|oxidation-reduction process	mitochondrial inner membrane	holocytochrome-c synthase activity|metal ion binding				0						ATCATAAACCGTTGCGGGACA	0.428													51	145	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19389075	19389075	+	Splice_Site	SNP	A	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19389075A>C	uc004czk.1	-	25	3462	c.1825_splice	c.e25+1	p.E609_splice	MAP3K15_uc004czj.1_Splice_Site_p.E569_splice|MAP3K15_uc004czi.1_Splice_Site_p.E68_splice	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GGGGGCGCTCACCTGGGATGA	0.488													37	115	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23019821	23019821	+	Silent	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23019821C>T	uc004daj.2	+	1	1735	c.1647C>T	c.(1645-1647)GAC>GAT	p.D549D		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	549	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						GGAATATTGACGTATATGTAC	0.388													35	178	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23411568	23411568	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23411568T>C	uc004dal.3	+	3	1941	c.1933T>C	c.(1933-1935)TCC>CCC	p.S645P		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	645					cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						TGTAGTGGCCTCCAGAATGTT	0.418													11	171	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412535	63412535	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412535G>A	uc004dvo.2	-	2	905	c.632C>T	c.(631-633)GCC>GTC	p.A211V		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	211					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						CACCTGAGGGGCTGAGCTCAC	0.592													19	61	---	---	---	---	PASS
RGAG4	340526	broad.mit.edu	37	X	71350488	71350488	+	Silent	SNP	A	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71350488A>T	uc010nlh.1	-	1	1264	c.903T>A	c.(901-903)ATT>ATA	p.I301I	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	301										ovary(2)|skin(1)	3	Renal(35;0.156)					CACATTCGAGAATCAGCTCAT	0.498													20	270	---	---	---	---	PASS
NKRF	55922	broad.mit.edu	37	X	118723545	118723545	+	Missense_Mutation	SNP	G	T	T	rs140452307	byFrequency	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118723545G>T	uc004erq.2	-	2	2496	c.1843C>A	c.(1843-1845)CGC>AGC	p.R615S	NKRF_uc004err.2_Missense_Mutation_p.R615S	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	615	R3H.			AR -> ES (in Ref. 1; CAB56459).	negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2						CTCTCGGAGCGGGCGTAGTTT	0.443													32	140	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122561806	122561806	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122561806G>A	uc004etq.3	+	13	2185	c.1892G>A	c.(1891-1893)CGC>CAC	p.R631H	GRIA3_uc004etr.3_Missense_Mutation_p.R631H|GRIA3_uc004ets.3_RNA	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	631	Cytoplasmic (Potential).		R -> S (in MRX94; homomers have minimal or no current; heteromers have altered desensitization kinetics).		glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	CTCTCCGGGCGCATTGTTGGA	0.438													17	237	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686496	125686496	+	Silent	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686496G>A	uc004eul.2	-	1	347	c.96C>T	c.(94-96)GAC>GAT	p.D32D		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	32										skin(3)|ovary(1)	4						GCCCCTCACCGTCCGCTGCCG	0.692													10	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2538	2538	+	5'Flank	SNP	C	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2538C>T	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		CAGTATTAGAGGCACCGCCTG	0.373													3	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	10911	10911	+	RNA	SNP	G	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:10911G>A	uc004cov.3	+	1		c.334G>A			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		CAACCTATTTAGCTGTTCCCC	0.438													4	1	---	---	---	---	PASS
BMP8A	353500	broad.mit.edu	37	1	39988318	39988319	+	Intron	INS	-	TTG	TTG	rs139401553	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39988318_39988319insTTG	uc001cdi.2	+						PPIEL_uc001cdj.1_Intron|PPIEL_uc001cdk.2_Intron	NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8A precursor						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAAGGGTTTTGTTGTTGTT	0.356													4	5	---	---	---	---	
TRIT1	54802	broad.mit.edu	37	1	40307167	40307167	+	3'UTR	DEL	A	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40307167delA	uc010oiz.1	-	11					TRIT1_uc001cec.3_RNA|TRIT1_uc001ced.3_3'UTR|TRIT1_uc001cee.3_RNA|TRIT1_uc001cef.3_RNA|TRIT1_uc001ceg.3_3'UTR|TRIT1_uc001ceh.3_3'UTR|TRIT1_uc009vvv.2_3'UTR|TRIT1_uc001cei.3_3'UTR|TRIT1_uc001ceq.2_3'UTR|TRIT1_uc001cek.2_3'UTR|TRIT1_uc009vvx.2_RNA|TRIT1_uc001cel.2_RNA|TRIT1_uc001cem.2_3'UTR|TRIT1_uc001cen.2_3'UTR|TRIT1_uc001ceo.2_3'UTR|TRIT1_uc001cep.2_3'UTR	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGGTTCAAAGAAAAAAAAAAT	0.378													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62483402	62483402	+	Intron	DEL	A	-	-	rs138754411		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62483402delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						agactgtctcaaaaaaaaaaa	0.075													4	3	---	---	---	---	
ZBTB41	360023	broad.mit.edu	37	1	197141236	197141237	+	Intron	DEL	TA	-	-	rs10572836		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197141236_197141237delTA	uc001gtx.1	-						ZBTB41_uc009wyz.1_Intron	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGATTACACTATATATATCTC	0.267													4	2	---	---	---	---	
CENPF	1063	broad.mit.edu	37	1	214788429	214788429	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214788429delT	uc001hkm.2	+							NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ATCAGATGCGTTTGTCTTTTC	0.303													13	11	---	---	---	---	
C1orf57	84284	broad.mit.edu	37	1	233091296	233091296	+	Intron	DEL	A	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233091296delA	uc001hvj.1	+						C1orf57_uc001hvi.2_Intron|C1orf57_uc009xft.1_Intron	NM_032324	NP_115700	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase C1orf57								ATP binding|nucleoside-triphosphatase activity|nucleotide phosphatase activity|transferase activity				0		all_cancers(173;0.0818)|Prostate(94;0.137)				ttttttttttattttAGGAGT	0.368													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20169510	20169510	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20169510delT	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTCTTGAAttttttttttt	0.144													6	3	---	---	---	---	
C2orf7	84279	broad.mit.edu	37	2	73456796	73456796	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73456796delT	uc002siy.2	-							NM_032319	NP_115695	Q9BSG0	PADC1_HUMAN	chromosome 2 open reading frame 7 precursor							extracellular region					0						CCTTATAAAGTGTGAAGGAAA	0.234													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89495754	89495754	+	RNA	DEL	A	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89495754delA	uc010ytr.1	-	25		c.3107delT			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		AAACCAATACAAATAGGTGTA	0.532													32	18	---	---	---	---	
NPAS2	4862	broad.mit.edu	37	2	101591538	101591540	+	Intron	DEL	CTC	-	-	rs3217562		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101591538_101591540delCTC	uc002tap.1	+						NPAS2_uc010yvt.1_Intron|NPAS2_uc010fit.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						GCAGTTTATACTCCTCCTTTCCT	0.557													4	3	---	---	---	---	
RND3	390	broad.mit.edu	37	2	151343663	151343664	+	Intron	INS	-	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343663_151343664insT	uc002txe.2	-						RND3_uc002txf.2_Intron|RND3_uc002txg.2_Intron|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_5'Flank	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor						actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		CCGAGAAAGACttttttttttc	0.525													2	5	---	---	---	---	
ILKAP	80895	broad.mit.edu	37	2	239081997	239081997	+	Intron	DEL	C	-	-	rs11309913		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239081997delC	uc002vxv.2	-						ILKAP_uc010zns.1_Intron|ILKAP_uc002vxw.2_Intron	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein							cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ccccatgtgtccccccctacc	0.070													1	5	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	241992218	241992218	+	Intron	DEL	G	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241992218delG	uc002wah.1	+							NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GGTAAGGCCTGGGGGGCCCAA	0.657													6	3	---	---	---	---	
SMARCC1	6599	broad.mit.edu	37	3	47704091	47704091	+	Intron	DEL	G	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47704091delG	uc003crq.2	-						SMARCC1_uc011bbc.1_Intron|SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		GCCTAAGACAGAAAAAACAGA	0.343													44	33	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52588748	52588748	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52588748delG	uc003des.2	-	27	4613	c.4601delC	c.(4600-4602)CCAfs	p.P1534fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Frame_Shift_Del_p.P1447fs|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.P1479fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.P1454fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.P1427fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.P1478fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1534	Pro-rich.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACCCGGTGGTGGGATGCCCGG	0.567			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								24	16	---	---	---	---	
SAMD7	344658	broad.mit.edu	37	3	169642738	169642738	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169642738delT	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TGCTGGTTTGTTTTTTTTTTT	0.318													4	2	---	---	---	---	
PRSS12	8492	broad.mit.edu	37	4	119203954	119203956	+	Intron	DEL	AAG	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119203954_119203956delAAG	uc003ica.1	-							NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor							membrane	scavenger receptor activity			skin(1)	1						CAGACACAAAAAGGTGCCCTGCT	0.399													410	188	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787399	121787400	+	Intron	INS	-	A	A			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787399_121787400insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAATCCCCAGGAAAAAAAAAAA	0.376													7	4	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130994600	130994601	+	Intron	INS	-	AAAA	AAAA			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130994600_130994601insAAAA	uc003kvp.1	-						FNIP1_uc003kvs.1_Intron|FNIP1_uc003kvt.1_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TGGGTCTAGCCaaaaaaaaaaa	0.376													4	4	---	---	---	---	
DIAPH1	1729	broad.mit.edu	37	5	140907915	140907915	+	Intron	DEL	A	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140907915delA	uc003llb.3	-						DIAPH1_uc011dbd.1_5'Flank|DIAPH1_uc003llc.3_Intron|DIAPH1_uc010jgc.1_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCATTTCCACTTGAAATAG	0.443													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167621962	167621962	+	IGR	DEL	A	-	-	rs10583811		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167621962delA								TCP10L2 (25567 upstream) : UNC93A (82841 downstream)																							GTTAGAATAGAAAAAAAATAC	0.338													4	4	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29438231	29438232	+	Intron	INS	-	G	G	rs140510730	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29438231_29438232insG	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						ttatgttatgaggggggggtcc	0.084													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64039219	64039219	+	Intron	DEL	T	-	-	rs151239431		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64039219delT	uc003ttc.1	+											Homo sapiens cDNA FLJ43440 fis, clone OCBBF2030517.																		CCTTTTTAGAttttttttttt	0.264													5	3	---	---	---	---	
ZNF107	51427	broad.mit.edu	37	7	64167976	64167976	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64167976delA	uc003ttd.2	+	7	2080	c.1294delA	c.(1294-1296)AAAfs	p.K432fs	ZNF107_uc003tte.2_Frame_Shift_Del_p.K432fs	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	432	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TAGACATAAGAAAATTCATAC	0.348													36	22	---	---	---	---	
GPR124	25960	broad.mit.edu	37	8	37696873	37696880	+	Intron	DEL	CCTACCCT	-	-	rs6998793	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37696873_37696880delCCTACCCT	uc003xkj.2	+						GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor						central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TTAAGGACTCCCTACCCTATGGCCTCTG	0.572													3	4	---	---	---	---	
STMN2	11075	broad.mit.edu	37	8	80553864	80553875	+	Intron	DEL	CACACACACACA	-	-	rs12675728	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80553864_80553875delCACACACACACA	uc003ybj.2	+						STMN2_uc010lzp.2_Intron|STMN2_uc011lfn.1_Intron	NM_007029	NP_008960	Q93045	STMN2_HUMAN	superiorcervical ganglia, neural specific 10						intracellular signal transduction|negative regulation of microtubule depolymerization|negative regulation of microtubule polymerization|negative regulation of neuron projection development|neuron differentiation|positive regulation of microtubule depolymerization|positive regulation of neuron projection development	axon|growth cone|membrane|membrane fraction|perinuclear region of cytoplasm|soluble fraction	protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			cacatgcacgcacacacacacacacacacaca	0.363													5	3	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94740321	94740321	+	Intron	DEL	A	-	-	rs77899597		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94740321delA	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_Intron|FAM92A1_uc003yfw.3_Intron|FAM92A1_uc010mar.2_Intron	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGACATGGACATTTTTTTGAA	0.219													4	2	---	---	---	---	
FAM91A1	157769	broad.mit.edu	37	8	124817491	124817491	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124817491delT	uc003yqv.2	+						FAM91A1_uc011lik.1_Intron|FAM91A1_uc011lil.1_Intron	NM_144963	NP_659400	Q658Y4	F91A1_HUMAN	hypothetical protein LOC157769											ovary(1)|central_nervous_system(1)	2	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			ACCTTTTAACTTTTGTTTATG	0.343													19	13	---	---	---	---	
SURF4	6836	broad.mit.edu	37	9	136230727	136230728	+	Intron	DEL	TC	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136230727_136230728delTC	uc004cdj.2	-						SURF4_uc011mda.1_Intron|SURF4_uc010nal.2_Intron|SURF4_uc011mdb.1_Intron|SURF4_uc011mdc.1_Intron|SURF4_uc011mdd.1_Intron	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4							endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		CGTCATGAAGTCTCTATCCATC	0.441													10	6	---	---	---	---	
ECD	11319	broad.mit.edu	37	10	74920042	74920042	+	Intron	DEL	A	-	-	rs113122458		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74920042delA	uc001jtn.2	-						ECD_uc009xqx.2_Intron|ECD_uc009xqy.2_Intron|ECD_uc001jto.2_Intron	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1						regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					agactgtctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55258683	55258683	+	IGR	DEL	G	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55258683delG								OR4A15 (122290 upstream) : OR4C15 (63100 downstream)																							AAGAACACATGGAAAATAGGA	0.363													18	13	---	---	---	---	
SMARCD1	6602	broad.mit.edu	37	12	50488080	50488080	+	Intron	DEL	C	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50488080delC	uc001rvx.3	+						SMARCD1_uc001rvy.3_Intron|SMARCD1_uc009zlp.2_Intron	NM_003076	NP_003067	Q96GM5	SMRD1_HUMAN	SWI/SNF-related matrix-associated						chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity			ovary(1)	1						aagtgtagaacatttctgtca	0.100													23	12	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76462515	76462516	+	Intron	INS	-	AC	AC	rs35120003		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76462515_76462516insAC	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				ACCCGCCCCTTacacacacaca	0.342													4	2	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104048615	104048615	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104048615delT	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GAAGAGGTGGTTTGTCTGTTT	0.443													12	8	---	---	---	---	
ATP8A2	51761	broad.mit.edu	37	13	26411562	26411569	+	Intron	DEL	CACACACA	-	-	rs72194516	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26411562_26411569delCACACACA	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACCCCACCACcacacacacacacacaca	0.389													4	2	---	---	---	---	
TBC1D4	9882	broad.mit.edu	37	13	75923089	75923094	+	Intron	DEL	GAGTGT	-	-	rs151307196		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75923089_75923094delGAGTGT	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		gagagagagagagtgtgtgtgtgtgt	0.180													7	4	---	---	---	---	
C14orf135	64430	broad.mit.edu	37	14	60600702	60600703	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60600702_60600703delGA	uc001xer.3	+	10	3102_3103	c.2580_2581delGA	c.(2578-2583)GGGAGAfs	p.G860fs	C14orf135_uc001xeq.2_Intron|C14orf135_uc010apm.2_RNA	NM_022495	NP_071940	Q63HM2	CN135_HUMAN	hepatitis C virus F protein-binding protein 2	1094_1095						integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)		TTTACACTGGGAGAGTGCTTAG	0.356													19	9	---	---	---	---	
ZFYVE26	23503	broad.mit.edu	37	14	68238636	68238646	+	Intron	DEL	TAGATTTGGCA	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68238636_68238646delTAGATTTGGCA	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Intron	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CCCAAAGTCTTAGATTTGGCAGTTCTGAAAA	0.422													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23610060	23610061	+	5'Flank	INS	-	G	G			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23610060_23610061insG	uc001ywf.2	-											DQ583953																		AGGCAGGAAGAGGGGGCTCCCA	0.639													4	5	---	---	---	---	
SLC30A4	7782	broad.mit.edu	37	15	45803689	45803690	+	Intron	INS	-	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45803689_45803690insT	uc001zvj.2	-						C15orf21_uc001zvk.2_Intron|C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),						regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		ttctttttttcttttttttttg	0.040													3	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48058484	48058484	+	Intron	DEL	G	-	-	rs528882	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058484delG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTTTTTTTTTGTTGTTATGGG	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	18441114	18441116	+	Splice_Site	DEL	CAC	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18441114_18441116delCAC	uc010bvw.2	-	7	1784	c.1128_splice	c.e7+1	p.V376_splice						SubName: Full=cDNA FLJ59085, highly similar to Polycystin-1;																		CGGCCATACTCACCACTGGGACT	0.709													6	3	---	---	---	---	
ACSM5	54988	broad.mit.edu	37	16	20442095	20442097	+	Intron	DEL	AAG	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20442095_20442097delAAG	uc002dhe.2	+							NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						aaaggaaagaaagaggaaaggaa	0.054													4	2	---	---	---	---	
PLD2	5338	broad.mit.edu	37	17	4725787	4725788	+	Intron	INS	-	A	A	rs138872940		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4725787_4725788insA	uc002fzc.2	+						PLD2_uc002fzd.2_Intron	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2						cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	aactccgtctcaaaaaaaaaaa	0.218													2	4	---	---	---	---	
HOXB7	3217	broad.mit.edu	37	17	46685076	46685077	+	3'UTR	INS	-	T	T	rs140410823	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46685076_46685077insT	uc002inv.2	-	2					HOXB6_uc002ins.1_5'Flank|HOXB6_uc010dbh.1_5'Flank	NM_004502	NP_004493	P09629	HXB7_HUMAN	homeobox B7							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ttttttttttgttttttttgtt	0.243													6	3	---	---	---	---	
TMEM49	81671	broad.mit.edu	37	17	57816188	57816188	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57816188delT	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			ACCTCATCCCTTTTTTTCAGT	0.353													131	57	---	---	---	---	
TSEN54	283989	broad.mit.edu	37	17	73513416	73513416	+	Intron	DEL	T	-	-	rs11316466		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73513416delT	uc002jof.1	+						CASKIN2_uc002joc.2_5'Flank|CASKIN2_uc002jod.2_5'Flank|TSEN54_uc002joe.1_Intron	NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog						mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAACCCGGTCTTTAGAGAACT	0.522													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	109963	109963	+	Intron	DEL	G	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109963delG	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		atctgcctatgggggcatagt	0.000													6	4	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3819298	3819299	+	Intron	INS	-	GGGCAGGT	GGGCAGGT	rs146619879	by1000genomes	TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3819298_3819299insGGGCAGGT	uc002lyw.2	-							NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCTGGGCAGGCGGGCAGGTGGG	0.728													6	3	---	---	---	---	
ZNF708	7562	broad.mit.edu	37	19	21493258	21493258	+	Intron	DEL	T	-	-	rs669560		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21493258delT	uc002npq.1	-						ZNF708_uc002npr.1_Intron|ZNF708_uc010ecs.1_Intron	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						aaaaaaaaaataataataaat	0.119													4	2	---	---	---	---	
TBCB	1155	broad.mit.edu	37	19	36606379	36606380	+	5'UTR	INS	-	CAG	CAG			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36606379_36606380insCAG	uc002odg.1	+	1					POLR2I_uc002ode.2_5'Flank|POLR2I_uc002odf.2_5'Flank|TBCB_uc002odh.1_5'Flank	NM_001281	NP_001272	Q99426	TBCB_HUMAN	cytoskeleton associated protein 1						'de novo' posttranslational protein folding|cell differentiation|nervous system development	cytoplasm|microtubule	protein binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGCTGATAGCCCAGCAGCAGCA	0.733													4	2	---	---	---	---	
CGB	1082	broad.mit.edu	37	19	49528886	49528886	+	5'Flank	DEL	C	-	-	rs36051701		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49528886delC	uc002plv.1	-						CGB_uc010yad.1_Intron|CGB_uc002plu.1_5'Flank	NM_000737	NP_000728	P01233	CGHB_HUMAN	chorionic gonadotropin beta 3 subunit precursor						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	CCGGCGGCAGCCCCCTCCACC	0.657													10	8	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46252525	46252526	+	Intron	DEL	CT	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46252525_46252526delCT	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						agagcgaaaactctgtctcgag	0.124													3	4	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190932	62190933	+	Intron	INS	-	T	T			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190932_62190933insT	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			tcaggtgggaggagtcagggtc	0.000													3	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26272002	26272013	+	Intron	DEL	TGTGTGTGTGTA	-	-	rs71789730		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26272002_26272013delTGTGTGTGTGTA	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						tgtgtgtgtgtgtgtgtgtgtatgtgtTTTAA	0.363													3	3	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26605954	26605957	+	Intron	DEL	AGGG	-	-	rs5752279		TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26605954_26605957delAGGG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						gaaggaaggaagggaggaaggaag	0.108													3	5	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19688957	19688958	+	Intron	INS	-	AAAA	AAAA			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19688957_19688958insAAAA	uc004czm.2	-						SH3KBP1_uc011mje.1_5'Flank|SH3KBP1_uc011mjf.1_Intron|SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						ACTCTAAAAGCAAAAAAAAAAA	0.391													9	5	---	---	---	---	
WDR44	54521	broad.mit.edu	37	X	117543605	117543605	+	Intron	DEL	T	-	-			TCGA-CW-5580-01A-01D-1669-08	TCGA-CW-5580-11A-02D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117543605delT	uc004eqn.2	+						WDR44_uc004eqo.2_Intron|WDR44_uc011mtr.1_Intron|WDR44_uc010nqi.2_Intron	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						TTTTCATCTATTTAAAAATCT	0.323													140	100	---	---	---	---	
