Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
LOC440563	440563	broad.mit.edu	37	1	13183833	13183833	+	Missense_Mutation	SNP	C	T	T	rs115597766	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13183833C>T	uc010obg.1	-	1	135	c.40G>A	c.(40-42)GTG>ATG	p.V14M		NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	14						ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						CGGGAGTTCACGGAGTGAGGA	0.468													5	159	---	---	---	---	PASS
KAZ	23254	broad.mit.edu	37	1	15370643	15370643	+	Silent	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15370643C>T	uc001avm.3	+	4	995	c.714C>T	c.(712-714)GCC>GCT	p.A238A	KAZ_uc009vog.1_Silent_p.A238A|KAZ_uc010obj.1_Silent_p.A238A|KAZ_uc001avo.2_Silent_p.A232A|KAZ_uc001avp.2_Silent_p.A144A|KAZ_uc001avq.2_Silent_p.A144A|KAZ_uc001avr.2_Silent_p.A141A	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	238	Interaction with PPL.|Potential.				keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						AGCTGGAGGCCGAGCTGGCCA	0.672													6	17	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16360289	16360289	+	3'UTR	SNP	C	T	T	rs61772371		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16360289C>T	uc001axu.2	+	20					CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_3'UTR|CLCNKA_uc010obw.1_3'UTR|CLCNKB_uc001axw.3_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	ACAGGCAACTCTAACCTAGCC	0.562													5	91	---	---	---	---	PASS
PADI6	353238	broad.mit.edu	37	1	17715311	17715311	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17715311T>C	uc001bak.1	+	8	898	c.898T>C	c.(898-900)TTC>CTC	p.F300L		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	292					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CACGGTGGTGTTCCGGGTGGC	0.547													6	224	---	---	---	---	PASS
CDC14A	8556	broad.mit.edu	37	1	100961574	100961574	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100961574G>C	uc001dtg.3	+	13	1755	c.1267G>C	c.(1267-1269)GGA>CGA	p.G423R	CDC14A_uc009web.2_RNA|CDC14A_uc010oui.1_Missense_Mutation_p.G365R|CDC14A_uc001dtf.2_Missense_Mutation_p.G423R|CDC14A_uc009wed.1_Missense_Mutation_p.G130R|CDC14A_uc009wee.2_Missense_Mutation_p.G423R	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	423					cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TGATACAAAAGGACATCCAAG	0.433													142	327	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109778703	109778703	+	Silent	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109778703T>A	uc001dwu.1	+	8	1149	c.1074T>A	c.(1072-1074)CCT>CCA	p.P358P	SARS_uc001dwt.1_Silent_p.P358P|SARS_uc001dwv.1_Silent_p.P358P|SARS_uc001dww.1_Silent_p.P291P|SARS_uc001dwx.1_Silent_p.P310P|SARS_uc009wfa.1_Silent_p.P358P|SARS_uc001dwy.1_Silent_p.P183P|SARS_uc001dwz.1_Silent_p.P183P	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase	358					seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	TGGGGATTCCTTACCACATTG	0.502													4	139	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142806254	142806254	+	Intron	SNP	A	G	G	rs114813183	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142806254A>G	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CATTTTGCATAAACTGTGTGT	0.353													161	176	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142806270	142806270	+	Intron	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142806270C>T	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TGTGTGGATTCATTGCCTACA	0.333													6	283	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813824	144813824	+	Silent	SNP	G	C	C	rs77446849		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813824G>C	uc009wig.1	+	10	1147	c.1071G>C	c.(1069-1071)CTG>CTC	p.L357L	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.L357L|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.L288L|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.L288L|NBPF9_uc010oyg.1_Silent_p.L322L|NBPF9_uc009wii.1_Silent_p.L86L|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.L17L	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	357	Potential.					cytoplasm					0						CAGAGCAGCTGAAGCAAGCTG	0.522													29	194	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144828583	144828583	+	Silent	SNP	G	A	A	rs28712116	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144828583G>A	uc009wig.1	+	23	2704	c.2628G>A	c.(2626-2628)TTG>TTA	p.L876L	NBPF9_uc010oxn.1_Silent_p.L774L|NBPF9_uc010oxo.1_Silent_p.L801L|NBPF9_uc010oxr.1_Silent_p.L903L|NBPF9_uc010oxt.1_Silent_p.L691L|NBPF9_uc001ekg.1_Silent_p.L203L|NBPF9_uc001ekk.1_Silent_p.L447L|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Silent_p.L203L|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.L536L|uc001elr.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	876	NBPF 7.					cytoplasm					0						CTGAAGTCTTGCAGGACTCAC	0.468													30	387	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144828610	144828610	+	Silent	SNP	T	G	G	rs12026633	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144828610T>G	uc009wig.1	+	23	2731	c.2655T>G	c.(2653-2655)TCT>TCG	p.S885S	NBPF9_uc010oxn.1_Silent_p.S783S|NBPF9_uc010oxo.1_Silent_p.S810S|NBPF9_uc010oxr.1_Silent_p.S912S|NBPF9_uc010oxt.1_Silent_p.S700S|NBPF9_uc001ekg.1_Silent_p.S212S|NBPF9_uc001ekk.1_Silent_p.S456S|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Silent_p.S212S|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.S545S|uc001elr.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	885	NBPF 7.					cytoplasm					0						GATGTTATTCTACTCCGTCAA	0.468													39	422	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144828807	144828807	+	3'UTR	SNP	A	G	G	rs76022554		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144828807A>G	uc009wig.1	+	23					NBPF9_uc010oxn.1_3'UTR|NBPF9_uc010oxo.1_3'UTR|NBPF9_uc010oxr.1_3'UTR|NBPF9_uc010oxt.1_3'UTR|NBPF9_uc001ekg.1_3'UTR|NBPF9_uc001ekk.1_3'UTR|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_3'UTR|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_3'UTR|uc001elr.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						AAGCCGAGAGATGTCATTCCT	0.473													16	263	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145296448	145296448	+	Missense_Mutation	SNP	T	A	A	rs4996268	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145296448T>A	uc001end.3	+	3	405	c.370T>A	c.(370-372)TAT>AAT	p.Y124N	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.Y124N|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	124											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGCTCATTGTATGAGCATCT	0.562													5	86	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145304529	145304529	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145304529T>C	uc001end.3	+	10	1497	c.1462T>C	c.(1462-1464)TCT>CCT	p.S488P	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Missense_Mutation_p.S419P|NBPF9_uc010oyg.1_Missense_Mutation_p.S453P|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Missense_Mutation_p.S27P|NBPF10_uc001emq.1_Missense_Mutation_p.S217P	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TAGCCATGGCTCTTATGACTC	0.468													20	718	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004475	148004475	+	3'UTR	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004475C>G	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TGGAACTGTACTTTCATTCAA	0.493													22	101	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	148891580	148891580	+	RNA	SNP	A	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148891580A>T	uc009wkv.1	+	9		c.882A>T								Homo sapiens cDNA, FLJ17483.																		GAATCAGGGAAGACTCAGTTA	0.358													118	674	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	148891643	148891643	+	RNA	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148891643A>G	uc009wkv.1	+	9		c.945A>G								Homo sapiens cDNA, FLJ17483.																		CCAAAACTGAAATTGAAGATT	0.423													142	642	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149763191	149763191	+	3'UTR	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149763191G>A	uc001esp.3	+	6					HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_RNA	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor						interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTCATGGTATGTAACTCTTAA	0.438													6	64	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152329632	152329632	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329632C>A	uc001ezw.3	-	3	703	c.630G>T	c.(628-630)AAG>AAT	p.K210N	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	210	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAATGTGTGACTTGTTTATTC	0.463													7	621	---	---	---	---	PASS
SEMA4A	64218	broad.mit.edu	37	1	156146590	156146590	+	Silent	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156146590A>G	uc001fnl.2	+	15	2192	c.2088A>G	c.(2086-2088)TCA>TCG	p.S696S	SEMA4A_uc009wrq.2_Silent_p.S696S|SEMA4A_uc001fnm.2_Silent_p.S696S|SEMA4A_uc001fnn.2_Silent_p.S564S|SEMA4A_uc001fno.2_Silent_p.S696S	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor	696	Helical; (Potential).				axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					TAGTGCTTTCAGGAGCCCTCA	0.642													40	116	---	---	---	---	PASS
CD247	919	broad.mit.edu	37	1	167404535	167404535	+	Intron	SNP	T	C	C	rs56387336	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167404535T>C	uc001gei.3	-						CD247_uc001gej.3_Intron|CD247_uc001gek.2_Missense_Mutation_p.Q146R	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			gcccttcctctggagccctcc	0.179													5	98	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169529926	169529926	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169529926T>A	uc001ggg.1	-	4	597	c.452A>T	c.(451-453)GAA>GTA	p.E151V	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	151	F5/8 type A 1.|Plastocyanin-like 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	GATACTCCATTCATAGGTGTA	0.507													70	276	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207787831	207787831	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207787831G>T	uc001hfy.2	+	32	5448	c.5308G>T	c.(5308-5310)GAA>TAA	p.E1770*	CR1_uc001hfx.2_Nonsense_Mutation_p.E2220*	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1770	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TCCAGTGTGTGAACGTGAGTA	0.408													9	607	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243333027	243333027	+	Silent	SNP	A	G	G	rs147752333	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243333027A>G	uc001hzs.2	-	12	2154	c.1746T>C	c.(1744-1746)CGT>CGC	p.R582R	CEP170_uc001hzt.2_Silent_p.R484R|CEP170_uc001hzu.2_Silent_p.R484R	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	582						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398													7	400	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40657253	40657253	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40657253C>G	uc002rrx.2	-	1	192	c.168G>C	c.(166-168)AAG>AAC	p.K56N	SLC8A1_uc002rry.2_Missense_Mutation_p.K56N|SLC8A1_uc002rrz.2_Missense_Mutation_p.K56N|SLC8A1_uc002rsa.2_Missense_Mutation_p.K56N|SLC8A1_uc002rsd.3_Missense_Mutation_p.K56N|SLC8A1_uc002rsb.1_Missense_Mutation_p.K56N|SLC8A1_uc010fan.1_Missense_Mutation_p.K56N|SLC8A1_uc002rsc.1_Missense_Mutation_p.K56N	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	56	Extracellular (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCACCCCTTTCTTACAGTAAT	0.418													8	231	---	---	---	---	PASS
C2orf61	285051	broad.mit.edu	37	2	47314258	47314258	+	Silent	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47314258G>T	uc010yog.1	-	7	763	c.636C>A	c.(634-636)GGC>GGA	p.G212G	C2orf61_uc010fbd.2_Intron	NM_001163561	NP_001157033	Q8N801	CB061_HUMAN	hypothetical protein LOC285051 isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ATGCTCCTGGGCCTGGGGTTT	0.483													11	421	---	---	---	---	PASS
APLF	200558	broad.mit.edu	37	2	68740264	68740264	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68740264C>A	uc002sep.2	+	4	567	c.394C>A	c.(394-396)CCC>ACC	p.P132T	APLF_uc010fdf.2_Missense_Mutation_p.P108T	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	132					double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						ACCAAAATCCCCCGTGATTAA	0.368													79	255	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74435758	74435758	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74435758C>G	uc002skk.2	+	4	551	c.472C>G	c.(472-474)CAT>GAT	p.H158D	MTHFD2_uc002skj.2_Missense_Mutation_p.H56D|MTHFD2_uc010yro.1_Missense_Mutation_p.H56D|MTHFD2_uc010ffb.2_Missense_Mutation_p.H117D|MTHFD2_uc010yrp.1_5'UTR	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2	158					folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	TGATGGCTTTCATGTAATTAA	0.413													27	747	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89100619	89100619	+	RNA	SNP	C	T	T	rs75347118		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89100619C>T	uc010fhg.2	+	13		c.1059C>T			FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_RNA	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						TCAACAGCAACTGGATGATGC	0.303													41	132	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89104364	89104364	+	RNA	SNP	A	G	G	rs62158695	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89104364A>G	uc010fhg.2	+	15		c.1397A>G			FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_RNA	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						AAATTGAGCGACTTGAGAAAA	0.313													9	275	---	---	---	---	PASS
ANKRD36B	57730	broad.mit.edu	37	2	98201858	98201858	+	Silent	SNP	A	G	G	rs2442304		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98201858A>G	uc010yvc.1	-	2	445	c.165T>C	c.(163-165)ACT>ACC	p.T55T	ANKRD36B_uc010yve.1_RNA|ANKRD36B_uc010fif.2_RNA	NM_025190	NP_079466	Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B	55	ANK 2.										0						AATGTAGGGCAGTCCTGTGAG	0.428													7	103	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107021431	107021431	+	3'UTR	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021431C>T	uc010ywi.1	-	23						NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						CTGGTATCAACACTTCAAGCT	0.378													5	67	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109379866	109379866	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109379866G>C	uc002tem.3	+	20	2997	c.2871G>C	c.(2869-2871)AGG>AGC	p.R957S		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	957					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TATCGCCCAGGGGTGATGATT	0.458													67	212	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160176732	160176732	+	3'UTR	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160176732T>A	uc002uao.2	-	37					BAZ2B_uc002uap.2_3'UTR	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CTGGTCTCATTTGTCCTTGTT	0.299													38	142	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216298066	216298066	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216298066T>C	uc002vfa.2	-	3	662	c.396A>G	c.(394-396)AGA>AGG	p.R132R	FN1_uc002vfb.2_Silent_p.R132R|FN1_uc002vfc.2_Silent_p.R132R|FN1_uc002vfd.2_Silent_p.R132R|FN1_uc002vfe.2_Silent_p.R132R|FN1_uc002vff.2_Silent_p.R132R|FN1_uc002vfg.2_Silent_p.R132R|FN1_uc002vfh.2_Silent_p.R132R|FN1_uc002vfi.2_Silent_p.R132R|FN1_uc002vfj.2_Silent_p.R132R|FN1_uc002vfl.2_Silent_p.R132R	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	132	Fibronectin type-I 2.|Fibrin- and heparin-binding 1.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TACAGCTTATTCTCCCTCGCC	0.438													6	189	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219146894	219146894	+	Translation_Start_Site	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219146894G>T	uc002vho.1	-	3	697	c.-29C>A	c.(-31--27)AGCTG>AGATG		PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_Translation_Start_Site|TMBIM1_uc010zjz.1_Intron|TMBIM1_uc010zka.1_Translation_Start_Site	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1							integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGAACCCCAGCTGCTGGGAC	0.647													7	34	---	---	---	---	PASS
CAND2	23066	broad.mit.edu	37	3	12869031	12869031	+	Silent	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12869031C>T	uc003bxk.2	+	13	3352	c.3303C>T	c.(3301-3303)TGC>TGT	p.C1101C	CAND2_uc003bxj.2_Silent_p.C984C	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	1101					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						TTGAGAGCTGCCTGGGCCAGC	0.562													5	119	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52663052	52663052	+	Splice_Site	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52663052C>A	uc003des.2	-	12	1314	c.1302_splice	c.e12-1	p.R434_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.R434_splice|PBRM1_uc003der.2_Splice_Site_p.R402_splice|PBRM1_uc003det.2_Splice_Site_p.R434_splice|PBRM1_uc003deu.2_Splice_Site_p.R434_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.R434_splice|PBRM1_uc010hmk.1_Splice_Site_p.R434_splice|PBRM1_uc003dey.2_Splice_Site_p.R434_splice|PBRM1_uc003dez.1_Splice_Site_p.R434_splice|PBRM1_uc003dfb.1_Splice_Site_p.R332_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CAGTTTTGTTCTGTGAAAGAC	0.318			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								25	214	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119190274	119190274	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119190274G>A	uc003ecm.2	+	3	379	c.295G>A	c.(295-297)GAA>AAA	p.E99K	KTELC1_uc011biz.1_RNA|KTELC1_uc011bja.1_5'UTR	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	99						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		ACTGTACCGGGAAAATGACTG	0.453													11	320	---	---	---	---	PASS
STAG1	10274	broad.mit.edu	37	3	136062787	136062787	+	Silent	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136062787G>T	uc003era.1	-	30	3625	c.3333C>A	c.(3331-3333)CCC>CCA	p.P1111P	STAG1_uc003erb.1_Silent_p.P1111P	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1111					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						GTGCTGGCAGGGGGCCAGGAG	0.507													73	180	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142281209	142281209	+	Silent	SNP	A	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142281209A>T	uc003eux.3	-	4	1157	c.1035T>A	c.(1033-1035)GCT>GCA	p.A345A		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	345					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						AATGGCACAAAGCTGCTTTTA	0.388								Other_conserved_DNA_damage_response_genes					105	223	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195698264	195698264	+	RNA	SNP	T	C	C	rs12485654	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195698264T>C	uc003fvx.3	-	11		c.1609A>G			SDHAP1_uc011btp.1_RNA	NR_003264				Homo sapiens full length insert cDNA clone ZC24D06.												0						TTTGTCAACATTCGTGACAGA	0.413													7	47	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348668	197348668	+	RNA	SNP	C	G	G	rs79940815	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348668C>G	uc011bug.1	-	4		c.423G>C			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						ACTTGAGGCTCTGTCCACCAA	0.488													11	87	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348674	197348674	+	RNA	SNP	A	G	G	rs144273946	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348674A>G	uc011bug.1	-	4		c.417T>C			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						GGCTCTGTCCACCAAATGCAC	0.478													13	88	---	---	---	---	PASS
DHX15	1665	broad.mit.edu	37	4	24529605	24529605	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24529605T>C	uc003gqx.2	-	14	2498	c.2330A>G	c.(2329-2331)AAG>AGG	p.K777R	DHX15_uc003gqv.2_Missense_Mutation_p.K183R|DHX15_uc003gqw.2_Missense_Mutation_p.K200R	NM_001358	NP_001349	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 15	777					mRNA processing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)				CAACTGTCTCTTTGCTTCACA	0.378													8	595	---	---	---	---	PASS
RPL9	6133	broad.mit.edu	37	4	39458089	39458089	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39458089A>G	uc003gub.2	-	4	476	c.328T>C	c.(328-330)TCT>CCT	p.S110P	RPL9_uc003guc.2_Missense_Mutation_p.S110P|RPL9_uc011byk.1_RNA|RPL9_uc011byl.1_Missense_Mutation_p.S110P|LIAS_uc003gue.3_5'Flank|LIAS_uc011bym.1_5'Flank|LIAS_uc003guf.2_5'Flank|LIAS_uc003gug.2_5'Flank|LIAS_uc003guh.2_5'Flank	NM_001024921	NP_001020092	P32969	RL9_HUMAN	ribosomal protein L9	110					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|nucleolus|ribosome	rRNA binding|structural constituent of ribosome			skin(1)	1						TCAACAAGAGACCCATTCTCC	0.403													5	153	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104067067	104067067	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104067067T>C	uc003hxb.1	-	30	4422	c.4332A>G	c.(4330-4332)AAA>AAG	p.K1444K	CENPE_uc003hxc.1_Silent_p.K1419K	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	1444	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GTAGGTCATCTTTCTCCTTAG	0.368													7	377	---	---	---	---	PASS
CBR4	84869	broad.mit.edu	37	4	169923170	169923170	+	Intron	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169923170C>T	uc003iry.2	-						CBR4_uc011cjy.1_Intron|CBR4_uc003irz.1_3'UTR	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		ATAATGGCTTCCCTATAAAAC	0.299													11	159	---	---	---	---	PASS
DCTD	1635	broad.mit.edu	37	4	183812459	183812459	+	3'UTR	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183812459G>A	uc003ivf.2	-	6					DCTD_uc003ivg.2_3'UTR|DCTD_uc010irw.2_3'UTR|DCTD_uc003ivh.2_3'UTR	NM_001921	NP_001912	P32321	DCTD_HUMAN	dCMP deaminase isoform b						nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)		ATACTGGCTAGTAAGAAGTTA	0.368													10	142	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37020560	37020560	+	Splice_Site	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37020560G>T	uc003jkl.3	+	26	5510	c.5011_splice	c.e26-1	p.F1671_splice	NIPBL_uc003jkk.3_Splice_Site_p.F1671_splice	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTTCTTTCCAGTTTTCTCGTA	0.328													110	343	---	---	---	---	PASS
PRKAA1	5562	broad.mit.edu	37	5	40767696	40767696	+	Silent	SNP	T	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40767696T>G	uc003jmc.2	-	6	699	c.693A>C	c.(691-693)CCA>CCC	p.P231P	PRKAA1_uc003jmb.2_Silent_p.P246P	NM_006251	NP_006242	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic	231	Protein kinase.				activation of MAPK activity|cell cycle arrest|cholesterol biosynthetic process|fatty acid biosynthetic process|insulin receptor signaling pathway|negative regulation of glucosylceramide biosynthetic process|positive regulation of anti-apoptosis|positive regulation of cholesterol biosynthetic process|regulation of fatty acid oxidation|response to hypoxia	cytosol	ATP binding|cAMP-dependent protein kinase activity|metal ion binding|protein binding			breast(1)	1					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	TAAAAAGAGTTGGCACATGGT	0.403													10	413	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70835434	70835434	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70835434G>A	uc003kbp.1	+	28	6243	c.5980G>A	c.(5980-5982)GAT>AAT	p.D1994N	BDP1_uc003kbo.2_Missense_Mutation_p.D1994N|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1994					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TACAATGGGAGATCTAGTATT	0.343													73	263	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79031276	79031276	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79031276G>C	uc003kgc.2	+	2	6760	c.6688G>C	c.(6688-6690)GCT>CCT	p.A2230P		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2230						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTTAATGTAGCTGAGAAACC	0.393													29	107	---	---	---	---	PASS
SPZ1	84654	broad.mit.edu	37	5	79617177	79617177	+	Silent	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79617177A>G	uc003kgn.2	+	1	1388	c.1143A>G	c.(1141-1143)CAA>CAG	p.Q381Q	uc011ctk.1_RNA	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	381					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		AGAACAAGCAAGCAATGAAGG	0.363													5	148	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118824956	118824956	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118824956A>G	uc003ksj.2	+	9	815	c.692A>G	c.(691-693)GAG>GGG	p.E231G	HSD17B4_uc011cwg.1_Missense_Mutation_p.E207G|HSD17B4_uc011cwh.1_Missense_Mutation_p.E213G|HSD17B4_uc011cwi.1_Missense_Mutation_p.E256G|HSD17B4_uc003ksk.3_Missense_Mutation_p.E84G|HSD17B4_uc011cwj.1_Missense_Mutation_p.E84G|HSD17B4_uc010jcn.1_5'UTR	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	231	(3R)-hydroxyacyl-CoA dehydrogenase.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	GAGAGTTGTGAGGAGAATGGT	0.403													10	791	---	---	---	---	PASS
C5orf60	285679	broad.mit.edu	37	5	179071892	179071892	+	Missense_Mutation	SNP	C	T	T	rs4990389	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179071892C>T	uc011dgo.1	-	1	156	c.130G>A	c.(130-132)GTT>ATT	p.V44I	C5orf60_uc003mki.2_Missense_Mutation_p.V44I	NM_001142306	NP_001135778	A6NFR6	CE060_HUMAN	hypothetical protein LOC285679	44	Helical; (Potential).					integral to membrane					0						CTGAACACAACAAAGAGGACG	0.517													6	166	---	---	---	---	PASS
C5orf60	285679	broad.mit.edu	37	5	179071893	179071893	+	Silent	SNP	A	G	G	rs4990388	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179071893A>G	uc011dgo.1	-	1	155	c.129T>C	c.(127-129)TTT>TTC	p.F43F	C5orf60_uc003mki.2_Silent_p.F43F	NM_001142306	NP_001135778	A6NFR6	CE060_HUMAN	hypothetical protein LOC285679	43	Helical; (Potential).					integral to membrane					0						TGAACACAACAAAGAGGACGA	0.517													6	169	---	---	---	---	PASS
C5orf60	285679	broad.mit.edu	37	5	179072006	179072006	+	Silent	SNP	A	G	G	rs13153811	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179072006A>G	uc011dgo.1	-	1	42	c.16T>C	c.(16-18)TTG>CTG	p.L6L	C5orf60_uc003mki.2_Silent_p.L6L	NM_001142306	NP_001135778	A6NFR6	CE060_HUMAN	hypothetical protein LOC285679	6						integral to membrane					0						TCCTCAGGCAACTGAGCCCTG	0.577													4	57	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25279922	25279922	+	5'UTR	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25279922A>G	uc011djw.1	+	1					LRRC16A_uc010jpx.2_5'UTR|LRRC16A_uc010jpy.2_5'UTR	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TCCATTTGCAAGCTGCATCTG	0.532													18	39	---	---	---	---	PASS
LMBRD1	55788	broad.mit.edu	37	6	70428911	70428911	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70428911T>C	uc003pfa.2	-	8	814	c.699A>G	c.(697-699)GAA>GAG	p.E233E	LMBRD1_uc003pey.2_Silent_p.E29E|LMBRD1_uc003pez.2_Silent_p.E160E|LMBRD1_uc010kal.2_Silent_p.E160E|LMBRD1_uc003pfb.2_RNA	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	233	Cytoplasmic (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						TTTCCAAACGTTCATAAGCAG	0.333													8	644	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108214765	108214765	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108214765A>T	uc003psc.3	-	16	1864	c.1595T>A	c.(1594-1596)TTA>TAA	p.L532*	SEC63_uc003psb.3_Nonsense_Mutation_p.L392*	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	532	SEC63 1.|Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTTTTTTTTAAAGGTTTCTT	0.358													7	667	---	---	---	---	PASS
FIG4	9896	broad.mit.edu	37	6	110083350	110083350	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110083350A>C	uc003ptt.2	+	12	1543	c.1328A>C	c.(1327-1329)AAA>ACA	p.K443T	FIG4_uc011eau.1_Missense_Mutation_p.K166T	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	443	SAC.				cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		GTGGTGAAGAAAACAGGTTTC	0.358													150	452	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35009120	35009120	+	Silent	SNP	G	A	A	rs116030464	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35009120G>A	uc003tem.3	-	9	865	c.720C>T	c.(718-720)AGC>AGT	p.S240S		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	240	Helical; (Potential).					integral to membrane					0						GTGCAATCAAGCTTCCTCTAT	0.358													5	377	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38288948	38288948	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38288948G>C	uc003tfu.3	-	2	276	c.41C>G	c.(40-42)ACG>AGG	p.T14R	uc003tfv.2_Missense_Mutation_p.T14R|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																		TTCTGGCACCGTTAACCAGCT	0.398													205	598	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38389495	38389495	+	Intron	SNP	C	A	A	rs2012300	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38389495C>A	uc003tgp.1	+						uc003tgq.1_5'UTR					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		CTTAAAACTCCGGCCCCACTC	0.542													7	66	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92938194	92938194	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92938194T>C	uc003umo.2	+	19	1816	c.1688T>C	c.(1687-1689)GTT>GCT	p.V563A	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.V533A|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.V283A	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	563											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GACAGTGATGTTCCTGAGGAA	0.378													8	470	---	---	---	---	PASS
CYP3A43	64816	broad.mit.edu	37	7	99445148	99445148	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99445148G>T	uc003urx.1	+	5	459	c.356G>T	c.(355-357)AGT>ATT	p.S119I	CYP3A43_uc003ury.1_Missense_Mutation_p.S119I|CYP3A43_uc003urz.1_Missense_Mutation_p.S119I|CYP3A43_uc003usa.1_RNA|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_5'UTR	NM_057095	NP_476436	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A,	119			Missing (in allele CYP3A43*2).		xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Cetirizine(DB00341)|Doxycycline(DB00254)	AGTGCCTTAAGTTTTGCTGAA	0.363													7	472	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	102136604	102136604	+	5'Flank	SNP	C	T	T	rs746316		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102136604C>T	uc011kkt.1	-						uc003uzs.1_5'Flank|uc010lia.1_Missense_Mutation_p.V280M|uc003uzt.1_Missense_Mutation_p.V352M|uc003uzu.1_Missense_Mutation_p.V352M|POLR2J3_uc011kku.1_Missense_Mutation_p.V280M|uc003uzv.1_5'Flank|uc010lib.1_Missense_Mutation_p.V160M					SubName: Full=cDNA FLJ50902, moderately similar to Ras GTPase-activating protein 4;																		AAAGACTCCACGGACTTTGAG	0.413													5	181	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104753209	104753209	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104753209A>G	uc003vcm.2	+	27	5540	c.5006A>G	c.(5005-5007)CAT>CGT	p.H1669R	MLL5_uc010ljc.2_Missense_Mutation_p.H1669R|MLL5_uc010ljf.1_Intron|MLL5_uc010ljg.2_Missense_Mutation_p.H403R	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	1669	Pro-rich.				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						TCGCATATTCATTCTCAAACT	0.577													83	217	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137080409	137080409	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137080409G>A	uc003vtt.2	-	33	3017	c.3016C>T	c.(3016-3018)CGG>TGG	p.R1006W	DGKI_uc003vtu.2_Missense_Mutation_p.R675W	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1006	ANK 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						GCCCGGTTCCGCTGGCAGGCA	0.557													4	67	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151921114	151921114	+	Nonsense_Mutation	SNP	A	T	T	rs4024337		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151921114A>T	uc003wla.2	-	20	3528	c.3309T>A	c.(3307-3309)TGT>TGA	p.C1103*	MLL3_uc003wkz.2_Nonsense_Mutation_p.C164*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1103	PHD-type 6.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CACATTGTCTACATTGCAGAA	0.338			N		medulloblastoma								4	217	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43152262	43152262	+	Silent	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43152262G>A	uc003xpz.1	+	2	442	c.399G>A	c.(397-399)AGG>AGA	p.R133R	POTEA_uc003xqa.1_Silent_p.R133R	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	133	ANK 2.									ovary(1)	1						GCAAAAAGAGGACAGCTCTGA	0.383													89	285	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53085059	53085059	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53085059C>A	uc003xqz.2	-	5	518	c.362G>T	c.(361-363)TGT>TTT	p.C121F	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.C86F|ST18_uc011lds.1_Missense_Mutation_p.C26F|ST18_uc003xra.2_Missense_Mutation_p.C121F|ST18_uc003xrb.2_Missense_Mutation_p.C121F	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	121						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CTCTTGATAACAAGAGTATCT	0.348													17	97	---	---	---	---	PASS
SLC39A4	55630	broad.mit.edu	37	8	145642062	145642062	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145642062C>T	uc003zcq.2	-	1	212	c.112G>A	c.(112-114)GCT>ACT	p.A38T	SLC39A4_uc003zco.2_5'Flank|SLC39A4_uc003zcp.2_5'Flank	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),	38	Extracellular (Potential).					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			TGATCCAGAGCGCCCTGGCCA	0.677													3	9	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145759519	145759519	+	Silent	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145759519G>A	uc003zdt.1	-	8	3144	c.2589C>T	c.(2587-2589)GCC>GCT	p.A863A	ARHGAP39_uc011llk.1_Silent_p.A863A|ARHGAP39_uc003zds.1_Silent_p.A894A	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	863	MyTH4.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						GTACCTTCTTGGCCCCGGTCA	0.637													17	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413654	68413654	+	RNA	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413654G>A	uc004aex.2	+	1		c.209G>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		GAGTGCAGACGAGAGCCCCGG	0.642													3	22	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93606288	93606288	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93606288T>C	uc004aqz.2	+	2	313	c.108T>C	c.(106-108)GAT>GAC	p.D36D	SYK_uc004aqy.2_Silent_p.D36D|SYK_uc004ara.2_Silent_p.D36D|SYK_uc004arb.2_Silent_p.D36D|SYK_uc004arc.2_Silent_p.D36D|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	36	SH2 1.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						GCATGAGTGATGGGCTTTATT	0.627			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								7	24	---	---	---	---	PASS
CYLC2	1539	broad.mit.edu	37	9	105767823	105767823	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105767823G>A	uc004bbs.2	+	5	980	c.910G>A	c.(910-912)GCC>ACC	p.A304T		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	304	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				caagaaagttgccaagaaaga	0.134													11	366	---	---	---	---	PASS
SH3GLB2	56904	broad.mit.edu	37	9	131772971	131772971	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131772971A>C	uc004bwv.2	-	7	772	c.626T>G	c.(625-627)CTC>CGC	p.L209R	SH3GLB2_uc004bww.2_Missense_Mutation_p.L213R|SH3GLB2_uc004bwx.1_Missense_Mutation_p.L209R|SH3GLB2_uc011mbm.1_Missense_Mutation_p.L213R	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	209	BAR.|Potential.				filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0						ATCATTCCAGAGCTGTGGAGA	0.642													20	65	---	---	---	---	PASS
PTER	9317	broad.mit.edu	37	10	16526711	16526711	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16526711T>C	uc001iog.1	+	3	535	c.328T>C	c.(328-330)TTG>CTG	p.L110L	PTER_uc001ioh.1_Silent_p.L110L|PTER_uc001ioi.1_Silent_p.L110L|PTER_uc009xjp.1_Silent_p.L110L	NM_030664	NP_109589	Q96BW5	PTER_HUMAN	phosphotriesterase related	110					catabolic process		hydrolase activity, acting on ester bonds|zinc ion binding			ovary(2)	2						CACACAGACGTTGAAGAGGCT	0.488													7	111	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17110704	17110704	+	Silent	SNP	T	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17110704T>G	uc001ioo.2	-	20	2743	c.2691A>C	c.(2689-2691)TCA>TCC	p.S897S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	897	CUB 4.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGTTATAAATGAAGGTATGT	0.338													78	192	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24874682	24874682	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24874682G>C	uc001isb.2	-	26	5023	c.4536C>G	c.(4534-4536)AAC>AAG	p.N1512K	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1511					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TTGGTGACTTGTTGTGTTTTG	0.498													10	322	---	---	---	---	PASS
EPC1	80314	broad.mit.edu	37	10	32561020	32561020	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32561020T>A	uc001iwg.1	-	13	2278	c.2008A>T	c.(2008-2010)ATG>TTG	p.M670L	EPC1_uc001iwi.3_Missense_Mutation_p.M597L|EPC1_uc001iwh.1_Missense_Mutation_p.M647L	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1	670					histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				TTGAATCCCATCAGTTGTTCT	0.398													4	194	---	---	---	---	PASS
WDFY4	57705	broad.mit.edu	37	10	50108353	50108353	+	Splice_Site	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50108353T>A	uc001jha.3	+	46	7600	c.7523_splice	c.e46+2	p.S2508_splice		NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						CTTTAAAAGGTAAGAGCTTGA	0.458													97	227	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88277398	88277398	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88277398T>C	uc001kdo.2	-	2	871	c.429A>G	c.(427-429)AAA>AAG	p.K143K	WAPAL_uc001kdn.2_Silent_p.K186K|WAPAL_uc009xsw.2_Silent_p.K143K|WAPAL_uc010qmh.1_Silent_p.K143K|WAPAL_uc010qmi.1_Silent_p.K180K|WAPAL_uc010qmj.1_Silent_p.K143K	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	143	Mediates interaction with the cohesin complex.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						TGCTCTTTTCTTTCCCAAGTA	0.363													7	447	---	---	---	---	PASS
DCLRE1A	9937	broad.mit.edu	37	10	115609321	115609321	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115609321C>T	uc001law.2	-	2	2461	c.1543G>A	c.(1543-1545)GTT>ATT	p.V515I		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	515	Nuclear focus formation.				cell division|mitosis	nucleus	hydrolase activity			skin(2)	2				Epithelial(162;0.0157)|all cancers(201;0.0171)		GCTTTACCAACTGGCACACCC	0.343								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					72	172	---	---	---	---	PASS
EBF3	253738	broad.mit.edu	37	10	131638545	131638545	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131638545G>A	uc001lki.1	-	15	1647	c.1588C>T	c.(1588-1590)CCT>TCT	p.P530S		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	575					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GTGCAGGAAGGAGGAGGAGAG	0.567													15	47	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	608822	608822	+	Silent	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:608822G>A	uc001lqe.2	+	14	3497	c.3366G>A	c.(3364-3366)GAG>GAA	p.E1122E	PHRF1_uc010qwc.1_Silent_p.E1121E|PHRF1_uc010qwd.1_Silent_p.E1120E|PHRF1_uc010qwe.1_Silent_p.E1118E|PHRF1_uc009ybz.1_Silent_p.E912E|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1122	Arg-rich.						RNA polymerase binding|zinc ion binding				0						GGGGAAGGGAGTGCTCCCCCA	0.637													3	25	---	---	---	---	PASS
DEAF1	10522	broad.mit.edu	37	11	687971	687971	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:687971C>A	uc001lqq.1	-	4	1297	c.604G>T	c.(604-606)GAG>TAG	p.E202*	DEAF1_uc009ycf.1_RNA	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	202	SAND.		E -> D (in a primary colorectal cancer).|YDSE -> CDND (in a primary colorectal cancer).		embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		ACGGGCAGCTCACTGTCGTAC	0.552													15	112	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867462	6867462	+	Silent	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867462G>A	uc001met.1	+	1	549	c.549G>A	c.(547-549)CCG>CCA	p.P183P		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													7	229	---	---	---	---	PASS
TPH1	7166	broad.mit.edu	37	11	18057607	18057607	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18057607T>C	uc001mnp.2	-	2	226	c.200A>G	c.(199-201)GAC>GGC	p.D67G	TPH1_uc009yhe.2_RNA	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	67	ACT.				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TCTGTTGATGTCACAGTCAAC	0.353													9	614	---	---	---	---	PASS
OR5AR1	219493	broad.mit.edu	37	11	56431747	56431747	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56431747G>T	uc010rjm.1	+	1	586	c.586G>T	c.(586-588)GAG>TAG	p.E196*		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTACATCAGTGAGATCTTGCT	0.448													77	229	---	---	---	---	PASS
SSH3	54961	broad.mit.edu	37	11	67072383	67072383	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67072383G>A	uc001okj.2	+	3	422	c.244G>A	c.(244-246)GGG>AGG	p.G82R	SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_5'UTR	NM_017857	NP_060327	Q8TE77	SSH3_HUMAN	slingshot homolog 3	82					regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GACAGACTTCGGGCAAGGATC	0.617													20	32	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96116355	96116355	+	Intron	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96116355A>G	uc009ywp.2	-						CCDC82_uc009ywq.2_Intron|CCDC82_uc001pfx.3_Intron|CCDC82_uc009ywr.2_Intron|CCDC82_uc009yws.2_3'UTR	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82								protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TTAGAACATGATATTAAAAGG	0.224													6	195	---	---	---	---	PASS
MMP27	64066	broad.mit.edu	37	11	102567124	102567124	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102567124C>T	uc001phd.1	-	6	903	c.880G>A	c.(880-882)GAA>AAA	p.E294K		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	294	Hemopexin-like 1.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		AACATTACTTCTCTGCGGAAA	0.423													18	774	---	---	---	---	PASS
TREH	11181	broad.mit.edu	37	11	118530568	118530568	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118530568T>C	uc001pty.1	-	11	1253	c.1208A>G	c.(1207-1209)GAC>GGC	p.D403G	TREH_uc009zaj.1_Missense_Mutation_p.D372G|TREH_uc001ptz.1_Missense_Mutation_p.D280G	NM_007180	NP_009111	O43280	TREA_HUMAN	trehalase precursor	403					polysaccharide digestion|trehalose catabolic process	anchored to plasma membrane	alpha,alpha-trehalase activity			pancreas(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		CTTCTCAAGGTCGTAATCGAA	0.587											OREG0021385	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	63	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													4	112	---	---	---	---	PASS
PRH2	5555	broad.mit.edu	37	12	11083284	11083284	+	Missense_Mutation	SNP	A	C	C	rs2923234	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11083284A>C	uc009zhr.2	+	3	162	c.124A>C	c.(124-126)ATA>CTA	p.I42L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH2_uc001qzh.2_Missense_Mutation_p.I42L|PRH2_uc001qzi.3_Missense_Mutation_p.I42L	NM_001110213	NP_001103683	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2	42	Inhibits hydroxyapatite formation, binds to hydroxyapatite and calcium.					extracellular space	protein binding				0						TGAGCAGTTCATAGATGAGGA	0.527													6	130	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506647	11506647	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506647T>C	uc001qzw.1	-	3	427	c.390A>G	c.(388-390)CAA>CAG	p.Q130Q	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	191	7.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).|Missing (in allele S).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTGGGGGACCTTGAGGTCTGT	0.617													10	51	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398717	49398717	+	Intron	SNP	T	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398717T>G	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						TCTCTTCCGCTTTTTGGACAG	0.408													55	152	---	---	---	---	PASS
DGKA	1606	broad.mit.edu	37	12	56330142	56330142	+	Intron	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56330142A>G	uc001sij.2	+						DGKA_uc009zoc.1_Intron|DGKA_uc001sih.1_Intron|DGKA_uc001sii.1_Intron|DGKA_uc009zod.1_Intron|DGKA_uc009zoe.1_Intron|DGKA_uc001sik.2_Intron|DGKA_uc001sil.2_Intron|DGKA_uc001sim.2_Intron|DGKA_uc001sin.2_Intron|DGKA_uc009zof.2_Intron|DGKA_uc001sio.2_5'UTR	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	AGAATGGAACAGACAGAAGAA	0.338													17	20	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56492332	56492332	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56492332A>G	uc001sjh.2	+	22	2858	c.2665A>G	c.(2665-2667)ACA>GCA	p.T889A	ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Missense_Mutation_p.T246A|ERBB3_uc010sqc.1_Missense_Mutation_p.T830A|ERBB3_uc009zok.2_Missense_Mutation_p.T154A|ERBB3_uc001sjk.2_Missense_Mutation_p.T130A|ERBB3_uc001sjl.2_5'UTR	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	889	Cytoplasmic (Potential).|Protein kinase.				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			TGGGAAATACACACACCAGAG	0.438													7	303	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67701186	67701186	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67701186A>G	uc001stn.2	+	11	3376	c.2939A>G	c.(2938-2940)TAT>TGT	p.Y980C	CAND1_uc001sto.2_Missense_Mutation_p.Y490C	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	980	HEAT 23.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GGCTCATCATATGCCCGAAGC	0.383													6	362	---	---	---	---	PASS
KRR1	11103	broad.mit.edu	37	12	75899999	75899999	+	Intron	SNP	A	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75899999A>C	uc001sxt.2	-						KRR1_uc009zsc.2_Intron|KRR1_uc010stx.1_3'UTR	NM_007043	NP_008974	Q13601	KRR1_HUMAN	HIV-1 rev binding protein 2						rRNA processing	nucleolus|ribonucleoprotein complex	RNA binding			ovary(1)|pancreas(1)	2						CACATTCTAAAGAAATAAAAT	0.294													32	70	---	---	---	---	PASS
TMTC2	160335	broad.mit.edu	37	12	83525988	83525988	+	Splice_Site	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83525988G>C	uc001szt.2	+	12	2764	c.2332_splice	c.e12-1	p.Y778_splice	TMTC2_uc010suk.1_Splice_Site_p.Y533_splice	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						TCTTGTTGCAGTATCCGGCTG	0.478													72	220	---	---	---	---	PASS
DTX1	1840	broad.mit.edu	37	12	113531851	113531851	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113531851C>G	uc001tuk.1	+	5	1510	c.1174C>G	c.(1174-1176)CCC>GCC	p.P392A		NM_004416	NP_004407	Q86Y01	DTX1_HUMAN	deltex homolog 1	392					negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4						AGGTAAGAATCCCGAGGATGT	0.622													19	73	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121655042	121655042	+	Silent	SNP	A	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121655042A>T	uc001tzr.2	+	2	544	c.240A>T	c.(238-240)GGA>GGT	p.G80G	P2RX4_uc010szr.1_RNA|P2RX4_uc010szs.1_RNA|P2RX4_uc009zxc.2_Silent_p.G80G|P2RX4_uc001tzs.2_Silent_p.G96G|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	80	Extracellular (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTAAACTTGGATTCCGGATCT	0.507													5	430	---	---	---	---	PASS
HIP1R	9026	broad.mit.edu	37	12	123345228	123345228	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123345228A>G	uc001udj.1	+	28	2722	c.2663A>G	c.(2662-2664)GAG>GGG	p.E888G	HIP1R_uc001udk.1_Missense_Mutation_p.E153G	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	888	Important for actin binding.|I/LWEQ.				receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		ACCCGCAGGGAGGCAGCTGAC	0.662											OREG0022225	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	21	---	---	---	---	PASS
LATS2	26524	broad.mit.edu	37	13	21562131	21562131	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21562131G>C	uc009zzs.2	-	4	2153	c.1788C>G	c.(1786-1788)AGC>AGG	p.S596R	LATS2_uc001unr.3_Missense_Mutation_p.S596R	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN	LATS, large tumor suppressor, homolog 2	596					cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		ATGGCGAGTAGCTCTTGATGC	0.512													73	230	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25144710	25144710	+	RNA	SNP	A	G	G	rs3742170	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25144710A>G	uc001upm.2	+	4		c.251A>G								Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						GATGTGTTTAACACAGCCCCT	0.398													5	111	---	---	---	---	PASS
NEK5	341676	broad.mit.edu	37	13	52661584	52661584	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52661584G>C	uc001vge.2	-	15	1422	c.1282C>G	c.(1282-1284)CGT>GGT	p.R428G		NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	428							ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GAAGATGGACGAAGACCCTAT	0.343													44	383	---	---	---	---	PASS
RAB20	55647	broad.mit.edu	37	13	111175974	111175974	+	3'UTR	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111175974C>T	uc001vqy.2	-	2						NM_017817	NP_060287	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			AGACCCCTTCCCAACATGCAC	0.507													44	99	---	---	---	---	PASS
C14orf19	280655	broad.mit.edu	37	14	35409214	35409214	+	RNA	SNP	T	C	C	rs1967723	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35409214T>C	uc010tpo.1	+	1		c.87T>C				NR_002937				Homo sapiens chromosome 14 open reading frame 19 protein (C14orf19) mRNA, 3' UTR.												0						CAACTTCTAATTCATCTCGCC	0.448													81	225	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51208408	51208408	+	Silent	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51208408C>T	uc001wym.2	-	25	5531	c.5340G>A	c.(5338-5340)CTG>CTA	p.L1780L	NIN_uc001wyi.2_Silent_p.L1780L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Silent_p.L1067L|NIN_uc010tqp.1_Silent_p.L1786L|NIN_uc001wyo.2_Silent_p.L1780L|NIN_uc001wyn.2_5'Flank	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1780	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GGGACATTTGCAGGTTTACAT	0.413			T	PDGFRB	MPD								6	447	---	---	---	---	PASS
ADAM21P1	145241	broad.mit.edu	37	14	70714259	70714259	+	5'UTR	SNP	A	G	G	rs7144638	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70714259A>G	uc010ttg.1	-	1						NR_003951				SubName: Full=ADAM21-like protein;												0						CACCACTTCCAGGGAAGTGAA	0.527													9	122	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71524405	71524405	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71524405C>G	uc001xmo.2	+	26	5262	c.4816C>G	c.(4816-4818)CTG>GTG	p.L1606V	PCNX_uc010are.1_Missense_Mutation_p.L1495V|PCNX_uc010arf.1_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1606						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGGCAATGGTCTGGTCACTTT	0.438													89	255	---	---	---	---	PASS
DPF3	8110	broad.mit.edu	37	14	73141008	73141008	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73141008T>C	uc001xnc.2	-	8	824	c.811A>G	c.(811-813)ATG>GTG	p.M271V	DPF3_uc001xnd.1_RNA|DPF3_uc001xnf.2_RNA|DPF3_uc010ari.1_Missense_Mutation_p.M271V|DPF3_uc010ttq.1_Missense_Mutation_p.M281V	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	271	PHD-type 1.				chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TTCTTGTTCATGTTGGAGCCC	0.547													41	86	---	---	---	---	PASS
GTF2A1	2957	broad.mit.edu	37	14	81682787	81682787	+	Silent	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81682787C>T	uc001xvf.1	-	2	534	c.102G>A	c.(100-102)GTG>GTA	p.V34V	GTF2A1_uc010atb.1_5'UTR|GTF2A1_uc001xvg.1_5'UTR|GTF2A1_uc001xvh.1_5'UTR	NM_015859	NP_056943	P52655	TF2AA_HUMAN	TFIIA alpha, p55 isoform 1	34					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)		CTTGTTCATCCACTCCATCAT	0.323													110	355	---	---	---	---	PASS
BTBD7	55727	broad.mit.edu	37	14	93754980	93754980	+	Intron	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93754980T>C	uc001ybo.2	-						BTBD7_uc010aur.2_Intron|BTBD7_uc010two.1_Intron|BTBD7_uc001ybp.2_Intron|BTBD7_uc001ybq.3_Intron|BTBD7_uc001ybr.2_3'UTR	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		tgggttttcatatttaagatt	0.050													107	312	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25616769	25616769	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25616769G>C	uc001zaq.2	-	4	561	c.561C>G	c.(559-561)GAC>GAG	p.D187E	uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.D164E|UBE3A_uc001zas.2_Missense_Mutation_p.D184E|UBE3A_uc001zat.2_Missense_Mutation_p.D164E	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	187					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CTTCATCTTTGTCTTCATCTT	0.423													155	510	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59376341	59376341	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59376341C>T	uc002afv.2	+	9	2590	c.2311C>T	c.(2311-2313)CGC>TGC	p.R771C	RNF111_uc002afs.2_Missense_Mutation_p.R771C|RNF111_uc002aft.2_Missense_Mutation_p.R780C|RNF111_uc002afu.2_Missense_Mutation_p.R770C|RNF111_uc002afw.2_Missense_Mutation_p.R780C|RNF111_uc002afx.2_Missense_Mutation_p.R297C|RNF111_uc002afy.2_5'Flank	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	771	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		GGCACATGAACGCCCCCCACC	0.438													4	150	---	---	---	---	PASS
RAB8B	51762	broad.mit.edu	37	15	63547744	63547744	+	Silent	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63547744C>G	uc002alz.2	+	4	381	c.285C>G	c.(283-285)TCC>TCG	p.S95S	RAB8B_uc010uih.1_Silent_p.S95S	NM_016530	NP_057614	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	95					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)|kidney(1)	2						ATGAAAAATCCTTTGACAATA	0.328													85	181	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66044741	66044741	+	Silent	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66044741G>A	uc002aph.2	-	4	915	c.537C>T	c.(535-537)GTC>GTT	p.V179V	DENND4A_uc002api.2_Silent_p.V179V|DENND4A_uc002apj.3_Silent_p.V179V|DENND4A_uc010ujj.1_Silent_p.V179V	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	179	MABP.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GATTCTTGTCGACTTTGCAGA	0.363													99	287	---	---	---	---	PASS
CLK3	1198	broad.mit.edu	37	15	74918258	74918258	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74918258C>T	uc010uln.1	+	7	1671	c.1210C>T	c.(1210-1212)CCC>TCC	p.P404S	CLK3_uc002ayg.3_Missense_Mutation_p.P256S|CLK3_uc002ayh.3_Missense_Mutation_p.P35S|CLK3_uc002ayj.3_Missense_Mutation_p.P233S|CLK3_uc002ayk.3_Missense_Mutation_p.P183S|CLK3_uc002ayl.3_Missense_Mutation_p.P89S	NM_001130028	NP_001123500	P49761	CLK3_HUMAN	CDC-like kinase 3 isoform a	404	Protein kinase.					acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2						CCAGCCTTACCCCCTACCACA	0.547													5	149	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	83014106	83014106	+	Silent	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83014106T>C	uc010uny.1	-	6	539	c.441A>G	c.(439-441)GTA>GTG	p.V147V	GOLGA6L10_uc010unt.1_RNA|uc002bhl.2_Intron|uc002bhm.2_Intron|GOLGA6L10_uc002bia.1_5'Flank	NM_198181	NP_937824	A6NI86	GG6LA_HUMAN	golgi autoantigen, golgin subfamily a, 6D-like	159	Potential.										0						GTAGCTGCTCTACCTTAGATG	0.498													6	50	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84706465	84706465	+	Silent	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84706465C>T	uc002bjz.3	+	30	5207	c.4983C>T	c.(4981-4983)GAC>GAT	p.D1661D	ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1661	PLAC.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACTGCACAGACACAACTCACT	0.338													16	338	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	21902166	21902166	+	RNA	SNP	C	A	A	rs55667229		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21902166C>A	uc002djs.3	-	2		c.79G>T			uc010vbo.1_RNA|uc002dju.1_5'Flank					Homo sapiens cDNA FLJ45371 fis, clone BRHIP3017855, highly  similar to Homo sapiens nuclear pore complex interacting protein (NPIP).																		TTCTTCATTACAACAGCTACT	0.318													3	46	---	---	---	---	PASS
RRN3P3	100131998	broad.mit.edu	37	16	22441236	22441236	+	RNA	SNP	G	A	A	rs114681793	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22441236G>A	uc002dkp.2	-	5		c.1170C>T			RRN3P3_uc010vbu.1_RNA	NR_027460				Homo sapiens cDNA FLJ31180 fis, clone KIDNE2000266.												0						TGTTCCTCTCGATGATGGTGT	0.507													6	172	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	32070612	32070612	+	RNA	SNP	A	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32070612A>C	uc002ecv.1	+	1		c.65A>C								Homo sapiens IGH mRNA for immunoglobulin heavy chain VHDJ region, partial cds, clone:TRH1-22.																		GGTCTCCTGCAAGGCTTCTGG	0.552													4	71	---	---	---	---	PASS
NLGN2	57555	broad.mit.edu	37	17	7319145	7319145	+	Silent	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7319145G>C	uc002ggt.1	+	6	1426	c.1353G>C	c.(1351-1353)CTG>CTC	p.L451L		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2 precursor	451	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)				GCAAAACCCTGCTGGCGCTCT	0.572													14	40	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8733086	8733086	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8733086G>T	uc002glq.1	-	10	1066	c.826C>A	c.(826-828)CCA>ACA	p.P276T	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	276					platelet activation	cytosol					0						GGAATGCTTGGTGGCCGCTCT	0.612													5	79	---	---	---	---	PASS
FAM18B2	201158	broad.mit.edu	37	17	15441536	15441536	+	Intron	SNP	C	A	A	rs143358115	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15441536C>A	uc002goq.2	-						CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron|FAM18B2_uc010cor.2_3'UTR	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		GGACTTGGGGCCTAGGCCTAG	0.358													16	310	---	---	---	---	PASS
SPAG5	10615	broad.mit.edu	37	17	26905536	26905536	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26905536T>A	uc002hbq.2	-	21	3301	c.3209A>T	c.(3208-3210)GAG>GTG	p.E1070V	ALDOC_uc002hbp.2_5'Flank|ALDOC_uc010cro.2_5'Flank	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1070	Potential.				cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					GGTCACCTCCTCTCTAAGGCT	0.537													27	60	---	---	---	---	PASS
SGK494	124923	broad.mit.edu	37	17	26939689	26939689	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26939689G>T	uc002hbr.1	-	5	526	c.494C>A	c.(493-495)CCC>CAC	p.P165H	SGK494_uc010waq.1_Intron|SGK494_uc010war.1_Intron|uc010crq.1_5'Flank|uc002hbs.1_Intron	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						GTGTACAAAGGGATGGTTGAT	0.488													58	183	---	---	---	---	PASS
SUZ12	23512	broad.mit.edu	37	17	30321020	30321020	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30321020A>C	uc002hgs.2	+	12	1652	c.1430A>C	c.(1429-1431)AAC>ACC	p.N477T	SUZ12_uc002hgt.2_Missense_Mutation_p.N454T	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	477					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TTTATCTTCAACTATGTTGTG	0.249			T	JAZF1	endometrial stromal tumours								78	162	---	---	---	---	PASS
ZNF830	91603	broad.mit.edu	37	17	33289804	33289804	+	3'UTR	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33289804C>A	uc002hih.3	+	1					CCT6B_uc002hig.2_5'Flank|CCT6B_uc010ctg.2_5'Flank|CCT6B_uc010wcc.1_5'Flank	NM_052857	NP_443089	Q96NB3	ZN830_HUMAN	coiled-coil domain containing 16						cell division|mitosis	cytoplasm|nucleus	metal ion binding			breast(1)	1		Ovarian(249;0.17)				GATTTGGGTACCTGGATTGCT	0.388													38	105	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38508596	38508596	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38508596A>G	uc002huk.1	+	6	1099	c.644A>G	c.(643-645)GAA>GGA	p.E215G	RARA_uc002hul.3_Missense_Mutation_p.E215G|RARA_uc010wfe.1_Missense_Mutation_p.E118G|RARA_uc002hun.1_Missense_Mutation_p.E210G	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	215	Ligand-binding.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	AACAGCTCAGAACAACGTGTC	0.587			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								27	94	---	---	---	---	PASS
KRTAP9-4	85280	broad.mit.edu	37	17	39406492	39406492	+	3'UTR	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39406492T>C	uc002hwi.2	+	1					KRTAP9-9_uc010wfq.1_Intron	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TCAACTGACTTATCTTTTGGG	0.443													5	144	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630635	44630635	+	3'UTR	SNP	A	G	G	rs150521815	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630635A>G	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TACACAGCATACAATTCCTGT	0.239													20	313	---	---	---	---	PASS
TLK2	11011	broad.mit.edu	37	17	60637441	60637441	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60637441G>A	uc010ddp.2	+	10	1053	c.785G>A	c.(784-786)CGA>CAA	p.R262Q	TLK2_uc002izx.3_Missense_Mutation_p.R110Q|TLK2_uc002izz.3_Missense_Mutation_p.R262Q|TLK2_uc002jaa.3_Missense_Mutation_p.R230Q|TLK2_uc010wpd.1_Missense_Mutation_p.R230Q	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	262	Potential.		R -> Q.		cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						TACAAGGAACGATTAAATAGA	0.358													8	546	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66040181	66040181	+	Silent	SNP	C	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66040181C>G	uc002jgk.2	+	8	1290	c.1158C>G	c.(1156-1158)CTC>CTG	p.L386L	KPNA2_uc002jgl.2_Silent_p.L386L	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	386	NLS binding site (minor) (By similarity).|ARM 8.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCAGTGTTCTCTCTAAGGTAA	0.418													16	250	---	---	---	---	PASS
ZNF20	7568	broad.mit.edu	37	19	12258560	12258560	+	Translation_Start_Site	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12258560G>T	uc002mtg.1	-	2	217	c.-348C>A	c.(-350--346)TGCTG>TGATG		ZNF625_uc010dyn.1_RNA|ZNF625_uc002mth.2_Translation_Start_Site|ZNF625_uc010dyo.1_Translation_Start_Site	NM_021143	NP_066966	P17024	ZNF20_HUMAN	zinc finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAAGGATCCAGCAAAGCCCAC	0.458													48	123	---	---	---	---	PASS
RAB3A	5864	broad.mit.edu	37	19	18309636	18309636	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18309636G>C	uc002nie.2	-	4	540	c.371C>G	c.(370-372)TCA>TGA	p.S124*		NM_002866	NP_002857	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	124					glutamate secretion|protein transport|small GTPase mediated signal transduction	clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|plasma membrane|synaptic vesicle	GTP binding|GTPase activity				0						ATTGTCCCATGAGTAGGTCTT	0.592													29	70	---	---	---	---	PASS
TM6SF2	53345	broad.mit.edu	37	19	19380554	19380554	+	Silent	SNP	G	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19380554G>C	uc002nmd.1	-	5	476	c.426C>G	c.(424-426)CTC>CTG	p.L142L	HAPLN4_uc002nmc.2_5'UTR	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	142	Helical; (Potential).					integral to membrane					0			Epithelial(12;0.0151)			CCAGCCAGTAGAGTCCAAAAT	0.542													31	95	---	---	---	---	PASS
ZNF546	339327	broad.mit.edu	37	19	40519782	40519782	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40519782T>C	uc002oms.2	+	7	861	c.605T>C	c.(604-606)ATA>ACA	p.I202T	ZNF546_uc002omt.2_Missense_Mutation_p.I176T	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	202					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAAAAACAAATATCTCATCCT	0.353													44	270	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53879109	53879109	+	5'UTR	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53879109G>A	uc010ydx.1	+	3					ZNF525_uc010eqn.2_5'UTR|ZNF525_uc002qbl.2_RNA	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		CTCTATACAGGGACGTGATGC	0.463													7	238	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243618	56243618	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243618G>A	uc002qly.2	-	2	1607	c.1579C>T	c.(1579-1581)CTT>TTT	p.L527F		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	527						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AAACTTTCAAGGCATTGGGTT	0.383													33	85	---	---	---	---	PASS
RASSF2	9770	broad.mit.edu	37	20	4764849	4764849	+	3'UTR	SNP	G	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4764849G>T	uc002wld.2	-	11					RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_3'UTR|RASSF2_uc010gbh.2_Intron	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2						cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						GAAAGAAAGTGCCTAGCTTCC	0.552													25	91	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633987	29633987	+	Intron	SNP	T	A	A	rs4006817		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633987T>A	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGAATAAAATATTCAGAGGA	0.308													14	297	---	---	---	---	PASS
ZHX3	23051	broad.mit.edu	37	20	39831405	39831405	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39831405C>T	uc002xjs.1	-	3	2530	c.2152G>A	c.(2152-2154)GCA>ACA	p.A718T	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.A718T|ZHX3_uc002xjt.1_Missense_Mutation_p.A718T|ZHX3_uc002xju.1_Missense_Mutation_p.A718T|ZHX3_uc002xjv.1_Missense_Mutation_p.A718T|ZHX3_uc002xjw.1_Missense_Mutation_p.A718T|ZHX3_uc010ggg.1_Missense_Mutation_p.A718T	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	718					negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				TTGCGCTCTGCCAAGATATGG	0.547													31	98	---	---	---	---	PASS
DNTTIP1	116092	broad.mit.edu	37	20	44439797	44439797	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44439797A>G	uc002xpk.2	+	13	1021	c.953A>G	c.(952-954)AAT>AGT	p.N318S	UBE2C_uc002xpl.2_5'Flank|UBE2C_uc002xpm.2_5'Flank|UBE2C_uc002xpn.2_5'Flank|UBE2C_uc002xpo.2_5'Flank|UBE2C_uc002xpp.2_5'Flank|UBE2C_uc002xpq.2_5'Flank	NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting	318						nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				CGGACAGAGAATGAGCATCGT	0.547													5	128	---	---	---	---	PASS
C20orf85	128602	broad.mit.edu	37	20	56728656	56728656	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56728656G>A	uc002xyv.2	+	2	163	c.125G>A	c.(124-126)GGG>GAG	p.G42E		NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	hypothetical protein LOC128602	42										ovary(1)	1	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			CAGAACTGGGGGTTTTTAACA	0.423													46	125	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37602748	37602748	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37602748A>G	uc002yvg.2	+	14	1745	c.1666A>G	c.(1666-1668)AGT>GGT	p.S556G	DOPEY2_uc011aeb.1_Missense_Mutation_p.S556G	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	556					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TTTTTTACAGAGTCCAGTAAA	0.358													6	223	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40568354	40568354	+	Intron	SNP	C	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40568354C>A	uc002yxk.1	-						BRWD1_uc010goc.1_Intron|BRWD1_uc002yxl.2_Missense_Mutation_p.S2214I	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATCATCCACACTTAACCTAGG	0.368													157	478	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	20980390	20980390	+	RNA	SNP	A	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20980390A>G	uc002zsv.2	-	4		c.1389T>C								Homo sapiens, clone IMAGE:5171202, mRNA.																		TACCAGTAGAAAGCTGGGCCG	0.473													20	47	---	---	---	---	PASS
SERHL2	253190	broad.mit.edu	37	22	42952207	42952207	+	Intron	SNP	C	T	T	rs142212902		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42952207C>T	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_RNA	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						GTCACAGTGACAGTCCTTATA	0.587													6	111	---	---	---	---	PASS
CYB5R3	1727	broad.mit.edu	37	22	43024289	43024289	+	Splice_Site	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43024289T>A	uc003bcz.2	-	5	418	c.334_splice	c.e5-1	p.V112_splice	CYB5R3_uc010gzc.1_Splice_Site|CYB5R3_uc003bcw.2_Splice_Site_p.V102_splice|CYB5R3_uc011aps.1_Splice_Site_p.V145_splice|CYB5R3_uc003bcy.2_Splice_Site_p.V89_splice|CYB5R3_uc003bcx.2_Splice_Site_p.V89_splice	NM_000398	NP_000389	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3 isoform m						blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity			skin(1)	1					NADH(DB00157)	GAAGTAAACCTGCAAGACACC	0.582													4	55	---	---	---	---	PASS
POU3F4	5456	broad.mit.edu	37	X	82763423	82763423	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82763423T>C	uc004eeg.2	+	1	155	c.91T>C	c.(91-93)TTC>CTC	p.F31L		NM_000307	NP_000298	P49335	PO3F4_HUMAN	POU domain, class 3, transcription factor 4	31					sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGGGAGTCCTTTCCGCAACCC	0.587													9	12	---	---	---	---	PASS
ARMCX3	51566	broad.mit.edu	37	X	100880895	100880895	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100880895T>A	uc004ehz.1	+	5	1459	c.926T>A	c.(925-927)TTT>TAT	p.F309Y	ARMCX3_uc004eia.1_Missense_Mutation_p.F309Y|ARMCX3_uc004eib.1_Missense_Mutation_p.F309Y|ARMCX3_uc004eic.1_Missense_Mutation_p.F309Y	NM_016607	NP_057691	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	309						integral to membrane	binding			ovary(1)|lung(1)	2						CTGGTCATATTTGAGAACATA	0.353													24	17	---	---	---	---	PASS
MAGEA1	4100	broad.mit.edu	37	X	152482392	152482392	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152482392C>T	uc004fhf.2	-	3	839	c.619G>A	c.(619-621)GGC>AGC	p.G207S		NM_004988	NP_004979	P43355	MAGA1_HUMAN	melanoma antigen family A, 1	207	MAGE.					cytoplasm|plasma membrane				central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAGCATGGCCGCCCTCCATT	0.552													5	121	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1588535	1588536	+	Intron	INS	-	TAA	TAA	rs138141689	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1588535_1588536insTAA	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|uc001ahc.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						TATGAACATACTAATGAACCGA	0.292													19	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	1881003	1881004	+	IGR	INS	-	G	G	rs72502757		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1881003_1881004insG								TMEM52 (30263 upstream) : KIAA1751 (3748 downstream)																							tggaactttcttaagttttgac	0.050													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4325354	4325354	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4325354delG								LOC100133612 (491477 upstream) : LOC284661 (146757 downstream)																							tataaattttggggggatata	0.000													4	2	---	---	---	---	
OTUD3	23252	broad.mit.edu	37	1	20221029	20221030	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20221029_20221030insA	uc001bcs.3	+							NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN	OTU domain containing 3												0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGCTTTGGGAATATCCGAAG	0.401													85	65	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34379913	34379914	+	Intron	INS	-	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34379913_34379914insG	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TAAGGTGGTCTGGGGGTGAGGG	0.431													4	2	---	---	---	---	
C1orf94	84970	broad.mit.edu	37	1	34684572	34684577	+	3'UTR	DEL	ACACAT	-	-	rs3831264	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34684572_34684577delACACAT	uc001bxs.3	+	7					C1orf94_uc001bxt.2_3'UTR	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b								protein binding				0		Myeloproliferative disorder(586;0.0393)				ACACACACACACACATGACCCTCATA	0.374													26	15	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39770238	39770238	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39770238delT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			cttttctttcttttttttttt	0.159													4	2	---	---	---	---	
ERI3	79033	broad.mit.edu	37	1	44773661	44773661	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44773661delT	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971	O43414	ERI3_HUMAN	prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3						TGGCTTAAAATTTTTTTTTCC	0.284													5	3	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49079176	49079176	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49079176delG	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ATTTTTGTTTGCCTAAGAATC	0.284													4	2	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49087493	49087494	+	Intron	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49087493_49087494insT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ttctgtggccattttttttttt	0.015													4	2	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49121001	49121001	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49121001delT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		tctttttttcttttttctttG	0.368													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57485008	57485009	+	Intron	DEL	TT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57485008_57485009delTT	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						TGGTGGCAGGTTTTTTTTCCCC	0.426													4	2	---	---	---	---	
PGM1	5236	broad.mit.edu	37	1	64104167	64104180	+	Intron	DEL	AATCCACATATAAT	-	-	rs138606894		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64104167_64104180delAATCCACATATAAT	uc001dbh.2	+						PGM1_uc010ooy.1_Intron|PGM1_uc010ooz.1_Intron	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1						cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3						GCCTTCTCTGAATCCACATATAATAGCCCATTGT	0.360													22	18	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67358749	67358750	+	Intron	DEL	AA	-	-	rs12738212		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67358749_67358750delAA	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						agagagagagaaagaaagaaag	0.089													22	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68884822	68884822	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68884822delT								WLS (186569 upstream) : RPE65 (9685 downstream)																							AAAGCTTTAGTTTTTTTCCCC	0.244													4	2	---	---	---	---	
LHX8	431707	broad.mit.edu	37	1	75599880	75599880	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75599880delA	uc001dgo.2	+						uc001dgp.1_5'Flank|LHX8_uc001dgq.2_5'Flank	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						CTTTAGTACTAAACCTGAAGT	0.393													4	2	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76823816	76823816	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76823816delT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						ttttgctggcttttttgcccc	0.159													4	2	---	---	---	---	
MGC27382	149047	broad.mit.edu	37	1	78718616	78718617	+	Intron	INS	-	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78718616_78718617insC	uc001dil.1	+						MGC27382_uc009wcc.2_Intron					Homo sapiens cDNA FLJ34438 fis, clone HLUNG2001144.												0						tcctcttaaagaacagatttat	0.074													4	2	---	---	---	---	
ODF2L	57489	broad.mit.edu	37	1	86850155	86850160	+	Intron	DEL	AAAAAT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86850155_86850160delAAAAAT	uc001dll.1	-						ODF2L_uc001dlm.1_Intron|ODF2L_uc001dln.2_Intron|ODF2L_uc001dlo.2_Intron|ODF2L_uc001dlp.2_Intron|ODF2L_uc010osg.1_Intron|ODF2L_uc001dlq.1_Intron|ODF2L_uc009wcr.1_Intron	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform							centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTTTGAGATGAAAAATAAAAATACAT	0.248													20	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	96805853	96805854	+	IGR	DEL	AC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96805853_96805854delAC								None (None upstream) : PTBP2 (381321 downstream)																							acacacacaaacacacacacac	0.050													4	2	---	---	---	---	
SLC30A7	148867	broad.mit.edu	37	1	101372783	101372783	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101372783delT	uc001dtn.2	+						SLC30A7_uc001dto.2_Intron	NM_001144884	NP_001138356	Q8NEW0	ZNT7_HUMAN	zinc transporter like 2						zinc ion transport	Golgi apparatus|integral to membrane	cation transmembrane transporter activity|protein binding				0		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		ATTTCTCAACTTTTTTTTGAA	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	109070186	109070187	+	IGR	DEL	TA	-	-	rs145723579		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109070186_109070187delTA								NBPF6 (56927 upstream) : FAM102B (32784 downstream)																							TCTCTCTCTCtatatatatata	0.198													21	10	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	114015303	114015304	+	Intron	DEL	TG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114015303_114015304delTG	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		tgtgtgtgtatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
NBPF7	343505	broad.mit.edu	37	1	120381686	120381687	+	Intron	INS	-	T	T	rs144031576	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120381686_120381687insT	uc010oxk.1	-							NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		gtgattataTGGAGCACCTAGC	0.213													43	23	---	---	---	---	
LOC647121	647121	broad.mit.edu	37	1	121309340	121309340	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121309340delT	uc009wht.1	+						LOC647121_uc001eiu.1_Intron					Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						GTGGGATTTCTTTTTTTTAGA	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121381832	121381833	+	IGR	INS	-	T	T	rs146968468	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121381832_121381833insT								LOC647121 (68146 upstream) : None (None downstream)																							aagattatcccttttccatcga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142536768	142536770	+	IGR	DEL	AGA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142536768_142536770delAGA								None (None upstream) : None (None downstream)																							aatggaatggaGAAAtgcaatgg	0.005													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142555309	142555310	+	IGR	INS	-	T	T	rs138506031	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142555309_142555310insT								None (None upstream) : None (None downstream)																							AAAATAATGCATTTTTTTCTCA	0.312													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142663276	142663277	+	Intron	DEL	AA	-	-	rs61807144		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663276_142663277delAA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		CATTTTTAGCAAAGTTGTTGCA	0.540													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143255819	143255820	+	RNA	INS	-	TTTT	TTTT	rs145582883		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143255819_143255820insTTTT	uc001eiw.1	+	8		c.2152_2153insTTTT								Homo sapiens PNAS-130 mRNA, complete cds.																		gtcaatatggatttttttttga	0.000													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144983239	144983240	+	Intron	DEL	CT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144983239_144983240delCT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emg.1_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATAGAGCCTCCTCTCTCTGTGC	0.485			T	PDGFRB	MPD								3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145195054	145195054	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145195054delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CCAACTTTGAGGGGGCACTGA	0.433													4	2	---	---	---	---	
COPA	1314	broad.mit.edu	37	1	160269249	160269249	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160269249delT	uc009wti.2	-						COPA_uc001fvv.3_Intron	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGCACGATCTTTATATGCTA	0.328													5	5	---	---	---	---	
CD84	8832	broad.mit.edu	37	1	160535663	160535663	+	Intron	DEL	T	-	-	rs34290381		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160535663delT	uc001fwh.3	-						CD84_uc001fwf.3_Intron|CD84_uc001fwg.3_Intron|CD84_uc009wtn.2_Intron|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Intron|CD84_uc001fwk.2_Intron	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule						blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TGAGGATGCCTTTTTTTTTTT	0.378													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184080017	184080018	+	IGR	DEL	CA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184080017_184080018delCA								TSEN15 (36676 upstream) : C1orf21 (276132 downstream)																							cacaccactgcacacacacacc	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188334385	188334385	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188334385delA								None (None upstream) : None (None downstream)																							tcaaatcagcaagatcttaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195835523	195835523	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195835523delA								None (None upstream) : KCNT2 (359390 downstream)																							CTAACTCAATAAAAAAAAAAG	0.333													4	2	---	---	---	---	
KCNT2	343450	broad.mit.edu	37	1	196352062	196352062	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196352062delA	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc009wyv.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TCAAGGAGTGAAAAAAAAAGG	0.378													4	2	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202194839	202194841	+	Intron	DEL	TCC	-	-	rs6143572		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202194839_202194841delTCC	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						TAGCTTTCATTCCTCTTTGAAAC	0.369													13	9	---	---	---	---	
LRRN2	10446	broad.mit.edu	37	1	204632060	204632060	+	Intron	DEL	A	-	-	rs111337144		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204632060delA	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ACTGAGCTGGAAAAAAAAAGG	0.254													4	2	---	---	---	---	
NFASC	23114	broad.mit.edu	37	1	204949122	204949122	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204949122delG	uc001hbj.2	+						NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Intron|NFASC_uc001hbk.1_Intron|NFASC_uc001hbl.1_5'Flank	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TAGAGATGCTGCCCAAAAAAA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	219443615	219443615	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219443615delG								LYPLAL1 (57409 upstream) : SLC30A10 (415154 downstream)																							agttcagagtggaagtttaat	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230558840	230558840	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230558840delT								PGBD5 (45473 upstream) : COG2 (219362 downstream)																							catacacacatttacataccc	0.199													4	2	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235993390	235993390	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235993390delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron|LYST_uc001hxl.1_Intron|LYST_uc001hxm.2_Intron|LYST_uc001hxn.1_3'UTR	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATAGGTCCACTTTTTTTTTAG	0.289									Chediak-Higashi_syndrome				12	6	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236385071	236385072	+	Intron	INS	-	TTAATA	TTAATA	rs10647377		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236385071_236385072insTTAATA	uc001hxt.2	-							NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			ACACATATACTTTAATTTTTTC	0.282													40	18	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236395936	236395937	+	Intron	INS	-	T	T	rs147783883	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236395936_236395937insT	uc001hxt.2	-							NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			GAAAAATGGTCTTTTTTTTTTA	0.252													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236491280	236491281	+	IGR	INS	-	A	A	rs150968907	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236491280_236491281insA								ERO1LB (45941 upstream) : EDARADD (66399 downstream)																							GAGGGGGAAGTAAAAAAAAAAC	0.317													3	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237765644	237765644	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237765644delA	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGCCTATAGAAAAAAAAATG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238655712	238655712	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238655712delG								LOC339535 (6395 upstream) : CHRM3 (894153 downstream)																							GCACAGACCTGGGCAAAGGGA	0.627													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246412822	246412823	+	Intron	INS	-	T	T	rs1622402		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246412822_246412823insT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CTAGTTTTTTGTTTTTTTTGTA	0.233													4	2	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					Tacacacacacgcacacacaca	0.198													40	35	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10740730	10740733	+	Intron	DEL	AAAT	-	-	rs35625977		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10740730_10740733delAAAT	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		ATTTTGAAACaaataagacaggaa	0.118													13	15	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17907512	17907513	+	Intron	INS	-	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17907512_17907513insG	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ACAATTTCCTAATCTAGGAAAT	0.267													102	71	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17907515	17907515	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17907515delC	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATTTCCTAATCTAGGAAATTG	0.264													105	71	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17907519	17907524	+	Intron	DEL	GAAATT	-	-	rs72184634		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17907519_17907524delGAAATT	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCTAATCTAGGAAATTGAATTACTTT	0.257													109	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22225324	22225324	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22225324delT								APOB (958379 upstream) : None (None downstream)																							TAAAGAACAATTTttttggtt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23271720	23271721	+	IGR	DEL	CT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23271720_23271721delCT								None (None upstream) : KLHL29 (483734 downstream)																							CCTCTGGCTGCTCTCTCTCTCT	0.371													5	4	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29462601	29462601	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29462601delT	uc002rmy.2	-	13	3207	c.2300delA	c.(2299-2301)AAGfs	p.K767fs		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	767	Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	CATGTCATCCTTCTCCAGGTT	0.612			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				58	25	---	---	---	---	
CAPN14	440854	broad.mit.edu	37	2	31436033	31436033	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31436033delG	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594	A8MX76	CAN14_HUMAN	calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						gaaggcaagtgagtttgccac	0.070													10	5	---	---	---	---	
RASGRP3	25780	broad.mit.edu	37	2	33760622	33760623	+	Intron	INS	-	C	C	rs146202085	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33760622_33760623insC	uc002rox.2	+						RASGRP3_uc010ync.1_Intron|RASGRP3_uc002roy.2_Intron	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					GGCAGTGAGAGCCGTCCTCTGG	0.480													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34703685	34703685	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34703685delA								MYADML (750401 upstream) : None (None downstream)																							TTTTGTAGTTAAAAAAATAAT	0.154													4	2	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37233065	37233066	+	Intron	DEL	CT	-	-	rs5830447		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37233065_37233066delCT	uc002rpp.1	-						HEATR5B_uc010ezy.1_Intron	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				AACAGCCAAACTCAACATAAGG	0.292													16	12	---	---	---	---	
CEBPZ	10153	broad.mit.edu	37	2	37442339	37442340	+	Intron	DEL	GT	-	-	rs3841525		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37442339_37442340delGT	uc002rpz.2	-							NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				TGTCAGTGCCGTTACAGTGAAA	0.386													8	6	---	---	---	---	
CDC42EP3	10602	broad.mit.edu	37	2	37877088	37877089	+	Intron	INS	-	CAT	CAT			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37877088_37877089insCAT	uc002rqi.1	-							NM_006449	NP_006440	Q9UKI2	BORG2_HUMAN	Cdc42 effector protein 3						regulation of cell shape|signal transduction	actin cytoskeleton|cytoplasm|endomembrane system|membrane	cytoskeletal regulatory protein binding				0		all_hematologic(82;0.172)				ACAAATATTTACATCATATTTA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43333652	43333652	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43333652delA								HAAO (313901 upstream) : ZFP36L2 (115890 downstream)																							ttctgagtctaaaactccaca	0.239											OREG0014577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
FSHR	2492	broad.mit.edu	37	2	49218031	49218032	+	Intron	INS	-	AA	AA	rs147687628	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49218031_49218032insAA	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	CAGTATACATTAAAAAAAAAAC	0.347									Gonadal_Dysgenesis_46_XX				8	4	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54701064	54701064	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54701064delA	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TTCCAGACATAAAAAATCTAT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58104420	58104421	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58104420_58104421insT								None (None upstream) : VRK2 (30365 downstream)																							GGTGGAGTGCCTTTTTTTTATT	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66328184	66328184	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66328184delA								SPRED2 (668528 upstream) : MEIS1 (334348 downstream)																							accctgtctcaaaaaaaaaaG	0.219													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66773420	66773420	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66773420delT	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						GCTGGTGGTGTTAGGAAAACA	0.502													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87423423	87423424	+	Intron	DEL	CT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87423423_87423424delCT	uc002srs.3	+						uc002ssh.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						tccaaaacacctctctcttcgg	0.069													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90438542	90438542	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90438542delT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		tgattttctgtcacttctttt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91629650	91629651	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91629650_91629651insT								None (None upstream) : LOC654342 (175541 downstream)																							GAAACtaaaaattttaaaaata	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766729	91766730	+	IGR	INS	-	AG	AG	rs141003417		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766729_91766730insAG								None (None upstream) : LOC654342 (38462 downstream)																							GGAGCTGTAACACTATTTGTGA	0.317													46	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92317886	92317886	+	IGR	DEL	T	-	-	rs71254507		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317886delT								FKSG73 (187392 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96606834	96606838	+	Intron	DEL	GTTTC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96606834_96606838delGTTTC	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		CACCACCTTTGTTTCTTTGTACACA	0.244													108	54	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96610787	96610788	+	5'Flank	INS	-	A	A	rs148448972	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96610787_96610788insA	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		actctgtctacaaaaaataaga	0.104													161	162	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96617496	96617496	+	Intron	DEL	A	-	-	rs141504763		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96617496delA	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		AACTAATAATAAAAAAAGTAA	0.249													9	4	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97817803	97817807	+	Intron	DEL	CACTG	-	-	rs5832831		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97817803_97817807delCACTG	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						gatcttggctcactgcagtttccat	0.024													85	59	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97827943	97827944	+	Intron	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97827943_97827944insT	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_5'Flank	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						TTTGTGTACAAAGAAACAAAGG	0.248													148	72	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97827945	97827949	+	Intron	DEL	GAAAC	-	-	rs4092202		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97827945_97827949delGAAAC	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_5'Flank	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						TGTGTACAAAGAAACAAAGGTGGTG	0.244													145	72	---	---	---	---	
MFSD9	84804	broad.mit.edu	37	2	103340443	103340450	+	Intron	DEL	CCTCTATC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103340443_103340450delCCTCTATC	uc002tcb.2	-						MFSD9_uc010fja.2_Intron	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						CTGTGCTTAACCTCTATCCCTGATGGAG	0.341													9	11	---	---	---	---	
BUB1	699	broad.mit.edu	37	2	111405134	111405134	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111405134delA	uc002tgc.2	-						BUB1_uc010yxh.1_Intron|BUB1_uc010fkb.2_Intron	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1						apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		acttatgattaaaaaaaaaac	0.000													4	2	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122144921	122144921	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122144921delT	uc002tnc.2	-						CLASP1_uc010yyv.1_Intron|CLASP1_uc002tmz.2_Intron|CLASP1_uc002tna.2_Intron|CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tnf.2_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CCCAGGATGGTTTTTTTTTTC	0.328													4	3	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122226597	122226597	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122226597delG	uc002tnc.2	-						CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					gtggtcctttggatggggttt	0.045													4	2	---	---	---	---	
AMMECR1L	83607	broad.mit.edu	37	2	128633536	128633536	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128633536delT	uc002tpl.2	-						AMMECR1L_uc002tpm.2_Intron	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like											central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		cccagctatcttttttttttt	0.010													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132774380	132774380	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132774380delT								C2orf27B (215146 upstream) : NCRNA00164 (130784 downstream)																							TATACCAAGCTTGTGGGATTC	0.383													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133114175	133114182	+	IGR	DEL	TTCTTTTT	-	-	rs36080411		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133114175_133114182delTTCTTTTT								NCRNA00164 (98633 upstream) : GPR39 (59965 downstream)																							Cttcttcttcttcttttttttttttttt	0.130													4	2	---	---	---	---	
ORC4L	5000	broad.mit.edu	37	2	148772683	148772683	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148772683delA	uc002twi.2	-						ORC4L_uc002twj.2_Intron|ORC4L_uc010zbo.1_Intron|ORC4L_uc010zbp.1_Intron|ORC4L_uc010fnr.2_Intron|ORC4L_uc010zbq.1_Intron|ORC4L_uc002twk.2_Intron|ORC4L_uc010zbr.1_Intron	NM_181741	NP_859525	O43929	ORC4_HUMAN	origin recognition complex subunit 4						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)		TGACTAGGAGAAAAAAAAAAA	0.214													3	3	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173865689	173865699	+	Intron	DEL	CCCACATGTGA	-	-	rs111316320		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173865689_173865699delCCCACATGTGA	uc002uhv.3	+						RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron|RAPGEF4_uc010zef.1_Intron|RAPGEF4_uc010zeg.1_Intron|RAPGEF4_uc010zeh.1_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TATGGTACTGCCCACATGTGACCCTTTAAGT	0.365													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174615626	174615627	+	IGR	DEL	GT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174615626_174615627delGT								CDCA7 (381908 upstream) : SP3 (157632 downstream)																							TGGTAGAGGGgtgtgtgtgtgt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177247634	177247634	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177247634delT								MTX2 (44883 upstream) : MIR1246 (218074 downstream)																							CTTTCTGAGATTTACTCTATT	0.313													4	2	---	---	---	---	
MYO1B	4430	broad.mit.edu	37	2	192161103	192161104	+	Intron	INS	-	TTCT	TTCT	rs145134787	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192161103_192161104insTTCT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002uss.1_Intron	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			tttaattgttattattttaaat	0.257													26	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206671160	206671162	+	IGR	DEL	AAG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206671160_206671162delAAG								NRP2 (8304 upstream) : INO80D (187284 downstream)																							CTCTGGGCTTAAGAAGAAGAGAG	0.527													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218604303	218604303	+	Intron	DEL	A	-	-	rs112192644		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218604303delA	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						CCAGGACTAGAAAAAAAAAAA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221315058	221315058	+	IGR	DEL	A	-	-	rs146948797	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221315058delA								SLC4A3 (808357 upstream) : EPHA4 (967691 downstream)																							gaggatgctgaacctgtggat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224323922	224323923	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224323922_224323923insT								KCNE4 (403569 upstream) : SCG2 (137737 downstream)																							GTTTCTCAGCATTGCAGCTTCA	0.431													4	2	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866713	224866716	+	Intron	DEL	AGAT	-	-	rs149030278		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866713_224866716delAGAT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		tttttcccccagatagagactcgt	0.127													14	7	---	---	---	---	
RHBDD1	84236	broad.mit.edu	37	2	227773299	227773302	+	Intron	DEL	ACAC	-	-	rs10559846		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227773299_227773302delACAC	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		ATTTTCCACTacacacacacacac	0.377													18	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	231033634	231033634	+	IGR	DEL	T	-	-	rs33940219		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231033634delT								FBXO36 (85618 upstream) : SP110 (11 downstream)																							gaagtattaatttttttTTTT	0.159													8	4	---	---	---	---	
CHRNG	1146	broad.mit.edu	37	2	233408190	233408191	+	Intron	INS	-	C	C	rs142201594		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233408190_233408191insC	uc002vsx.1	+						CHRNG_uc010fye.1_Intron	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma						muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		CCCTCCATCCACCCCCCCCATC	0.619													28	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239602913	239602913	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239602913delA								ASB1 (242023 upstream) : TWIST2 (153760 downstream)																							aaagagagggaaaagagaaac	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	2062307	2062307	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2062307delT								CNTN6 (617030 upstream) : CNTN4 (78243 downstream)																							TTTGTTCCCATTTCAGGTAAG	0.259													4	2	---	---	---	---	
GRM7	2917	broad.mit.edu	37	3	7399582	7399583	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7399582_7399583insA	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	TTTAGCTATGGAAAAAAAAACC	0.119													4	2	---	---	---	---	
SYN2	6854	broad.mit.edu	37	3	12198608	12198609	+	Intron	INS	-	A	A	rs60422800		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12198608_12198609insA	uc003bwm.2	+						SYN2_uc003bwl.1_Intron|SYN2_uc003bwn.2_Intron|TIMP4_uc003bwo.2_Intron	NM_133625	NP_598328	Q92777	SYN2_HUMAN	synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2						AAAACAACAACAACAAAAAACA	0.441													12	7	---	---	---	---	
PPARG	5468	broad.mit.edu	37	3	12346545	12346546	+	Intron	DEL	TT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12346545_12346546delTT	uc003bwr.2	+						PPARG_uc003bws.2_Intron|PPARG_uc003bwu.2_Intron|PPARG_uc003bwq.1_Intron|PPARG_uc010hdz.1_Intron|PPARG_uc003bwt.1_Intron	NM_138712	NP_619726	P37231	PPARG_HUMAN	peroxisome proliferative activated receptor						activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)	tttcctcctCTTTTCCCCTCAA	0.149			T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	13271810	13271811	+	IGR	INS	-	A	A	rs151322485	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13271810_13271811insA								IQSEC1 (157193 upstream) : NUP210 (85926 downstream)																							gatttcccctcaaacgctcaca	0.000													4	4	---	---	---	---	
RARB	5915	broad.mit.edu	37	3	25635836	25635836	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25635836delT	uc011awl.1	+						RARB_uc003cdi.1_Intron|RARB_uc003cdh.2_Intron	NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GGGGGGGCAGTTTTTTTTTGT	0.368													13	7	---	---	---	---	
LIMD1	8994	broad.mit.edu	37	3	45677635	45677636	+	Intron	INS	-	T	T	rs5848761		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45677635_45677636insT	uc003coq.2	+							NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		TTCTCTTGTCCTGCAAGGAGCC	0.520													82	50	---	---	---	---	
LIMD1	8994	broad.mit.edu	37	3	45677639	45677639	+	Intron	DEL	A	-	-	rs5848762		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45677639delA	uc003coq.2	+							NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CTTGTCCTGCAAGGAGCCTGT	0.517													80	52	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49364972	49364972	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49364972delA	uc003cwq.2	-						USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		actccatctcaaaaaaaaaaG	0.199													4	5	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52713306	52713307	+	Intron	INS	-	C	C	rs146579424	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52713306_52713307insC	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		tgggcttgtttccacatggcta	0.030			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								3	5	---	---	---	---	
SUCLG2	8801	broad.mit.edu	37	3	67659682	67659699	+	Intron	DEL	CACCATGTGATTCCTGCA	-	-	rs71830786		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67659682_67659699delCACCATGTGATTCCTGCA	uc003dna.3	-							NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	ACGCTGCAGTCACCATGTGATTCCTGCACACTTACACA	0.486													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75588669	75588669	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75588669delC								FAM86D (104403 upstream) : MIR1324 (91245 downstream)																							CAAAGCTTCACCCCGCCCTCT	0.537													5	5	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89521832	89521836	+	Intron	DEL	GAAAG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89521832_89521836delGAAAG	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGCTTGACATGAAAGATTTGTAACA	0.385										TSP Lung(6;0.00050)			25	15	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89521839	89521841	+	Intron	DEL	TTG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89521839_89521841delTTG	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CATGAAAGATTTGTAACATCTTG	0.404										TSP Lung(6;0.00050)			22	15	---	---	---	---	
GABRR3	200959	broad.mit.edu	37	3	97720999	97720999	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97720999delA	uc011bgr.1	-							NM_001105580	NP_001099050	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 3						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0						ATAACAAATGAAAAAAACATT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112918017	112918017	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112918017delC								C3orf17 (179462 upstream) : BOC (12395 downstream)																							GAAACAGCATCCCCCCAACTG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116973201	116973201	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116973201delT								LOC285194 (537316 upstream) : None (None downstream)																							cattcttctcttttttttttc	0.318													4	3	---	---	---	---	
ALG1L2	644974	broad.mit.edu	37	3	129814807	129814807	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129814807delG	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624	C9J202	AG1L2_HUMAN	asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0						CACTCCCCTCGGGGGGTGTTG	0.607													9	7	---	---	---	---	
NCK1	4690	broad.mit.edu	37	3	136593523	136593523	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136593523delT	uc003erh.2	+							NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						gtgttaaatcttttttttccc	0.020													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149366230	149366231	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149366230_149366231insA	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ctaaacaaaacaaaaaaaaaac	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156533443	156533444	+	Intron	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156533443_156533444insT	uc003fax.1	-											Homo sapiens cDNA FLJ31839 fis, clone NT2RP7000086.																		TCATGGACTGATTTTTTTTTCA	0.366													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159601640	159601640	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159601640delT	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron|SCHIP1_uc003fcu.1_Intron|SCHIP1_uc003fcv.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CTCCCCCAACTTTTTTTTTTC	0.393													6	3	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176767668	176767671	+	Intron	DEL	TTAC	-	-	rs35503291		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176767668_176767671delTTAC	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CGGTTTGTTGTTACTAGTTAATAA	0.333													24	11	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194865765	194865766	+	Intron	DEL	TA	-	-	rs144929834		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194865765_194865766delTA	uc003fum.3	-						C3orf21_uc003ful.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		GAGCTGCAATTATACATCATCA	0.411													4	4	---	---	---	---	
TNK2	10188	broad.mit.edu	37	3	195596501	195596502	+	Intron	INS	-	AG	AG	rs140811686	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195596501_195596502insAG	uc003fvu.1	-						TNK2_uc003fvq.1_5'UTR|TNK2_uc003fvr.1_Intron|TNK2_uc003fvs.1_Intron|TNK2_uc003fvt.1_Intron|TNK2_uc010hzw.1_Intron|TNK2_uc003fvv.1_3'UTR	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1						positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GGGCAGAGTGTAGAGAGACGAA	0.629													23	13	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6939388	6939388	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6939388delT	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						tccagccatgttttttgcaca	0.000													4	2	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	15987514	15987515	+	Intron	INS	-	GT	GT	rs55689632		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15987514_15987515insGT	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						AAACATTATAAATATTTAATCT	0.312													184	109	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	15987515	15987516	+	Intron	INS	-	TGCT	TGCT	rs55689632		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15987515_15987516insTGCT	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						AACATTATAAATATTTAATCTG	0.317													183	110	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18089895	18089895	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18089895delA								LCORL (66510 upstream) : None (None downstream)																							cctagaacttaaaaaaaatcc	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31994073	31994074	+	IGR	INS	-	TTTA	TTTA	rs34170477		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31994073_31994074insTTTA								PCDH7 (845652 upstream) : None (None downstream)																							ATTCCAGGACTTTTGTCTTTaa	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49648374	49648375	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49648374_49648375insA								CWH43 (584281 upstream) : None (None downstream)																							gaatggaaaggaatgaatggaa	0.000													9	4	---	---	---	---	
ANXA3	306	broad.mit.edu	37	4	79525591	79525593	+	Intron	DEL	CCT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79525591_79525593delCCT	uc003hld.2	+						ANXA3_uc003hle.2_Intron|ANXA3_uc010ijk.2_Intron	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3						defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						CATATTTTGCCCTTCTCTACCCA	0.320													66	35	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80553470	80553470	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80553470delG								GK2 (224098 upstream) : GDEP (195155 downstream)																							ATACTGCCTTGGGCCAGGATT	0.403													4	2	---	---	---	---	
NUDT9	53343	broad.mit.edu	37	4	88343913	88343925	+	5'UTR	DEL	GCTACTCCCGTTC	-	-	rs113013798		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88343913_88343925delGCTACTCCCGTTC	uc003hqq.2	+	1					NUDT9_uc003hqr.2_Intron|NUDT9_uc010ikl.2_5'UTR	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a							mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GATAGGCACAGCTACTCCCGTTCGGGAACCCAA	0.592													1	6	---	---	---	---	
ADH1C	126	broad.mit.edu	37	4	100268753	100268754	+	Intron	INS	-	ATTTAT	ATTTAT	rs141335697	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100268753_100268754insATTTAT	uc003huu.2	-							NM_000669	NP_000660	P00326	ADH1G_HUMAN	class I alcohol dehydrogenase, gamma subunit						ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)	AAAATTTAACAATTTATACTTT	0.243									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133948500	133948501	+	IGR	INS	-	A	A	rs139751180	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133948500_133948501insA								None (None upstream) : PCDH10 (121969 downstream)																							gcaaaataattaaaaaaaaaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	140550414	140550414	+	IGR	DEL	T	-	-	rs77921852		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140550414delT								SETD7 (72837 upstream) : MGST2 (36508 downstream)																							tatacttggattttttttttc	0.010													3	3	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140797574	140797574	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140797574delG	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					TCTTGTCTCTGGACTTTTTCT	0.393													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154215279	154215280	+	Intron	INS	-	A	A	rs148467106	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154215279_154215280insA	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TCTGAAGAGACAAAATCTCTTC	0.282													10	12	---	---	---	---	
C4orf45	152940	broad.mit.edu	37	4	159843512	159843512	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159843512delC	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940												0						ccaccacagtcccccaacttg	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	161226272	161226272	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161226272delT								RAPGEF2 (944973 upstream) : None (None downstream)																							tccacagtcattttttttttg	0.000													3	3	---	---	---	---	
SPOCK3	50859	broad.mit.edu	37	4	167663376	167663379	+	Intron	DEL	TCTA	-	-	rs141328456		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167663376_167663379delTCTA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CATACATGTGtctatctatcatct	0.211													15	13	---	---	---	---	
CLCN3	1182	broad.mit.edu	37	4	170633491	170633491	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170633491delT	uc003isi.2	+						CLCN3_uc003ish.2_Intron|CLCN3_uc011cjz.1_Intron|CLCN3_uc011cka.1_Intron|CLCN3_uc003isj.1_Intron	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b						endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TTGTCTAGCATTTTTTTTTTA	0.378													4	2	---	---	---	---	
LOC285501	285501	broad.mit.edu	37	4	178898813	178898814	+	Intron	INS	-	T	T	rs143567254	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178898813_178898814insT	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		AAATTAACCCATTTTTTTTTAC	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190201129	190201130	+	IGR	INS	-	CC	CC	rs67640366		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190201129_190201130insCC								None (None upstream) : FRG1 (660844 downstream)																							tctggaactctgcaggggataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190547549	190547549	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190547549delA								None (None upstream) : FRG1 (314425 downstream)																							TTCAAATGAGAAAAGTTCCTT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190584947	190584952	+	IGR	DEL	TCTGAA	-	-	rs142261947		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190584947_190584952delTCTGAA								None (None upstream) : FRG1 (277022 downstream)																							GCCTCATGGGTCTGAATCTGAGGGAG	0.471													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190617712	190617713	+	IGR	INS	-	GAG	GAG	rs138153158		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190617712_190617713insGAG								None (None upstream) : FRG1 (244261 downstream)																							ATCTGTGAGAAAAGGAGTCTCC	0.401													4	4	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1076520	1076530	+	Intron	DEL	CAGGTTCCAGC	-	-	rs111668454		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1076520_1076530delCAGGTTCCAGC	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CAGGCCCCCTCAGGTTCCAGCCATCCTGTGA	0.630													3	3	---	---	---	---	
SLC6A3	6531	broad.mit.edu	37	5	1419204	1419205	+	Intron	INS	-	CTAC	CTAC			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1419204_1419205insCTAC	uc003jck.2	-							NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter						cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	atcctatctagctacctatcat	0.000													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11795796	11795796	+	Intron	DEL	A	-	-	rs73052783	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11795796delA	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GGAAGAAGACAAAGATTTCTT	0.408													4	2	---	---	---	---	
RAI14	26064	broad.mit.edu	37	5	34688211	34688216	+	Intron	DEL	GACAAA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34688211_34688216delGACAAA	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_5'UTR|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					AAGAGACTTCGACAAAGACAGAAAAC	0.413													77	55	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40095552	40095552	+	IGR	DEL	A	-	-	rs11330986		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40095552delA								DAB2 (670217 upstream) : PTGER4 (584480 downstream)																							gatatatgggaaaatgctgca	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44187904	44187904	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44187904delA								NNT (482237 upstream) : FGF10 (117193 downstream)																							gggtaaacttaaaagaagtta	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46324281	46324281	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46324281delA								HCN1 (628061 upstream) : None (None downstream)																							gctactgtgtagtttttatgt	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51021978	51021979	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51021978_51021979insA								ISL1 (331421 upstream) : None (None downstream)																							aaaTCAGGCAGAAAAAAAAATT	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51840577	51840577	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51840577delT								None (None upstream) : ITGA1 (243197 downstream)																							TAAAATGCTCTTTTTTTCAGT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61447356	61447356	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61447356delC								FLJ37543 (444994 upstream) : KIF2A (154633 downstream)																							TGTTAAACAACCAATCCACTC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	71947708	71947708	+	IGR	DEL	T	-	-	rs11297923		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71947708delT								ZNF366 (144459 upstream) : TNPO1 (164710 downstream)																							gagagagacaTTAGAGAGAGG	0.159													3	4	---	---	---	---	
AGGF1	55109	broad.mit.edu	37	5	76331124	76331124	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76331124delT	uc003ket.2	+						AGGF1_uc003kes.2_Intron|AGGF1_uc003keu.1_Intron	NM_018046	NP_060516	Q8N302	AGGF1_HUMAN	angiogenic factor VG5Q						angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		CCAACTTACCTTTTTTTTTTC	0.308													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79655916	79655916	+	5'Flank	DEL	A	-	-	rs111607880		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79655916delA	uc003kgo.2	-											SubName: Full=Putative uncharacterized protein; Flags: Fragment;																		CCATGGGCAGAAAAAAAAAAA	0.383													19	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	83069248	83069248	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83069248delG								HAPLN1 (52352 upstream) : EDIL3 (168878 downstream)																							tctctgagatgggggaaGGgg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85159150	85159150	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85159150delT								None (None upstream) : NBPF22P (419112 downstream)																							caaaatacacttagacacata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90814112	90814113	+	IGR	INS	-	T	T	rs144151355	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90814112_90814113insT								LOC100129716 (97581 upstream) : None (None downstream)																							GCATAAGACGCTTTTTTTTTCA	0.406													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90990783	90990784	+	IGR	DEL	GA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90990783_90990784delGA								LOC100129716 (274252 upstream) : None (None downstream)																							ggcagagtgggagagagagagt	0.000													4	2	---	---	---	---	
PPIP5K2	23262	broad.mit.edu	37	5	102534654	102534654	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102534654delT	uc003kod.3	+						PPIP5K2_uc011cva.1_Intron|PPIP5K2_uc003koe.2_Intron|PPIP5K2_uc003kof.2_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						tctttttgcatttttttttgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105536940	105536940	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105536940delT								None (None upstream) : None (None downstream)																							AAGGTTAGTATTTTTTTCAAC	0.318													4	2	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108243005	108243005	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108243005delT	uc003kop.1	+						FER_uc011cvf.1_Intron|FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ttttcttttctttttttttga	0.164													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113146159	113146160	+	IGR	DEL	AG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113146159_113146160delAG								YTHDC2 (215180 upstream) : KCNN2 (551856 downstream)																							acagagccatagagagagacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	120342954	120342954	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120342954delT								PRR16 (319992 upstream) : FTMT (844696 downstream)																							CCAACTGCCCTACAACTTTGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141449315	141449316	+	IGR	DEL	CC	-	-	rs71939846		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141449315_141449316delCC								GNPDA1 (56695 upstream) : NDFIP1 (39008 downstream)																							cacacacacacccccacacaTG	0.208													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	142957732	142957733	+	IGR	DEL	GT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142957732_142957733delGT								NR3C1 (142655 upstream) : HMHB1 (233993 downstream)																							TTCTTtgtgcgtgtgtgtgtgt	0.139													6	3	---	---	---	---	
SPINK5	11005	broad.mit.edu	37	5	147493803	147493804	+	Intron	INS	-	A	A	rs142874955		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147493803_147493804insA	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAACTGCCAGAAAAAAAATTC	0.337													15	12	---	---	---	---	
ITK	3702	broad.mit.edu	37	5	156659606	156659617	+	Intron	DEL	AGGGAGGGAGGG	-	-	rs113148156		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156659606_156659617delAGGGAGGGAGGG	uc003lwo.1	+							NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase						cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			aaagagaggaagggagggagggagggagggaA	0.151			T	SYK	peripheral T-cell lymphoma								8	9	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156789829	156789829	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156789829delG	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGACTTCTCTGGGGAGATGGC	0.522													4	2	---	---	---	---	
TTC1	7265	broad.mit.edu	37	5	159489825	159489825	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159489825delC	uc003lxu.2	+							NM_003314	NP_003305	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1						protein folding		unfolded protein binding			skin(1)	1	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TTTTTTTTTTCCCCCTTCCTG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163181274	163181274	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163181274delT								MAT2B (234941 upstream) : None (None downstream)																							ctccactcccttttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170945683	170945683	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170945683delA								FGF18 (61521 upstream) : FBXW11 (342873 downstream)																							ctgcctcaggaaaaaaaaaat	0.194													6	5	---	---	---	---	
FBXW11	23291	broad.mit.edu	37	5	171336689	171336690	+	Intron	INS	-	TG	TG	rs140754545	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171336689_171336690insTG	uc003mbm.1	-						FBXW11_uc011dey.1_Intron|FBXW11_uc003mbl.1_Intron|FBXW11_uc003mbn.1_Intron	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform						cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATTTAACCAGAtgtgtgtgtgt	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177398373	177398396	+	IGR	DEL	AGGACGAAGAGCTGGAGAGCGCCA	-	-	rs145131557		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177398373_177398396delAGGACGAAGAGCTGGAGAGCGCCA								LOC728554 (87106 upstream) : PROP1 (20840 downstream)																							GTCCCCGGGGAGGACGAAGAGCTGGAGAGCGCCAAGGACGACGA	0.531													21	11	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178708616	178708616	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178708616delT	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		gggttgttggtttttggctcc	0.000													4	2	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5661868	5661868	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5661868delA	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	catgatcaacaaaaagccatt	0.000													4	2	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11193598	11193598	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11193598delG	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			AATTGTAGAAGAACATAAGCT	0.224													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11638864	11638865	+	IGR	DEL	GA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11638864_11638865delGA								TMEM170B (55108 upstream) : C6orf105 (75025 downstream)																							CTTGTGGGGGGAGAGAGAGAGA	0.431													3	3	---	---	---	---	
PHACTR1	221692	broad.mit.edu	37	6	13073043	13073043	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13073043delA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CTTGCTTTCCAAAAAGGTTGT	0.398													4	2	---	---	---	---	
RNF144B	255488	broad.mit.edu	37	6	18460134	18460134	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18460134delT	uc003ncs.2	+							NM_182757	NP_877434	Q7Z419	R144B_HUMAN	IBR domain containing 2						apoptosis|positive regulation of anti-apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			AGCCTGATACTTTAGATATCT	0.343													10	5	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20739629	20739632	+	Intron	DEL	AATC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20739629_20739632delAATC	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GTTGTAAGAAAATCTTGTTTCATG	0.343													21	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	23589251	23589252	+	IGR	INS	-	AT	AT			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23589251_23589252insAT								None (None upstream) : NRSN1 (537162 downstream)																							acaaagttagaatatcgcaatt	0.084													4	2	---	---	---	---	
BAT2	7916	broad.mit.edu	37	6	31595083	31595084	+	Intron	DEL	TG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31595083_31595084delTG	uc003nvb.3	+						BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Intron	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2							cytoplasm|nucleus	protein binding				0						AAAAATGGGCTGTGTGAAGTGC	0.465													4	2	---	---	---	---	
ZNF76	7629	broad.mit.edu	37	6	35263693	35263694	+	3'UTR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35263693_35263694insT	uc003oki.1	+	14					ZNF76_uc003okj.1_3'UTR|DEF6_uc003okk.2_5'Flank|DEF6_uc010jvs.2_5'Flank|DEF6_uc010jvt.2_5'Flank	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CATTTTGATAATTTTTTTCCTG	0.446													4	2	---	---	---	---	
PEX6	5190	broad.mit.edu	37	6	42932348	42932348	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42932348delT	uc003otf.2	-						uc003ote.1_5'Flank|PEX6_uc010jya.2_Intron	NM_000287	NP_000278	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6						protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)	1			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CTCCCACTAGttttttttttc	0.279													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43714421	43714421	+	IGR	DEL	A	-	-	rs36045928		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43714421delA								MRPS18A (58893 upstream) : VEGFA (23532 downstream)																							GTAAATCTTCAATCTGCAGTT	0.512													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57381492	57381494	+	Intron	DEL	TGC	-	-	rs10563148		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57381492_57381494delTGC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTCTTTTTAATGCTATTGAAGGA	0.266													3	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57436915	57436916	+	Intron	INS	-	TTCTT	TTCTT	rs142426424		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57436915_57436916insTTCTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GAAAGGATGGATTCTTTTCTGG	0.223													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57477324	57477327	+	Intron	DEL	AAAC	-	-	rs66970910		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57477324_57477327delAAAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgaaaatgaaaaacaaagtggaga	0.132													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512787	57512788	+	Splice_Site	INS	-	CACCAAGGC	CACCAAGGC	rs79832250		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512787_57512788insCACCAAGGC	uc003pdx.2	+	15	1702	c.1615_splice	c.e15+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.129													61	27	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512788	57512789	+	Splice_Site	INS	-	TA	TA	rs79832250		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512788_57512789insTA	uc003pdx.2	+	15	1702	c.1615_splice	c.e15+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcactctgttgtgtaattgtg	0.129													59	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57535889	57535889	+	IGR	DEL	C	-	-	rs66928712		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57535889delC								PRIM2 (22514 upstream) : GUSBL2 (710270 downstream)																							Gctgcaagtacttgggactct	0.219													4	2	---	---	---	---	
KCNQ5	56479	broad.mit.edu	37	6	73443419	73443419	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73443419delA	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		TAAGAGGAAGAAAGAAAACCT	0.279													4	2	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74115935	74115936	+	Intron	INS	-	GG	GG	rs143908408	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74115935_74115936insGG	uc003pgw.2	+						DDX43_uc011dyn.1_Intron	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						ttagtagagacggtttctctat	0.000													13	11	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84284564	84284590	+	Intron	DEL	AGAATGGAGGGCAGCCCCCTGGGCTGG	-	-	rs71545874		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84284564_84284590delAGAATGGAGGGCAGCCCCCTGGGCTGG	uc011dze.1	-						SNAP91_uc011dzd.1_Intron|SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TTCATACCTAAGAATGGAGGGCAGCCCCCTGGGCTGGAGTGCTACTT	0.441													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92827199	92827200	+	IGR	DEL	TA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92827199_92827200delTA								None (None upstream) : None (None downstream)																							TTCTAAGATCTATAAAAGCAAA	0.327													4	2	---	---	---	---	
LIN28B	389421	broad.mit.edu	37	6	105519964	105519967	+	Intron	DEL	TGTG	-	-	rs113521265		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105519964_105519967delTGTG	uc003pqv.1	+						LIN28B_uc010kda.1_Intron	NM_001004317	NP_001004317	Q6ZN17	LN28B_HUMAN	lin-28 homolog B						miRNA catabolic process|pre-miRNA processing|regulation of transcription, DNA-dependent|RNA 3'-end processing	cytoplasm|nucleus	DNA binding|protein binding|RNA binding|zinc ion binding				0		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CTTTtgtgtctgtgtgtgtgtgtg	0.270													4	2	---	---	---	---	
SEC63	11231	broad.mit.edu	37	6	108225614	108225614	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108225614delA	uc003psc.3	-						SEC63_uc003psb.3_Intron	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein						protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		actccatctcaaaaaaaaaaa	0.104													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	109574043	109574043	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109574043delA	uc003pta.1	+											RecName: Full=Transmembrane protein FLJ37396;																		CCTGCTAAATAACCAAACAAT	0.448													4	2	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112523641	112523641	+	Intron	DEL	A	-	-	rs11313465		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112523641delA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGTGGGGCATAGGGgtgtgtg	0.348													4	2	---	---	---	---	
GOPC	57120	broad.mit.edu	37	6	117771965	117771965	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117771965delT	uc003pxq.1	-							NM_001017408	NP_001017408	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		ATTTTGCATATTTTTTTCTTC	0.378			O	ROS1	glioblastoma								4	2	---	---	---	---	
DCBLD1	285761	broad.mit.edu	37	6	117873757	117873757	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117873757delT	uc003pxs.2	+						GOPC_uc003pxq.1_Intron	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		TCCAGGCCACTTTTTTCCATT	0.378													4	2	---	---	---	---	
STX7	8417	broad.mit.edu	37	6	132791962	132791967	+	Intron	DEL	TATAAT	-	-	rs71990473		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132791962_132791967delTATAAT	uc003qdg.2	-						STX7_uc011ecg.1_Intron|STX7_uc011ech.1_Intron	NM_003569	NP_003560	O15400	STX7_HUMAN	syntaxin 7						intracellular protein transport|post-Golgi vesicle-mediated transport	early endosome membrane|integral to membrane	SNAP receptor activity				0	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		CAAGtaataatataattataagtaat	0.214													12	10	---	---	---	---	
NHSL1	57224	broad.mit.edu	37	6	138820290	138820297	+	Intron	DEL	ACACACAG	-	-	rs71754767		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138820290_138820297delACACACAG	uc003qhx.2	-						NHSL1_uc011edp.1_Intron|NHSL1_uc003qhy.2_Intron	NM_020464	NP_065197	Q5SYE7	NHSL1_HUMAN	NHS-like 1 isoform 1												0						acacacacacacacacagacacacaGGG	0.260													54	32	---	---	---	---	
ULBP3	79465	broad.mit.edu	37	6	150387586	150387586	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150387586delG	uc003qns.3	-						ULBP3_uc011eej.1_5'Flank|ULBP3_uc011eek.1_Intron	NM_024518	NP_078794	Q9BZM4	N2DL3_HUMAN	UL16 binding protein 3 precursor						antigen processing and presentation|immune response|natural killer cell activation	anchored to membrane|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.12)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.45e-12)		CAGCCCAGGTGGACTGCAAGA	0.562													4	2	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155566095	155566096	+	Intron	INS	-	T	T	rs151112442	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155566095_155566096insT	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_Intron|TIAM2_uc003qqg.2_Intron|TIAM2_uc003qqh.2_Intron	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGCTGTATATATTTTTTTTTCC	0.450													9	8	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157490505	157490505	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157490505delA	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc010kjl.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GTACGGGGCCAAAAAAAAATC	0.413													5	4	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4138811	4138811	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4138811delA	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		gagaggaatgaaaggctcagg	0.050													4	2	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18794090	18794091	+	Intron	DEL	AG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18794090_18794091delAG	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003sua.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	AGCCACCCACAGACATTTGCTT	0.381													4	2	---	---	---	---	
SCRN1	9805	broad.mit.edu	37	7	29976506	29976507	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29976506_29976507insA	uc010kvp.2	-						SCRN1_uc011jzy.1_Intron|SCRN1_uc003tak.2_Intron|SCRN1_uc011jzz.1_Intron|SCRN1_uc011kaa.1_Intron|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Intron	NM_001145515	NP_001138987	Q12765	SCRN1_HUMAN	secernin 1 isoform c						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2						actaaaaatacaaaaaaaaagc	0.000													6	3	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30891616	30891616	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30891616delT	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron|AQP1_uc011kac.1_5'Flank	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						TTTCCATTTCTTTTTTTTTTC	0.438													7	5	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36465192	36465193	+	Intron	INS	-	ATTA	ATTA	rs148316707	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36465192_36465193insATTA	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						cgtgagccactgctcccggcTA	0.099													43	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41135740	41135740	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41135740delA								C7orf10 (235383 upstream) : INHBA (592863 downstream)																							gggaggtgggagggcaaccag	0.010													4	2	---	---	---	---	
POLR2J4	84820	broad.mit.edu	37	7	44040390	44040394	+	Intron	DEL	CAAAA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44040390_44040394delCAAAA	uc010kxw.2	-						POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc003tje.3_Intron|SPDYE1_uc003tjf.2_5'Flank					SubName: Full=cDNA FLJ58900, weakly similar to Uroplakin-3B;												0						gattctgtGTcaaaacaaaacaaaa	0.229													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49117021	49117021	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49117021delT								CDC14C (149972 upstream) : VWC2 (696236 downstream)																							TGGCAGAGCATTTCAGTTTTC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61761559	61761559	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61761559delA								None (None upstream) : LOC643955 (990113 downstream)																							TTTTATCTTTAAAAATGTTGT	0.214													4	2	---	---	---	---	
HIP1	3092	broad.mit.edu	37	7	75309348	75309351	+	Intron	DEL	ATTG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75309348_75309351delATTG	uc003uds.1	-							NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						gccagcttttattgattgattgat	0.000			T	PDGFRB	CMML								4	2	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76626477	76626478	+	Intron	INS	-	GT	GT	rs141618293	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626477_76626478insGT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						AAGTGTgtggggtgtgaggtgg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91541509	91541510	+	IGR	DEL	AC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91541509_91541510delAC								MTERF (31493 upstream) : AKAP9 (28679 downstream)																							ctggctttatacacacacacag	0.000													4	2	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100373941	100373948	+	Intron	DEL	AGGGAGGG	-	-	rs3991185		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100373941_100373948delAGGGAGGG	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kke.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			actTGAaggaagggagggagggagggag	0.125													24	14	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104376954	104376955	+	Intron	INS	-	CA	CA	rs140158383	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104376954_104376955insCA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						GTTTGCATGCCcacacacacac	0.371													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108360663	108360663	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108360663delT								DNAJB9 (145371 upstream) : C7orf66 (163377 downstream)																							TGAGCTTGTCTTTTGACAACT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	122897233	122897233	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122897233delA								SLC13A1 (57208 upstream) : IQUB (195005 downstream)																							TTCCTCATGCAAAAAAATTAT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128730939	128730940	+	IGR	INS	-	TCAC	TCAC	rs111905346		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128730939_128730940insTCAC								TPI1P2 (33646 upstream) : LOC407835 (35385 downstream)																							TTGAAGAGAAGTGGGCTGCAGC	0.347													3	3	---	---	---	---	
PTN	5764	broad.mit.edu	37	7	136912464	136912464	+	3'UTR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136912464delA	uc003vtq.2	-	5					PTN_uc010lmx.2_3'UTR|PTN_uc003vtr.1_3'UTR	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2						CAAAAAATGTAAAAAAAATTT	0.244													7	12	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138356730	138356731	+	Intron	INS	-	G	G	rs5887895		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138356730_138356731insG	uc011kqh.1	-							NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						CGCCCTCAGTTGCTGTGTTCAC	0.550													85	52	---	---	---	---	
LUC7L2	51631	broad.mit.edu	37	7	139087268	139087268	+	Intron	DEL	T	-	-	rs111406651		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139087268delT	uc003vux.2	+						LUC7L2_uc011kqs.1_Intron|LUC7L2_uc011kqt.1_Intron|LUC7L2_uc003vuy.2_Intron|LUC7L2_uc003vuz.1_Intron|LUC7L2_uc003vva.2_Intron	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2								enzyme binding|metal ion binding				0	Melanoma(164;0.242)					ctctgtgcagtttttttgttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141193397	141193397	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141193397delT								MRPS33 (478616 upstream) : AGK (57681 downstream)																							CTGCAGGTAATTTTTTTGTTC	0.502													4	2	---	---	---	---	
OR2A14	135941	broad.mit.edu	37	7	143826045	143826046	+	5'Flank	INS	-	T	T	rs140693974	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143826045_143826046insT	uc011kua.1	+							NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					ATACAATGCGATTTTTTCTCAT	0.193													10	8	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148025603	148025604	+	Intron	DEL	AT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148025603_148025604delAT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			tTGGTGTTCAATAGGCCTTGGG	0.272										HNSCC(39;0.1)			7	5	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151988400	151988401	+	Intron	INS	-	TGA	TGA			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151988400_151988401insTGA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ttcataggatttgatgatgaag	0.000			N		medulloblastoma								6	3	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155503845	155503845	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155503845delT	uc010lqk.1	+						RBM33_uc011kvv.1_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGAACTTTTGTTTTTTTTTTT	0.413													24	12	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155573476	155573477	+	3'UTR	INS	-	CTCCATCACCT	CTCCATCACCT	rs149385956	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155573476_155573477insCTCCATCACCT	uc010lqk.1	+	18					RBM33_uc003wmg.2_3'UTR	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGTGTTTACCACTCCATCACCT	0.500													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	4863001	4863004	+	IGR	DEL	TTTG	-	-	rs113560734		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4863001_4863004delTTTG								CSMD1 (10673 upstream) : None (None downstream)																							TGAGGGTGTTtttgtttgtttgtt	0.338													14	9	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6390140	6390141	+	Intron	INS	-	C	C	rs141106218	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6390140_6390141insC	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TACCTTGCCTTCCTTTTGGAAT	0.312													41	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15864763	15864764	+	IGR	DEL	AG	-	-	rs145480211	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15864763_15864764delAG								TUSC3 (242770 upstream) : MSR1 (100624 downstream)																							taaagtaaaaagaaaaaaaaaA	0.233													6	4	---	---	---	---	
TNFRSF10B	8795	broad.mit.edu	37	8	22882038	22882038	+	Intron	DEL	T	-	-	rs36010961		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22882038delT	uc003xcu.2	-						TNFRSF10B_uc003xcs.1_Intron|TNFRSF10B_uc003xct.2_Intron|TNFRSF10B_uc011kzq.1_Intron|TNFRSF10B_uc003xcv.2_Intron	NM_003842	NP_003833	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily,						activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cell surface receptor linked signaling pathway|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|positive regulation of I-kappaB kinase/NF-kappaB cascade	plasma membrane	caspase activator activity|receptor activity|TRAIL binding				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GTCTTGATGAttttttttttt	0.159													4	2	---	---	---	---	
ADAMDEC1	27299	broad.mit.edu	37	8	24249586	24249586	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24249586delA	uc003xdz.2	+						ADAMDEC1_uc010lub.2_Intron|ADAMDEC1_uc011lab.1_Intron	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1						integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		GAGGGAGAGCAAAAAAAAAAA	0.363													26	17	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25720525	25720530	+	Intron	DEL	ATTATA	-	-	rs71832770		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25720525_25720530delATTATA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		AAAATTTCAGATTATAATTATCATTT	0.233													9	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26772877	26772878	+	IGR	DEL	TC	-	-	rs71519621	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26772877_26772878delTC								ADRA1A (49955 upstream) : MIR548H-4 (133492 downstream)																							TTTTTTTTTTTCGGTGGAAGTA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	31249379	31249379	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31249379delA								WRN (218103 upstream) : NRG1 (247889 downstream)																							GGTGGCCCAGAAAACCTCCCC	0.453													4	2	---	---	---	---	
MAK16	84549	broad.mit.edu	37	8	33343022	33343028	+	Intron	DEL	GCTGTCA	-	-	rs72058969		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33343022_33343028delGCTGTCA	uc003xjj.2	+						C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898	Q9BXY0	MAK16_HUMAN	MAK16 homolog							nucleolus				ovary(1)	1						GTCGCGTCATGCTGTCAGCTGTCAGCT	0.628													4	4	---	---	---	---	
IKBKB	3551	broad.mit.edu	37	8	42147233	42147233	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42147233delT	uc003xow.1	+						IKBKB_uc003xov.2_Intron|IKBKB_uc010lxh.1_Intron|IKBKB_uc011lco.1_Intron|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_Intron|IKBKB_uc011lcp.1_Intron|IKBKB_uc011lcq.1_Intron|IKBKB_uc010lxi.1_Intron|IKBKB_uc011lcr.1_Intron	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta						anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	TGTGTCCACCTTGGGGTGATG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	46898426	46898426	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46898426delA								None (None upstream) : BEYLA (854082 downstream)																							cctatggtggaaaaggaaata	0.000													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48595280	48595280	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48595280delA	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron|KIAA0146_uc010lxv.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				CACATTTATCAAAAAGGTATA	0.348													4	2	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51510281	51510281	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51510281delT	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				acatttgttattttttttgtc	0.000													4	2	---	---	---	---	
KCNB2	9312	broad.mit.edu	37	8	73471243	73471244	+	Intron	DEL	AG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73471243_73471244delAG	uc003xzb.2	+							NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			gaTCTACAACAGAGAGAGAGAG	0.238													4	2	---	---	---	---	
RALYL	138046	broad.mit.edu	37	8	85371813	85371813	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85371813delA	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						tgtcctttgcaatggaggaat	0.134													4	2	---	---	---	---	
SDC2	6383	broad.mit.edu	37	8	97538326	97538326	+	Intron	DEL	G	-	-	rs35185471		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97538326delG	uc003yhv.1	+							NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor							integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	GGCCAGGCATGGTGCAGGGCC	0.393													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98381292	98381292	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98381292delT								TSPYL5 (91116 upstream) : MTDH (275115 downstream)																							acaaagtttctttttttacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	107143493	107143493	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107143493delT								ZFPM2 (326728 upstream) : OXR1 (138980 downstream)																							CTCCTGGGACTTTTCTTTGGT	0.468													4	2	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	124924519	124924520	+	Intron	INS	-	A	A	rs10090051		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124924519_124924520insA	uc003yqw.2	+							NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			tgtcAATGTTTAAAAAAAAAGA	0.178													4	2	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135540337	135540339	+	Intron	DEL	CTC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135540337_135540339delCTC	uc003yup.2	-						ZFAT_uc011ljj.1_Intron|ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			cctcctctttctcctcctcctcT	0.251													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	139076090	139076090	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139076090delC								None (None upstream) : FAM135B (66178 downstream)																							gagctggttactgggggtgct	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142893880	142893881	+	IGR	DEL	AC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142893880_142893881delAC								MIR1302-7 (26206 upstream) : NCRNA00051 (385836 downstream)																							GCAAAATGTTACAGCCAACAAA	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143072935	143072936	+	IGR	DEL	CC	-	-	rs10094562	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143072935_143072936delCC								MIR1302-7 (205261 upstream) : NCRNA00051 (206781 downstream)																							CGCTAATTCTCCCTCTCTCCAC	0.554													3	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	334047	334048	+	Intron	INS	-	CTTCTGG	CTTCTGG	rs146663671	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:334047_334048insCTTCTGG	uc003zgf.2	+						DOCK8_uc011lls.1_Intron|DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgg.2_Intron|DOCK8_uc003zgh.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TATCAGCTAGACCCAAGTGCAT	0.302													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	2708439	2708439	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2708439delG								VLDLR (53954 upstream) : KCNV2 (9087 downstream)																							GAAGGTTGCTGGGTGGGGCTT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	13591070	13591072	+	IGR	DEL	TGC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13591070_13591072delTGC								MPDZ (311507 upstream) : NFIB (490776 downstream)																							agatgagagatgctgctgctgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	18168117	18168117	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18168117delT								SH3GL2 (370997 upstream) : ADAMTSL1 (305987 downstream)																							TCTTAACTAGtttttttttta	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33617692	33617703	+	5'Flank	DEL	GGATGTAACACG	-	-	rs113178723		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33617692_33617703delGGATGTAACACG	uc003ztf.1	+											Homo sapiens patient CS-1 clone 1 T cell receptor beta chain CDR3 (TCRB) mRNA, partial cds.																		GCAGAGAGATGGATGTAACACGGGTCATGAGC	0.349											OREG0019139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34893046	34893046	+	IGR	DEL	C	-	-	rs71506187		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34893046delC								C9orf144 (54463 upstream) : KIAA1045 (64475 downstream)																							TTCTCACCTGCCAGCAATTGC	0.527													12	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	35561913	35561920	+	IGR	DEL	CCCACCCT	-	-	rs36227978		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35561913_35561920delCCCACCCT								RUSC2 (19 upstream) : FAM166B (25 downstream)																							TTTGTGTTCCCCCACCCTCCCACCCTCC	0.462													52	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66267864	66267865	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66267864_66267865insA								FAM74A4 (773478 upstream) : LOC442421 (228605 downstream)																							tggattctgttaaaaaaaaaga	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66455366	66455367	+	Intron	INS	-	GA	GA	rs139265653		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455366_66455367insGA	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		AGAAACGGAAGGAGAGAAACAG	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66470874	66470875	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66470874_66470875insA								FAM74A4 (976488 upstream) : LOC442421 (25595 downstream)																							tccctgaatctaaaaAATTTAA	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66478299	66478299	+	IGR	DEL	G	-	-	rs139319632		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66478299delG								FAM74A4 (983913 upstream) : LOC442421 (18171 downstream)																							ttaagttctagggtacatgtg	0.005													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66491787	66491788	+	IGR	INS	-	A	A	rs145157912	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66491787_66491788insA								FAM74A4 (997401 upstream) : LOC442421 (4682 downstream)																							aaattagaaataaaaaacagaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68421071	68421072	+	IGR	INS	-	TTTG	TTTG	rs144603656		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68421071_68421072insTTTG								FAM27B (626882 upstream) : MIR1299 (581167 downstream)																							ATATCTAAACCTTTGTTTTTTA	0.337													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68427592	68427593	+	IGR	INS	-	AC	AC	rs139250107		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68427592_68427593insAC								FAM27B (633403 upstream) : MIR1299 (574646 downstream)																							TGGTTTCTAGTACTTCATGCTT	0.337													23	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68481417	68481418	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68481417_68481418insT								FAM27B (687228 upstream) : MIR1299 (520821 downstream)																							atagaaaaaaaaatcctaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491533	68491534	+	IGR	DEL	TC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491533_68491534delTC								FAM27B (697344 upstream) : MIR1299 (510705 downstream)																							TATTCCtctttctctctttctt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491556	68491556	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491556delC								FAM27B (697367 upstream) : MIR1299 (510683 downstream)																							ccctttctttctttctttctt	0.090													4	2	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668426	71668427	+	Intron	INS	-	GG	GG	rs58150402	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668426_71668427insGG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						gatggatggatagatagataga	0.059													4	3	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668427	71668428	+	Intron	INS	-	TG	TG	rs75408130	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668427_71668428insTG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						atggatggatagatagatagat	0.059													4	3	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73170229	73170229	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73170229delC	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TCCTTACAATCCCAGAGCACC	0.522													3	3	---	---	---	---	
FLJ43859	389761	broad.mit.edu	37	9	84545116	84545116	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84545116delC	uc004amh.2	+							NM_001145197	NP_001138669	Q6ZUB0	YI020_HUMAN	hypothetical protein LOC389761							integral to membrane					0						CCACCGCCttctttttttttt	0.388													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89314400	89314401	+	IGR	INS	-	A	A	rs35551414		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89314400_89314401insA								ZCCHC6 (345022 upstream) : GAS1 (244878 downstream)																							AGAGCCAGATTAAAAAAAAAAA	0.450													4	3	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	96004043	96004043	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96004043delG	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron|WNK2_uc010mrc.1_Intron|WNK2_uc010mrd.1_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						CCTTGTCCATGGGGGCACTGG	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	108597322	108597322	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108597322delT								TMEM38B (59878 upstream) : None (None downstream)																							TAGTGTCATATTTTTGCGGCA	0.483													4	2	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994281	114994281	+	Intron	DEL	G	-	-	rs3983403		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994281delG	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						gaagagaagagaagagaagag	0.090													21	19	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994286	114994286	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994286delG	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						gaagagaagagaagagaagag	0.100													21	21	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994291	114994291	+	Intron	DEL	G	-	-	rs80175589	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994291delG	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						gaagagaagagaagagaagaa	0.109													24	21	---	---	---	---	
NTNG2	84628	broad.mit.edu	37	9	135089082	135089082	+	Intron	DEL	T	-	-	rs34653212		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135089082delT	uc004cbh.2	+							NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor						axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		atgaaaaatgttttttcccaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133784	133784	+	IGR	DEL	G	-	-	rs34107798		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133784delG								TUBB8 (38280 upstream) : ZMYND11 (46640 downstream)																							ACCAGGACCTGGGGGAAGCAC	0.617													29	17	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	552635	552635	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:552635delG	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AACACACAGTGGCCTCCCGGG	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5150019	5150020	+	IGR	INS	-	GTAA	GTAA	rs150642205	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5150019_5150020insGTAA								AKR1C3 (143 upstream) : AKR1CL1 (46635 downstream)																							GTGATTTGCCTGTAAGTTAGGA	0.366													3	3	---	---	---	---	
TRDMT1	1787	broad.mit.edu	37	10	17202186	17202187	+	Intron	INS	-	AG	AG	rs140268541	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17202186_17202187insAG	uc001iop.2	-						TRDMT1_uc001ioq.2_Intron|TRDMT1_uc001ior.2_Intron|TRDMT1_uc001ios.2_Intron|TRDMT1_uc009xjt.2_Intron|TRDMT1_uc010qcc.1_Intron|TRDMT1_uc010qcd.1_Intron|TRDMT1_uc009xjs.1_Intron|TRDMT1_uc009xju.1_Intron	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform						tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						AAACTATTTTCAGTTTACCTAT	0.248													9	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28655624	28655624	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28655624delA								MPP7 (63629 upstream) : WAC (165803 downstream)																							tcaggagttcaaaaccagcct	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29395362	29395362	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29395362delC								BAMBI (423494 upstream) : LYZL1 (182628 downstream)																							GGTCTAATCTCTTACAAAATC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29634419	29634420	+	IGR	INS	-	A	A	rs149379532	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29634419_29634420insA								LYZL1 (34262 upstream) : LOC387647 (64063 downstream)																							CTGTCAGGTTTAAAAAAAAAAG	0.342													4	3	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35464374	35464374	+	Intron	DEL	A	-	-	rs78388179		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35464374delA	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron|CREM_uc001iyd.2_Intron|CREM_uc001iye.2_Intron|CREM_uc001iyf.2_Intron|CREM_uc001iyg.2_Intron|CREM_uc001iyh.2_5'Flank|CREM_uc001iyi.2_5'Flank|CREM_uc001iyj.2_5'Flank|CREM_uc001iyk.2_5'Flank	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						actccgtctcaaaaaaaaaag	0.174													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42653350	42653350	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42653350delT								None (None upstream) : LOC441666 (173965 downstream)																							TGAGAAAATGTTTCCCCCAAA	0.338													4	3	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49382781	49382781	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49382781delA	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron|FRMPD2L1_uc001jgf.2_Intron|FRMPD2_uc001jgg.2_Intron|FRMPD2_uc001jgk.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AATGGAAGAGAAAAAAAAAAC	0.423													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467957	52467957	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467957delT								SGMS1 (83034 upstream) : ASAH2B (31739 downstream)																							TCTTCAtttcttttttttttt	0.214													10	6	---	---	---	---	
NODAL	4838	broad.mit.edu	37	10	72197666	72197666	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72197666delC	uc001jrc.2	-							NM_018055	NP_060525	Q96S42	NODAL_HUMAN	nodal precursor						growth	extracellular space	cytokine activity|growth factor activity			large_intestine(1)|kidney(1)	2						TAGCAGCTTTCCCCAGAAGTG	0.498													4	2	---	---	---	---	
CYP2C18	1562	broad.mit.edu	37	10	96484516	96484516	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96484516delT	uc001kjv.3	+						CYP2C18_uc001kjw.3_Intron|CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_Intron	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		ttctttagtattttttttttg	0.080													7	4	---	---	---	---	
TLL2	7093	broad.mit.edu	37	10	98262463	98262463	+	Intron	DEL	A	-	-	rs77163838		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98262463delA	uc001kml.1	-						TLL2_uc009xvf.1_Intron	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor						cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CTGCGACCTGAAAAAGAGTTA	0.577													4	3	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105593557	105593557	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105593557delC	uc001kxj.1	-							NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTATTAGCTGCCCCCAAGAGA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	108003500	108003500	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108003500delG								SORCS3 (978507 upstream) : SORCS1 (329922 downstream)																							ttatccaggtgggtccattat	0.000													4	2	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108485851	108485851	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108485851delT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTCTGTGCTATTTACTTCCAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110884927	110884927	+	IGR	DEL	T	-	-	rs11194411		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110884927delT								None (None upstream) : XPNPEP1 (739597 downstream)																							CGTTTTGGtgttttttttttt	0.219													7	4	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127582434	127582434	+	Intron	DEL	T	-	-	rs5788733		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127582434delT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATTTGCTACATTTTTTATCAA	0.289													5	3	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127582669	127582670	+	Intron	DEL	AT	-	-	rs141033053		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127582669_127582670delAT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ACTTAAAAAAATATATATAGAA	0.297													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262702	130262703	+	IGR	INS	-	A	A	rs66538679		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262702_130262703insA								MKI67 (338234 upstream) : None (None downstream)																							cctcctcctccccatccttccc	0.040													19	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262887	130262888	+	IGR	INS	-	CC	CC			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262887_130262888insCC								MKI67 (338419 upstream) : None (None downstream)																							ctccccatcctcctgccttccc	0.198													58	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262890	130262891	+	IGR	INS	-	CTA	CTA	rs11016255	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262890_130262891insCTA								MKI67 (338422 upstream) : None (None downstream)																							cccatcctcctgccttcccctc	0.203													19	30	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132421253	132421254	+	IGR	DEL	CT	-	-	rs74580411	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132421253_132421254delCT								GLRX3 (438469 upstream) : TCERG1L (469402 downstream)																							GCTCCCGCCCCTCTCTCTCTCT	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133135367	133135367	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133135367delC								TCERG1L (25383 upstream) : PPP2R2D (612593 downstream)																							CAAAAACTATCCCCAGGGCTG	0.473													4	2	---	---	---	---	
WEE1	7465	broad.mit.edu	37	11	9602790	9602790	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9602790delA	uc001mhs.2	+						WEE1_uc001mht.2_Intron|WEE1_uc001mhu.2_3'UTR	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1						blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		aaaaacaaaCAAAAAAAAAGC	0.174													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11117807	11117808	+	IGR	DEL	TG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11117807_11117808delTG								ZBED5 (238187 upstream) : GALNTL4 (174613 downstream)																							TTGAGGCTTTTGTGTGTGTGTG	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11186186	11186187	+	IGR	INS	-	CT	CT			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11186186_11186187insCT								ZBED5 (306566 upstream) : GALNTL4 (106234 downstream)																							TTGTATCTAAACTCTAAAACAC	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13757122	13757122	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13757122delT								FAR1 (3231 upstream) : SPON1 (226792 downstream)																							ATTGTCCAGGTTTTTTTTGTT	0.398													4	2	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14482071	14482071	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14482071delT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						AGAATAtttcttttttttttt	0.149													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15836905	15836905	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15836905delT								INSC (568153 upstream) : SOX6 (151091 downstream)																							AACACCAGAATTTTTTTTTTC	0.398													4	3	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	20876946	20876947	+	Intron	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20876946_20876947insT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						TGTTGGCTACCTGAGGCGAGGA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30886941	30886954	+	Intron	DEL	ATACACACATTTAT	-	-	rs3830995		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30886941_30886954delATACACACATTTAT	uc001mss.1	-						uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		acgcacacacatacacacatttatatacacacat	0.210													24	14	---	---	---	---	
CSTF3	1479	broad.mit.edu	37	11	33163765	33163765	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33163765delA	uc001muh.2	-						CSTF3_uc001mui.2_Intron|CSTF3_uc001muj.2_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						actcagagagaaaaaaaaaag	0.055													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34696610	34696610	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34696610delA								EHF (13529 upstream) : APIP (200104 downstream)																							gggtcatattaaaaaaaattg	0.000													4	2	---	---	---	---	
CD44	960	broad.mit.edu	37	11	35239348	35239348	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35239348delA	uc001mvu.2	+						CD44_uc001mvv.2_Intron|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor						cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	ATTTGGTAGGAAAAAAAAAGT	0.368													4	2	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35428186	35428187	+	Intron	INS	-	A	A	rs138528118	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35428186_35428187insA	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	gctgaaggaagaaaaaaaaggc	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64011615	64011616	+	IGR	DEL	TG	-	-	rs150253900		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64011615_64011616delTG								FKBP2 (9 upstream) : PPP1R14B (337 downstream)																							GGAGTAAGCCTGTGTGTGTTTG	0.480													4	6	---	---	---	---	
LRP5	4041	broad.mit.edu	37	11	68078882	68078882	+	5'Flank	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68078882delT	uc001ont.2	+						LRP5_uc009ysg.2_5'Flank	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TGAACTGCCCTCCCACCGGAC	0.607													4	2	---	---	---	---	
CLPB	81570	broad.mit.edu	37	11	72102486	72102486	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72102486delC	uc001osj.2	-						CLPB_uc010rqx.1_Intron|CLPB_uc010rqy.1_Intron|CLPB_uc001osk.2_Intron|CLPB_uc009ytg.2_Intron|CLPB_uc010rqz.1_Intron	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B						cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						atttgcctttcccactagact	0.005													4	2	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73686860	73686862	+	Intron	DEL	CTT	-	-	rs141148353		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73686860_73686862delCTT	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					taatccaggacttcttttggagg	0.118													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	80051592	80051592	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80051592delG								ODZ4 (899897 upstream) : None (None downstream)																							aaacatctctgggaaaactga	0.070													4	2	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92130737	92130737	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92130737delC	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCTGCCAGACCAGCTATTTT	0.433										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99398334	99398335	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99398334_99398335insA	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		aaggtaaacagaaaaaaaaata	0.134													4	2	---	---	---	---	
PDGFD	80310	broad.mit.edu	37	11	103870637	103870638	+	Intron	INS	-	TGA	TGA			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103870637_103870638insTGA	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TCTGTTAGGGTCTTTAGGCTTT	0.416													13	7	---	---	---	---	
PDGFD	80310	broad.mit.edu	37	11	103870638	103870639	+	Intron	INS	-	A	A	rs113541111		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103870638_103870639insA	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CTGTTAGGGTCTTTAGGCTTTT	0.411													14	7	---	---	---	---	
ALG9	79796	broad.mit.edu	37	11	111740826	111740826	+	Intron	DEL	T	-	-	rs12276358		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111740826delT	uc001pmb.2	-						ALG9_uc001ply.2_Intron|ALG9_uc001plz.2_Intron|ALG9_uc010rwm.1_Intron|ALG9_uc010rwn.1_Intron|ALG9_uc010rwo.1_Intron|ALG9_uc009yyh.1_Intron	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		tgTTTTTTTGTTTTTTTTTTT	0.144													11	5	---	---	---	---	
C11orf34	349633	broad.mit.edu	37	11	112125166	112125167	+	Intron	DEL	GT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112125166_112125167delGT	uc009yyp.2	-						PTS_uc009yyo.2_Intron	NM_001145024	NP_001138496	Q6UQ28	PLET1_HUMAN	hypothetical protein LOC349633 precursor							integral to membrane					0						tggtatgtacgtgtgtgtggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115657188	115657188	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115657188delA								CADM1 (281947 upstream) : BUD13 (961700 downstream)																							gcaggactagaagggaaagga	0.095													4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120457061	120457062	+	Intron	INS	-	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120457061_120457062insG	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	ttagagtagccgggggaaaggt	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124410537	124410537	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124410537delT								OR8B8 (99556 upstream) : OR8B12 (2083 downstream)																							GATTGGCTCCTCTTCTTTTTA	0.448													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134090261	134090261	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134090261delA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GTCGTGTCTTAAAAAAAAAAA	0.209													10	6	---	---	---	---	
CCND2	894	broad.mit.edu	37	12	4409271	4409271	+	3'UTR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4409271delA	uc001qmo.2	+	5						NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GGTGAAACTTAAAAAAAAAAT	0.388			T	IGL@	NHL,CLL								6	3	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21168393	21168393	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21168393delA	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_5'Flank			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					aaaaATCACTAAAAAAAAAGT	0.139													6	3	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25250160	25250163	+	Intron	DEL	AAAA	-	-	rs144702666		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25250160_25250163delAAAA	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					aaaaaatgttaaaaaaatataata	0.196													4	14	---	---	---	---	
FGFR1OP2	26127	broad.mit.edu	37	12	27118705	27118705	+	3'UTR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27118705delG	uc001rhm.2	+	7					FGFR1OP2_uc001rhn.2_3'UTR	NM_015633	NP_056448	Q9NVK5	FGOP2_HUMAN	FGFR1 oncogene partner 2							cytoplasm					0	Colorectal(261;0.0847)					AGCTGAAAGTGGGGGTAAAGG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	39432318	39432318	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39432318delT								CPNE8 (132898 upstream) : KIF21A (254713 downstream)																							tacccctgcctttcagggttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	39597538	39597538	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39597538delA								CPNE8 (298118 upstream) : KIF21A (89493 downstream)																							acaaccttacaaaaaaaagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48337879	48337879	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48337879delG								VDR (39065 upstream) : TMEM106C (19451 downstream)																							GAGCCCACCCGGGAGACCCCC	0.612													4	2	---	---	---	---	
ATF7	11016	broad.mit.edu	37	12	53920081	53920081	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53920081delT	uc001sdy.2	-						ATF7_uc010sok.1_Intron|ATF7_uc001sdz.2_Intron|ATF7_uc010sol.1_Intron	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1						interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						ctgctacccctgagacagcaa	0.000													5	3	---	---	---	---	
C12orf56	115749	broad.mit.edu	37	12	64770625	64770625	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64770625delT	uc001ssa.3	-						uc001srx.2_Intron	NM_001099676	NP_001093146	Q8IXR9	CL056_HUMAN	hypothetical protein LOC115749												0			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		ccacattttcttttttttttc	0.000													2	4	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79702393	79702408	+	Intron	DEL	AAAGAAAGAAAGAAAG	-	-	rs56676070	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79702393_79702408delAAAGAAAGAAAGAAAG	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						aaagaaagaaaaagaaagaaagaaagaaagaaagaa	0.134													12	11	---	---	---	---	
SLC6A15	55117	broad.mit.edu	37	12	85309467	85309467	+	5'Flank	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85309467delT	uc001szv.2	-						SLC6A15_uc010sul.1_5'Flank|SLC6A15_uc001szy.2_5'Flank	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1						cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						ATTGTGAGGATTTTTTTTTTG	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89354021	89354021	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89354021delA								KITLG (379783 upstream) : DUSP6 (387818 downstream)																							TTCATTTGTGAAAAAAAAATT	0.358													4	2	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92413484	92413484	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92413484delT	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CAGAAAACAGTTTAGCTTTTA	0.313			T	MYC	BCLL								4	2	---	---	---	---	
LOC253724	253724	broad.mit.edu	37	12	104297426	104297426	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104297426delA	uc010swf.1	-							NR_027249				Homo sapiens cDNA FLJ56788 complete cds, moderately similar to Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant 2, mRNA.												0						caatccacccaaaaccctcca	0.000													4	2	---	---	---	---	
WSCD2	9671	broad.mit.edu	37	12	108567399	108567399	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108567399delA	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						ATGCTGGGGTAAGGGGATGCT	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130430441	130430441	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130430441delC								TMEM132D (42229 upstream) : LOC100190940 (87558 downstream)																							tgtaacagatccccacaaacc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130619831	130619832	+	IGR	DEL	GT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130619831_130619832delGT								LOC100190940 (92944 upstream) : FZD10 (27200 downstream)																							tttatgtgtagtgtgtgtatat	0.084													4	2	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132398256	132398256	+	Intron	DEL	C	-	-	rs68126752		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132398256delC	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ccaaaaaaaacaaaaaaaTGC	0.318													9	9	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21988038	21988039	+	Intron	INS	-	CTT	CTT			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21988038_21988039insCTT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TTGTCTTCAAAAAAAAGCAGAT	0.267													48	31	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21988040	21988041	+	Intron	INS	-	CTGT	CTGT	rs138667845		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21988040_21988041insCTGT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		GTCTTCAAAAAAAAGCAGATAA	0.267													41	31	---	---	---	---	
EFHA1	221154	broad.mit.edu	37	13	22113183	22113184	+	Intron	INS	-	G	G	rs150597527	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22113183_22113184insG	uc001uof.2	-							NM_152726	NP_689939	Q8IYU8	EFHA1_HUMAN	EF-hand domain family, member A1								calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)		ccctaagtggtgtggctcctct	0.020													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27615640	27615640	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27615640delC								GPR12 (280718 upstream) : USP12 (26798 downstream)																							cacctacctgcacagggcatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31383925	31383934	+	IGR	DEL	GCTTGAGATA	-	-	rs150932569		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31383925_31383934delGCTTGAGATA								ALOX5AP (45369 upstream) : C13orf33 (96378 downstream)																							tcagactaaggcttgagatagcacaaccaa	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	41353275	41353276	+	IGR	DEL	AG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41353275_41353276delAG								MRPS31 (7928 upstream) : SLC25A15 (10271 downstream)																							ACACTCTCTTAGCAGGGCCTGT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49150139	49150141	+	IGR	DEL	ATG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49150139_49150141delATG								RCBTB2 (40021 upstream) : CYSLTR2 (77724 downstream)																							ggtgataataatgatgatgatgg	0.251													4	2	---	---	---	---	
DIAPH3	81624	broad.mit.edu	37	13	60285470	60285470	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60285470delT	uc001vht.2	-						DIAPH3_uc001vhs.2_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TAACAGCAGGTTTTTTTTTCC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81223784	81223784	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81223784delT								SPRY2 (308698 upstream) : None (None downstream)																							tctctttaggtttatcatgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86411651	86411651	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86411651delT								SLITRK6 (38168 upstream) : None (None downstream)																							AAAGAATTTCTTATATCAAAT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88109344	88109344	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88109344delA	uc001vlm.1	-											Homo sapiens clone IMAGE:32106, mRNA sequence.																		tggcgtactcaaaaaattatc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89461869	89461869	+	IGR	DEL	A	-	-	rs34257544		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89461869delA								None (None upstream) : None (None downstream)																							CTACTATAACAGGCACAATTC	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105413324	105413325	+	IGR	DEL	GG	-	-	rs112049629		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105413324_105413325delGG								None (None upstream) : DAOA (704891 downstream)																							TGAAGAGTAAGGTGCACTGAAT	0.446													4	3	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	33244380	33244380	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33244380delT	uc001wrq.2	+						uc001wrr.2_5'Flank	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGCTGGCATGTTTTTTGTTTG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57150085	57150085	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57150085delT								C14orf101 (33855 upstream) : OTX2 (117342 downstream)																							caatataaactttTTTTTTTA	0.179													8	4	---	---	---	---	
C14orf37	145407	broad.mit.edu	37	14	58727897	58727898	+	Intron	INS	-	T	T	rs11402145		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58727897_58727898insT	uc010tro.1	-						PSMA3_uc001xdj.1_Intron|PSMA3_uc001xdk.1_Intron	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						GTCCAACAGAAttttttttttt	0.109													16	13	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66123777	66123778	+	Intron	INS	-	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66123777_66123778insG	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		aaggaaacattggggaaactct	0.000													4	2	---	---	---	---	
NEK9	91754	broad.mit.edu	37	14	75582586	75582586	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75582586delA	uc001xrl.2	-						NEK9_uc001xrk.2_Intron	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9						cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TTAAAAAAAGAAAAAAAGACT	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86418989	86418991	+	IGR	DEL	AAC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86418989_86418991delAAC								FLRT2 (324720 upstream) : None (None downstream)																							ccaataggaaaacaacaacaaca	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86759671	86759672	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86759671_86759672insA								FLRT2 (665402 upstream) : None (None downstream)																							CACCTCAGTGGAAAAAAAAAAT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90102204	90102205	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90102204_90102205insT								FOXN3 (16710 upstream) : C14orf143 (161266 downstream)																							TCATACAGGGATTTTTTTTCTC	0.322													4	2	---	---	---	---	
SERPINA9	327657	broad.mit.edu	37	14	94944624	94944624	+	5'Flank	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94944624delA	uc001ydf.2	-						SERPINA9_uc001yde.2_5'Flank|SERPINA9_uc010avc.2_5'Flank|SERPINA9_uc001ydg.2_5'Flank|SERPINA9_uc001ydh.1_5'Flank|SERPINA9_uc001ydi.1_5'Flank	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade						regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		ccatgaccagaagaaaaatta	0.000													4	2	---	---	---	---	
KIAA0125	9834	broad.mit.edu	37	14	106356759	106356784	+	Intron	DEL	TGATATTGGGAGGTGCCGGTGATCCC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106356759_106356784delTGATATTGGGAGGTGCCGGTGATCCC	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						TGCCTGGGGTTGATATTGGGAGGTGCCGGTGATCCCTGTCTTTCTG	0.580													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106622428	106622429	+	Intron	INS	-	G	G	rs111337191		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106622428_106622429insG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CTGCAGGGTCAGGCTGCGCTGC	0.510													16	78	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106932579	106932580	+	Intron	INS	-	A	A	rs150402327	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106932579_106932580insA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						tagattgtgtttttttttattt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20126136	20126137	+	IGR	DEL	AG	-	-	rs34281620		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20126136_20126137delAG								None (None upstream) : GOLGA6L6 (610957 downstream)																							agtggttaacagggtacatttt	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20127637	20127637	+	IGR	DEL	A	-	-	rs147932702	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20127637delA								None (None upstream) : GOLGA6L6 (609457 downstream)																							CTGCACTGGGAGTCATATGAG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24012886	24012886	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24012886delT								NDN (80436 upstream) : PWRN2 (397040 downstream)																							ttgcttttgattttacaggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38115542	38115543	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38115542_38115543insT								MEIS2 (722042 upstream) : TMCO5A (111284 downstream)																							TGTGCAATATATTTTCAGTTTC	0.386													4	2	---	---	---	---	
SPRED1	161742	broad.mit.edu	37	15	38641774	38641775	+	Intron	INS	-	AAT	AAT	rs34352434		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38641774_38641775insAAT	uc001zka.3	+							NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain						inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TAATTAATAGATAGGTAAAGTT	0.317									Legius_syndrome				57	73	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	42942983	42942984	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42942983_42942984insA	uc001zqg.2	+						uc001zqh.2_Intron					Homo sapiens cDNA FLJ16106 fis, clone THYMU1000496, moderately similar to KINESIN-LIKE PROTEIN KIF1C.																		TTATAGACCATAATCTCTGTGA	0.277													8	5	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43398407	43398407	+	5'Flank	DEL	T	-	-	rs78412725		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43398407delT	uc001zqq.2	-						UBR1_uc010udk.1_5'Flank	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GGACTGGAGATTTTTTTTTTC	0.512													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48052328	48052329	+	Intron	INS	-	AAAAG	AAAAG	rs75506472		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48052328_48052329insAAAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TATTTTGAGTTAAAAAGACCAT	0.337													24	13	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													10	8	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66210135	66210150	+	Intron	DEL	TAATAATCCATCATGT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66210135_66210150delTAATAATCCATCATGT	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						TGATCAATCCTAATAATCCATCATGTTAGCTATAGA	0.412													6	3	---	---	---	---	
SEMA7A	8482	broad.mit.edu	37	15	74704899	74704899	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74704899delT	uc002axv.2	-						SEMA7A_uc010ulk.1_Intron|SEMA7A_uc010ull.1_Intron	NM_003612	NP_003603	O75326	SEM7A_HUMAN	semaphorin 7A isoform 1 preproprotein						axon guidance|immune response|inflammatory response|integrin-mediated signaling pathway|positive regulation of axon extension|positive regulation of ERK1 and ERK2 cascade|positive regulation of macrophage cytokine production|regulation of inflammatory response	anchored to membrane|external side of plasma membrane	receptor activity			breast(1)|central_nervous_system(1)	2						tttaaatacatttttttttta	0.045													4	2	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75676395	75676395	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75676395delT	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						ATATAACTAGTTTTTTTTTTT	0.279													4	5	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84582289	84582289	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84582289delT	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			TTTTTCTTTCTTTTTTTTTTG	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87742300	87742300	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87742300delA								AGBL1 (170017 upstream) : NCRNA00052 (377860 downstream)																							TTCTCAATTTAAAAAAAAAAt	0.199													4	2	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90585911	90585911	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90585911delA	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GAAGACAAAGAAGGGGGACAG	0.532													4	2	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99348535	99348535	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99348535delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CACACGCTGATTTTTTTTTTC	0.388													2	4	---	---	---	---	
UBN1	29855	broad.mit.edu	37	16	4917165	4917165	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4917165delA	uc002cyb.2	+						UBN1_uc010uxw.1_Intron|UBN1_uc002cyc.2_Intron	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1						chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						ggttctgaagaagggagtggc	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5463206	5463206	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5463206delA	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		CTTAACTAAGAAAAAAAACCT	0.468													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6726421	6726421	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6726421delA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TCTCAATAGTAAATAAAGGTG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8457228	8457228	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8457228delA								A2BP1 (693888 upstream) : TMEM114 (162275 downstream)																							TTAGCCACCTAAAAAAAAAAT	0.224													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15132211	15132212	+	Intron	INS	-	AAAGTTG	AAAGTTG	rs147448533	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15132211_15132212insAAAGTTG	uc002ddc.2	+						NTAN1_uc002ddd.2_Intron|NTAN1_uc010uzo.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTAGTAAGAAAAAAGTTGATTG	0.361													10	5	---	---	---	---	
ACSM2A	123876	broad.mit.edu	37	16	20480528	20480528	+	Intron	DEL	T	-	-	rs67796636		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20480528delT	uc010bwe.2	+						ACSM2A_uc010bwd.1_Intron|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						CTGTAGAAAATTTTTTTTGAG	0.363													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26675452	26675452	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26675452delG								HS3ST4 (526444 upstream) : C16orf82 (402767 downstream)																							atgaggaggaggcggtggaag	0.000													4	2	---	---	---	---	
ATXN2L	11273	broad.mit.edu	37	16	28845028	28845035	+	Intron	DEL	GATCAGGG	-	-	rs141681863		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28845028_28845035delGATCAGGG	uc002drc.2	+						uc010vct.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Intron|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_Intron|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A							membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AGGTTTGGGTGATCAGGGGATCAGGGAT	0.423													8	6	---	---	---	---	
ITGAM	3684	broad.mit.edu	37	16	31342128	31342129	+	Intron	INS	-	AC	AC	rs139593799	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31342128_31342129insAC	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						cacagagacagacaaaggagag	0.000													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32817485	32817486	+	IGR	INS	-	TCA	TCA			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817485_32817486insTCA								TP53TG3B (128607 upstream) : SLC6A10P (71311 downstream)																							ttgatttcatgtcatttcatca	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33532015	33532016	+	IGR	INS	-	TT	TT	rs147576683	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33532015_33532016insTT								SLC6A10P (635552 upstream) : MIR1826 (433492 downstream)																							CATCTTAAAAGTTTAACTTGCA	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34678664	34678664	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34678664delA								LOC283914 (52580 upstream) : LOC146481 (33121 downstream)																							aagatgcattaaaaaaaccta	0.000													7	4	---	---	---	---	
CCDC113	29070	broad.mit.edu	37	16	58312699	58312700	+	Intron	INS	-	TTTT	TTTT	rs112414360		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58312699_58312700insTTTT	uc002ene.2	+						CCDC113_uc010vid.1_Intron	NM_014157	NP_054876	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113 isoform 1							protein complex					0						ACGAAGGATGATTTGTTTTTTT	0.366													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60765237	60765237	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60765237delT								None (None upstream) : CDH8 (921998 downstream)																							actctttttctttttttaagt	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60986506	60986507	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60986506_60986507insT								None (None upstream) : CDH8 (700728 downstream)																							ATTTTCTGTGATTTTTTTTTTC	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64390223	64390223	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64390223delT								None (None upstream) : CDH11 (590462 downstream)																							tgcatgaggcttttttttttc	0.119													4	3	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66886451	66886454	+	Intron	DEL	AAGA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66886451_66886454delAAGA	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		ggaaggaaggaagaaagaaagaaa	0.039													4	3	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66886480	66886495	+	Intron	DEL	AAAAGAAAAGAAAAAA	-	-	rs72439001		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66886480_66886495delAAAAGAAAAGAAAAAA	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		aaaaagaaagaaaagaaaagaaaaaaaaaagaaaag	0.148													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73269827	73269827	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73269827delC								HTA (142157 upstream) : None (None downstream)																							acctaggcttcccaaagggct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	76291160	76291160	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76291160delG								TERF2IP (599832 upstream) : CNTNAP4 (20016 downstream)																							CTTCTTTCCTGGAATTAGTCC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86487803	86487804	+	IGR	INS	-	A	A	rs138292461	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86487803_86487804insA								LOC732275 (108518 upstream) : FOXF1 (56329 downstream)																							agcagaggaggaaaaaaacagc	0.000													5	3	---	---	---	---	
ARHGEF15	22899	broad.mit.edu	37	17	8214378	8214380	+	Intron	DEL	CAT	-	-	rs140256327		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8214378_8214380delCAT	uc002glc.2	+						ARHGEF15_uc002glb.1_Intron|ARHGEF15_uc002gld.2_Intron|ARHGEF15_uc010vuw.1_5'Flank	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15						negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CTGCAAGACCCATCATCTACAAC	0.571													3	7	---	---	---	---	
PIK3R6	146850	broad.mit.edu	37	17	8732842	8732845	+	Intron	DEL	CACT	-	-	rs34608441		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8732842_8732845delCACT	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						catacacacacactgacacacgca	0.000													14	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	12440209	12440209	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12440209delA								MAP2K4 (393159 upstream) : MYOCD (128998 downstream)																							TGACATTCTGAAAAAAAAAGT	0.313													4	2	---	---	---	---	
CDRT4	284040	broad.mit.edu	37	17	15368709	15368710	+	Intron	DEL	AC	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15368709_15368710delAC	uc002gop.1	-						CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_173622	NP_775893	Q8N9R6	CDRT4_HUMAN	CMT1A duplicated region transcript 4												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0874)		acacacaccaacacacacacac	0.064													4	2	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16023502	16023502	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16023502delC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ctgaatccatcccctccttgc	0.100													4	2	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16097602	16097603	+	Intron	INS	-	AAG	AAG	rs148802567	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16097602_16097603insAAG	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AAAGCCACAGTAAGACAGAAAT	0.327													23	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20571695	20571696	+	IGR	DEL	TG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20571695_20571696delTG								LGALS9B (200847 upstream) : CCDC144NL (195014 downstream)																							TTTATACATAtgtgtgtgtgtg	0.347													5	3	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21217017	21217017	+	Intron	DEL	C	-	-	rs67245637		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21217017delC	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ATACCTGGCTCCCTCCTCCCT	0.393													12	8	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21217021	21217022	+	Intron	DEL	CC	-	-	rs67362606		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21217021_21217022delCC	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CTGGCTCCCTCCTCCCTCCTTC	0.381													11	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21252361	21252362	+	IGR	INS	-	G	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21252361_21252362insG								MAP2K3 (33812 upstream) : KCNJ12 (27337 downstream)																							CGCTTGGTGGTGGTgggggaag	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21341833	21341833	+	IGR	DEL	G	-	-	rs63315060		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21341833delG								KCNJ12 (18654 upstream) : C17orf51 (89739 downstream)																							agaaccagaagtgaacatgag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21353596	21353596	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21353596delA								KCNJ12 (30417 upstream) : C17orf51 (77976 downstream)																							TATTCCTACTAAAGTCTCTCT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21507129	21507129	+	IGR	DEL	A	-	-	rs113637029		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21507129delA								C17orf51 (29398 upstream) : FAM27L (318241 downstream)																							caggagtggcaaagctgagat	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21548660	21548662	+	IGR	DEL	TCT	-	-	rs147918165		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21548660_21548662delTCT								C17orf51 (70929 upstream) : FAM27L (276708 downstream)																							TTAGAAGGCATCTTCTTAGATTA	0.409													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21556827	21556828	+	IGR	INS	-	AGAG	AGAG	rs145452478		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21556827_21556828insAGAG								C17orf51 (79096 upstream) : FAM27L (268542 downstream)																							GTTTCTTGTCTAGAGAGAGATG	0.327													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25285558	25285559	+	IGR	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25285558_25285559insA								None (None upstream) : WSB1 (335547 downstream)																							aaaggaatcagaaaaaatatta	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25988693	25988702	+	IGR	DEL	CACAGGTGGC	-	-	rs3217511		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25988693_25988702delCACAGGTGGC								LGALS9 (12108 upstream) : NOS2 (95091 downstream)																							GATGTAAAAGCACAGGTGGCCACAGGTTAC	0.500													5	8	---	---	---	---	
CCL3	6348	broad.mit.edu	37	17	34416271	34416272	+	Intron	INS	-	C	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34416271_34416272insC	uc002hkv.2	-							NM_002983	NP_002974	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3						cell-cell signaling|cellular calcium ion homeostasis|cellular component movement|cytoskeleton organization|exocytosis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|regulation of viral genome replication	extracellular space|soluble fraction	chemoattractant activity|chemokine activity|signal transducer activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCTCAGTGACTCAGTAGGGGTG	0.599													14	7	---	---	---	---	
AATF	26574	broad.mit.edu	37	17	35345613	35345613	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35345613delA	uc002hni.2	+						AATF_uc002hnj.2_Intron	NM_012138	NP_036270	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity				0		Breast(25;0.00607)				agactgtctcaaaaaaaaaaG	0.154													7	4	---	---	---	---	
ACACA	31	broad.mit.edu	37	17	35530401	35530401	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35530401delT	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TCCTAAATTGTTTTTTTGATA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39051098	39051098	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39051098delA								KRT20 (9619 upstream) : KRT23 (27854 downstream)																							ACACTTAAGTAAAAAGGGAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39162792	39162792	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39162792delC								KRTAP3-2 (6654 upstream) : KRTAP3-1 (1982 downstream)																							cttagggccacagaggcagct	0.045													4	2	---	---	---	---	
DNAJC7	7266	broad.mit.edu	37	17	40128479	40128480	+	3'UTR	INS	-	T	T	rs139687730	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40128479_40128480insT	uc002hyo.2	-	14					CNP_uc002hyl.1_3'UTR|CNP_uc010wfz.1_3'UTR|CNP_uc002hym.1_3'UTR|CNP_uc010wga.1_3'UTR|CNP_uc002hyn.1_3'UTR|DNAJC7_uc010cxu.2_3'UTR|DNAJC7_uc010cxv.2_3'UTR|DNAJC7_uc010wgb.1_3'UTR|DNAJC7_uc010wgc.1_3'UTR|DNAJC7_uc002hyp.2_3'UTR	NM_003315	NP_003306	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7						chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding			ovary(1)	1		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				ATTTTATTCTCTTTTTTTTTTC	0.495													4	4	---	---	---	---	
SOST	50964	broad.mit.edu	37	17	41831362	41831362	+	3'UTR	DEL	T	-	-	rs71800595		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41831362delT	uc002iec.1	-	2						NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor						negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		TGTTTAAAACTTTTTTTTTTT	0.363													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43261806	43261806	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43261806delT								HEXIM2 (14400 upstream) : FMNL1 (37486 downstream)																							aaattttccctttttttttga	0.000													4	2	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43893770	43893770	+	Intron	DEL	C	-	-	rs68004164		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43893770delC	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron|CRHR1_uc010das.1_Intron|CRHR1_uc002ijo.1_Intron	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		ATGTCCTCTGCCTGCCTGGGG	0.587													14	11	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43893773	43893777	+	Intron	DEL	GCCTG	-	-	rs66475418		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43893773_43893777delGCCTG	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron|CRHR1_uc010das.1_Intron|CRHR1_uc002ijo.1_Intron	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TCCTCTGCCTGCCTGGGGCCTTGGC	0.605													11	11	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44155926	44155929	+	Intron	DEL	ACAA	-	-	rs67212864		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44155926_44155929delACAA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				ctgataatatacaaacaagcccat	0.059													4	4	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56646111	56646112	+	Intron	INS	-	ATTT	ATTT	rs146390153	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56646111_56646112insATTT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTAGGAAGGGGATTTATTCACA	0.436													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	69536232	69536235	+	IGR	DEL	ACAC	-	-	rs72194841		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69536232_69536235delACAC								None (None upstream) : SOX9 (580926 downstream)																							tcacatacatacacacacacacac	0.191													5	7	---	---	---	---	
SSTR2	6752	broad.mit.edu	37	17	71159530	71159531	+	5'Flank	INS	-	T	T	rs79061108		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71159530_71159531insT	uc002jje.2	+							NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2						digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)			TCCAGTTATTATTTTTTTTAAT	0.490													4	2	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73205917	73205918	+	Splice_Site	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73205917_73205918insA	uc002jng.1	+	3	388	c.128_splice	c.e3-1	p.E43_splice	NUP85_uc010dgd.1_Splice_Site_p.E43_splice|NUP85_uc010wrv.1_Splice_Site	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TTTGGTTTCAGAAAAATCAGAG	0.282													162	73	---	---	---	---	
QRICH2	84074	broad.mit.edu	37	17	74270478	74270492	+	Intron	DEL	GCCGGGGCCGGGGGG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74270478_74270492delGCCGGGGCCGGGGGG	uc002jrd.1	-						QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						GAGGGGAGCTGCCGGGGCCGGGGGGCACGGCGCAG	0.609													17	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	76665984	76665984	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76665984delC								DNAH17 (197128 upstream) : CYTH1 (4147 downstream)																							GTGTGCCCAGCCCCAGTGAGG	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10080235	10080236	+	IGR	DEL	TG	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10080235_10080236delTG								VAPA (120218 upstream) : APCDD1 (374389 downstream)																							actgtatgtttgtgtgtgtgtg	0.213													5	3	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11876430	11876431	+	Intron	INS	-	CAGCCTGGGCAAGAGA	CAGCCTGGGCAAGAGA	rs142274868	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11876430_11876431insCAGCCTGGGCAAGAGA	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_Intron	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						ccactgcactccagcctgggca	0.104													23	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15307686	15307687	+	IGR	DEL	TT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15307686_15307687delTT								ANKRD30B (454949 upstream) : LOC644669 (5868 downstream)																							TTTGTAGCTGTTTTTTTGTAGG	0.366													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15384999	15384999	+	IGR	DEL	G	-	-	rs112267991		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15384999delG								LOC644669 (59081 upstream) : None (None downstream)																							tcatctcatagagttgaacat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33867152	33867152	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33867152delC								MOCOS (18468 upstream) : FHOD3 (10550 downstream)																							AACATACACTCCAGTTCTTCC	0.478													4	2	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	34088233	34088233	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34088233delT	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCAAATAAGCTTTTTTTTTTT	0.134													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	48756928	48756928	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48756928delT								MEX3C (33238 upstream) : None (None downstream)																							gcgatcaagatttttgcaaac	0.000													2	4	---	---	---	---	
RAB27B	5874	broad.mit.edu	37	18	52505617	52505617	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52505617delT	uc002lfr.2	+							NM_004163	NP_004154	O00194	RB27B_HUMAN	RAB27B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus|plasma membrane	GTP binding|GTPase activity				0				Colorectal(16;0.0273)|READ - Rectum adenocarcinoma(59;0.219)		catgttaatattttttttctA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	54138264	54138265	+	IGR	DEL	CA	-	-	rs76480206		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54138264_54138265delCA								TCF4 (835079 upstream) : TXNL1 (131790 downstream)																							cactctttctcacacacacaca	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68588979	68588979	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68588979delA								SOCS6 (591545 upstream) : None (None downstream)																							ctgaaaccccaaaaagccaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68887272	68887272	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68887272delA								SOCS6 (889838 upstream) : None (None downstream)																							tgccacaaagaaaaaaaaata	0.000													4	2	---	---	---	---	
ATP9B	374868	broad.mit.edu	37	18	76884165	76884166	+	Intron	DEL	AG	-	-	rs34522646		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76884165_76884166delAG	uc002lmx.2	+						ATP9B_uc002lmv.1_Intron|ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmy.1_Intron|ATP9B_uc002lmz.1_Intron	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		tcatagagacagaaagtggatg	0.000													2	4	---	---	---	---	
MKNK2	2872	broad.mit.edu	37	19	2042956	2042956	+	Intron	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2042956delC	uc002lus.2	-						MKNK2_uc002luq.1_5'Flank|MKNK2_uc010xgu.1_Intron|MKNK2_uc010xgv.1_Intron|MKNK2_uc002lur.2_Intron|MKNK2_uc002lut.1_5'Flank	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCACTTTGGCGGGGACGCCC	0.557													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6627051	6627054	+	IGR	DEL	CTTT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6627051_6627054delCTTT								CD70 (35888 upstream) : TNFSF14 (37512 downstream)																							tccctccttcctttctttctttct	0.083													4	2	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8172840	8172840	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8172840delA	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						AAAGATCAATAAACCAACAAG	0.234													4	2	---	---	---	---	
ZNF559	84527	broad.mit.edu	37	19	9441533	9441533	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9441533delT	uc002mlg.2	+						ZNF559_uc002mlf.2_Intron|ZNF559_uc010dwl.1_Intron|ZNF559_uc010xkn.1_Intron|ZNF559_uc010dwm.1_Intron|ZNF559_uc002mle.3_Intron|ZNF559_uc010dwk.1_Intron|ZNF559_uc002mld.2_Intron|ZNF559_uc010dwo.1_Intron|ZNF559_uc002mlh.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ttcttcttgattcttcatgct	0.000													4	2	---	---	---	---	
DNMT1	1786	broad.mit.edu	37	19	10260019	10260019	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10260019delA	uc002mng.2	-						DNMT1_uc010xlc.1_Intron|DNMT1_uc002mnh.2_Intron|DNMT1_uc010xld.1_Intron	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	aaaaaaaaacaaaaaaaaaac	0.194													8	5	---	---	---	---	
C19orf38	255809	broad.mit.edu	37	19	10973513	10973514	+	Intron	INS	-	A	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10973513_10973514insA	uc010dxm.1	+							NM_001136482	NP_001129954	A8MVS5	HIDE1_HUMAN	hypothetical protein LOC255809 precursor							integral to membrane					0						tcaaaaacaagaaaaaaaaaaT	0.257													4	2	---	---	---	---	
NR2F6	2063	broad.mit.edu	37	19	17351377	17351377	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17351377delG	uc002nfq.2	-							NM_005234	NP_005225	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6						negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding				0						CCCTGTGAAAGGGAGGGGTGA	0.627													20	10	---	---	---	---	
NR2F6	2063	broad.mit.edu	37	19	17351381	17351392	+	Intron	DEL	GGGGTGAAAGGG	-	-	rs115141412	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17351381_17351392delGGGGTGAAAGGG	uc002nfq.2	-							NM_005234	NP_005225	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6						negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding				0						GTGAAAGGGAGGGGTGAAAGGGAGGGGAAAAA	0.618													22	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23184141	23184141	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23184141delA								ZNF99 (231357 upstream) : ZNF91 (337278 downstream)																							GTAGCTTTCCAAAAAAACAGC	0.433													4	2	---	---	---	---	
LYPD5	284348	broad.mit.edu	37	19	44306390	44306395	+	Intron	DEL	CCCCCA	-	-	rs72214885		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44306390_44306395delCCCCCA	uc002oxm.3	-						LYPD5_uc002oxn.3_Intron	NM_001031749	NP_001026919	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5 isoform A							anchored to membrane|plasma membrane					0		Prostate(69;0.0352)				ggagtccaggcccccagtctctcctc	0.102													14	10	---	---	---	---	
IGFL2	147920	broad.mit.edu	37	19	46652434	46652437	+	Intron	DEL	TCTC	-	-	rs143439832	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46652434_46652437delTCTC	uc010xxv.1	+						IGFL2_uc002peb.2_Intron	NM_001135113	NP_001128585	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2 isoform b							extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		ctctctctcttctctctctctttc	0.132													24	11	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49851747	49851755	+	Intron	DEL	CAGCTGCAT	-	-	rs33974425		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49851747_49851755delCAGCTGCAT	uc002pnj.2	-						TEAD2_uc002png.2_Intron|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		gtccccagaccagctgcatcaacgcacct	0.158													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53823487	53823488	+	IGR	INS	-	GAGAAGAT	GAGAAGAT	rs139292766	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53823487_53823488insGAGAAGAT								BIRC8 (28612 upstream) : ZNF845 (13514 downstream)																							CTATTTAaatggagaagatcac	0.069													3	3	---	---	---	---	
CACNG8	59283	broad.mit.edu	37	19	54469033	54469033	+	Intron	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54469033delG	uc002qcs.1	+							NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		acaaggagttgggggagggga	0.000													4	2	---	---	---	---	
ZNF587	84914	broad.mit.edu	37	19	58354911	58354911	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58354911delT	uc002qqb.2	+						ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|ZNF587_uc002qqj.1_Intron	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TCACGAGAGATTTTTTTTTTA	0.204													4	2	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25507463	25507463	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25507463delT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						TAAATAGTCCTTCAGTCGTCA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26142398	26142398	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26142398delG								C20orf191 (47721 upstream) : MIR663 (46424 downstream)																							TCATGTTGGAGGGCGTGATTT	0.363													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29645743	29645743	+	Intron	DEL	G	-	-	rs146031080	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29645743delG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						actggataaagaaaatgtggt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38132414	38132414	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38132414delT								LOC339568 (279023 upstream) : None (None downstream)																							CAGGAGACACTTTGCAATAAG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42949756	42949757	+	IGR	DEL	GG	-	-	rs142923797	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42949756_42949757delGG								FITM2 (9867 upstream) : R3HDML (15869 downstream)																							ttgtttttgtggtttttttgtt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49758984	49758984	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49758984delT								KCNG1 (119309 upstream) : NFATC2 (248782 downstream)																							attttacaacttttTCCTCAC	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58744653	58744654	+	Intron	INS	-	TT	TT	rs150710079	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58744653_58744654insTT	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		GCTCTGGAGACTATCTGCATTT	0.386													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9832230	9832231	+	IGR	INS	-	AA	AA	rs74337112		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9832230_9832231insAA								None (None upstream) : None (None downstream)																							ccctagcagagaaccctgtaag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9838039	9838042	+	IGR	DEL	TGAT	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9838039_9838042delTGAT								None (None upstream) : None (None downstream)																							atgtttactctgattgatgtgtga	0.000													4	3	---	---	---	---	
LOC100132288	100132288	broad.mit.edu	37	21	9917077	9917078	+	Intron	DEL	TA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9917077_9917078delTA	uc002zka.1	-							NM_001033515	NP_001028687			hypothetical protein LOC100132288												0						ATCAAAATtgtatatgtgtgtg	0.099													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10469320	10469320	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10469320delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		aaactctgcctttttttttct	0.070													4	3	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10943981	10943982	+	Intron	INS	-	A	A	rs137971530		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10943981_10943982insA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTGTCACAGTAAAAAAAGAGT	0.386													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAGGAAAAGTTATGTATAT	0.124													9	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071749	11071750	+	Intron	INS	-	ACTT	ACTT	rs148241564		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071749_11071750insACTT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gctcagtgataacttaaccacc	0.000													17	8	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11099473	11099474	+	5'Flank	INS	-	C	C	rs76520713	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11099473_11099474insC	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aggaaaagatgttgggaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11178376	11178376	+	IGR	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11178376delT								BAGE (79439 upstream) : None (None downstream)																							aaacttttaatttttttaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11179613	11179613	+	IGR	DEL	T	-	-	rs71639665		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11179613delT								BAGE (80676 upstream) : None (None downstream)																							AATAGTTGGAttttttttttc	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11182438	11182439	+	IGR	INS	-	T	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11182438_11182439insT								BAGE (83501 upstream) : None (None downstream)																							ttggtttctcattttgtttatt	0.059													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14343426	14343427	+	IGR	INS	-	A	A	rs150026790		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343426_14343427insA								None (None upstream) : C21orf99 (67060 downstream)																							tgccctgtgataaagtatgacc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14345601	14345601	+	IGR	DEL	T	-	-	rs113491252		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14345601delT								None (None upstream) : C21orf99 (64886 downstream)																							aaatgtccacttgcagatcct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14777757	14777757	+	IGR	DEL	T	-	-	rs140129927		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14777757delT								C21orf99 (287188 upstream) : POTED (204741 downstream)																							Gtttttgttgttttttttttt	0.144													6	5	---	---	---	---	
SON	6651	broad.mit.edu	37	21	34948508	34948509	+	Intron	INS	-	T	T	rs111372529		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34948508_34948509insT	uc002yse.1	+						SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysh.2_Intron|DONSON_uc002ysi.1_Intron	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F						anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						TTTGCAGTCCCTTTCCCAAATG	0.287													11	42	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39906277	39906290	+	Intron	DEL	CAAATGAACACCTG	-	-	rs111755368		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39906277_39906290delCAAATGAACACCTG	uc010gnw.2	-						ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				TTTCTATTGCCAAATGAACACCTGTTTCAGAGTC	0.308													26	29	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45814728	45814728	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45814728delT	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGGGAGATGGTTTTTTTTCTA	0.448													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45815574	45815574	+	Intron	DEL	G	-	-	rs67099101		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45815574delG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ggggtgtggagggctgtggag	0.249													10	6	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45815583	45815584	+	Intron	INS	-	G	G	rs67276218		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45815583_45815584insG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						agggctgtggaggatgtggagg	0.218													7	5	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45815613	45815613	+	Intron	DEL	G	-	-	rs68122078		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45815613delG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gggctgtggagggatgtggag	0.119													4	2	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46930960	46930960	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46930960delA	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Intron|COL18A1_uc002zhk.2_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		acacccccccacaaacaccca	0.144													16	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47555409	47555410	+	IGR	DEL	CA	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47555409_47555410delCA								COL6A2 (2646 upstream) : FTCD (767 downstream)																							AGTGTCCCCTCACAAATGTCCC	0.535													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17374203	17374203	+	IGR	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17374203delA								HSFYL1 (63978 upstream) : GAB4 (68626 downstream)																							aatagttaccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30051931	30051931	+	Intron	DEL	T	-	-	rs113985281		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30051931delT	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						AAGTTTAAGAttttttttttt	0.174			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35929280	35929280	+	IGR	DEL	C	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35929280delC								MCM5 (108786 upstream) : RASD2 (8072 downstream)																							CAGCTTCTCTCCCACataata	0.358													4	2	---	---	---	---	
GCAT	23464	broad.mit.edu	37	22	38205827	38205827	+	Intron	DEL	A	-	-	rs78837898		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38205827delA	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	accctgtctcaaaaaaaaaaa	0.204													8	9	---	---	---	---	
DMC1	11144	broad.mit.edu	37	22	38934156	38934156	+	Intron	DEL	A	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38934156delA	uc003avz.1	-						DMC1_uc011anv.1_Intron	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog						reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					ctcaaaaaacaaaaaaaaaac	0.134								Homologous_recombination					8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41408694	41408694	+	IGR	DEL	G	-	-	rs13055033	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41408694delG								RBX1 (40028 upstream) : MIR1281 (79823 downstream)																							ttttagttttgtttttttttt	0.065													3	3	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46788309	46788310	+	Intron	DEL	TG	-	-	rs145186826		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46788309_46788310delTG	uc003bhw.1	-						CELSR1_uc011arc.1_Intron	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGTTCAGACCTGTGTGTCAGGT	0.535													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	46956849	46956849	+	IGR	DEL	G	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46956849delG								CELSR1 (23782 upstream) : GRAMD4 (65809 downstream)																							GGAGCTGGGTGGAGGCTGGCT	0.597													4	2	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47300233	47300234	+	Intron	INS	-	CTG	CTG	rs139436143	by1000genomes	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47300233_47300234insCTG	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		TTCAGTGATGTCTATGTGGCGA	0.490													5	6	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	302224	302225	+	Intron	INS	-	CCC	CCC			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:302224_302225insCCC	uc004cpg.2	-						PPP2R3B_uc004cpf.2_5'UTR	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTGAGGGGAGCCCCCCGGGCC	0.520													29	24	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467625	1467626	+	Intron	INS	-	TC	TC			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467625_1467626insTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tcctttctttttctttctttct	0.000													5	5	---	---	---	---	
RBBP7	5931	broad.mit.edu	37	X	16867569	16867569	+	Intron	DEL	T	-	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16867569delT	uc004cxt.2	-						RBBP7_uc004cxs.1_Intron|RBBP7_uc004cxu.2_Intron	NM_002893	NP_002884	Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7						cell proliferation|cellular heat acclimation|CenH3-containing nucleosome assembly at centromere|DNA replication|multicellular organismal development|negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex|NuRD complex	protein binding			upper_aerodigestive_tract(1)|ovary(1)	2	Hepatocellular(33;0.0997)					ATCAATTAGGttttttttttc	0.164													25	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13430917	13430918	+	IGR	INS	-	AA	AA			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13430917_13430918insAA								None (None upstream) : None (None downstream)																							TTTAAACTTGGAAAAAATTGAA	0.361													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28582961	28582962	+	IGR	INS	-	AT	AT	rs4008413		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28582961_28582962insAT								None (None upstream) : None (None downstream)																							AAGTATAAAACAAAAACCTAAA	0.322													13	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28588050	28588052	+	IGR	DEL	CAT	-	-	rs111989825		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28588050_28588052delCAT								None (None upstream) : None (None downstream)																							tcttcttttacatcattctgtcA	0.182													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58990564	58990564	+	IGR	DEL	C	-	-	rs113350256		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58990564delC								None (None upstream) : None (None downstream)																							gcactgatcacccaggtgatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59022489	59022490	+	IGR	INS	-	A	A	rs28547130		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59022489_59022490insA								None (None upstream) : None (None downstream)																							aaaagaaaaagaaaaaaCTCca	0.010													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59032071	59032071	+	IGR	DEL	T	-	-	rs113525697		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59032071delT								None (None upstream) : None (None downstream)																							agcaaaactcttgtctctaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59032513	59032515	+	IGR	DEL	TCC	-	-	rs4047360		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59032513_59032515delTCC								None (None upstream) : None (None downstream)																							ccctgttttttcctcctcctctc	0.054													4	2	---	---	---	---	
