Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892443	16892443	+	Intron	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892443A>G	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TATTGCCTTTATGTTGGGATA	0.294													3	67	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16935130	16935130	+	5'UTR	SNP	C	T	T	rs1762921		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16935130C>T	uc009vos.1	-	2					NBPF1_uc001aza.3_RNA|NBPF1_uc001azb.1_RNA|NBPF1_uc001azc.1_RNA	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGGGAGTCAGCGGCATCCCCA	0.607											OREG0004737	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	15	72	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16946396	16946396	+	RNA	SNP	C	T	T	rs367013	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946396C>T	uc010ocf.1	-	3		c.502G>A			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						TGCTGCAGGGCAGCAATCTCC	0.667													4	18	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959698	16959698	+	Intron	SNP	G	A	A	rs9730434	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959698G>A	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						GGTCCTTCTCGTGGAGCACCT	0.657													6	42	---	---	---	---	PASS
GPATCH3	63906	broad.mit.edu	37	1	27217386	27217386	+	3'UTR	SNP	A	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27217386A>C	uc001bne.2	-	7					GPN2_uc001bnd.1_5'Flank|GPATCH3_uc009vsp.1_3'UTR	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3							intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GGAACAAAACACCCTGAACCA	0.537													10	25	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75055355	75055355	+	Silent	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75055355C>A	uc001dgg.2	-	12	2355	c.2136G>T	c.(2134-2136)GTG>GTT	p.V712V	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Silent_p.V506V	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	712	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TTTTGTCCTTCACCTGAGCAG	0.473													6	217	---	---	---	---	PASS
DENND2D	79961	broad.mit.edu	37	1	111737241	111737241	+	Silent	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111737241G>A	uc001eak.1	-	7	953	c.753C>T	c.(751-753)GCC>GCT	p.A251A	DENND2D_uc001eal.1_Silent_p.A248A	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	251	DENN.									ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		TCTCCAGCACGGCAGAGGCAA	0.537													13	55	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145302714	145302714	+	Silent	SNP	A	G	G	rs9424867		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145302714A>G	uc001end.3	+	8	1187	c.1152A>G	c.(1150-1152)TTA>TTG	p.L384L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Silent_p.L113L	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGAGAAGTTACGGGAAGGGA	0.527													7	156	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168278015	168278015	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168278015G>C	uc001gfl.2	+	7	1003	c.952G>C	c.(952-954)GTT>CTT	p.V318L	TBX19_uc001gfj.3_Missense_Mutation_p.V186L|TBX19_uc001gfm.2_Missense_Mutation_p.V21L	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	318					anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					TAATCTGCAAGTTTTCTCGGG	0.463													3	92	---	---	---	---	PASS
DPT	1805	broad.mit.edu	37	1	168698284	168698284	+	Silent	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168698284C>T	uc001gfp.2	-	1	145	c.129G>A	c.(127-129)CGG>CGA	p.R43R		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	43	2 X 53-55 AA tandem repeats.|1-1.				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					TGAAGCCTTGCCGGTTCAAAT	0.542													4	64	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207787753	207787753	+	Nonsense_Mutation	SNP	C	T	T	rs55749440		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207787753C>T	uc001hfy.2	+	32	5370	c.5230C>T	c.(5230-5232)CGA>TGA	p.R1744*	CR1_uc001hfx.2_Nonsense_Mutation_p.R2194*	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1744	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CTTTAGGTTCCGATTAAAAGG	0.423													3	47	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214656164	214656164	+	Intron	SNP	A	G	G	rs58782956		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656164A>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TTAAAAGAGGACAGGTTTGGC	0.388													3	35	---	---	---	---	PASS
STRN	6801	broad.mit.edu	37	2	37152329	37152329	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37152329C>T	uc002rpn.2	-	2	266	c.257G>A	c.(256-258)GGA>GAA	p.G86E	STRN_uc010ezx.2_Missense_Mutation_p.G86E	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	86	Potential.				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTTCCTTTCTCCCTGCAGGAA	0.373													4	78	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95522786	95522786	+	RNA	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95522786T>C	uc010fhp.2	-	1		c.35A>G				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						CGGCGTCGCCTTTGACAGCTG	0.687													3	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96523162	96523162	+	RNA	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96523162G>T	uc002sva.1	-	42		c.2337C>A			uc002suz.1_Silent_p.I352I					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		GCTCTTCTGTGATTCTTAACT	0.343													5	31	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130872871	130872871	+	Silent	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130872871C>T	uc010fmh.2	-	4	952	c.552G>A	c.(550-552)GGG>GGA	p.G184G		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	184	ANK 1.					cell cortex	ATP binding			skin(3)|ovary(2)	5						CTTCTGAATTCCCATTGGCAG	0.423													4	92	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133489406	133489406	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133489406C>A	uc002ttp.2	-	17	5721	c.5347G>T	c.(5347-5349)GCA>TCA	p.A1783S	NCKAP5_uc002ttq.2_Missense_Mutation_p.A464S	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1783							protein binding				0						GCGCTATCTGCAGGGCGCTGG	0.582													4	123	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155115552	155115552	+	Silent	SNP	T	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155115552T>G	uc002tyr.3	+	8	1443	c.876T>G	c.(874-876)GGT>GGG	p.G292G	GALNT13_uc002tyt.3_Silent_p.G292G|GALNT13_uc010foc.1_Silent_p.G111G|GALNT13_uc010fod.2_Silent_p.G45G	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	292	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CTATGGCTGGTGGCCTATTTT	0.363													9	79	---	---	---	---	PASS
STK39	27347	broad.mit.edu	37	2	169020263	169020263	+	Silent	SNP	G	A	A	rs113390327	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169020263G>A	uc002uea.2	-	4	718	c.558C>T	c.(556-558)AAC>AAT	p.N186N		NM_013233	NP_037365	Q9UEW8	STK39_HUMAN	serine threonine kinase 39 (STE20/SPS1 homolog,	186	Protein kinase.				response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2						GAATCTGACCGTTTCTGTGTA	0.398													5	86	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179412752	179412752	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179412752A>G	uc010zfg.1	-	288	86121	c.85897T>C	c.(85897-85899)TTC>CTC	p.F28633L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.F22328L|TTN_uc010zfi.1_Missense_Mutation_p.F22261L|TTN_uc010zfj.1_Missense_Mutation_p.F22136L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29560							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGAAGAGAAGGCTTCTCTG	0.443													33	52	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187540359	187540359	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187540359A>G	uc003izf.2	-	10	7569	c.7381T>C	c.(7381-7383)TAC>CAC	p.Y2461H		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2461	Extracellular (Potential).|Cadherin 22.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TTAAGACTGTAAAATGGCTTC	0.443										HNSCC(5;0.00058)			6	234	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128983512	128983512	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128983512G>A	uc003kvb.1	+	12	1909	c.1909G>A	c.(1909-1911)GGA>AGA	p.G637R	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	637	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ACATCTGGCCGGAGAGTGGAG	0.522													55	27	---	---	---	---	PASS
DND1	373863	broad.mit.edu	37	5	140050926	140050926	+	Silent	SNP	G	A	A	rs62384220		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140050926G>A	uc003lgt.2	-	4	1058	c.1014C>T	c.(1012-1014)AAC>AAT	p.N338N		NM_194249	NP_919225	Q8IYX4	DND1_HUMAN	dead end homolog 1	338					multicellular organismal development|negative regulation of gene silencing by miRNA	cytoplasm|nucleus	AU-rich element binding|nucleotide binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCACAGGAGGTTGGCCCCAG	0.587													7	63	---	---	---	---	PASS
FOXC1	2296	broad.mit.edu	37	6	1611154	1611154	+	Silent	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1611154C>T	uc003mtp.2	+	1	474	c.474C>T	c.(472-474)TCC>TCT	p.S158S		NM_001453	NP_001444	Q12948	FOXC1_HUMAN	forkhead box C1	158	Fork-head.				anti-apoptosis|artery morphogenesis|blood vessel remodeling|brain development|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|germ cell migration|glycosaminoglycan metabolic process|lacrimal gland development|lymphangiogenesis|metanephros development|negative regulation of mitotic cell cycle|neural crest cell fate commitment|Notch signaling pathway|odontogenesis of dentine-containing tooth|ossification|ovarian follicle development|paraxial mesodermal cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	nuclear heterochromatin|transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		ACCCGGACTCCTACAACATGT	0.627													8	38	---	---	---	---	PASS
RIPK1	8737	broad.mit.edu	37	6	3077128	3077128	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3077128A>G	uc010jni.2	+	2	303	c.71A>G	c.(70-72)GAC>GGC	p.D24G	RIPK1_uc003muv.3_5'UTR|RIPK1_uc003muw.3_Intron|RIPK1_uc011dhs.1_Missense_Mutation_p.D24G|RIPK1_uc003mux.2_Missense_Mutation_p.D24G	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine	24	Protein kinase.|ATP (By similarity).				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GCAGAACTGGACAGCGGAGGC	0.478													8	49	---	---	---	---	PASS
TMEM14B	81853	broad.mit.edu	37	6	10756712	10756712	+	Silent	SNP	C	T	T	rs143087269	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756712C>T	uc003mzk.3	+	6	470	c.306C>T	c.(304-306)GCC>GCT	p.A102A	SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_Silent_p.A68A|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a	102	Helical; (Potential).					integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TGCTGATGGCCGCCAAAGTTG	0.383													5	54	---	---	---	---	PASS
TMEM14B	81853	broad.mit.edu	37	6	10756728	10756728	+	Missense_Mutation	SNP	C	T	T	rs72821581	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756728C>T	uc003mzk.3	+	6	486	c.322C>T	c.(322-324)CGT>TGT	p.R108C	SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_Missense_Mutation_p.R74C|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a	108						integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				AGTTGGAGTTCGTATGTTGAT	0.358													10	54	---	---	---	---	PASS
VARS	7407	broad.mit.edu	37	6	31752254	31752254	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31752254C>T	uc003nxe.2	-	12	1916	c.1493G>A	c.(1492-1494)CGC>CAC	p.R498H	VARS_uc011doi.1_RNA	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	498					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	GAGCAGGGTGCGACCTGTCAG	0.597													25	56	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32093899	32093899	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32093899G>T	uc003nzn.2	-	5	506	c.473C>A	c.(472-474)TCC>TAC	p.S158Y	ATF6B_uc003nzo.2_Missense_Mutation_p.S155Y|ATF6B_uc011dpg.1_Missense_Mutation_p.S92Y|ATF6B_uc011dph.1_Missense_Mutation_p.S158Y	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	158	Cytoplasmic (Potential).				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ATTACCTGAGGAATCATCAGA	0.507													42	81	---	---	---	---	PASS
HLA-DRB5	3127	broad.mit.edu	37	6	32522489	32522489	+	Intron	SNP	C	T	T	rs17852220		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32522489C>T	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_RNA|HLA-DRB6_uc003obn.1_RNA|HLA-DRB6_uc003obo.1_RNA	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TGAGAGGGCTCGTCACGCTTG	0.512													14	31	---	---	---	---	PASS
TAF8	129685	broad.mit.edu	37	6	42019120	42019120	+	Missense_Mutation	SNP	A	C	C	rs74710424		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42019120A>C	uc003ors.2	+	2	100	c.71A>C	c.(70-72)AAC>ACC	p.N24T	CCND3_uc003orp.2_5'Flank|CCND3_uc011duk.1_5'Flank|CCND3_uc011dum.1_5'Flank|TAF8_uc003orr.2_Missense_Mutation_p.N24T|TAF8_uc003ort.2_Missense_Mutation_p.N24T|TAF8_uc003oru.1_Missense_Mutation_p.N24T|TAF8_uc003orv.1_Missense_Mutation_p.N24T|TAF8_uc011dun.1_5'UTR	NM_138572	NP_612639	Q7Z7C8	TAF8_HUMAN	TBP-associated factor 8	24					cell differentiation|maintenance of protein location in nucleus|positive regulation of transcription, DNA-dependent|regulation of fat cell differentiation|transcription, DNA-dependent	perinuclear region of cytoplasm|transcription factor TFIID complex	DNA binding|protein binding			ovary(1)	1	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			CAGTCCACTAACCCTGCCGAT	0.512													6	73	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72361244	72361244	+	5'UTR	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72361244A>G	uc010lam.1	+	2					POM121_uc003twj.2_5'UTR	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				TGAGAAGATAACATACGGGGA	0.478													4	113	---	---	---	---	PASS
DTX2	113878	broad.mit.edu	37	7	76131564	76131564	+	Intron	SNP	G	A	A	rs73703179	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76131564G>A	uc003uff.3	+						DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Intron|DTX2_uc003ufh.3_Intron|DTX2_uc003ufj.3_Intron|DTX2_uc003ufk.3_Intron|DTX2_uc003ufl.1_Intron|DTX2_uc003ufm.3_Intron|DTX2_uc003ufn.3_5'UTR	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a						Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						ACTGGCCCACGTCAGCCCAGC	0.453													5	32	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151932916	151932916	+	Missense_Mutation	SNP	C	G	G	rs111791757		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932916C>G	uc003wla.2	-	16	2974	c.2755G>C	c.(2755-2757)GTT>CTT	p.V919L	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	919					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGTAATACAACAGCTCCGATT	0.468			N		medulloblastoma								7	87	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52733209	52733209	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52733209A>G	uc003xqx.3	-	6	1117	c.776T>C	c.(775-777)ATA>ACA	p.I259T	PCMTD1_uc011ldm.1_Missense_Mutation_p.I129T|PCMTD1_uc003xqw.3_Missense_Mutation_p.I259T|PCMTD1_uc011ldn.1_Missense_Mutation_p.I71T|PCMTD1_uc010lya.2_Missense_Mutation_p.I183T	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	259						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTCATCATTTATGAAATTTCT	0.403													3	101	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62491435	62491435	+	Intron	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62491435C>T	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Silent_p.D160D	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GGCTGACTGACGAGATCAACT	0.512													7	82	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113529332	113529332	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113529332C>T	uc003ynu.2	-	28	4846	c.4687G>A	c.(4687-4689)GAG>AAG	p.E1563K	CSMD3_uc003yns.2_Missense_Mutation_p.E835K|CSMD3_uc003ynt.2_Missense_Mutation_p.E1523K|CSMD3_uc011lhx.1_Missense_Mutation_p.E1459K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1563	Extracellular (Potential).|Sushi 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATTCTTTCCTCTCCTTGAAGT	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			32	66	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33395103	33395103	+	Silent	SNP	G	A	A	rs148012859	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395103G>A	uc003zst.2	-	3	289	c.117C>T	c.(115-117)GCC>GCT	p.A39A	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Silent_p.A39A|AQP7_uc011lny.1_Silent_p.A38A|AQP7_uc003zss.3_5'UTR|AQP7_uc011lnz.1_5'UTR|AQP7_uc011loa.1_5'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	39	Helical; (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TCATGAACTCGGCCAGGAACT	0.582													4	54	---	---	---	---	PASS
PIGO	84720	broad.mit.edu	37	9	35089137	35089137	+	Silent	SNP	A	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35089137A>C	uc003zwd.2	-	11	3618	c.3222T>G	c.(3220-3222)GGT>GGG	p.G1074G	PIGO_uc003zwc.1_3'UTR|PIGO_uc003zwe.2_Silent_p.G657G|PIGO_uc003zwf.2_Silent_p.G657G|PIGO_uc003zwg.1_3'UTR	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	1074					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCTCACAGCACCATCCACTC	0.522													8	81	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500871	66500871	+	RNA	SNP	T	C	C	rs11262348		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500871T>C	uc004aed.1	+	3		c.964T>C								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						TACACGGAACTGCTGTTGGTC	0.597													10	17	---	---	---	---	PASS
EXD3	54932	broad.mit.edu	37	9	140243844	140243844	+	Missense_Mutation	SNP	C	T	T	rs28545754	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140243844C>T	uc004cmp.2	-	15	1830	c.1634G>A	c.(1633-1635)TGC>TAC	p.C545Y	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Missense_Mutation_p.C225Y|EXD3_uc004cmq.1_RNA	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	545	3'-5' exonuclease.			C -> Y (in Ref. 1; BAC10986 and 2; BAC04356/BAB70838).	nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CTGCTCCTCGCAGAGCGGCCT	0.706													6	13	---	---	---	---	PASS
SEPHS1	22929	broad.mit.edu	37	10	13375855	13375855	+	Silent	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13375855T>C	uc001imk.2	-	5	881	c.522A>G	c.(520-522)GGA>GGG	p.G174G	SEPHS1_uc001imh.2_Silent_p.G98G|SEPHS1_uc010qbs.1_Silent_p.G126G|SEPHS1_uc001imi.2_Silent_p.G174G|SEPHS1_uc001imj.2_Silent_p.G174G|SEPHS1_uc010qbt.1_Silent_p.G107G|SEPHS1_uc009xje.2_Silent_p.G174G	NM_012247	NP_036379	P49903	SPS1_HUMAN	selenophosphate synthetase 1	174					protein modification process		ATP binding|GTP binding|selenide, water dikinase activity			skin(1)	1						TGGTAGCCACTCCTCCCAGGA	0.438													16	28	---	---	---	---	PASS
FAM21C	253725	broad.mit.edu	37	10	46254776	46254776	+	Missense_Mutation	SNP	A	C	C	rs144609657	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46254776A>C	uc001jcu.2	+	17	1661	c.1562A>C	c.(1561-1563)TAC>TCC	p.Y521S	FAM21C_uc001jcs.1_Missense_Mutation_p.Y466S|FAM21C_uc001jct.2_Missense_Mutation_p.Y521S|FAM21C_uc010qfi.1_Missense_Mutation_p.Y497S|FAM21C_uc010qfj.1_Intron|FAM21C_uc010qfk.1_5'UTR	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725	521										ovary(1)	1						ACCTTATCTTACAGCAAAAAT	0.413													5	55	---	---	---	---	PASS
PIPSL	266971	broad.mit.edu	37	10	95718641	95718641	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95718641C>T	uc009xuj.2	-	1	3032	c.2513G>A	c.(2512-2514)CGA>CAA	p.R838Q		NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						CACAGCATTTCGAATGGCTTC	0.542													10	62	---	---	---	---	PASS
HPS1	3257	broad.mit.edu	37	10	100177455	100177455	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100177455G>A	uc010qpf.1	-	20	2215	c.1969C>T	c.(1969-1971)CGC>TGC	p.R657C	PYROXD2_uc001kpc.2_5'Flank|PYROXD2_uc001kpd.2_5'Flank|PYROXD2_uc010qpe.1_5'Flank|HPS1_uc001kpi.1_Missense_Mutation_p.R658C|HPS1_uc001kpj.1_Missense_Mutation_p.P566L|HPS1_uc001kpk.1_Missense_Mutation_p.R482C	NM_000195	NP_000186	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1 protein isoform a	657					lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity			skin(1)	1		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		TCGGTTGGGCGGTTCTTGCTG	0.662									Hermansky-Pudlak_syndrome				21	31	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119013862	119013862	+	Intron	SNP	A	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119013862A>C	uc001ldd.1	+						SLC18A2_uc009xyy.1_5'UTR	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GTCACGCATTATTCTTTTGCT	0.498													3	24	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	747468	747468	+	5'UTR	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:747468C>T	uc001lqz.2	+	1					TALDO1_uc010qwl.1_5'UTR|TALDO1_uc001lra.2_5'UTR	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1						energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		cgccgcAGACCCCTCGGTCTT	0.567													4	4	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5878381	5878381	+	Silent	SNP	A	G	G	rs144459127	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5878381A>G	uc010qzr.1	-	1	552	c.552T>C	c.(550-552)TAT>TAC	p.Y184Y	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGCTCACAATAAGTATGAG	0.502													4	143	---	---	---	---	PASS
KCNJ11	3767	broad.mit.edu	37	11	17409274	17409274	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17409274A>C	uc001mna.2	-	1	933	c.365T>G	c.(364-366)CTT>CGT	p.L122R	KCNJ11_uc001mnb.3_Missense_Mutation_p.L35R	NM_000525	NP_000516	B4DWI4	B4DWI4_HUMAN	potassium inwardly-rectifying channel J11	122						integral to membrane	ATP-activated inward rectifier potassium channel activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)		AATGGAGAAAAGGAAGGCAGA	0.607													8	41	---	---	---	---	PASS
KCNJ11	3767	broad.mit.edu	37	11	17409276	17409276	+	Silent	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17409276G>A	uc001mna.2	-	1	931	c.363C>T	c.(361-363)TTC>TTT	p.F121F	KCNJ11_uc001mnb.3_Silent_p.F34F	NM_000525	NP_000516	B4DWI4	B4DWI4_HUMAN	potassium inwardly-rectifying channel J11	121						integral to membrane	ATP-activated inward rectifier potassium channel activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)		TGGAGAAAAGGAAGGCAGACG	0.607													8	41	---	---	---	---	PASS
CCDC34	91057	broad.mit.edu	37	11	27379087	27379087	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27379087T>C	uc001mrh.1	-	2	415	c.361A>G	c.(361-363)ACT>GCT	p.T121A	CCDC34_uc001mri.1_Missense_Mutation_p.T121A	NM_030771	NP_110398	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34 isoform 1	121											0						TCAACCTGAGTGCTACAAAAG	0.398													17	75	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48347071	48347071	+	Missense_Mutation	SNP	C	A	A	rs138317832		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48347071C>A	uc010rhv.1	+	1	579	c.579C>A	c.(577-579)TTC>TTA	p.F193L		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GGTTGCCCTTCTGTGGGCCCA	0.532													23	63	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58978336	58978336	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58978336A>C	uc001nnu.3	-	1	2159	c.2003T>G	c.(2002-2004)CTG>CGG	p.L668R		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	668	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				AACAACAGCCAGAATGGTGGT	0.557													32	79	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59282589	59282589	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59282589T>G	uc010rkv.1	+	1	204	c.204T>G	c.(202-204)ATT>ATG	p.I68M		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACCTGTCTATTCTTGACATCT	0.443													79	123	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65269936	65269936	+	RNA	SNP	A	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269936A>T	uc010roh.1	+	1		c.4704A>T			uc001ody.2_RNA|MALAT1_uc001odz.2_Intron	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TCCATTGTTTAACTGCAAAAC	0.264													10	23	---	---	---	---	PASS
ADRBK1	156	broad.mit.edu	37	11	67052768	67052768	+	Silent	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67052768G>A	uc009yrn.1	+	21	2183	c.1917G>A	c.(1915-1917)GAG>GAA	p.E639E	ADRBK1_uc009yrm.1_Intron	NM_001619	NP_001610	P25098	ARBK1_HUMAN	beta-adrenergic receptor kinase 1	639	PH.				activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	GCGACCCTGAGCTGGTGCAGT	0.697													21	31	---	---	---	---	PASS
LOC645332	645332	broad.mit.edu	37	11	67560630	67560630	+	3'UTR	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67560630A>G	uc001omt.3	-	4					LOC645332_uc001omu.3_3'UTR	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						GAGTGACTTGATTCTCACAAT	0.428													3	61	---	---	---	---	PASS
INTS4	92105	broad.mit.edu	37	11	77614592	77614592	+	Silent	SNP	C	T	T	rs140666680	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77614592C>T	uc001oys.2	-	17	2119	c.2091G>A	c.(2089-2091)GCG>GCA	p.A697A	C11orf67_uc001oyp.2_Intron|INTS4_uc001oyt.2_RNA	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	697					snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TTACCTGTTTCGCTGCTGCTG	0.483													3	50	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965573	111965573	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965573T>C	uc001pmz.2	+	4	420	c.359T>C	c.(358-360)TTG>TCG	p.L120S		NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D	120	Mitochondrial matrix (By similarity).				respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	GGGGATGCCTTGCAGAAAGCT	0.413			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				3	101	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900753	123900753	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900753C>T	uc001pzp.1	+	1	424	c.424C>T	c.(424-426)CTT>TTT	p.L142F		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTCGTGTACTCTTCTGGCCAC	0.557													6	152	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135200	124135200	+	IGR	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135200G>A								OR8G2 (38890 upstream) : OR8D1 (44537 downstream)																							CGGCTACGTGGCCATCTGTAG	0.463													5	158	---	---	---	---	PASS
LOC642846	642846	broad.mit.edu	37	12	9452017	9452017	+	3'UTR	SNP	C	A	A	rs149620408	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9452017C>A	uc010sgq.1	+	9					LOC642846_uc010sgp.1_RNA|LOC642846_uc001qvo.2_Silent_p.R172R|LOC642846_uc001qvp.2_5'Flank					SubName: Full=cDNA FLJ60032, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-);												0						GAAGGAGGCCCGGGCCTGTCC	0.642													3	11	---	---	---	---	PASS
TAS2R46	259292	broad.mit.edu	37	12	11214857	11214857	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11214857T>C	uc001qzp.1	-	1	37	c.37A>G	c.(37-39)ATA>GTA	p.I13V	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176887	NP_795368	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	13	Helical; Name=1; (Potential).				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GTAACCACTATTAGAATGGAA	0.338													4	38	---	---	---	---	PASS
TAS2R46	259292	broad.mit.edu	37	12	11214870	11214870	+	Silent	SNP	A	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11214870A>T	uc001qzp.1	-	1	24	c.24T>A	c.(22-24)ATT>ATA	p.I8I	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176887	NP_795368	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	8	Helical; Name=1; (Potential).				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GAATGGAAAAAATGATGGGCA	0.333													4	32	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52843581	52843581	+	Silent	SNP	A	G	G	rs382894		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52843581A>G	uc001sak.2	-	4	921	c.873T>C	c.(871-873)CTT>CTC	p.L291L		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	291	Coil 1B.|Rod.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCTCATCTGTAAGAGTGTCTG	0.488													4	123	---	---	---	---	PASS
OR9K2	441639	broad.mit.edu	37	12	55523685	55523685	+	Missense_Mutation	SNP	C	A	A	rs12303066	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55523685C>A	uc010spe.1	+	1	133	c.133C>A	c.(133-135)CGC>AGC	p.R45S		NM_001005243	NP_001005243	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K,	45	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2						CTTCAGGGTACGCCCAGAGCT	0.453													53	85	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63964599	63964599	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63964599T>C	uc001srp.1	-	20	2120	c.1939A>G	c.(1939-1941)ATC>GTC	p.I647V	DPY19L2_uc010sso.1_Missense_Mutation_p.I94V	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	647					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GACAGCTTGATGCTTGCCATT	0.378													3	97	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113544983	113544983	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113544983G>T	uc001tum.1	-	16	1869	c.1576C>A	c.(1576-1578)CCC>ACC	p.P526T	RASAL1_uc010syp.1_Missense_Mutation_p.P526T|RASAL1_uc001tul.2_Missense_Mutation_p.P526T|RASAL1_uc001tun.1_Missense_Mutation_p.P527T|RASAL1_uc010syq.1_Missense_Mutation_p.P526T|RASAL1_uc001tuo.3_Missense_Mutation_p.P526T|RASAL1_uc010syr.1_3'UTR	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	526					intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						GGGTGCAGGGGGGCCATCCAC	0.622													18	30	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25021323	25021323	+	Missense_Mutation	SNP	A	G	G	rs73172125	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25021323A>G	uc001upl.2	-	26	3222	c.3116T>C	c.(3115-3117)ATA>ACA	p.I1039T		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1039	VWFA.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTGGTCTTCTATCTATTTATA	0.408													9	34	---	---	---	---	PASS
LOC220429	220429	broad.mit.edu	37	13	50466990	50466990	+	Missense_Mutation	SNP	T	C	C	rs144184696	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50466990T>C	uc001vdk.2	+	1	2446	c.2264T>C	c.(2263-2265)CTG>CCG	p.L755P		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						GTCTGTCCACTGAGGGGTTTT	0.517													4	55	---	---	---	---	PASS
CCNB1IP1	57820	broad.mit.edu	37	14	20779638	20779638	+	3'UTR	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20779638G>T	uc001vwv.2	-	7					CCNB1IP1_uc001vww.2_3'UTR|CCNB1IP1_uc001vwx.2_3'UTR|CCNB1IP1_uc001vwy.2_3'UTR|CCNB1IP1_uc001vwz.2_3'UTR	NM_182851	NP_878271	Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1 isoform 3							chromosome|nucleus	ligase activity|metal ion binding|protein binding		HMGA2/CCNB1IP1(2)	soft_tissue(2)|ovary(1)	3	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		cagactcctgggctcaagtga	0.065			T	HMGA2	leiomyoma								3	36	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105409196	105409196	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105409196C>T	uc010axc.1	-	7	12712	c.12592G>A	c.(12592-12594)GAC>AAC	p.D4198N	AHNAK2_uc001ypx.2_Missense_Mutation_p.D4098N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4198						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGTTTCACGTCCACTTGGCCA	0.647													8	218	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107062360	107062360	+	RNA	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107062360A>G	uc010tyt.1	-	131		c.6235T>C								Parts of antibodies, mostly variable regions.												0						GACAGCGCAGATGAGGGACAG	0.612													3	65	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644521	20644521	+	Intron	SNP	G	A	A	rs56232550		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644521G>A	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron|uc010tyy.1_3'UTR					RecName: Full=Putative HERC2-like protein 3;																		ACCTCTGAGTGATGGCACTAC	0.632													3	9	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73615456	73615456	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73615456G>T	uc002avp.2	-	8	3972	c.2978C>A	c.(2977-2979)ACG>AAG	p.T993K		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	993	Pro-rich.|Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		TGTCTCTGGCGTGCTCAGTGG	0.697													7	13	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86838596	86838596	+	Silent	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86838596G>A	uc002blz.1	+	16	2273	c.2193G>A	c.(2191-2193)ACG>ACA	p.T731T	AGBL1_uc002bma.1_Silent_p.T462T|AGBL1_uc002bmb.1_Silent_p.T425T	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	731					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						TGACCATCACGGCCATGCCTG	0.498													37	68	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													5	18	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27353479	27353479	+	Silent	SNP	C	T	T	rs17548704	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27353479C>T	uc002don.2	+	4	350	c.108C>T	c.(106-108)TCC>TCT	p.S36S	IL4R_uc002dom.2_Silent_p.S36S|IL4R_uc002dop.3_Silent_p.S21S|IL4R_uc010bxy.2_Silent_p.S36S|IL4R_uc002doo.2_5'UTR	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	36	Extracellular (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CCTGCGTCTCCGACTACATGA	0.582													36	65	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48261786	48261786	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48261786C>A	uc002eff.1	-	3	676	c.326G>T	c.(325-327)CGG>CTG	p.R109L	ABCC11_uc002efg.1_Missense_Mutation_p.R109L|ABCC11_uc002efh.1_Missense_Mutation_p.R109L|ABCC11_uc010vgl.1_Missense_Mutation_p.R109L	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	109	Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				TAAGCGACTCCGTAAGCTTTG	0.552									Cerumen_Type				3	125	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66436911	66436911	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66436911G>A	uc002eom.3	+	12	2350	c.2194G>A	c.(2194-2196)GGC>AGC	p.G732S		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	732	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		GCACATCTACGGCTACGAGGG	0.642													11	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74411869	74411869	+	5'Flank	SNP	G	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74411869G>C	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		AAAGGACCAGGACATGCGGCT	0.642													2	8	---	---	---	---	PASS
ARHGEF15	22899	broad.mit.edu	37	17	8221715	8221715	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8221715G>A	uc002glc.2	+	10	1836	c.1715G>A	c.(1714-1716)CGC>CAC	p.R572H	ARHGEF15_uc002gld.2_Missense_Mutation_p.R572H|ARHGEF15_uc010vuw.1_Missense_Mutation_p.R461H	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	572	DH.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						AATATCCTGCGCCAGACAGAA	0.627													47	84	---	---	---	---	PASS
CDRT1	374286	broad.mit.edu	37	17	15502013	15502013	+	Intron	SNP	A	G	G	rs61396574	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15502013A>G	uc002gov.3	-						TRIM16_uc002gor.1_Intron|CDRT1_uc010vvy.1_5'Flank|CDRT1_uc010vvz.1_5'Flank|CDRT1_uc002gou.2_Intron|CDRT1_uc010cos.1_5'UTR	NM_006382	NP_006373	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TGAGGGCCCAAAGGATCATAC	0.418													4	39	---	---	---	---	PASS
CCDC144A	9720	broad.mit.edu	37	17	16664991	16664991	+	Missense_Mutation	SNP	G	A	A	rs145983138	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16664991G>A	uc002gqk.1	+	13	3701	c.3625G>A	c.(3625-3627)GAG>AAG	p.E1209K	CCDC144A_uc002gql.1_Missense_Mutation_p.E725K|LOC162632_uc010cpj.1_RNA	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1209	Potential.										0						AGCAAGGAAGGAGATAGAAGA	0.333													26	53	---	---	---	---	PASS
LOC162632	162632	broad.mit.edu	37	17	16705600	16705600	+	RNA	SNP	A	G	G	rs112562242	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16705600A>G	uc010cpj.1	+	21		c.4917A>G			LOC162632_uc010cpk.1_RNA|LOC162632_uc002gqm.2_RNA					Homo sapiens mRNA for KIAA0565 protein, partial cds.												0						AATTGACACCAACTCTGCCTA	0.423													4	67	---	---	---	---	PASS
LOC220594	220594	broad.mit.edu	37	17	18420772	18420772	+	RNA	SNP	G	A	A	rs28569074	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18420772G>A	uc010cqe.2	-	2		c.1787C>T			LOC220594_uc010cqf.2_RNA|LOC220594_uc002gty.2_RNA	NR_003554				Homo sapiens mRNA for TL132.												0						AATTGAAATCGCTTAAGGTGA	0.343													3	34	---	---	---	---	PASS
STARD3	10948	broad.mit.edu	37	17	37814071	37814071	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37814071C>T	uc002hsd.2	+	4	465	c.341C>T	c.(340-342)GCC>GTC	p.A114V	STARD3_uc010weg.1_Missense_Mutation_p.A114V|STARD3_uc010weh.1_RNA|STARD3_uc002hse.2_Missense_Mutation_p.A114V|STARD3_uc010wei.1_Missense_Mutation_p.A114V|STARD3_uc002hsf.2_5'UTR|STARD3_uc002hsg.2_5'Flank	NM_006804	NP_006795	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain	114	MENTAL.|Helical; (Potential).				cholesterol metabolic process|mitochondrial transport|steroid biosynthetic process	integral to membrane|late endosome membrane	cholesterol binding|cholesterol transporter activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTAGGCTATGCCGTGCTGCGG	0.647													4	90	---	---	---	---	PASS
KRT222	125113	broad.mit.edu	37	17	38821349	38821349	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38821349C>A	uc002hvc.2	-	1	68	c.3G>T	c.(1-3)ATG>ATT	p.M1I	KRT222_uc010wfk.1_RNA|KRT222_uc002hvb.2_5'UTR|KRT222_uc010cxc.2_5'UTR	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21	1						intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						GGGACAGTTCCATTCTTTTCC	0.512													4	125	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234367A>T	uc002ild.3	-	7	881	c.754T>A	c.(754-756)TCC>ACC	p.S252T	CDC27_uc002ile.3_Missense_Mutation_p.S252T|CDC27_uc002ilf.3_Missense_Mutation_p.S252T|CDC27_uc010wkp.1_Missense_Mutation_p.S191T|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						GATAATATGGAAGTTCCTGTT	0.383													7	56	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234386	45234386	+	Silent	SNP	G	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234386G>T	uc002ild.3	-	7	862	c.735C>A	c.(733-735)GTC>GTA	p.V245V	CDC27_uc002ile.3_Silent_p.V245V|CDC27_uc002ilf.3_Silent_p.V245V|CDC27_uc010wkp.1_Silent_p.V184V|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TTCCCAGTGGGACAGTATCAG	0.358													5	47	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234713	45234713	+	Silent	SNP	T	C	C	rs139751753	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234713T>C	uc002ild.3	-	6	640	c.513A>G	c.(511-513)ACA>ACG	p.T171T	CDC27_uc002ile.3_Silent_p.T171T|CDC27_uc002ilf.3_Silent_p.T171T|CDC27_uc010wkp.1_Silent_p.T110T|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	171					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TCTGTAAAGATGTGAATTTAA	0.373													7	51	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234725	45234725	+	Silent	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234725T>C	uc002ild.3	-	6	628	c.501A>G	c.(499-501)ACA>ACG	p.T167T	CDC27_uc002ile.3_Silent_p.T167T|CDC27_uc002ilf.3_Silent_p.T167T|CDC27_uc010wkp.1_Silent_p.T106T|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGAATTTAAATGTTTGGTCAG	0.368													3	50	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45247323	45247323	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45247323A>T	uc002ild.3	-	4	464	c.337T>A	c.(337-339)TCA>ACA	p.S113T	CDC27_uc002ile.3_Missense_Mutation_p.S113T|CDC27_uc002ilf.3_Missense_Mutation_p.S113T|CDC27_uc010wkp.1_Missense_Mutation_p.S52T|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	113	TPR 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AAGCAAGCTGAATCACCAAAC	0.333													5	101	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45247333	45247333	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45247333C>A	uc002ild.3	-	4	454	c.327G>T	c.(325-327)GAG>GAT	p.E109D	CDC27_uc002ile.3_Missense_Mutation_p.E109D|CDC27_uc002ilf.3_Missense_Mutation_p.E109D|CDC27_uc010wkp.1_Missense_Mutation_p.E48D|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	109	TPR 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AATCACCAAACTCAGTAACAA	0.333													12	105	---	---	---	---	PASS
ANKRD30B	374860	broad.mit.edu	37	18	14779969	14779969	+	Missense_Mutation	SNP	C	G	G	rs9675365	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779969C>G	uc010dlo.2	+	11	1611	c.1431C>G	c.(1429-1431)TTC>TTG	p.F477L	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	477										ovary(1)|skin(1)	2						ATCAGATGTTCCCATCAGAAT	0.279													8	14	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753063	76753063	+	Silent	SNP	C	T	T	rs2472643	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753063C>T	uc002lmt.2	+	2	1072	c.1072C>T	c.(1072-1074)CTG>TTG	p.L358L	SALL3_uc010dra.2_5'UTR	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	358					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGCGCCCGGCCTGCCAAGTCC	0.662													4	5	---	---	---	---	PASS
NFATC1	4772	broad.mit.edu	37	18	77170942	77170942	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77170942C>A	uc010xfg.1	+	2	1120	c.667C>A	c.(667-669)CGC>AGC	p.R223S	NFATC1_uc002lnc.1_Missense_Mutation_p.R223S|NFATC1_uc010xff.1_Missense_Mutation_p.R223S|NFATC1_uc002lnd.2_Missense_Mutation_p.R223S|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Missense_Mutation_p.R223S|NFATC1_uc010xfi.1_Missense_Mutation_p.R210S|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Missense_Mutation_p.R210S|NFATC1_uc002lng.2_Missense_Mutation_p.R210S|NFATC1_uc010xfk.1_Missense_Mutation_p.R210S	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	223	3 X SP repeats.				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		GGGCTTTCCCCGCGGGCTGGG	0.711													3	71	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10270719	10270719	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10270719C>G	uc002mng.2	-	14	1196	c.1016G>C	c.(1015-1017)CGC>CCC	p.R339P	DNMT1_uc010xlc.1_Missense_Mutation_p.R355P|DNMT1_uc002mnh.2_Missense_Mutation_p.R234P|DNMT1_uc010xld.1_Missense_Mutation_p.R339P|DNMT1_uc002mnk.2_RNA	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	339	DNA replication foci-targeting sequence (By similarity).|Homodimerization.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	TGTTTTGGCGCGAGCCATTTT	0.478													7	99	---	---	---	---	PASS
PRKCSH	5589	broad.mit.edu	37	19	11552168	11552168	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11552168A>G	uc002mrt.2	+	6	800	c.464A>G	c.(463-465)AAG>AGG	p.K155R	PRKCSH_uc002mru.2_Missense_Mutation_p.K155R|PRKCSH_uc010xlz.1_Missense_Mutation_p.K155R|PRKCSH_uc010dya.2_Intron|PRKCSH_uc002mrv.1_Missense_Mutation_p.K155R|PRKCSH_uc010dyb.2_Missense_Mutation_p.K155R	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	155					innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						CGGGAGGAGAAGCAGGTAAGG	0.612													52	113	---	---	---	---	PASS
RHPN2	85415	broad.mit.edu	37	19	33484928	33484928	+	Silent	SNP	C	T	T	rs146441798	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33484928C>T	uc002nuf.2	-	12	1518	c.1452G>A	c.(1450-1452)TTG>TTA	p.L484L	RHPN2_uc010xro.1_Silent_p.L333L|RHPN2_uc002nue.2_Silent_p.L214L	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	484					signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					AGAACTGGGGCAATATAATGT	0.418													5	45	---	---	---	---	PASS
CABP5	56344	broad.mit.edu	37	19	48533840	48533840	+	Intron	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48533840C>T	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		TTCACAAACTCTGCAAAGAAA	0.368													31	62	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54721090	54721090	+	Missense_Mutation	SNP	A	G	G	rs141841040	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54721090A>G	uc002qef.1	-	13	1879	c.1768T>C	c.(1768-1770)TCC>CCC	p.S590P	LILRB3_uc002qee.1_Missense_Mutation_p.S591P|LILRB3_uc002qeh.1_Missense_Mutation_p.S590P|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.S590P|LILRA6_uc002qek.1_Missense_Mutation_p.S591P|LILRB3_uc010erh.1_Missense_Mutation_p.S607P|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.S590P|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S591P|LILRB3_uc002qep.1_Missense_Mutation_p.S591P|LILRB3_uc002qeq.1_Missense_Mutation_p.S590P|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S591P	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	590	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACATCCTGGGAGGCTTCAGAT	0.637													3	86	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54726861	54726861	+	5'UTR	SNP	C	T	T	rs114813697	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54726861C>T	uc002qef.1	-	1					LILRB3_uc002qee.1_5'UTR|LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CGTCTCCTCCCGGTGACCCCG	0.642													5	102	---	---	---	---	PASS
SNAP25	6616	broad.mit.edu	37	20	10273562	10273562	+	Intron	SNP	C	G	G			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10273562C>G	uc002wnq.1	+						SNAP25_uc002wnr.1_Missense_Mutation_p.H66D|SNAP25_uc002wns.1_5'UTR|SNAP25_uc010gca.1_Missense_Mutation_p.H66D|SNAP25_uc010gcb.1_Intron|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824	P60880	SNP25_HUMAN	synaptosomal-associated protein 25 isoform						energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)	AGGCATGAACCATATCAACCA	0.413													12	84	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	C	C	rs143761036	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625875T>C	uc010ztl.1	+	2	61	c.29T>C	c.(28-30)ATC>ACC	p.I10T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGTACAGAATCGCCCTGAAA	0.353													6	96	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625947	29625947	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625947T>C	uc010ztl.1	+	2	133	c.101T>C	c.(100-102)ATT>ACT	p.I34T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TCAGATGCAATTGGACCAAGA	0.343													8	94	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	C	C	rs145412486	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628236G>C	uc010ztl.1	+	3	180	c.148G>C	c.(148-150)GCT>CCT	p.A50P	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A2P					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGGGAAAATGGCTTTGTTGGC	0.333													3	84	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													4	55	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28315754	28315754	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28315754C>A	uc002ymg.2	-	3	2079	c.1350G>T	c.(1348-1350)AAG>AAT	p.K450N		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	450	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TGGACCAGGGCTTAGATGCAT	0.448													4	34	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663086	22663086	+	RNA	SNP	T	G	G	rs1054157	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663086T>G	uc011aim.1	+	29		c.1859T>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						AGCTGCCACATAAGTTGTCCT	0.299													3	46	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663087	22663087	+	RNA	SNP	A	G	G	rs1054158		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663087A>G	uc011aim.1	+	29		c.1860A>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						GCTGCCACATAAGTTGTCCTT	0.303													3	46	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25016296	25016296	+	Silent	SNP	G	A	A	rs4049844	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016296G>A	uc003aan.1	+	8	871	c.384G>A	c.(382-384)GGG>GGA	p.G128G	GGT1_uc003aas.1_Silent_p.G128G|GGT1_uc003aat.1_Silent_p.G128G|GGT1_uc003aau.1_Silent_p.G128G|GGT1_uc003aav.1_Silent_p.G128G|GGT1_uc003aaw.1_Silent_p.G128G|GGT1_uc003aax.1_Silent_p.G128G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	128	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TCTCCCCAGGGGGGCTGTCGG	0.642													4	56	---	---	---	---	PASS
RRP7A	27341	broad.mit.edu	37	22	42910769	42910769	+	Silent	SNP	G	A	A	rs4822146	byFrequency	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42910769G>A	uc003bcq.2	-	5	493	c.477C>T	c.(475-477)TAC>TAT	p.Y159Y	SERHL_uc011apm.1_Intron|RRP7A_uc003bcp.2_Silent_p.Y182Y	NM_015703	NP_056518	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A	159							nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2						CAGAGTCTGCGTAGTCACTGA	0.622													6	6	---	---	---	---	PASS
RRP7B	91695	broad.mit.edu	37	22	42971987	42971987	+	RNA	SNP	T	C	C	rs137064	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42971987T>C	uc003bcs.2	-	6		c.707A>G			RRP7B_uc003bct.2_RNA					Homo sapiens cDNA FLJ90011 fis, clone HEMBA1000443, highly similar to Gastric cancer antigen Zg14.												0						CAGCTCTTTTTGGCTGCGCTT	0.672													3	23	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21450761	21450761	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21450761C>A	uc004czx.1	+	3	296	c.260C>A	c.(259-261)ACC>AAC	p.T87N	CNKSR2_uc004czw.2_Missense_Mutation_p.T87N|CNKSR2_uc011mjn.1_Missense_Mutation_p.T87N|CNKSR2_uc011mjo.1_Missense_Mutation_p.T87N	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	87	CRIC.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AATCTAAAAACCCTTTCTCAC	0.303													7	76	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299935	125299935	+	5'Flank	SNP	G	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299935G>A	uc004euk.1	-							NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2											lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CTgcagcagcggcggcggcgg	0.517													3	13	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16363393	16363412	+	Intron	DEL	TCAGTGCACCATGATCTCCA	-	-	rs71003234		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16363393_16363412delTCAGTGCACCATGATCTCCA	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCACATTCCCTCAGTGCACCATGATCTCCATCAGTGCCCC	0.632													6	4	---	---	---	---	
USP1	7398	broad.mit.edu	37	1	62908741	62908742	+	Intron	INS	-	CTA	CTA			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62908741_62908742insCTA	uc001daj.1	+						USP1_uc001dak.1_Intron|USP1_uc001dal.1_Intron	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1						DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		ACTTAGAAAATCTAGTATTCTT	0.243													18	8	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144854342	144854343	+	Intron	DEL	CT	-	-	rs112945996		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144854342_144854343delCT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TATCCACCCCCTGTCCTCCACT	0.480			T	PDGFRB	MPD								27	7	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144916371	144916371	+	Intron	DEL	T	-	-	rs68164265		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144916371delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ctcacataagttctttgagaa	0.040			T	PDGFRB	MPD								22	7	---	---	---	---	
RGS16	6004	broad.mit.edu	37	1	182569291	182569292	+	3'UTR	INS	-	TT	TT	rs10649643		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182569291_182569292insTT	uc001gpl.3	-	5						NM_002928	NP_002919	O15492	RGS16_HUMAN	regulator of G-protein signalling 16						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(1)	1						GCTGGAGCGCAttttttttttt	0.515													11	5	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203786224	203786225	+	Frame_Shift_Ins	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203786224_203786225insT	uc001hac.2	+	5	642_643	c.26_27insT	c.(25-27)TATfs	p.Y9fs	ZC3H11A_uc001had.2_Frame_Shift_Ins_p.Y9fs|ZC3H11A_uc001hae.2_Frame_Shift_Ins_p.Y9fs|ZC3H11A_uc001haf.2_Frame_Shift_Ins_p.Y9fs|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Frame_Shift_Ins_p.Y9fs	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	9	C3H1-type 1.						nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAAGACTGCTATTTTTTTTTCT	0.371													99	7	---	---	---	---	
LPGAT1	9926	broad.mit.edu	37	1	211923084	211923085	+	3'UTR	INS	-	G	G	rs141524258	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211923084_211923085insG	uc001hiu.2	-	8					LPGAT1_uc001hiv.2_3'UTR	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		ATTTTAGTAGATTTTAAAATAT	0.248													10	9	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241954006	241954006	+	Intron	DEL	A	-	-	rs35435449		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241954006delA	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AAGGTAGCTTAAAAAAAAAAA	0.313													56	19	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					Tacacacacacgcacacacaca	0.198													8	5	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61552411	61552412	+	Intron	INS	-	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61552411_61552412insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			taaattaaactaaaaaaaaaaa	0.114													4	2	---	---	---	---	
DGUOK	1716	broad.mit.edu	37	2	74177637	74177638	+	Intron	DEL	TC	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74177637_74177638delTC	uc002sjx.2	+						DGUOK_uc002sjy.2_Intron|DGUOK_uc002sjz.2_Intron	NM_080916	NP_550438	Q16854	DGUOK_HUMAN	deoxyguanosine kinase isoform a precursor						guanosine metabolic process|purine base metabolic process|purine deoxyribonucleoside metabolic process|purine-containing compound salvage	mitochondrial matrix	ATP binding|deoxyguanosine kinase activity|phosphotransferase activity, alcohol group as acceptor				0						TTTTTCTGCTTCTCTCTCTCTC	0.406													142	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133019029	133019029	+	IGR	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133019029delA								NCRNA00164 (3487 upstream) : GPR39 (155118 downstream)																							GAAGGGGAACAAATCTTATCT	0.398													135	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133019886	133019887	+	IGR	INS	-	GAA	GAA	rs2311279		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133019886_133019887insGAA								NCRNA00164 (4344 upstream) : GPR39 (154260 downstream)																							TGTGCTGCATTGAAGTTCACGA	0.396													82	10	---	---	---	---	
ABCB6	10058	broad.mit.edu	37	2	220082643	220082643	+	Intron	DEL	A	-	-	rs75859701		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220082643delA	uc002vkc.1	-						ABCB6_uc010fwe.1_Intron|ABCB6_uc010zku.1_Intron	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6						cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTACAGGCTTAAAAAAAAAAA	0.443													6	4	---	---	---	---	
HACL1	26061	broad.mit.edu	37	3	15613336	15613336	+	Intron	DEL	C	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15613336delC	uc003caf.2	-						HACL1_uc011avr.1_Intron|HACL1_uc011avs.1_Intron|HACL1_uc011avt.1_Intron|HACL1_uc003cag.2_Intron|HACL1_uc011avu.1_Intron|HACL1_uc010hep.2_Intron	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase						fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0						CCttttttttctttttttttt	0.154													16	7	---	---	---	---	
IL1RAP	3556	broad.mit.edu	37	3	190345044	190345048	+	Intron	DEL	TTTTG	-	-	rs10538189		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190345044_190345048delTTTTG	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGTCTTTGttttttgttttgttttg	0.283													4	2	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195400918	195400919	+	Intron	INS	-	T	T	rs138187538	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195400918_195400919insT	uc003fuw.2	+						SDHAP2_uc011btc.1_Intron|SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AGTCttttttctttttttttga	0.252													5	7	---	---	---	---	
TFRC	7037	broad.mit.edu	37	3	195792289	195792292	+	Intron	DEL	GGGG	-	-	rs67752813		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195792289_195792292delGGGG	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)		AAAgcggggcgggggggggggggg	0.333			T	BCL6	NHL								7	4	---	---	---	---	
SEPSECS	51091	broad.mit.edu	37	4	25158425	25158426	+	Intron	DEL	GT	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25158425_25158426delGT	uc003grg.2	-						SEPSECS_uc003gri.2_Intron|SEPSECS_uc003grh.2_Intron	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine)						selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)	TGAGTCAGTGGTGTGTGTGTGT	0.322													89	9	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	74010556	74010556	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74010556delA	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron|ANKRD17_uc011cbd.1_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTCCTGTTTAAAAAAAAAAA	0.313													53	10	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123269055	123269055	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123269055delA	uc003ieh.2	+						KIAA1109_uc003iem.2_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ATGACACGTCAAAAAAAAAAA	0.328													10	6	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143081408	143081409	+	Intron	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143081408_143081409insT	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					AGTGTTATAACTTTTTTTCCAT	0.327													12	8	---	---	---	---	
PRMT10	90826	broad.mit.edu	37	4	148604884	148604884	+	Intron	DEL	C	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148604884delC	uc003ilc.2	-						PRMT10_uc003ild.2_Intron	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						ttttttttttctgtttttttt	0.478													63	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	68902898	68902898	+	5'Flank	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68902898delT	uc010ixi.1	+											Homo sapiens cDNA, FLJ18088.																		GACTGCGCGATTTTTTTTTGC	0.403													278	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	110284912	110284913	+	IGR	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110284912_110284913insT								SLC25A46 (186430 upstream) : TSLP (120865 downstream)																							TGAAGGTAGACTTTCTCATGCA	0.416													55	8	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131325276	131325276	+	Intron	DEL	C	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131325276delC	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kwc.1_Intron|ACSL6_uc003kwd.1_Intron|ACSL6_uc010jdn.1_Intron|ACSL6_uc010jdp.1_5'Flank	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGAGGAATTCtttttttttt	0.274													9	4	---	---	---	---	
VPS52	6293	broad.mit.edu	37	6	33231191	33231192	+	Intron	INS	-	ACACACACACAG	ACACACACACAG	rs142124369	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33231191_33231192insACACACACACAG	uc003odm.1	-						VPS52_uc003odn.1_Intron	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52						protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						cacacacacacagagagagaga	0.361													27	8	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	Splice_Site	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512916_57512917insT	uc003pdx.2	+	16	1839	c.1752_splice	c.e16+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.000													6	3	---	---	---	---	
KIAA0776	23376	broad.mit.edu	37	6	96971186	96971186	+	Intron	DEL	T	-	-	rs9486462	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96971186delT	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TTCTTTAGTGTTTTTTTTTTT	0.333													74	11	---	---	---	---	
FAM162B	221303	broad.mit.edu	37	6	117073875	117073878	+	Intron	DEL	ATAT	-	-	rs10556522		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117073875_117073878delATAT	uc003pxi.2	-							NM_001085480	NP_001078949	Q5T6X4	F162B_HUMAN	hypothetical protein LOC221303							integral to membrane					0						GGGGGAAGAAatatatatatatat	0.314													49	9	---	---	---	---	
KIAA1244	57221	broad.mit.edu	37	6	138640661	138640662	+	Intron	INS	-	A	A			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138640661_138640662insA	uc003qhu.2	+							NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AAACCCCGCAGAAAAAAAAAGG	0.376													4	3	---	---	---	---	
C7orf42	55069	broad.mit.edu	37	7	66416138	66416139	+	Intron	DEL	TG	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66416138_66416139delTG	uc003tvk.2	+						C7orf42_uc010lah.2_Intron|C7orf42_uc003tvl.2_Intron	NM_017994	NP_060464	Q9NWD8	CG042_HUMAN	hypothetical protein LOC55069							integral to membrane				ovary(1)	1						TGAGAAAAATtgtgtgtgtgtg	0.342													42	8	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74172386	74172386	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74172386delT	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						tttcttcttcttttttttttt	0.209													55	7	---	---	---	---	
OSGIN2	734	broad.mit.edu	37	8	90933285	90933285	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90933285delT	uc003yeg.2	+						OSGIN2_uc003yeh.2_Intron	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family						germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TGACGGTACATTTTTTTTTTT	0.343													171	9	---	---	---	---	
KLF10	7071	broad.mit.edu	37	8	103664698	103664699	+	Intron	INS	-	T	T	rs10639139		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103664698_103664699insT	uc011lhk.1	-						KLF10_uc011lhj.1_Intron	NM_005655	NP_005646	Q13118	KLF10_HUMAN	Kruppel-like factor 10 isoform a						cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			AAATGAGCAAAttttttttttt	0.277													17	8	---	---	---	---	
DENND4C	55667	broad.mit.edu	37	9	19299209	19299210	+	Intron	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19299209_19299210insT	uc003znq.2	+						DENND4C_uc011lnc.1_Intron	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C							integral to membrane				ovary(1)|skin(1)	2						GTTAATTTATCTTTTTTTTTTT	0.252													38	9	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69420250	69420251	+	Intron	INS	-	CTTA	CTTA			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420250_69420251insCTTA	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						TTATTATTCATCTTTTATTAAA	0.257													19	8	---	---	---	---	
KIF27	55582	broad.mit.edu	37	9	86485622	86485622	+	Intron	DEL	C	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86485622delC	uc004ana.2	-						KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27						cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						CAATTAttttctttttttttt	0.144													6	5	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92007209	92007210	+	Intron	INS	-	C	C	rs150111858	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92007209_92007210insC	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						TTGGGAAGTATCCCCCACAAAC	0.545													6	5	---	---	---	---	
SEC61B	10952	broad.mit.edu	37	9	101990074	101990075	+	Intron	INS	-	T	T	rs111986989		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990074_101990075insT	uc004azh.2	+							NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGCAAAGAAAGTTTTTTTTTTT	0.302													4	2	---	---	---	---	
C9orf119	375757	broad.mit.edu	37	9	131046568	131046568	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131046568delA	uc004bup.2	+						C9orf119_uc010mxx.1_Intron	NM_001040011	NP_001035100	Q1ZZU3	SWI5_HUMAN	hypothetical protein LOC375757						double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0						actccgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
CACNB2	783	broad.mit.edu	37	10	18439784	18439785	+	Intron	INS	-	TTTTTT	TTTTTT	rs79936088		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18439784_18439785insTTTTTT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TCTTATTTGTCttttttttttt	0.327													53	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	95043862	95043862	+	IGR	DEL	C	-	-	rs143425855		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95043862delC								CYP26A1 (206221 upstream) : MYOF (22325 downstream)																							TGTTCCTTTTCCAGTAAGAAT	0.473													5	7	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112649270	112649270	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112649270delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TTTATAGCTCTTTTTTTTTTC	0.303													208	13	---	---	---	---	
C10orf84	63877	broad.mit.edu	37	10	120070458	120070458	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120070458delA	uc001ldo.2	-						C10orf84_uc010qss.1_Intron	NM_022063	NP_071346	Q9H8W3	F204A_HUMAN	hypothetical protein LOC63877												0		Colorectal(252;0.101)		all cancers(201;0.0244)		TTTATTTCTTAAAAAAAAAAA	0.294													85	8	---	---	---	---	
TACC2	10579	broad.mit.edu	37	10	123996880	123996880	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123996880delT	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron|TACC2_uc001lfz.2_Intron|TACC2_uc001lga.2_Intron|TACC2_uc009xzy.2_Intron|TACC2_uc001lgb.2_Intron	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ATGCTAACTGTTTTTTTTTTA	0.413													24	7	---	---	---	---	
MKI67	4288	broad.mit.edu	37	10	129905112	129905113	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129905112_129905113delTG	uc001lke.2	-	13	5186_5187	c.4991_4992delCA	c.(4990-4992)ACAfs	p.T1664fs	MKI67_uc001lkf.2_Frame_Shift_Del_p.T1304fs|MKI67_uc009yav.1_Frame_Shift_Del_p.T1239fs|MKI67_uc009yaw.1_Frame_Shift_Del_p.T814fs	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1664	6.|16 X 122 AA approximate repeats.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGTTGGCTCTGTGTGTGTGTG	0.510													239	7	---	---	---	---	
TRIM49	57093	broad.mit.edu	37	11	89531802	89531802	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89531802delA	uc001pdb.2	-							NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TATGCACTGCAAAAAAAAAAA	0.294													25	7	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116767743	116767743	+	Intron	DEL	A	-	-	rs34854326		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116767743delA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						actctgtttcaaaaaaaaaaa	0.174													4	3	---	---	---	---	
CBL	867	broad.mit.edu	37	11	119145464	119145464	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119145464delT	uc001pwe.2	+							NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral						epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		GTTGGTGTTGTTTTTTTTTTT	0.378									CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				85	8	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134055426	134055426	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134055426delA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TATCGGCTGGAAAAAAAAAAG	0.363													58	9	---	---	---	---	
CCDC77	84318	broad.mit.edu	37	12	527847	527848	+	Intron	INS	-	CATT	CATT	rs139488868	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:527847_527848insCATT	uc001qig.2	+						CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			ACTTTAAATTAcattcattcat	0.218													25	8	---	---	---	---	
SILV	6490	broad.mit.edu	37	12	56348065	56348075	+	Frame_Shift_Del	DEL	AGACGCAGCCA	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56348065_56348075delAGACGCAGCCA	uc001sip.2	-	11	1940_1950	c.1909_1919delTGGCTGCGTCT	c.(1909-1920)TGGCTGCGTCTAfs	p.W637fs	SILV_uc001siq.2_Frame_Shift_Del_p.W644fs|SILV_uc010spx.1_Frame_Shift_Del_p.W551fs|SILV_uc001sir.2_Frame_Shift_Del_p.W637fs	NM_006928	NP_008859	P40967	PMEL_HUMAN	silver homolog	637_640	Cytoplasmic (Potential).				melanin biosynthetic process|melanosome organization	endoplasmic reticulum membrane|extracellular region|Golgi apparatus|integral to membrane|melanosome|multivesicular body membrane|plasma membrane	protein binding				0						GATGCGGGGTAGACGCAGCCAGTGACTGCTG	0.521													70	8	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56811590	56811591	+	Intron	DEL	GA	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56811590_56811591delGA	uc001slf.2	-							NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						CGATGGGGGTGAGAGAGAGAGA	0.446													99	7	---	---	---	---	
TAOK3	51347	broad.mit.edu	37	12	118588780	118588780	+	3'UTR	DEL	G	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118588780delG	uc001twx.2	-	21					TAOK3_uc001twv.2_3'UTR|TAOK3_uc001tww.2_3'UTR|TAOK3_uc001twy.3_3'UTR	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttttttttttGTAAATGGCAA	0.338													50	7	---	---	---	---	
KLHL1	57626	broad.mit.edu	37	13	70549943	70549944	+	Intron	DEL	CA	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70549943_70549944delCA	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GCCTATAAACcacacacacaca	0.302													35	7	---	---	---	---	
DNAJC3	5611	broad.mit.edu	37	13	96394870	96394872	+	Intron	DEL	TCT	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96394870_96394872delTCT	uc001vmq.2	+						DNAJC3_uc001vmp.2_Intron|DNAJC3_uc001vmr.2_Intron	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			ctcacttctctcttcttcttctt	0.000													363	7	---	---	---	---	
C14orf106	55320	broad.mit.edu	37	14	45716018	45716019	+	Frame_Shift_Ins	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45716018_45716019insT	uc001wwf.2	-	2	930_931	c.471_472insA	c.(469-474)AAATTGfs	p.K157fs	C14orf106_uc010anh.2_RNA	NM_018353	NP_060823	Q6P0N0	M18BP_HUMAN	chromosome 14 open reading frame 106	157_158					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding				0						GTATGCTGCAATTTTTTTTTTT	0.356													128	8	---	---	---	---	
STYX	6815	broad.mit.edu	37	14	53235545	53235545	+	Intron	DEL	A	-	-	rs2274274	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53235545delA	uc010tqy.1	+						STYX_uc001xaa.2_Intron	NM_001130701	NP_001124173	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein						protein dephosphorylation|spermatogenesis	cytoplasm	protein tyrosine/serine/threonine phosphatase activity				0	Breast(41;0.176)					taattaacttatttttttttt	0.274													37	19	---	---	---	---	
ARID4A	5926	broad.mit.edu	37	14	58825825	58825826	+	Intron	INS	-	T	T	rs75957825	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58825825_58825826insT	uc001xdp.2	+						ARID4A_uc001xdo.2_Intron|ARID4A_uc001xdq.2_Intron|ARID4A_uc010apg.1_Intron	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TGTACAAACTCttttttttttt	0.317													32	7	---	---	---	---	
KIAA0125	9834	broad.mit.edu	37	14	106375882	106375883	+	Intron	INS	-	C	C	rs34101324		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106375882_106375883insC	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron|KIAA0125_uc001yss.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						CTTCAGGGGCTCTGAGGCTGTG	0.668													12	7	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28517555	28517556	+	Intron	INS	-	C	C	rs112104080		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517555_28517556insC	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGATATTTATTCTAGTAAAAAC	0.391													16	9	---	---	---	---	
SPPL2A	84888	broad.mit.edu	37	15	51017382	51017382	+	Intron	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51017382delT	uc001zyv.2	-							NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A							integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		ATCATCAGTGTTTTTTTTTTT	0.328													51	7	---	---	---	---	
ADAM10	102	broad.mit.edu	37	15	58925561	58925561	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58925561delA	uc002afd.1	-						ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor						cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		AGAGCTTCCTAATCCAGAACA	0.313													36	14	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66257236	66257237	+	Intron	INS	-	A	A	rs138144863	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66257236_66257237insA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CGCCCATTCCCAGCTCATACCT	0.673													6	4	---	---	---	---	
SNUPN	10073	broad.mit.edu	37	15	75899749	75899750	+	Intron	DEL	CC	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75899749_75899750delCC	uc002ban.2	-						SNUPN_uc002bao.2_Intron|SNUPN_uc002bap.2_Intron|SNUPN_uc002baq.2_Intron|SNUPN_uc002bar.2_Intron|SNUPN_uc002bas.2_Intron	NM_005701	NP_005692	O95149	SPN1_HUMAN	snurportin 1						ncRNA metabolic process|protein import into nucleus|spliceosomal snRNP assembly	cytosol|nuclear pore	protein transporter activity|RNA cap binding			pancreas(1)	1						AGGCTTGAGTCCAACAATCCTC	0.535													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93974510	93974510	+	Intron	DEL	C	-	-	rs76539783		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93974510delC	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		TGGCTGGGTTCtttttttttt	0.303													34	7	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19455255	19455258	+	Intron	DEL	ATGG	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19455255_19455258delATGG	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ggatggatacatggatggatggat	0.015													4	4	---	---	---	---	
ACSM2A	123876	broad.mit.edu	37	16	20494714	20494714	+	Intron	DEL	A	-	-	rs71377660		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20494714delA	uc010bwe.2	+						ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						caacatggtgaaaccccatct	0.000													4	4	---	---	---	---	
ZFHX3	463	broad.mit.edu	37	16	72820939	72820939	+	3'UTR	DEL	T	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72820939delT	uc002fck.2	-	10					uc002fcj.1_Intron|ZFHX3_uc002fcl.2_3'UTR	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				cttttttttcttttttttttt	0.219													22	9	---	---	---	---	
ATP2C2	9914	broad.mit.edu	37	16	84456439	84456440	+	Intron	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84456439_84456440insT	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron|ATP2C2_uc002fhy.2_Intron|ATP2C2_uc002fhz.2_Intron	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						TAAACATTTAAttttttttttt	0.178													10	7	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20768840	20768840	+	Intron	DEL	A	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768840delA	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						ATGGTGGCAGAAAAAAAAATG	0.358													42	9	---	---	---	---	
FOXN1	8456	broad.mit.edu	37	17	26851370	26851371	+	Intron	INS	-	CTT	CTT	rs138715148	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851370_26851371insCTT	uc010crm.2	+						FOXN1_uc002hbj.2_Intron	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1						defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					TGAAATCGGGGCCAAGGGTAGG	0.574													7	4	---	---	---	---	
RPL23A	6147	broad.mit.edu	37	17	27050925	27050926	+	3'UTR	DEL	AT	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27050925_27050926delAT	uc002hci.2	+	5						NM_000984	NP_000975	P62750	RL23A_HUMAN	ribosomal protein L23a						cell proliferation|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	nucleotide binding|protein binding|rRNA binding|structural constituent of ribosome			ovary(1)	1	Lung NSC(42;0.00431)					CTAATTCTGAATATATATATAT	0.416													42	7	---	---	---	---	
TNS4	84951	broad.mit.edu	37	17	38644759	38644760	+	Intron	DEL	TG	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38644759_38644760delTG	uc010cxb.2	-							NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			TGCGTGTGCCTGTGTGTGTGTG	0.505													152	10	---	---	---	---	
AARSD1	80755	broad.mit.edu	37	17	41108010	41108011	+	Intron	DEL	AC	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41108010_41108011delAC	uc002icc.2	-						AARSD1_uc002icd.2_Intron|AARSD1_uc002ice.2_Intron|AARSD1_uc002icf.2_Intron|AARSD1_uc010whg.1_Intron|AARSD1_uc010cyu.1_3'UTR	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1						alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding				0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CAAGGGGGTAACACACACACAC	0.490													145	12	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76425005	76425006	+	Intron	INS	-	AA	AA	rs60351485		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76425005_76425006insAA	uc010dhp.1	-						DNAH17_uc002jvq.2_Intron|DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTTCTTTCTTTaaaaaaaaaaa	0.446													4	2	---	---	---	---	
GALNT1	2589	broad.mit.edu	37	18	33272292	33272293	+	Intron	DEL	AT	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33272292_33272293delAT	uc010dmu.2	+						GALNT1_uc002kyz.3_Intron|GALNT1_uc002kzb.2_Intron	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1						protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						GAGGTAAGAAATATATATATAT	0.287													60	9	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47501149	47501150	+	Intron	INS	-	CA	CA	rs146410387	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47501149_47501150insCA	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTCTCTCTcacacacacac	0.426													2	5	---	---	---	---	
EPS15L1	58513	broad.mit.edu	37	19	16528668	16528669	+	Intron	INS	-	CC	CC			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16528668_16528669insCC	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron|EPS15L1_uc002neb.1_Intron|EPS15L1_uc002nec.1_Intron	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						AGCACCCGCCACCGTGGGCTCA	0.678											OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	7	---	---	---	---	
RSPH6A	81492	broad.mit.edu	37	19	46299147	46299149	+	In_Frame_Del	DEL	CCT	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46299147_46299149delCCT	uc002pdm.2	-	6	2275_2277	c.2132_2134delAGG	c.(2131-2136)GAGGGC>GGC	p.E711del	RSPH6A_uc002pdl.2_In_Frame_Del_p.E447del	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	711	Glu-rich.					intracellular				ovary(1)|central_nervous_system(1)	2						GTctcctcgccctcctcctcctc	0.409													129	11	---	---	---	---	
RRBP1	6238	broad.mit.edu	37	20	17607832	17607833	+	Intron	INS	-	CT	CT	rs72533972	by1000genomes	TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17607832_17607833insCT	uc002wpv.1	-						RRBP1_uc002wpu.2_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron|RRBP1_uc010gcm.1_Intron	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						AGGCCTGTCCCGTCCTCTAAAT	0.634													4	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62062654	62062655	+	Intron	DEL	CA	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62062654_62062655delCA	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GAACTAGAACCACACACACACA	0.569													114	13	---	---	---	---	
GART	2618	broad.mit.edu	37	21	34903298	34903299	+	Intron	INS	-	T	T			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34903298_34903299insT	uc002yrx.2	-						GART_uc002yrz.2_Intron|GART_uc010gmd.2_Intron|GART_uc002yry.2_Intron|GART_uc002ysa.2_Intron	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,						'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)	GGAAAAGTTTGTTTTTTTTTTT	0.277													4	2	---	---	---	---	
CBS	875	broad.mit.edu	37	21	44476001	44476001	+	Intron	DEL	T	-	-	rs79861734		TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44476001delT	uc002zcu.2	-						CBS_uc002zcs.1_Intron|CBS_uc002zct.2_Intron|CBS_uc002zcw.3_Intron|CBS_uc002zcv.2_Intron|CBS_uc002zcx.2_3'UTR	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase						cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	aatttgcatctttttttTTTT	0.239													4	2	---	---	---	---	
RBMY1A1	5940	broad.mit.edu	37	Y	24326955	24326956	+	Intron	DEL	AC	-	-			TCGA-G9-6332-01A-11D-1786-08	TCGA-G9-6332-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:24326955_24326956delAC	uc010nxc.1	-						RBMY1E_uc011nbg.1_Intron|RBMY1J_uc010nxh.2_Intron|RBMY1J_uc004fva.2_Intron	NM_152585	NP_689798	Q15414	RBY1A_HUMAN	RNA binding motif protein, Y-linked, family 1,						mRNA processing|RNA splicing|spermatogenesis	nucleus	nucleotide binding|RNA binding				0						ATGTGAAAATacacacacacac	0.193													11	6	---	---	---	---	
