Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MIIP	60672	broad.mit.edu	37	1	12090150	12090150	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12090150T>G	uc001ato.1	+	8	1091	c.911T>G	c.(910-912)TTT>TGT	p.F304C		NM_021933	NP_068752	Q5JXC2	MIIP_HUMAN	invasion inhibitory protein 45	304										ovary(1)	1						CGAAAGAGCTTTGACGCCTCT	0.697													14	38	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16257158	16257158	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16257158C>T	uc001axk.1	+	11	4627	c.4423C>T	c.(4423-4425)CGA>TGA	p.R1475*	SPEN_uc010obp.1_Nonsense_Mutation_p.R1434*	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1475					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGCAAATTTTCGAAACAACAA	0.378													12	172	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976825	16976825	+	RNA	SNP	C	A	A	rs2761525	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976825C>A	uc010och.1	+	14		c.2546C>A			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						taataaaattcatatttttac	0.164													4	28	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51826841	51826841	+	Splice_Site	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51826841A>G	uc001csq.1	-	24	2636	c.2544_splice	c.e24+1	p.A848_splice	EPS15_uc009vyz.1_Splice_Site_p.A714_splice|EPS15_uc001csp.3_Splice_Site_p.A534_splice	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CACAGTACTTACAGCACTGAA	0.358			T	MLL	ALL								40	128	---	---	---	---	PASS
PRPF38B	55119	broad.mit.edu	37	1	109241909	109241909	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109241909G>A	uc001dvv.3	+	6	1190	c.908G>A	c.(907-909)CGA>CAA	p.R303Q	PRPF38B_uc001dvw.3_Missense_Mutation_p.R192Q|PRPF38B_uc010ouz.1_Missense_Mutation_p.R106Q	NM_018061	NP_060531	Q5VTL8	PR38B_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	303	Arg-rich.|Potential.				mRNA processing|RNA splicing	spliceosomal complex					0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		GAACGCCAGCGACTAGAGCGT	0.512													12	77	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144857010	144857010	+	Missense_Mutation	SNP	T	C	C	rs3853916	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144857010T>C	uc001elw.3	-	40	6766	c.6475A>G	c.(6475-6477)ACC>GCC	p.T2159A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.T2053A|PDE4DIP_uc001elv.3_Missense_Mutation_p.T1166A	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2159					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTGGGAGGGGTCTTCATTACT	0.443			T	PDGFRB	MPD								3	90	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145359169	145359169	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145359169T>A	uc001end.3	+	74	9369	c.9334T>A	c.(9334-9336)TTG>ATG	p.L3112M	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oyq.1_Intron|NBPF10_uc010oyr.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3037											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCGTGTTGGCTTGGCTGTTGA	0.458													9	422	---	---	---	---	PASS
TMOD4	29765	broad.mit.edu	37	1	151146066	151146066	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151146066C>A	uc001exc.3	-	4	496	c.306G>T	c.(304-306)AGG>AGT	p.R102S	TMOD4_uc001exb.2_5'Flank|TMOD4_uc001exd.2_RNA|TMOD4_uc010pct.1_Intron	NM_013353	NP_037485	Q9NZQ9	TMOD4_HUMAN	tropomodulin 4 (muscle)	102					muscle contraction	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGGGATTTCCCTCTTGGGCT	0.547													4	155	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152186042	152186042	+	Missense_Mutation	SNP	A	G	G	rs12751022	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152186042A>G	uc001ezt.1	-	3	8139	c.8063T>C	c.(8062-8064)TTG>TCG	p.L2688S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2688	29.			L -> S (in Ref. 1; BAC57496).	keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAGTGACCCAAGCGAGACTC	0.582													8	114	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207737312	207737312	+	Silent	SNP	T	C	C	rs56232421		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207737312T>C	uc001hfy.2	+	14	2480	c.2340T>C	c.(2338-2340)TAT>TAC	p.Y780Y	CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Silent_p.Y1230Y|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	780	Sushi 12.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						AGCCCGGCTATGACCTCAGAG	0.577													7	164	---	---	---	---	PASS
SMYD2	56950	broad.mit.edu	37	1	214505689	214505689	+	Intron	SNP	G	C	C	rs870118	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214505689G>C	uc010ptx.1	+						SMYD2_uc009xdj.2_3'UTR|SMYD2_uc010ptw.1_RNA|SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2						negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		GCAGGGCACTGCTCCCGAGTC	0.572											OREG0012979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	2	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227152757	227152757	+	Silent	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227152757G>A	uc001hqm.1	+	8	3653	c.234G>A	c.(232-234)GAG>GAA	p.E78E	CABC1_uc010pvp.1_Silent_p.E41E|CABC1_uc001hqn.1_Silent_p.E78E|CABC1_uc009xeq.1_Silent_p.E26E|CABC1_uc010pvq.1_Intron|CABC1_uc010pvr.1_5'Flank	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	78					cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CAGAAGGGGAGTTCCACTTCT	0.587													6	57	---	---	---	---	PASS
CNNM4	26504	broad.mit.edu	37	2	97464910	97464910	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97464910C>A	uc002swx.2	+	4	1896	c.1798C>A	c.(1798-1800)CAT>AAT	p.H600N	CNNM4_uc010yuy.1_Missense_Mutation_p.H87N	NM_020184	NP_064569	Q6P4Q7	CNNM4_HUMAN	cyclin M4	600					biomineral tissue development|ion transport|response to stimulus|visual perception	integral to membrane|plasma membrane				breast(2)|ovary(1)	3						CTACGCCCGCCATTACCTGTA	0.567													9	94	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165970412	165970412	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165970412G>T	uc002ucx.2	-	20	4075	c.3583C>A	c.(3583-3585)CTT>ATT	p.L1195I	SCN3A_uc002ucy.2_Missense_Mutation_p.L1146I|SCN3A_uc002ucz.2_Missense_Mutation_p.L1146I|SCN3A_uc002uda.1_Missense_Mutation_p.L1015I|SCN3A_uc002udb.1_Missense_Mutation_p.L1015I	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1195						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	GTTTTTCGAAGATTCCACCAG	0.333													7	289	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209190767	209190767	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209190767C>T	uc002vcz.2	+	20	3390	c.3232C>T	c.(3232-3234)CGA>TGA	p.R1078*	PIKFYVE_uc010fun.1_Nonsense_Mutation_p.R759*|PIKFYVE_uc002vcy.1_Nonsense_Mutation_p.R1022*	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1078					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						ATGCTCTACCCGAGATTATTT	0.423													5	189	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210658516	210658516	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210658516C>T	uc010zjc.1	+	7	951	c.871C>T	c.(871-873)CGA>TGA	p.R291*	UNC80_uc002vdj.1_Nonsense_Mutation_p.R291*	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	291						integral to membrane					0						AGGCTGTCACCGAGGAAACTC	0.488													40	123	---	---	---	---	PASS
GIGYF2	26058	broad.mit.edu	37	2	233620970	233620970	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233620970T>C	uc002vti.3	+	8	642	c.305T>C	c.(304-306)CTG>CCG	p.L102P	GIGYF2_uc010zmj.1_Missense_Mutation_p.L102P|GIGYF2_uc002vtg.2_Missense_Mutation_p.L102P|GIGYF2_uc002vtj.3_Missense_Mutation_p.L102P|GIGYF2_uc002vtk.3_Missense_Mutation_p.L102P|GIGYF2_uc002vth.3_Missense_Mutation_p.L102P|GIGYF2_uc010zmk.1_RNA	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	102					cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GCTGCTGTCCTGCGATTGACA	0.363													3	78	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10108898	10108898	+	Silent	SNP	A	G	G	rs77246387	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10108898A>G	uc003buw.2	+	26	2469	c.2391A>G	c.(2389-2391)GTA>GTG	p.V797V	FANCD2_uc003bux.1_Silent_p.V797V|FANCD2_uc003buy.1_Silent_p.V797V|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	797					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	52	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	T	T	rs80258959	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10108913G>T	uc003buw.2	+	26	2484	c.2406G>T	c.(2404-2406)CAG>CAT	p.Q802H	FANCD2_uc003bux.1_Missense_Mutation_p.Q802H|FANCD2_uc003buy.1_Missense_Mutation_p.Q802H|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	802					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	54	---	---	---	---	PASS
PRSS50	29122	broad.mit.edu	37	3	46755773	46755773	+	Missense_Mutation	SNP	G	A	A	rs139823108	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46755773G>A	uc003cqe.1	-	4	748	c.689C>T	c.(688-690)ACG>ATG	p.T230M	PRSS50_uc003cqf.1_Missense_Mutation_p.T144M	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN	testes-specific protease 50 precursor	230	Peptidase S1.				proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity				0						CACATAGTCCGTGCCAGGCAG	0.602													4	47	---	---	---	---	PASS
RBM5	10181	broad.mit.edu	37	3	50137905	50137905	+	Intron	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50137905C>A	uc003cyg.2	+						RBM5_uc003cyf.2_3'UTR|RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGAGATTCACCTGTTATAAA	0.443													3	67	---	---	---	---	PASS
AGTR1	185	broad.mit.edu	37	3	148458896	148458896	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148458896A>C	uc003ewg.2	+	4	520	c.74A>C	c.(73-75)AAT>ACT	p.N25T	AGTR1_uc003ewh.2_Missense_Mutation_p.N25T|AGTR1_uc003ewi.2_Missense_Mutation_p.N25T|AGTR1_uc003ewj.2_Missense_Mutation_p.N25T|AGTR1_uc003ewk.2_Missense_Mutation_p.N25T	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	25	Extracellular (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	GGAAGGCATAATTACATATTT	0.353													24	168	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155571051	155571051	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155571051G>A	uc003fan.3	-	1	1117	c.736C>T	c.(736-738)CGG>TGG	p.R246W	SLC33A1_uc003fao.1_Missense_Mutation_p.R246W	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	246	Extracellular (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GGCTGAAACCGCAAATATTTG	0.408													4	98	---	---	---	---	PASS
DGKQ	1609	broad.mit.edu	37	4	956989	956989	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:956989G>T	uc003gbw.2	-	16	1898	c.1824C>A	c.(1822-1824)AGC>AGA	p.S608R	DGKQ_uc010ibn.2_Missense_Mutation_p.S595R	NM_001347	NP_001338	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta	608	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding			kidney(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCTTCCGGAAGCTGCAGAGCA	0.627													3	49	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79458218	79458218	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79458218T>A	uc003hlb.2	+	72	11602	c.11162T>A	c.(11161-11163)CTG>CAG	p.L3721Q		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3716	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AAACTCCAGCTGGAGAAAGTC	0.418													32	238	---	---	---	---	PASS
INTS12	57117	broad.mit.edu	37	4	106607868	106607868	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106607868A>G	uc003hxw.2	-	7	1043	c.785T>C	c.(784-786)TTT>TCT	p.F262S	INTS12_uc010ilr.2_Missense_Mutation_p.F262S	NM_020395	NP_065128	Q96CB8	INT12_HUMAN	integrator complex subunit 12	262					snRNA processing	integrator complex	protein binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		TGTTCTCTTAAACGCTAGAAA	0.313													3	132	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572205	1572205	+	Intron	SNP	T	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572205T>C	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						GGTGCCAATCTCCCTTCAATG	0.483													3	17	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572243	1572243	+	Intron	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572243C>T	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						AGTGCAGAAGCGTATGAAGAC	0.502													3	34	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5303543	5303543	+	Silent	SNP	G	A	A	rs35200003		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5303543G>A	uc003jdl.2	+	19	3090	c.2952G>A	c.(2950-2952)CAG>CAA	p.Q984Q	ADAMTS16_uc003jdk.1_Silent_p.Q984Q	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	984	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GCAACTCTCAGAGCTGCCCAC	0.677													4	15	---	---	---	---	PASS
POLR3G	10622	broad.mit.edu	37	5	89781358	89781358	+	5'UTR	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89781358C>T	uc003kjq.2	+	2					POLR3G_uc011cuc.1_5'UTR	NM_006467	NP_006458	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		TCAGAATTTGCCCACTCATCT	0.363													5	205	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137485406	137485406	+	Silent	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137485406G>A	uc003lcf.1	-	23	3256	c.3201C>T	c.(3199-3201)GGC>GGT	p.G1067G	BRD8_uc003lcc.1_Intron	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	1067					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CATCACACTCGCCTGAAGGGG	0.502													15	154	---	---	---	---	PASS
BMP6	654	broad.mit.edu	37	6	7845502	7845502	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7845502G>A	uc003mxu.3	+	2	972	c.794G>A	c.(793-795)GGG>GAG	p.G265E		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	265					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					TGTGTTATGGGGAGTTTTAAA	0.473													13	164	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50740431	50740431	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50740431A>G	uc003paf.2	+	8	1725	c.1213A>G	c.(1213-1215)ATG>GTG	p.M405V	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	405	H-S-H (helix-span-helix), dimerization.						DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					TCTCAGTGAAATGCTGAACTA	0.478													33	94	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54735045	54735045	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54735045A>T	uc003pck.2	+	2	117	c.1A>T	c.(1-3)ATG>TTG	p.M1L		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	1										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					ACTTGCAAGCATGGAGACCTC	0.378													19	175	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	63990299	63990299	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63990299T>C	uc003peh.2	-	4	1191	c.1157A>G	c.(1156-1158)TAC>TGC	p.Y386C	LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	386					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	GTTGTCATTGTATCCCCATGT	0.468													132	299	---	---	---	---	PASS
MAN1A1	4121	broad.mit.edu	37	6	119509656	119509656	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119509656G>A	uc003pym.1	-	11	2075	c.1633C>T	c.(1633-1635)CGG>TGG	p.R545W		NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	545	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		ACTTCTGGCCGTAAGATGTAG	0.413													6	342	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155776951	155776951	+	5'UTR	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155776951C>T	uc003qqm.2	-	1						NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TGTTGCTCTTCGGCTGTCAGG	0.388													4	108	---	---	---	---	PASS
PRPS1L1	221823	broad.mit.edu	37	7	18067240	18067240	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18067240C>T	uc003stz.2	-	1	247	c.166G>A	c.(166-168)GTT>ATT	p.V56I		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	56					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CCACTCTGAACGATGTAGACA	0.488													9	533	---	---	---	---	PASS
CDC14C	168448	broad.mit.edu	37	7	48964214	48964214	+	5'UTR	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48964214C>T	uc010kyv.1	+	1						NR_003595				SubName: Full=Putative uncharacterized protein MGC26484;												0						CGAGCTGGGCCGCCGCGCCCC	0.746													3	8	---	---	---	---	PASS
VSTM2A	222008	broad.mit.edu	37	7	54617681	54617681	+	Missense_Mutation	SNP	A	C	C	rs74396799		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54617681A>C	uc010kzf.2	+	4	857	c.452A>C	c.(451-453)AAC>ACC	p.N151T	VSTM2A_uc010kze.2_Missense_Mutation_p.N151T|VSTM2A_uc003tqc.3_Missense_Mutation_p.N151T	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	151						extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			GTCAATGCCAACAGCCATGCC	0.562													6	17	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86415634	86415634	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86415634G>A	uc003uid.2	+	3	1625	c.526G>A	c.(526-528)GCC>ACC	p.A176T	GRM3_uc010lef.2_Missense_Mutation_p.A174T|GRM3_uc010leg.2_Missense_Mutation_p.A48T|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	176	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	ATCCACCAGCGCCAAACTCAG	0.552													6	353	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91631337	91631337	+	Silent	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91631337A>G	uc003ulg.2	+	8	2331	c.2106A>G	c.(2104-2106)CTA>CTG	p.L702L	AKAP9_uc003ule.2_Silent_p.L714L|AKAP9_uc003ulf.2_Silent_p.L702L|AKAP9_uc003uli.2_Silent_p.L327L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	714	Glu-rich.|Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTTCAAAGCTAAAAGATTTAC	0.289			T	BRAF	papillary thyroid								3	101	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99795408	99795408	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99795408A>T	uc003utx.1	+	11	1228	c.1073A>T	c.(1072-1074)GAA>GTA	p.E358V	STAG3_uc010lgs.1_Missense_Mutation_p.E146V|STAG3_uc011kjk.1_Missense_Mutation_p.E300V|STAG3_uc003uub.1_5'Flank	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	358	SCD.				chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGCACCGAGAAGTCCGCCTG	0.562													8	146	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107674715	107674715	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107674715C>T	uc010ljo.1	-	31	4840	c.4756G>A	c.(4756-4758)GCA>ACA	p.A1586T	LAMB4_uc003vey.2_Missense_Mutation_p.A1586T|LAMB4_uc010ljp.1_Missense_Mutation_p.A555T	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	1586	Potential.|Domain I.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GTAGAGTTTGCCCGTCCTTGA	0.333													6	295	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141727465	141727465	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141727465G>A	uc003vwy.2	+	10	1205	c.1151G>A	c.(1150-1152)CGT>CAT	p.R384H		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	384	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CACCTCAGTCGTTACGAATAT	0.453													8	81	---	---	---	---	PASS
TAS2R39	259285	broad.mit.edu	37	7	142881419	142881419	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142881419A>C	uc011ksw.1	+	1	908	c.908A>C	c.(907-909)TAC>TCC	p.Y303S		NM_176881	NP_795362	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	303	Helical; Name=7; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1	Melanoma(164;0.059)					ATGGCTGCCTACCCTGCCAGC	0.458													5	24	---	---	---	---	PASS
DEFB135	613209	broad.mit.edu	37	8	11841989	11841989	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11841989G>T	uc003wuw.1	+	2	124	c.124G>T	c.(124-126)GGT>TGT	p.G42C		NM_001033017	NP_001028189	Q30KP9	DB135_HUMAN	beta-defensin 135 precursor	42					defense response to bacterium	extracellular region					0						GCGACTGCAAGGTACTTGCCG	0.383													4	136	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95140541	95140541	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95140541C>T	uc003ygh.2	-	18	2551	c.2426G>A	c.(2425-2427)CGC>CAC	p.R809H	CDH17_uc011lgo.1_Missense_Mutation_p.R557H|CDH17_uc011lgp.1_Missense_Mutation_p.R809H	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	809	Cytoplasmic (Potential).					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CTTCTTTATGCGGATAAACAC	0.323													33	84	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97342509	97342509	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97342509G>T	uc003yht.1	+	11	1344	c.1242G>T	c.(1240-1242)AAG>AAT	p.K414N	PTDSS1_uc003yhu.1_Missense_Mutation_p.K268N	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	414					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ACCGAGAAAAGGTATGGAAGG	0.473													4	93	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27949564	27949564	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27949564C>T	uc003zqu.1	-	2	1300	c.1106G>A	c.(1105-1107)CGA>CAA	p.R369Q	LINGO2_uc010mjf.1_Missense_Mutation_p.R369Q|LINGO2_uc003zqv.1_Missense_Mutation_p.R369Q	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	369	LRRCT.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GGTGGGCTGTCGCTGCAAGAT	0.547													14	61	---	---	---	---	PASS
PRSS3	5646	broad.mit.edu	37	9	33797991	33797991	+	Missense_Mutation	SNP	G	A	A	rs146966861	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33797991G>A	uc003ztj.3	+	3	536	c.536G>A	c.(535-537)CGC>CAC	p.R179H	uc003ztk.1_Intron|PRSS3_uc003zti.3_Missense_Mutation_p.R136H|PRSS3_uc003ztl.3_Missense_Mutation_p.R122H	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein	179	Peptidase S1.				digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			ATCAATGCCCGCGTGTCCACC	0.572													4	81	---	---	---	---	PASS
PRSS3	5646	broad.mit.edu	37	9	33797992	33797992	+	Silent	SNP	C	T	T	rs147593137	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33797992C>T	uc003ztj.3	+	3	537	c.537C>T	c.(535-537)CGC>CGT	p.R179R	uc003ztk.1_Intron|PRSS3_uc003zti.3_Silent_p.R136R|PRSS3_uc003ztl.3_Silent_p.R122R	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein	179	Peptidase S1.				digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			TCAATGCCCGCGTGTCCACCA	0.577													4	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	38615739	38615739	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38615739C>A	uc004abg.3	-	3	372	c.347G>T	c.(346-348)TGT>TTT	p.C116F	uc010mme.2_Missense_Mutation_p.C116F					RecName: Full=Ankyrin repeat domain-containing protein 18B;																		AACGATGGCACAAGCCTCTTC	0.413													6	13	---	---	---	---	PASS
FAM108B1	51104	broad.mit.edu	37	9	74485071	74485071	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74485071G>A	uc004aim.1	-	3	1177	c.575C>T	c.(574-576)TCT>TTT	p.S192F	FAM108B1_uc004ail.2_Missense_Mutation_p.S192F	NM_001025780	NP_001020951	Q5VST6	F108B_HUMAN	family with sequence similarity 108, member B1	192						extracellular region	hydrolase activity				0						AGTCAGAGGAGAATGAAGAAT	0.408													74	225	---	---	---	---	PASS
TBC1D2	55357	broad.mit.edu	37	9	100995790	100995790	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100995790C>T	uc011lvb.1	-	4	869	c.689G>A	c.(688-690)GGA>GAA	p.G230E	TBC1D2_uc004ayq.2_Missense_Mutation_p.G230E|TBC1D2_uc004ayr.2_Missense_Mutation_p.G12E|TBC1D2_uc004ayo.3_Missense_Mutation_p.G230E	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	230						cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		ATGGCCTGTTCCCTGGGCCTG	0.587													24	245	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117852969	117852969	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117852969G>T	uc004bjj.3	-	2	691	c.329C>A	c.(328-330)GCC>GAC	p.A110D	TNC_uc010mvf.2_Missense_Mutation_p.A110D	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	110					cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						ACAGCCACAGGCCCGGCGGGG	0.587													64	531	---	---	---	---	PASS
LOXL4	84171	broad.mit.edu	37	10	100013411	100013411	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100013411G>T	uc001kpa.1	-	11	1885	c.1734C>A	c.(1732-1734)TAC>TAA	p.Y578*		NM_032211	NP_115587	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4 precursor	578	Lysyl-oxidase like.					extracellular space|membrane	copper ion binding|protein binding|scavenger receptor activity			ovary(3)|breast(1)|skin(1)	5		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		ATAGGCGGCGGTATCCGTAGG	0.592													5	72	---	---	---	---	PASS
NUCB2	4925	broad.mit.edu	37	11	17332484	17332484	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17332484A>C	uc001mmw.2	+	7	841	c.596A>C	c.(595-597)AAG>ACG	p.K199T	NUCB2_uc001mms.1_Missense_Mutation_p.K200T|NUCB2_uc001mmt.1_Missense_Mutation_p.K199T|NUCB2_uc001mmv.1_Missense_Mutation_p.K199T|NUCB2_uc009ygz.2_Missense_Mutation_p.K199T	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor	199	By similarity.					cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						AATGAAGAAAAGAGAAAAGAA	0.303													6	299	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043514	56043514	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043514C>A	uc001nio.1	+	1	400	c.400C>A	c.(400-402)CGC>AGC	p.R134S		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	134	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					GGCTTATGATCGCTATGTAGC	0.413													46	444	---	---	---	---	PASS
FADS2	9415	broad.mit.edu	37	11	61630459	61630459	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61630459G>A	uc001nsl.1	+	8	1048	c.898G>A	c.(898-900)GTC>ATC	p.V300I	FADS2_uc001nsj.2_Missense_Mutation_p.V278I|FADS2_uc010rlo.1_Missense_Mutation_p.V269I|FADS2_uc001nsk.2_Missense_Mutation_p.V300I	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2	300	Lumenal (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	GGCCTGGGCCGTCAGCTACTA	0.577													55	130	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9583286	9583286	+	Silent	SNP	A	G	G	rs2429895	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9583286A>G	uc010sgs.1	-	10	1335	c.1140T>C	c.(1138-1140)GCT>GCC	p.A380A		NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						GGATGCCCGCAGCCTGCCGAG	0.672													4	18	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32135028	32135028	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32135028C>A	uc001rks.2	+	4	1553	c.1139C>A	c.(1138-1140)TCA>TAA	p.S380*		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	380										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			AATCCAACTTCAAATCAAGTA	0.348													5	212	---	---	---	---	PASS
PDE1B	5153	broad.mit.edu	37	12	54971306	54971306	+	Intron	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54971306C>T	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						AATCCTCCCACGCTCTTCTGT	0.547													6	151	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57566959	57566959	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57566959C>A	uc001snd.2	+	21	3638	c.3172C>A	c.(3172-3174)CCC>ACC	p.P1058T		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1058	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCACGAGGCCCCCTGGTGG	0.672											OREG0021936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	48	---	---	---	---	PASS
TMEM5	10329	broad.mit.edu	37	12	64173824	64173824	+	Silent	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64173824C>T	uc001srq.1	+	1	188	c.84C>T	c.(82-84)TTC>TTT	p.F28F	TMEM5_uc001srr.1_5'UTR|TMEM5_uc001srs.1_5'Flank	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	28	Helical; Signal-anchor for type II membrane protein; (Potential).					integral to plasma membrane					0		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		ACCACGTCTTCTTcgggcgcc	0.522													3	29	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72288542	72288542	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72288542G>A	uc001swu.2	+	8	860	c.851G>A	c.(850-852)AGA>AAA	p.R284K	TBC1D15_uc009zrv.2_Missense_Mutation_p.R146K|TBC1D15_uc010stt.1_Missense_Mutation_p.R253K|TBC1D15_uc001swv.2_Missense_Mutation_p.R267K|TBC1D15_uc001sww.2_Missense_Mutation_p.R16K	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	262							protein binding|Rab GTPase activator activity				0						GACAGTTTGAGAGGCAGCGAT	0.368													5	200	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88487642	88487642	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88487642G>A	uc001tar.2	-	28	3558	c.3214C>T	c.(3214-3216)CGG>TGG	p.R1072W	CEP290_uc001taq.2_Missense_Mutation_p.R132W|CEP290_uc001tat.2_Missense_Mutation_p.R865W	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1072	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TGTTCAGCCCGCTGCCTTTCA	0.348													3	78	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32912796	32912796	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32912796A>C	uc001uub.1	+	11	4531	c.4304A>C	c.(4303-4305)AAT>ACT	p.N1435T		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1435	BRCA2 3.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGTGGGAAAAATATTAGTGTC	0.284			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			26	237	---	---	---	---	PASS
DIS3	22894	broad.mit.edu	37	13	73337743	73337743	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73337743T>C	uc001vix.3	-	16	2347	c.1973A>G	c.(1972-1974)GAA>GGA	p.E658G	DIS3_uc001viy.3_Missense_Mutation_p.E628G|DIS3_uc001viz.2_RNA	NM_014953	NP_055768	Q9Y2L1	RRP44_HUMAN	DIS3 mitotic control isoform a	658					CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding			central_nervous_system(1)	1		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		GGAATTTGTTTCCCTGCCAAT	0.308										Multiple Myeloma(4;0.011)			12	32	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23866411	23866411	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23866411C>T	uc001wjv.2	-	17	2085	c.2018G>A	c.(2017-2019)CGT>CAT	p.R673H		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	673	Actin-binding.|Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GATGATGCAACGCACAAAGTG	0.542													7	305	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724734	38724734	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724734C>A	uc001wum.1	-	1	841	c.494G>T	c.(493-495)CGC>CTC	p.R165L		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	165	Extracellular (Potential).|C-type lectin.					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GCCGTTGGCGCGCAGGTGGCA	0.577													16	52	---	---	---	---	PASS
ARG2	384	broad.mit.edu	37	14	68113409	68113409	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68113409G>C	uc001xjs.2	+	5	687	c.571G>C	c.(571-573)GCA>CCA	p.A191P		NM_001172	NP_001163	P78540	ARGI2_HUMAN	arginase 2 precursor	191					arginine metabolic process|nitric oxide biosynthetic process|urea cycle	mitochondrial matrix	arginase activity|metal ion binding				0				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	TATCTCTTCTGCAAGTATTGT	0.423													7	239	---	---	---	---	PASS
COX8C	341947	broad.mit.edu	37	14	93814475	93814475	+	3'UTR	SNP	T	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93814475T>C	uc001ybt.1	+	2					KIAA1409_uc001ybs.1_Intron	NM_182971	NP_892016	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIc							integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity				0		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		AGATGGAAGATGATGTTGAAC	0.398													31	67	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106237741	106237741	+	RNA	SNP	A	G	G	rs12586349	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106237741A>G	uc010tyt.1	-	3611		c.57142T>C			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						CCTTGGTGGAAGCTGCAAGAG	0.667													3	38	---	---	---	---	PASS
GOLGA8DP	100132979	broad.mit.edu	37	15	22709152	22709152	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22709152G>T	uc010axw.2	-	11	1245	c.347C>A	c.(346-348)GCG>GAG	p.A116E	GOLGA8DP_uc010axx.2_Missense_Mutation_p.A116E|uc010tzw.1_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E												0						GGCCTGGAGCGCTCCTGCCAC	0.607													4	76	---	---	---	---	PASS
IGF1R	3480	broad.mit.edu	37	15	99460175	99460175	+	Intron	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99460175C>A	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron|IGF1R_uc010urr.1_Silent_p.P207P	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CCTTTCTCCCCACCAGGTAGT	0.532													3	15	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30991347	30991347	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30991347G>A	uc002ead.1	+	14	4926	c.4240G>A	c.(4240-4242)GCC>ACC	p.A1414T		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1414	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						accgccccgcgccTACGAGCC	0.393													7	14	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49669876	49669876	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49669876G>A	uc002efs.2	-	5	3485	c.3187C>T	c.(3187-3189)CTC>TTC	p.L1063F	ZNF423_uc010vgn.1_Missense_Mutation_p.L946F	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1063					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				CACTTGTAGAGCTTCTGCAGC	0.627													3	28	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71718485	71718485	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71718485C>A	uc002fax.2	-	4	635	c.629G>T	c.(628-630)CGG>CTG	p.R210L	PHLPP2_uc002fav.2_5'Flank|PHLPP2_uc010cgf.2_Missense_Mutation_p.R210L|PHLPP2_uc002fay.1_Missense_Mutation_p.R210L	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	210	PH.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						GGAGTATTGCCGTCGCTTCAC	0.473													3	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425461	74425461	+	Missense_Mutation	SNP	A	G	G	rs2868593		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425461A>G	uc010vmt.1	+	6	633	c.632A>G	c.(631-633)CAT>CGT	p.H211R						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TGTCTCCTTCATCCCCTTCCA	0.493													9	239	---	---	---	---	PASS
SLFN13	146857	broad.mit.edu	37	17	33768284	33768284	+	Missense_Mutation	SNP	G	A	A	rs9896552	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33768284G>A	uc002hjk.1	-	4	2354	c.2024C>T	c.(2023-2025)ACT>ATT	p.T675I	SLFN13_uc010wch.1_Missense_Mutation_p.T675I|SLFN13_uc002hjl.2_Missense_Mutation_p.T675I|SLFN13_uc010ctt.2_Missense_Mutation_p.T357I|SLFN13_uc002hjm.2_Missense_Mutation_p.T344I	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	675						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CCCATCTTCAGTACGGAAATT	0.433													81	234	---	---	---	---	PASS
KRTAP4-8	728224	broad.mit.edu	37	17	39253835	39253835	+	Missense_Mutation	SNP	C	T	T	rs72625995	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39253835C>T	uc010wfo.1	-	1	541	c.502G>A	c.(502-504)GCC>ACC	p.A168T		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	168				A -> T (in Ref. 2; CAC27579).		keratin filament					0						ATGACACAGGCTGGGCGATAG	0.493													4	7	---	---	---	---	PASS
KRT35	3886	broad.mit.edu	37	17	39633889	39633889	+	Silent	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39633889G>A	uc002hws.2	-	6	1144	c.1101C>T	c.(1099-1101)GCC>GCT	p.A367A		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	367	Rod.|Coil 2.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				CCCGGATCTCGGCCAGCTGGG	0.647													3	57	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587708	43587708	+	Intron	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587708A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						AACAACCACCATCTCCAAATC	0.348													3	149	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13621043	13621043	+	Intron	SNP	T	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13621043T>G	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_Intron|C18orf1_uc002ksf.2_Intron|C18orf1_uc002ksg.1_Intron|C18orf1_uc002ksh.1_5'UTR|C18orf1_uc002ksi.1_5'UTR	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		ATGGCTGGGGTGGTGACAGTG	0.592													15	127	---	---	---	---	PASS
CD226	10666	broad.mit.edu	37	18	67614065	67614065	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67614065C>G	uc010dqo.2	-	2	734	c.287G>C	c.(286-288)CGG>CCG	p.R96P	CD226_uc002lkm.3_Missense_Mutation_p.R96P	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor	96	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				AGAGGCATTCCGAAAGAAAAG	0.448													52	108	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2210728	2210728	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2210728C>T	uc002lvb.3	+	14	1261	c.1225C>T	c.(1225-1227)CGC>TGC	p.R409C	DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	409	Required for interaction with nucleosomes and DNA.					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGGCTGGCCGCAAGCGCGG	0.602													9	129	---	---	---	---	PASS
OR1M1	125963	broad.mit.edu	37	19	9204125	9204125	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9204125G>A	uc010xkj.1	+	1	205	c.205G>A	c.(205-207)GTT>ATT	p.V69I		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						CCTGTCCCTGGTTGATTTCTG	0.557													4	155	---	---	---	---	PASS
ZNF738	148203	broad.mit.edu	37	19	21567713	21567713	+	3'UTR	SNP	A	G	G			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21567713A>G	uc002nps.3	+	5						NR_027130				SubName: Full=cDNA FLJ14673 fis, clone NT2RP2003714, moderately similar to Zinc finger protein 430;												0						ATATTGGAGAATAACACTACA	0.333													4	22	---	---	---	---	PASS
PNMAL1	55228	broad.mit.edu	37	19	46973938	46973938	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46973938G>A	uc002peq.3	-	2	661	c.355C>T	c.(355-357)CGC>TGC	p.R119C	PNMAL1_uc002per.3_Missense_Mutation_p.R119C	NM_018215	NP_060685	Q86V59	PNML1_HUMAN	PNMA-like 1 isoform a	119											0		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		tcccaggtgcgcccctcggca	0.010													19	135	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701513	56701513	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701513G>A	uc010ygh.1	-	4	1171	c.1171C>T	c.(1171-1173)CGC>TGC	p.R391C		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	391	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TGCAAGAAGCGCTTCCGACAG	0.527													8	98	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3678583	3678583	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3678583G>A	uc002wja.2	-	8	1984	c.1984C>T	c.(1984-1986)CGC>TGC	p.R662C	SIGLEC1_uc002wiz.3_Missense_Mutation_p.R662C	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	662	Ig-like C2-type 6.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						ACCTTCATGCGTGGGGAACAG	0.627													9	97	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846232	18846232	+	RNA	SNP	A	G	G	rs571744		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846232A>G	uc002zoe.2	+	5		c.2594A>G			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		CCCTATGTGCACACCCGGAGG	0.607													3	13	---	---	---	---	PASS
CDC45	8318	broad.mit.edu	37	22	19467485	19467485	+	5'UTR	SNP	C	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19467485C>A	uc002zpr.2	+	1					UFD1L_uc002zpm.2_5'Flank|UFD1L_uc002zpo.2_5'Flank|UFD1L_uc011agy.1_5'Flank|UFD1L_uc002zpp.2_5'Flank|UFD1L_uc010grq.2_5'Flank|CDC45_uc011agz.1_5'UTR|CDC45_uc011aha.1_5'UTR|CDC45_uc002zps.2_5'UTR|CDC45_uc002zpt.2_5'UTR	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like						DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1						GTCCGGCCGCCGTGGCTATGT	0.672													6	68	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20937203	20937203	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20937203C>T	uc002zsp.2	+	11	1566	c.1486C>T	c.(1486-1488)CGG>TGG	p.R496W	MED15_uc002zsq.2_Missense_Mutation_p.R456W|MED15_uc010gso.2_Missense_Mutation_p.R439W|MED15_uc002zsr.2_Missense_Mutation_p.R430W|MED15_uc011ahs.1_Missense_Mutation_p.R430W|MED15_uc002zss.2_Missense_Mutation_p.R375W|MED15_uc011ahu.1_Missense_Mutation_p.R206W|MED15_uc002zst.2_Missense_Mutation_p.R112W|MED15_uc002zsu.2_Missense_Mutation_p.R101W	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	496	Pro-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			AGTGACGGCGCGGACCCCACA	0.602													7	95	---	---	---	---	PASS
LOC644165	644165	broad.mit.edu	37	22	25045815	25045815	+	Intron	SNP	G	C	C			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25045815G>C	uc011ajv.1	+						POM121L10P_uc003aaz.3_RNA|POM121L10P_uc003abc.2_RNA	NR_024494				Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).												0						CCTCTGCTTCGGTCCTCTACA	0.632													2	11	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38120300	38120300	+	Silent	SNP	T	C	C	rs58793439		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38120300T>C	uc003atr.2	+	7	2008	c.1737T>C	c.(1735-1737)TGT>TGC	p.C579C	TRIOBP_uc003atu.2_Silent_p.C407C|TRIOBP_uc003atq.1_Silent_p.C579C|TRIOBP_uc003ats.1_Silent_p.C407C	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	579					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAACATCCTGTGCCCAGCGGG	0.587													3	97	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151869728	151869728	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151869728G>A	uc004ffq.1	+	3	612	c.418G>A	c.(418-420)GTC>ATC	p.V140I	MAGEA6_uc004ffr.1_Missense_Mutation_p.V140I|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	140	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					GGGGAGTGTCGTCGGAAATTG	0.527													4	150	---	---	---	---	PASS
PADI6	353238	broad.mit.edu	37	1	17723476	17723477	+	Intron	INS	-	CA	CA	rs144056968	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17723476_17723477insCA	uc001bak.1	+							NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGGAATGCACCCAGGTGGCTGG	0.629													4	3	---	---	---	---	
RRAGC	64121	broad.mit.edu	37	1	39339998	39339999	+	Translation_Start_Site	INS	-	T	T	rs142354328	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39339998_39339999insT	uc001ccr.2	-	1	168_169	c.-817_-816insA	c.(-819--814)AAATGA>AAAATGA		MYCBP_uc001ccs.2_5'Flank|GJA9_uc001cct.1_Splice_Site	NM_022157	NP_071440	Q9HB90	RRAGC_HUMAN	Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				AAAGGATATCATTTAAAAAAAA	0.327													4	2	---	---	---	---	
EPHX4	253152	broad.mit.edu	37	1	92510850	92510850	+	Intron	DEL	T	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92510850delT	uc001don.2	+							NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7							integral to membrane	hydrolase activity			central_nervous_system(1)	1						cTATTTCAGATTTTTTTTTTT	0.179													4	2	---	---	---	---	
UAP1	6675	broad.mit.edu	37	1	162558826	162558826	+	Intron	DEL	T	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162558826delT	uc001gce.3	+							NM_003115	NP_003106	Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|nucleus|plasma membrane	UDP-N-acetylglucosamine diphosphorylase activity			ovary(2)|skin(2)|kidney(1)	5	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGAGTACAACTTTTTTTTTTT	0.239													6	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850667	+	Intron	INS	-	T	T	rs41267515		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666_237850667insT	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttcttttttttttt	0.327													4	3	---	---	---	---	
C1orf101	257044	broad.mit.edu	37	1	244715390	244715390	+	Intron	DEL	G	-	-	rs67424039		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244715390delG	uc001iam.2	+						C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			aaaaaaaaaagaatctttact	0.055													4	4	---	---	---	---	
C1orf150	148823	broad.mit.edu	37	1	247712252	247712253	+	5'Flank	DEL	GT	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247712252_247712253delGT	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			gtgtgtatgagtgtgtgtgtgt	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764926	91764935	+	IGR	DEL	TGTGTGTGTA	-	-	rs4844533		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764926_91764935delTGTGTGTGTA								None (None upstream) : LOC654342 (40257 downstream)																							tgtgtgtgtgtgtgtgtgtatatatataca	0.014													4	2	---	---	---	---	
RAPH1	65059	broad.mit.edu	37	2	204355768	204355768	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204355768delA	uc002vad.2	-						RAPH1_uc002vae.2_Intron|RAPH1_uc002vaf.2_Intron	NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains						cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						actctgtctcaaaaaaaaaaa	0.100													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40418595	40418595	+	IGR	DEL	G	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40418595delG								EIF1B (64682 upstream) : ENTPD3 (10078 downstream)																							agggaggggaggggagggagg	0.000													5	3	---	---	---	---	
WNT5A	7474	broad.mit.edu	37	3	55508479	55508480	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55508479_55508480insT	uc003dhn.2	-	4	887_888	c.569_570insA	c.(568-570)TACfs	p.Y190fs	WNT5A_uc003dhm.2_Frame_Shift_Ins_p.Y175fs|WNT5A_uc010hmw.2_Frame_Shift_Ins_p.Y175fs|WNT5A_uc010hmx.2_Frame_Shift_Ins_p.Y101fs	NM_003392	NP_003383	P41221	WNT5A_HUMAN	wingless-type MMTV integration site family,	190					activation of JUN kinase activity|activation of protein kinase B activity|axon guidance|cartilage development|cellular protein localization|cellular response to calcium ion|cellular response to interferon-gamma|cellular response to lipopolysaccharide|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|cervix development|cochlea morphogenesis|convergent extension involved in organogenesis|dopaminergic neuron differentiation|dorsal/ventral axis specification|embryonic digit morphogenesis|embryonic skeletal system development|epithelial cell proliferation involved in mammary gland duct elongation|epithelial to mesenchymal transition|face development|genitalia development|heart looping|hemopoietic stem cell proliferation|keratinocyte differentiation|lateral sprouting involved in mammary gland duct morphogenesis|lens development in camera-type eye|male gonad development|mammary gland branching involved in thelarche|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of mesenchymal cell proliferation|negative regulation of transcription, DNA-dependent|neural tube closure|olfactory bulb interneuron development|optic cup formation involved in camera-type eye development|palate development|positive regulation of angiogenesis|positive regulation of cartilage development|positive regulation of cGMP metabolic process|positive regulation of chemokine biosynthetic process|positive regulation of cytokine secretion involved in immune response|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of macrophage activation|positive regulation of macrophage cytokine production|positive regulation of mesenchymal cell proliferation|positive regulation of neuron projection development|positive regulation of NF-kappaB transcription factor activity|positive regulation of ossification|positive regulation of protein catabolic process|positive regulation of protein kinase C signaling cascade|positive regulation of T cell chemotaxis|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|primitive streak formation|regulation of branching involved in mammary gland duct morphogenesis|somitogenesis|tail morphogenesis|type B pancreatic cell development|urinary bladder development|uterus development|vagina development|Wnt receptor signaling pathway, calcium modulating pathway|wound healing	extracellular space|membrane fraction|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|receptor tyrosine kinase-like orphan receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		TGGCAAAGCGGTAGCCATAGTC	0.683													11	5	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119128712	119128712	+	Intron	DEL	T	-	-	rs149651758		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119128712delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TGAAAAAAAATTTTTTTTTGA	0.378													3	3	---	---	---	---	
SLC25A36	55186	broad.mit.edu	37	3	140695478	140695479	+	3'UTR	INS	-	A	A	rs112628499		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140695478_140695479insA	uc003etr.2	+	7					SLC25A36_uc003ets.2_3'UTR|SLC25A36_uc003etq.2_3'UTR|SLC25A36_uc011bmz.1_3'UTR	NM_001104647	NP_001098117	Q96CQ1	S2536_HUMAN	solute carrier family 25, member 36 isoform a						response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						TCGGTAATGTGAAAAAAAAAAA	0.386													4	3	---	---	---	---	
SSR3	6747	broad.mit.edu	37	3	156262396	156262397	+	Intron	INS	-	A	A	rs150921382	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156262396_156262397insA	uc003fau.2	-						SSR3_uc011bop.1_Intron	NM_007107	NP_009038	Q9UNL2	SSRG_HUMAN	signal sequence receptor gamma subunit						cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTCTTCCACTGAAAAAAAATAT	0.351													4	5	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180381743	180381743	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180381743delA	uc010hxe.2	-	2	237	c.122delT	c.(121-123)TTGfs	p.L41fs	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	41	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTCATCTTGCAAGCTTGCTCT	0.338													141	35	---	---	---	---	
NHEDC2	133308	broad.mit.edu	37	4	103968494	103968494	+	Intron	DEL	T	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103968494delT	uc003hwx.3	-						NHEDC2_uc010iln.1_Intron|NHEDC2_uc003hwy.2_Intron|NHEDC2_uc011cew.1_Intron|NHEDC2_uc011cex.1_Intron	NM_178833	NP_849155	Q86UD5	NHDC2_HUMAN	Na+/H+ exchanger domain containing 2						sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)		ACAGTCTTTCTTTTTTTTTTT	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56416572	56416573	+	IGR	DEL	AA	-	-	rs71602978		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56416572_56416573delAA								MIER3 (149071 upstream) : GPBP1 (53202 downstream)																							actctgtctcaaaaaaaaaaaa	0.228													1	5	---	---	---	---	
PPP2CA	5515	broad.mit.edu	37	5	133535130	133535131	+	Intron	INS	-	A	A	rs74343557		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133535130_133535131insA	uc003kze.2	-							NM_002715	NP_002706	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha						ceramide metabolic process|inactivation of MAPK activity|induction of apoptosis|meiosis|negative regulation of cell growth|negative regulation of epithelial to mesenchymal transition|negative regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of protein serine/threonine kinase activity|protein dephosphorylation|regulation of cell adhesion|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction|spindle pole	metal ion binding|phosphoprotein phosphatase activity			ovary(2)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	TTTAGTACTTTAAAAAAAAAAA	0.322													1	5	---	---	---	---	
CNOT8	9337	broad.mit.edu	37	5	154242596	154242597	+	Intron	DEL	TG	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154242596_154242597delTG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770	Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			cgtgtgtgcatgtgtgtgtgtg	0.257								Direct_reversal_of_damage					3	3	---	---	---	---	
PSMB9	5698	broad.mit.edu	37	6	32827562	32827564	+	3'UTR	DEL	GAA	-	-	rs138588811		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32827562_32827564delGAA	uc003sga.2	+	7						NM_148954	NP_683756	P28065	PSB9_HUMAN	proteasome beta 9 subunit isoform 2 proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0						GAATGATTTTGAAGTAGTACAAA	0.399													5	5	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810501	35810501	+	Intron	DEL	T	-	-	rs71652741		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810501delT	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTATAGATCATTTAAAAAAAA	0.308													7	5	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149228	44149229	+	Intron	DEL	CA	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149228_44149229delCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			acaaccacaccacacacacaca	0.163													6	4	---	---	---	---	
SLC35B2	347734	broad.mit.edu	37	6	44224750	44224751	+	Intron	DEL	CT	-	-	rs72454787		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44224750_44224751delCT	uc003oxd.2	-						SLC35B2_uc011dvt.1_Intron|SLC35B2_uc011dvu.1_Intron	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GACAAAGAGCctctctctctct	0.663													11	5	---	---	---	---	
GPR116	221395	broad.mit.edu	37	6	46830440	46830441	+	Intron	INS	-	TTT	TTT	rs11450200		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46830440_46830441insTTT	uc003oyo.3	-						GPR116_uc011dwj.1_Intron|GPR116_uc011dwk.1_Intron|GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Intron|GPR116_uc010jzi.1_Intron	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			TGAATTGAGGCttttttttttt	0.351													10	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38385227	38385227	+	Intron	DEL	A	-	-	rs79129934	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38385227delA	uc003tgp.1	+											Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AGGAGCTGGTATTCCTGAGAC	0.527													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013698	142013699	+	Intron	DEL	CT	-	-	rs36111580		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013698_142013699delCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGAGTGTGACTCTGCCCCGTC	0.307													9	6	---	---	---	---	
CTAGE6	340307	broad.mit.edu	37	7	143454287	143454291	+	Frame_Shift_Del	DEL	TTCTT	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143454287_143454291delTTCTT	uc003wdk.3	-	1	553_557	c.461_465delAAGAA	c.(460-465)AAAGAAfs	p.K154fs	uc011ktn.1_Intron|uc011kto.1_Intron|uc011ktp.1_Intron|LOC154761_uc011ktq.1_Intron|LOC154761_uc011ktr.1_Intron|LOC154761_uc011kts.1_Intron|LOC154761_uc003wdj.1_Intron	NM_178561	NP_848656	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	154_155	Potential.					integral to membrane					0	Melanoma(164;0.0903)					TAGATTTCTCTTCTTTTAAGTCTTT	0.376													4	2	---	---	---	---	
AMAC1L2	83650	broad.mit.edu	37	8	11188424	11188424	+	5'Flank	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11188424delA	uc003wtp.1	+							NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme							integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		atgatcaattaaaaaaaaaaa	0.199													4	2	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25708397	25708397	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25708397delA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		tgcagggattaaaaaaaaaaa	0.050													4	2	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118535435	118535435	+	Intron	DEL	T	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118535435delT	uc003yoj.2	+						MED30_uc011lib.1_Intron	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			CAAAGCCAACTTTTTTTTTTT	0.303													6	6	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125130936	125130936	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125130936delA	uc003yqw.2	+						uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCCCAGGACCAAAAAAAGCAA	0.388													4	2	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144405927	144405928	+	Intron	DEL	CA	-	-	rs146419914		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144405927_144405928delCA	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	atgcacgccccacacagacatg	0.000													4	6	---	---	---	---	
HAUS6	54801	broad.mit.edu	37	9	19063367	19063368	+	Intron	INS	-	AT	AT	rs141813713	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19063367_19063368insAT	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						AGCAATAAGGAATATAAGTAGA	0.248													7	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43314685	43314686	+	IGR	INS	-	A	A	rs149767052	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43314685_43314686insA								LOC642929 (169201 upstream) : FAM75A6 (309818 downstream)																							CACAGTAAAACAAAAAAAAACA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67791249	67791250	+	5'Flank	DEL	AC	-	-	rs74992488		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67791249_67791250delAC	uc004aes.1	+											Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311.																		agaatgggagacacacacacac	0.064													4	2	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77418972	77418973	+	Intron	INS	-	A	A	rs138585311	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77418972_77418973insA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_5'Flank	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CTCTGTTTCTCTCCATGATTAG	0.337													6	9	---	---	---	---	
ZNF169	169841	broad.mit.edu	37	9	97054922	97054923	+	Intron	INS	-	GC	GC	rs74578608	byFrequency	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97054922_97054923insGC	uc004aum.1	+						ZNF169_uc004aun.2_Intron|ZNF169_uc004auo.2_Intron	NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				tgtgtgtgtgtgcgcgtgCACA	0.396													8	4	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123927597	123927597	+	Intron	DEL	A	-	-	rs34558172		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123927597delA	uc004bkx.1	+						CEP110_uc004blb.1_Intron|CEP110_uc010mvp.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						aaagtcagttaaaaaaAAAAA	0.050													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618893	137618896	+	Intron	DEL	GGAT	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618893_137618896delGGAT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		atgagtgaacggatggatggatgg	0.176													5	4	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112344318	112344319	+	Intron	INS	-	TC	TC	rs148794272	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112344318_112344319insTC	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ATACATATAGTTCTTTTTTAAA	0.208													6	3	---	---	---	---	
DRD4	1815	broad.mit.edu	37	11	639374	639374	+	Intron	DEL	C	-	-	rs71738587		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:639374delC	uc001lqp.1	+							NM_000797	NP_000788	P21917	DRD4_HUMAN	dopamine receptor D4						activation of MAPK activity|adult locomotory behavior|arachidonic acid secretion|behavioral fear response|behavioral response to cocaine|behavioral response to ethanol|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of protein secretion|positive regulation of sodium:hydrogen antiporter activity|regulation of dopamine metabolic process|regulation of inhibitory postsynaptic membrane potential|response to amphetamine|response to histamine|social behavior	integral to plasma membrane	dopamine D4 receptor activity|drug binding|potassium channel regulator activity|SH3 domain binding				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Apomorphine(DB00714)|Clozapine(DB00363)|Olanzapine(DB00334)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Ropinirole(DB00268)|Thiethylperazine(DB00372)|Ziprasidone(DB00246)	AGAGTGGGGGCGGGTCACAAG	0.697													5	3	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63472093	63472093	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63472093delA	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						ATGTTTGACTAAAAAAAAAAA	0.323													4	2	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89914775	89914776	+	Intron	INS	-	T	T			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89914775_89914776insT	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTTCTTTTCTATTTTTAAAAAA	0.356													95	23	---	---	---	---	
MMP13	4322	broad.mit.edu	37	11	102818396	102818397	+	Intron	INS	-	TGTG	TGTG	rs10634131		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102818396_102818397insTGTG	uc001phl.2	-							NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein						collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		TGTTTGAGTATtgtgtgtgtgt	0.297													4	2	---	---	---	---	
LOH12CR1	118426	broad.mit.edu	37	12	12510571	12510571	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12510571delA	uc001ral.2	+						LOH12CR1_uc009zhu.2_Intron|LOH12CR2_uc001rak.2_5'Flank	NM_058169	NP_477517	Q969J3	L12R1_HUMAN	LOH1CR12											ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)		TGCTAGTAGGAAAAAAAAAAA	0.572													4	3	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	22041045	22041056	+	Intron	DEL	GACAGAGGGGTT	-	-	rs145112683		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22041045_22041056delGACAGAGGGGTT	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	aattgctgaggacagaggggtttccaggacat	0.175													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269805	31269806	+	Intron	INS	-	AAG	AAG	rs10650892		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269805_31269806insAAG	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CAATATTCCTCAAACTTCTCTT	0.307													5	4	---	---	---	---	
MIR1293	100302220	broad.mit.edu	37	12	50627995	50627995	+	RNA	DEL	T	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50627995delT	hsa-mir-1293|MI0006355	-			c.1delT			LIMA1_uc001rwj.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron																	0						CAGAACAACCttttttttttt	0.229													4	2	---	---	---	---	
CORO1C	23603	broad.mit.edu	37	12	109071794	109071795	+	Intron	INS	-	A	A			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109071794_109071795insA	uc001tnj.2	-						CORO1C_uc009zva.2_Intron|CORO1C_uc010sxf.1_Intron	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1						actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						gactccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
EFHA1	221154	broad.mit.edu	37	13	22084117	22084117	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22084117delA	uc001uof.2	-						EFHA1_uc010tct.1_Intron	NM_152726	NP_689939	Q8IYU8	EFHA1_HUMAN	EF-hand domain family, member A1								calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)		AAATTTCCCTAAATGAATGTA	0.279													64	11	---	---	---	---	
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CTCTCTCTCTCTTTTTTTTTGT	0.411													6	8	---	---	---	---	
WDR25	79446	broad.mit.edu	37	14	100947777	100947777	+	Intron	DEL	T	-	-	rs140674339		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100947777delT	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25												0		Melanoma(154;0.212)				GTGTAAATGCTTTTTTTTTTT	0.308													5	3	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94842066	94842067	+	Intron	INS	-	CT	CT	rs149048088	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94842066_94842067insCT	uc002btj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btg.3_Intron|MCTP2_uc002bth.3_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			cctccccctccctctctcttcc	0.035													6	3	---	---	---	---	
TNFRSF17	608	broad.mit.edu	37	16	12061912	12061913	+	3'UTR	INS	-	T	T	rs149410582	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12061912_12061913insT	uc002dbv.2	+	3					TNFRSF17_uc010buy.2_3'UTR|TNFRSF17_uc010buz.2_3'UTR	NM_001192	NP_001183	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily,						cell proliferation|multicellular organismal development	endomembrane system|integral to membrane|plasma membrane					0						TGATTAAACTCTTTTTTTTCCT	0.386			T	IL2	intestinal T-cell lymphoma								6	3	---	---	---	---	
AQP8	343	broad.mit.edu	37	16	25239588	25239588	+	Intron	DEL	A	-	-	rs73551053	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25239588delA	uc002doc.2	+							NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		tgtctcaattaaaaaaaaaaa	0.219													6	3	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518737	21518737	+	IGR	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518737delA								C17orf51 (41006 upstream) : FAM27L (306633 downstream)																							TATTGGTAGCAAAACAGCCAT	0.259													9	4	---	---	---	---	
SLC13A2	9058	broad.mit.edu	37	17	26823923	26823923	+	Intron	DEL	C	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26823923delC	uc002hbh.2	+						SLC13A2_uc010wam.1_Intron|SLC13A2_uc010wan.1_Intron|SLC13A2_uc010wao.1_Intron|SLC13A2_uc002hbi.2_Intron	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b							integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	AGGAGGAGCGCCCCTTTCCCC	0.582													2	7	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29667866	29667866	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29667866delA	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc010cso.2_Intron|NF1_uc010wbt.1_Intron|NF1_uc010wbu.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TAAAAATAGCaaaaaaaaaaa	0.249			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			3	4	---	---	---	---	
MYO19	80179	broad.mit.edu	37	17	34855111	34855112	+	Intron	DEL	TT	-	-	rs111268012		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34855111_34855112delTT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron|ZNHIT3_uc010cut.1_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTCAAATACGTTTTTTTTTTTT	0.376													4	3	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						cttattattacttttttttgag	0.000													5	5	---	---	---	---	
HNRNPM	4670	broad.mit.edu	37	19	8538344	8538344	+	Intron	DEL	A	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8538344delA	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron|HNRNPM_uc002mka.2_Intron	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						tactgtgtttaaaaaaaaaaa	0.119													4	2	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16628260	16628261	+	Intron	DEL	AC	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16628260_16628261delAC	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						GGGGTGATGGACACACACACAC	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736594	27736594	+	IGR	DEL	G	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736594delG								None (None upstream) : LOC148189 (544808 downstream)																							gagatttcaagagctttgttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16920274	16920275	+	IGR	DEL	AT	-	-			TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16920274_16920275delAT								OR11H1 (470470 upstream) : CCT8L2 (151373 downstream)																							TTATAGTGACATGTATGAAAAC	0.267													6	3	---	---	---	---	
SERHL2	253190	broad.mit.edu	37	22	42962564	42962565	+	Intron	INS	-	A	A	rs147819513		TCGA-CH-5764-01A-21D-1576-08	TCGA-CH-5764-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42962564_42962565insA	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_Intron	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						tccatctcaagaaaaaaaaaac	0.005													3	3	---	---	---	---	
