Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBE4B	10277	broad.mit.edu	37	1	10179659	10179659	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10179659T>C	uc001aqs.3	+	9	2140	c.1427T>C	c.(1426-1428)CTA>CCA	p.L476P	UBE4B_uc001aqr.3_Missense_Mutation_p.L347P|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	476					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CAAGGCTCCCTAACACAGCCC	0.532													4	108	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16952952	16952952	+	RNA	SNP	G	A	A	rs1762946	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16952952G>A	uc010ocf.1	-	1		c.43C>T			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA|CROCCL1_uc001azg.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						TCTGCCCTCAGCTTGGTCACG	0.622													5	48	---	---	---	---	PASS
CYP4B1	1580	broad.mit.edu	37	1	47279221	47279221	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47279221C>T	uc001cqm.3	+	5	647	c.563C>T	c.(562-564)GCG>GTG	p.A188V	CYP4B1_uc009vyl.1_Missense_Mutation_p.A25V|CYP4B1_uc001cqn.3_Missense_Mutation_p.A188V|CYP4B1_uc009vym.2_Missense_Mutation_p.A173V|CYP4B1_uc010omk.1_Missense_Mutation_p.A25V|CYP4B1_uc010oml.1_Missense_Mutation_p.A25V	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	188					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					GGTCACATGGCGCTGAACACA	0.572													36	104	---	---	---	---	PASS
OSBPL9	114883	broad.mit.edu	37	1	52215867	52215867	+	Silent	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52215867A>G	uc001cst.2	+	8	562	c.543A>G	c.(541-543)AAA>AAG	p.K181K	OSBPL9_uc001css.2_Silent_p.K199K|OSBPL9_uc001csx.2_RNA|OSBPL9_uc009vza.2_Silent_p.K182K|OSBPL9_uc001csu.2_Silent_p.K204K|OSBPL9_uc001csv.2_Silent_p.K16K|OSBPL9_uc001csw.2_Silent_p.K181K|OSBPL9_uc001csy.2_Silent_p.K16K|OSBPL9_uc001csz.2_Silent_p.K16K|OSBPL9_uc001cta.2_Silent_p.K84K	NM_024586	NP_078862	Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9 isoform e	181					lipid transport		lipid binding			central_nervous_system(1)	1						AGATTGCCAAAGTAAGTAAAT	0.299													5	179	---	---	---	---	PASS
RPE65	6121	broad.mit.edu	37	1	68904699	68904699	+	Silent	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68904699A>G	uc001dei.1	-	9	978	c.924T>C	c.(922-924)CCT>CCC	p.P308P		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	308					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						AGAGGTTGAAAGGAGAAGTTC	0.368													6	222	---	---	---	---	PASS
DDAH1	23576	broad.mit.edu	37	1	85817252	85817252	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85817252A>C	uc001dlb.2	-	3	575	c.414T>G	c.(412-414)TTT>TTG	p.F138L	DDAH1_uc001dlc.2_Missense_Mutation_p.F35L|uc001dla.1_Intron|DDAH1_uc010osb.1_Missense_Mutation_p.F38L|DDAH1_uc009wco.2_Missense_Mutation_p.F35L	NM_012137	NP_036269	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1	138					arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	GGCCCACAAAAAATTCTCTGC	0.388													45	140	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100368332	100368332	+	Missense_Mutation	SNP	C	G	G	rs113994131		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100368332C>G	uc001dsi.1	+	27	4082	c.3682C>G	c.(3682-3684)CGA>GGA	p.R1228G	AGL_uc001dsj.1_Missense_Mutation_p.R1228G|AGL_uc001dsk.1_Missense_Mutation_p.R1228G|AGL_uc001dsl.1_Missense_Mutation_p.R1228G|AGL_uc001dsm.1_Missense_Mutation_p.R1212G|AGL_uc001dsn.1_Missense_Mutation_p.R1211G	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1228	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CCAGATAGATCGAAACATGAA	0.373													6	38	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	168034953	168034953	+	Silent	SNP	A	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168034953A>T	uc001gew.2	+	16	2534	c.2292A>T	c.(2290-2292)GTA>GTT	p.V764V	DCAF6_uc001gev.2_Silent_p.V784V|DCAF6_uc001gex.2_Silent_p.V855V|DCAF6_uc010plk.1_Silent_p.V824V|DCAF6_uc001gey.2_Silent_p.V637V|DCAF6_uc001gez.2_Silent_p.V69V	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	764	WD 7.				positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATCATGTGGTAAACTGCCTGC	0.418													10	40	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24480848	24480848	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24480848T>C	uc002rfe.2	-	23	3055	c.2797A>G	c.(2797-2799)AAT>GAT	p.N933D	ITSN2_uc002rff.2_Missense_Mutation_p.N906D|ITSN2_uc002rfg.2_Missense_Mutation_p.N933D|ITSN2_uc002rfh.1_RNA	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	933	SH3 2.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACCACCAATTTTCTTGCTGC	0.423													5	144	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43801938	43801938	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43801938G>C	uc002rsw.3	-	11	1618	c.1266C>G	c.(1264-1266)CAC>CAG	p.H422Q	THADA_uc002rsx.3_Missense_Mutation_p.H422Q|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.H132Q|THADA_uc002rta.2_Missense_Mutation_p.H132Q|THADA_uc002rtb.1_Missense_Mutation_p.H422Q|THADA_uc002rtc.3_Missense_Mutation_p.H422Q|THADA_uc002rtd.2_Missense_Mutation_p.H422Q	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	422							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CAGTGAGCCGGTGCATTTGGA	0.418													22	96	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50723141	50723141	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50723141A>C	uc010fbq.2	-	15	4569	c.3092T>G	c.(3091-3093)GTG>GGG	p.V1031G	NRXN1_uc002rxb.3_Missense_Mutation_p.V663G|NRXN1_uc002rxe.3_Missense_Mutation_p.V991G|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	180	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGATATCATCACGTTGTGCCA	0.438													35	114	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128855098	128855098	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128855098A>G	uc002tps.2	+	2	332	c.154A>G	c.(154-156)ACA>GCA	p.T52A	UGGT1_uc010fme.1_5'UTR|UGGT1_uc002tpr.2_Missense_Mutation_p.T28A	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	52					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						AACCTCTCTTACAACAAAATG	0.393													5	180	---	---	---	---	PASS
ARPC2	10109	broad.mit.edu	37	2	219093573	219093573	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219093573G>T	uc002vhd.2	+	4	334	c.222G>T	c.(220-222)GAG>GAT	p.E74D	ARPC2_uc002vhe.2_Missense_Mutation_p.E74D	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2	74					cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		GTGCTGATGAGGTAAGATCCA	0.408													24	79	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238280926	238280926	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238280926C>T	uc002vwl.2	-	9	4019	c.3734G>A	c.(3733-3735)GGG>GAG	p.G1245E	COL6A3_uc002vwo.2_Missense_Mutation_p.G1039E|COL6A3_uc010znj.1_Missense_Mutation_p.G638E|COL6A3_uc002vwq.2_Missense_Mutation_p.G1039E|COL6A3_uc002vwr.2_Missense_Mutation_p.G838E	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1245	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GAACTCAGGCCCGGCACTTTG	0.552													4	44	---	---	---	---	PASS
AQP12B	653437	broad.mit.edu	37	2	241622318	241622318	+	Splice_Site	SNP	C	T	T	rs139037294	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241622318C>T	uc010fzj.2	-	1	1	c.-62_splice	c.e1-1		AQP12B_uc002vzt.2_RNA	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B							integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		AGGAGCTGGCCGGTTCCCACA	0.672													3	27	---	---	---	---	PASS
GALNTL2	117248	broad.mit.edu	37	3	16237362	16237362	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16237362A>G	uc003car.3	+	2	1110	c.635A>G	c.(634-636)CAC>CGC	p.H212R	GALNTL2_uc003caq.3_5'UTR	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	212	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1						CGGACTGTACACAGCATCCTC	0.607													5	24	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180325654	180325654	+	Intron	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180325654A>G	uc003fkk.2	+						TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TAAGTAAGGCATTATGAAAAG	0.308													5	20	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505855	195505855	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505855G>T	uc011bto.1	-	3	12672	c.12212C>A	c.(12211-12213)TCC>TAC	p.S4071Y	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.597													4	32	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197652965	197652965	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197652965C>A	uc003fyo.2	-	6	802	c.656G>T	c.(655-657)GGA>GTA	p.G219V	IQCG_uc003fyn.2_Missense_Mutation_p.G121V|IQCG_uc003fyp.2_Missense_Mutation_p.G219V|IQCG_uc003fyq.3_Missense_Mutation_p.G219V	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	219											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CTGTTTTCTTCCTTTTTCCTC	0.234													111	355	---	---	---	---	PASS
PPM1K	152926	broad.mit.edu	37	4	89183707	89183707	+	3'UTR	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89183707G>A	uc003hrm.3	-	7						NM_152542	NP_689755	Q8N3J5	PPM1K_HUMAN	protein phosphatase 1K (PP2C domain containing)						protein dephosphorylation	mitochondrial matrix|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		CATGCTCAGTGAAAAACTGTT	0.418													9	34	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33683970	33683970	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33683970C>T	uc003jia.1	-	4	988	c.825G>A	c.(823-825)ATG>ATA	p.M275I	ADAMTS12_uc010iuq.1_Missense_Mutation_p.M275I	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	275	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ATACCATGTTCATGATGGTGA	0.468										HNSCC(64;0.19)			6	19	---	---	---	---	PASS
MSX2	4488	broad.mit.edu	37	5	174156377	174156377	+	Nonsense_Mutation	SNP	A	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174156377A>T	uc003mcy.2	+	2	683	c.595A>T	c.(595-597)AGA>TGA	p.R199*		NM_002449	NP_002440	P35548	MSX2_HUMAN	msh homeobox 2	199	Homeobox.				cranial suture morphogenesis|negative regulation of transcription, DNA-dependent|osteoblast differentiation	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAAGGCGAAAAGACTGCAGGA	0.552													10	38	---	---	---	---	PASS
LOC100287718	100287718	broad.mit.edu	37	6	46721623	46721623	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46721623G>A	uc011dwf.1	+	4	453	c.406G>A	c.(406-408)GGA>AGA	p.G136R		NM_001162435	NP_001155907	B4E2M5	B4E2M5_HUMAN	hypothetical protein LOC100287718	136											0						TGACTTCTTTGGAGACACACC	0.478													11	36	---	---	---	---	PASS
OOEP	441161	broad.mit.edu	37	6	74078472	74078472	+	3'UTR	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74078472A>G	uc003pgu.3	-	3					OOEP_uc003pgv.3_3'UTR	NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						CAAAAGTTAGAAAGTTAAGAT	0.408													6	218	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150004381	150004381	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150004381A>G	uc003qmu.1	-	4	2392	c.1844T>C	c.(1843-1845)ATT>ACT	p.I615T	LATS1_uc010kif.1_Missense_Mutation_p.I510T|LATS1_uc003qmv.1_Missense_Mutation_p.I615T|LATS1_uc003qmw.2_Missense_Mutation_p.I615T|LATS1_uc010kig.1_Missense_Mutation_p.I510T	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	615	Interaction with YAP1.				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CCTAACAGTAATAGGTGAAGT	0.363													6	333	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151894314	151894314	+	Silent	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151894314G>A	uc003qol.2	+	6	869	c.780G>A	c.(778-780)CTG>CTA	p.L260L		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	260	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		TTTAGGACCTGCTCAGTGCTG	0.443													7	14	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6042192	6042192	+	Silent	SNP	A	G	G	rs35650314		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6042192A>G	uc003spl.2	-	5	516	c.429T>C	c.(427-429)ATT>ATC	p.I143I	PMS2_uc003spj.2_Silent_p.I37I|PMS2_uc003spk.2_Silent_p.I8I|PMS2_uc011jwl.1_Silent_p.I8I|PMS2_uc010ktg.2_5'UTR|PMS2_uc010kte.2_Silent_p.I143I|PMS2_uc010ktf.1_Silent_p.I143I	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	143					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TTTTCTGGATAATTTTCCCAT	0.502			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				13	59	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98490138	98490138	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98490138T>C	uc003upp.2	+	5	562	c.353T>C	c.(352-354)TTT>TCT	p.F118S	TRRAP_uc011kis.1_Missense_Mutation_p.F118S	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	118					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCTGTGATGTTTCGCTTTTTA	0.348													6	329	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1817555	1817555	+	Intron	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1817555G>A	uc003wpr.2	+						ARHGEF10_uc003wpq.1_Intron|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_Intron|ARHGEF10_uc010lrd.1_Silent_p.*188*|ARHGEF10_uc003wpu.2_Silent_p.*187*	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		ATGGCTTATTGATGTGTGGTG	0.383													9	34	---	---	---	---	PASS
CHRNA2	1135	broad.mit.edu	37	8	27321118	27321118	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27321118C>G	uc010lur.2	-	6	1451	c.842G>C	c.(841-843)TGC>TCC	p.C281S	CHRNA2_uc011lal.1_Missense_Mutation_p.C266S|CHRNA2_uc010lus.2_Missense_Mutation_p.C83S	NM_000742	NP_000733	Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha	281	Helical; (Potential).					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(1)	1		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Gallamine Triethiodide(DB00483)|Levallorphan(DB00504)|Mecamylamine(DB00657)|Metocurine(DB01336)|Metocurine Iodide(DB00416)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Rocuronium(DB00728)|Tubocurarine(DB01199)	CACAGTGAGGCAGGAGATGAG	0.602													68	203	---	---	---	---	PASS
CRISPLD1	83690	broad.mit.edu	37	8	75927084	75927084	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75927084C>T	uc003yan.2	+	6	1039	c.664C>T	c.(664-666)CGG>TGG	p.R222W	CRISPLD1_uc011lfk.1_Missense_Mutation_p.R34W|CRISPLD1_uc011lfl.1_Missense_Mutation_p.R34W	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	222						extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CAAACATGGGCGGCCCTGTTC	0.423													11	27	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764366	77764366	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764366T>C	uc003yav.2	+	10	5461	c.5074T>C	c.(5074-5076)TTT>CTT	p.F1692L	ZFHX4_uc003yau.1_Missense_Mutation_p.F1737L|ZFHX4_uc003yaw.1_Missense_Mutation_p.F1692L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1692	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCAGCCTCAGTTTCTCTTTCC	0.502										HNSCC(33;0.089)			6	198	---	---	---	---	PASS
ANKRD46	157567	broad.mit.edu	37	8	101534865	101534865	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101534865A>G	uc003yjm.2	-	5	809	c.605T>C	c.(604-606)ATT>ACT	p.I202T	ANKRD46_uc003yjn.1_Missense_Mutation_p.I202T|ANKRD46_uc003yjo.1_Missense_Mutation_p.I202T|ANKRD46_uc003yjp.1_Missense_Mutation_p.I202T	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	202	Helical; (Potential).					integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			CAGCAAAGCAATGACGAAGAT	0.507													5	116	---	---	---	---	PASS
ASPN	54829	broad.mit.edu	37	9	95228658	95228658	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95228658T>C	uc004ase.1	-	4	827	c.583A>G	c.(583-585)AAT>GAT	p.N195D	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ASPN_uc010mqy.1_Missense_Mutation_p.N195D	NM_017680	NP_060150	Q9BXN1	ASPN_HUMAN	asporin precursor	195	Interaction with TGFB1 (By similarity).				bone mineralization|negative regulation of tooth mineralization|negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	calcium ion binding				0						TGTAAAGCATTCATTCCTTTG	0.303													5	152	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116267783	116267783	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116267783G>C	uc004bhq.2	+	12	1168	c.959G>C	c.(958-960)CGA>CCA	p.R320P	RGS3_uc004bhr.2_Missense_Mutation_p.R208P|RGS3_uc004bhs.2_Missense_Mutation_p.R210P|RGS3_uc004bht.2_Missense_Mutation_p.R39P|RGS3_uc010muy.2_Missense_Mutation_p.R39P|RGS3_uc004bhu.2_5'UTR	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	320	PDZ.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						TCTCCAGTTCGAGTCCAGGCC	0.562													42	137	---	---	---	---	PASS
TRIM21	6737	broad.mit.edu	37	11	4411299	4411299	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4411299C>T	uc001lyy.1	-	2	454	c.341G>A	c.(340-342)TGT>TAT	p.C114Y		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	114	B box-type.				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		AGACTGGGCACATACCCAGCA	0.587													14	73	---	---	---	---	PASS
BEST1	7439	broad.mit.edu	37	11	61730491	61730491	+	Intron	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61730491T>C	uc001nss.2	+						BEST1_uc010rls.1_Missense_Mutation_p.L250P|BEST1_uc001nsr.2_Missense_Mutation_p.L562P|BEST1_uc009ynt.2_Intron|BEST1_uc010rlt.1_Intron|BEST1_uc001nst.2_Intron|BEST1_uc010rlv.1_Intron	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1						response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						ACACTGGACCTACGCCCAGCA	0.567													35	104	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66807536	66807536	+	Silent	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66807536G>A	uc009yrl.2	+	4	713	c.483G>A	c.(481-483)GAG>GAA	p.E161E	SYT12_uc001oju.2_Silent_p.E161E	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	161	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						TGAGCATGGAGTACGACACTG	0.627													18	58	---	---	---	---	PASS
KRTAP5-7	440050	broad.mit.edu	37	11	71238705	71238705	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71238705G>A	uc001oqq.1	+	1	393	c.359G>A	c.(358-360)TGC>TAC	p.C120Y		NM_001012503	NP_001012521	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	120	7 X 4 AA repeats of C-C-X-P.					keratin filament					0						tgtaagccctgctgctgccag	0.055													4	28	---	---	---	---	PASS
TBRG1	84897	broad.mit.edu	37	11	124500331	124500331	+	Silent	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124500331T>C	uc001qak.3	+	6	1024	c.786T>C	c.(784-786)TCT>TCC	p.S262S	TBRG1_uc001qaj.3_Silent_p.S111S|TBRG1_uc001qal.3_Silent_p.S38S|TBRG1_uc001qam.3_RNA|TBRG1_uc009zbf.2_RNA|TBRG1_uc009zbg.2_Silent_p.S111S|TBRG1_uc009zbh.2_Silent_p.S38S	NM_032811	NP_116200	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	262	FYR C-terminal.				cell cycle arrest|DNA replication|negative regulation of cell proliferation|nucleolus to nucleoplasm transport|protein stabilization	nucleus	DNA binding|protein binding				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		TTGTCAGCTCTTCTGCAGATG	0.428													5	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92133	92133	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92133G>T	uc010sdi.1	-	2	205	c.177C>A	c.(175-177)GAC>GAA	p.D59E	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		GCAGCTGCCTGTCAGGAAGAG	0.592													4	14	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112193484	112193484	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112193484G>A	uc001tsq.2	+	20	3174	c.2974G>A	c.(2974-2976)GAT>AAT	p.D992N	ACAD10_uc009zvx.2_Missense_Mutation_p.D1023N|ACAD10_uc001tss.1_RNA	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	992							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						TGCAGCCTTGGATATAGCCAT	0.517													31	123	---	---	---	---	PASS
GPR109A	338442	broad.mit.edu	37	12	123187550	123187550	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123187550T>C	uc001ucx.1	-	1	355	c.281A>G	c.(280-282)AAG>AGG	p.K94R	GPR81_uc001ucw.1_Intron	NM_177551	NP_808219	Q8TDS4	HCAR2_HUMAN	G protein-coupled receptor 109A	94	Extracellular (Potential).				negative regulation of lipid catabolic process|neutrophil apoptosis|positive regulation of adiponectin secretion|positive regulation of neutrophil apoptosis	integral to membrane|plasma membrane	nicotinic acid receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	GTCCCCAAACTTCCAGTCCCA	0.542													5	94	---	---	---	---	PASS
CDK2AP1	8099	broad.mit.edu	37	12	123746106	123746106	+	3'UTR	SNP	T	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123746106T>A	uc001ueq.2	-	4					CDK2AP1_uc001uep.2_RNA	NM_004642	NP_004633	O14519	CDKA1_HUMAN	CDK2-associated protein  1						DNA-dependent DNA replication|protein phosphorylation|S phase of mitotic cell cycle	cytoplasm|nucleus	DNA binding|protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000554)|Epithelial(86;0.00178)		CAAATCCTAATTAACTGCAAA	0.348													3	6	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129467521	129467521	+	Silent	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129467521A>G	uc010tbh.1	+	13	951	c.942A>G	c.(940-942)GAA>GAG	p.E314E	GLT1D1_uc001uhx.1_Silent_p.E229E|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	309					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CTGCATTAGAAAAGGAAATCG	0.428													6	276	---	---	---	---	PASS
C14orf174	161394	broad.mit.edu	37	14	77844367	77844367	+	Silent	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77844367A>G	uc001xtq.1	+	1	606	c.606A>G	c.(604-606)GAA>GAG	p.E202E	TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394	202											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)		TGCAACATGAAGAGACAGGTC	0.468													4	46	---	---	---	---	PASS
C14orf109	26175	broad.mit.edu	37	14	93651789	93651789	+	Silent	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93651789T>C	uc010auo.2	+	1	415	c.57T>C	c.(55-57)TCT>TCC	p.S19S	MOAP1_uc001ybj.2_5'Flank|C14orf109_uc001ybk.3_Intron	NM_001098621	NP_001092091	Q8N6I4	CN109_HUMAN	hypothetical protein LOC26175 isoform 1	13						integral to membrane					0		all_cancers(154;0.11)|Acute lymphoblastic leukemia(33;0.0488)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		TGAGTGACTCTTTAACGCTTG	0.498													5	167	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106134751	106134751	+	Intron	SNP	C	G	G	rs141442623		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106134751C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysb.1_RNA					Parts of antibodies, mostly variable regions.												0						GAGGCGTGGTCTTGTAGTTGT	0.587													5	168	---	---	---	---	PASS
MSLN	10232	broad.mit.edu	37	16	816088	816088	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:816088C>T	uc002cjw.1	+	11	976	c.925C>T	c.(925-927)CGC>TGC	p.R309C	MSLN_uc002cjt.1_Missense_Mutation_p.R309C|MSLN_uc002cju.1_Missense_Mutation_p.R309C|MSLN_uc010brd.1_Missense_Mutation_p.R308C|MSLN_uc002cjv.1_Missense_Mutation_p.R309C|MSLN_uc002cjx.1_Missense_Mutation_p.R309C|MSLN_uc002cjy.1_5'UTR	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	309					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				CAAGAAGGCCCGCGAGATAGA	0.408													4	88	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15221657	15221657	+	Intron	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15221657C>T	uc002ddc.2	+						uc010uzs.1_RNA|uc002ddh.2_Silent_p.P416P|uc002ddi.2_Silent_p.P192P|uc010uzt.1_Silent_p.P416P	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AGCTACGAGGCGGCCGGTCCC	0.632													6	26	---	---	---	---	PASS
SULT1A1	6817	broad.mit.edu	37	16	28620121	28620121	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28620121G>A	uc002dqi.2	-	1	529	c.56C>T	c.(55-57)CCG>CTG	p.P19L	uc010vct.1_Intron|SULT1A1_uc002dqj.2_Missense_Mutation_p.P19L|SULT1A1_uc002dqk.2_Missense_Mutation_p.P19L|SULT1A1_uc002dql.2_Missense_Mutation_p.P19L|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Missense_Mutation_p.P110L|SULT1A1_uc002dqo.2_Missense_Mutation_p.P19L|SULT1A1_uc002dqp.2_Missense_Mutation_p.P19L	NM_177534	NP_803878	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A,	19					3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0						CTTGATGAGCGGGACCCCCTT	0.632													5	90	---	---	---	---	PASS
CCDC79	283847	broad.mit.edu	37	16	66804157	66804157	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66804157A>G	uc010viv.1	-	14	1590	c.1328T>C	c.(1327-1329)ATT>ACT	p.I443T	CCDC79_uc002eqc.1_RNA|CCDC79_uc002eqd.1_Missense_Mutation_p.I443T	NM_001136505	NP_001129977	Q8NA31	CCD79_HUMAN	coiled-coil domain containing 79	443	Potential.				regulation of transcription, DNA-dependent		DNA binding				0						TGTATTCTGAATACTTATGTT	0.328													5	142	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72829790	72829790	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72829790T>G	uc002fck.2	-	9	7464	c.6791A>C	c.(6790-6792)AAT>ACT	p.N2264T	ZFHX3_uc002fcl.2_Missense_Mutation_p.N1350T	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	2264	Homeobox 2.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TGGGTAAGCATTGGCATCGAA	0.488													62	223	---	---	---	---	PASS
PLSCR3	57048	broad.mit.edu	37	17	7296226	7296226	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7296226G>A	uc002ggm.1	-	6	762	c.553C>T	c.(553-555)CAG>TAG	p.Q185*	PLSCR3_uc002ggl.2_Intron|PLSCR3_uc002ggq.1_Nonsense_Mutation_p.Q16*|PLSCR3_uc002ggn.1_Nonsense_Mutation_p.Q185*|PLSCR3_uc002ggo.1_Nonsense_Mutation_p.Q185*|PLSCR3_uc002ggp.1_Nonsense_Mutation_p.Q16*|PLSCR3_uc002ggr.1_Nonsense_Mutation_p.Q185*|PLSCR3_uc010cmg.1_Nonsense_Mutation_p.Q185*	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3	185	Cytoplasmic (By similarity).				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				TGCCAGGTCTGTAGCACGTGG	0.622													12	332	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37883729	37883729	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37883729A>G	uc002hso.2	+	26	3579	c.3341A>G	c.(3340-3342)GAG>GGG	p.E1114G	ERBB2_uc002hsm.2_Missense_Mutation_p.E1084G|ERBB2_uc010cwa.2_Missense_Mutation_p.E1099G|ERBB2_uc002hsp.2_Missense_Mutation_p.E917G|ERBB2_uc010cwb.2_Intron|ERBB2_uc010wek.1_Missense_Mutation_p.E838G	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1114	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	CGGTACAGTGAGGACCCCACA	0.612		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			4	44	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59155722	59155722	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59155722A>G	uc002iyv.3	+	22	2313	c.2204A>G	c.(2203-2205)CAT>CGT	p.H735R	BCAS3_uc002iyu.3_Missense_Mutation_p.H720R|BCAS3_uc002iyw.3_Missense_Mutation_p.H716R|BCAS3_uc002iyy.3_Missense_Mutation_p.H491R|BCAS3_uc002iyz.3_Missense_Mutation_p.H289R|BCAS3_uc002iza.3_Missense_Mutation_p.H274R	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	735						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			ACTGGACCCCATAGACGTCTG	0.448													35	105	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76795062	76795062	+	Silent	SNP	A	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76795062A>C	uc002jvz.1	-	19	3493	c.3168T>G	c.(3166-3168)GCT>GCG	p.A1056A	USP36_uc002jwa.1_Silent_p.A1056A|USP36_uc002jvy.1_Silent_p.A116A	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1054					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TGTCTTCAATAGCATCCTGAC	0.577													52	189	---	---	---	---	PASS
ATP5A1	498	broad.mit.edu	37	18	43668204	43668204	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43668204C>A	uc002lbr.1	-	6	760	c.670G>T	c.(670-672)GAC>TAC	p.D224Y	ATP5A1_uc010dnl.1_Missense_Mutation_p.D174Y|ATP5A1_uc002lbs.1_Missense_Mutation_p.D174Y|ATP5A1_uc002lbt.1_Missense_Mutation_p.D224Y	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	224					ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						ATGATTGTGTCAATAGCAATT	0.284													22	75	---	---	---	---	PASS
C18orf32	497661	broad.mit.edu	37	18	47015778	47015778	+	5'Flank	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47015778T>C	uc002ldk.1	-						C18orf32_uc002ldl.2_5'Flank|C18orf32_uc002ldm.1_Missense_Mutation_p.K153R|RPL17_uc002ldn.2_Missense_Mutation_p.K115R|RPL17_uc002ldo.2_Missense_Mutation_p.K153R|RPL17_uc002ldp.2_Missense_Mutation_p.K153R|RPL17_uc002ldq.2_Missense_Mutation_p.K153R|RPL17_uc010xdg.1_Missense_Mutation_p.K115R|SNORD58C_uc002ldr.2_5'Flank	NM_001035005	NP_001030177	Q8TCD1	CR032_HUMAN	hypothetical protein LOC497661						positive regulation of I-kappaB kinase/NF-kappaB cascade		signal transducer activity				0						AATCTGTTCCTTTTCCGTAAG	0.448													6	235	---	---	---	---	PASS
LRRC8E	80131	broad.mit.edu	37	19	7964495	7964495	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7964495T>C	uc002mir.2	+	3	1189	c.1088T>C	c.(1087-1089)TTC>TCC	p.F363S		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	363						integral to membrane				lung(1)|pancreas(1)	2						AAGAATGACTTCGCCTTCATG	0.582													18	49	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533087	41533087	+	Intron	SNP	T	C	C	rs10426686	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533087T>C	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CAGAGCCTCCTTGACGGCATC	0.647													5	96	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533104	41533104	+	Intron	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533104G>A	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CATCATGTCCGCACAGCACCA	0.632													4	99	---	---	---	---	PASS
ZNF180	7733	broad.mit.edu	37	19	44982173	44982173	+	Silent	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44982173T>C	uc002ozf.3	-	5	807	c.525A>G	c.(523-525)GAA>GAG	p.E175E	ZNF180_uc002ozh.3_5'UTR|ZNF180_uc002ozi.3_Silent_p.E148E|ZNF180_uc002ozg.3_Silent_p.E174E|ZNF180_uc010ejm.2_Silent_p.E150E	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	175					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				TGAATGCCACTTCCTGCAAAA	0.408													4	63	---	---	---	---	PASS
KLK4	9622	broad.mit.edu	37	19	51413939	51413939	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51413939A>G	uc002pua.1	-	1	56	c.56T>C	c.(55-57)GTC>GCC	p.V19A	KLK4_uc002pty.1_5'Flank|KLK4_uc002ptz.1_5'Flank|KLK4_uc002pub.1_5'UTR|KLK4_uc002puc.1_RNA|KLK4_uc010eoi.1_5'Flank|KLK4_uc002pud.1_5'Flank	NM_004917	NP_004908	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4 preproprotein	19					proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		GATACCTGCGACACCAAGGAT	0.557													6	258	---	---	---	---	PASS
ZNF649	65251	broad.mit.edu	37	19	52395088	52395088	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52395088T>C	uc002pxy.2	-	5	569	c.301A>G	c.(301-303)ACG>GCG	p.T101A	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	101					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CGTTGTCCCGTCCTCTTCAGT	0.403													6	219	---	---	---	---	PASS
EPS8L1	54869	broad.mit.edu	37	19	55597327	55597327	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55597327C>T	uc002qis.3	+	15	1608	c.1504C>T	c.(1504-1506)CGG>TGG	p.R502W	EPS8L1_uc010ess.1_Missense_Mutation_p.R516W|EPS8L1_uc010yfr.1_Missense_Mutation_p.R438W|EPS8L1_uc010esu.1_RNA|EPS8L1_uc002qiu.2_Missense_Mutation_p.R375W|EPS8L1_uc002qiv.2_Missense_Mutation_p.R180W|EPS8L1_uc002qiw.2_Missense_Mutation_p.R281W	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	502	SH3.					cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGTCAAGCAGCGGGACGTACT	0.562													47	120	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56466258	56466258	+	Silent	SNP	C	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56466258C>T	uc002qmh.2	+	3	905	c.834C>T	c.(832-834)CCC>CCT	p.P278P	NLRP8_uc010etg.2_Silent_p.P278P	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	278	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGTCCAAACCCGACCAACTTC	0.522													5	131	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385654	58385654	+	Silent	SNP	A	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385654A>G	uc002qqo.2	-	3	1376	c.1104T>C	c.(1102-1104)AGT>AGC	p.S368S	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	368	C2H2-type 6.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						TCTGATGATTACTGAAGCTAA	0.363													5	201	---	---	---	---	PASS
SIRPG	55423	broad.mit.edu	37	20	1616066	1616066	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1616066A>T	uc002wfm.1	-	4	993	c.928T>A	c.(928-930)TGG>AGG	p.W310R	SIRPG_uc002wfn.1_Intron|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1	310	Extracellular (Potential).|Ig-like C1-type 2.				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						CAGCTTGTCCAGTTGTAGGTA	0.547													32	129	---	---	---	---	PASS
RGL4	266747	broad.mit.edu	37	22	24034361	24034361	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24034361G>T	uc002zxn.2	+	1	1314	c.144G>T	c.(142-144)CAG>CAT	p.Q48H	LOC91316_uc002zxh.3_RNA|LOC91316_uc002zxi.3_RNA|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron|RGL4_uc002zxo.2_Missense_Mutation_p.Q48H|RGL4_uc002zxp.1_Translation_Start_Site|RGL4_uc002zxq.2_Translation_Start_Site	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation	48					small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						TGTATGGCCAGGTCTGCCCCT	0.637													19	75	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83374987	83374987	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83374987G>A	uc004eej.1	-	9	772	c.695C>T	c.(694-696)TCA>TTA	p.S232L	RPS6KA6_uc011mqt.1_Missense_Mutation_p.S232L|RPS6KA6_uc011mqu.1_Missense_Mutation_p.S129L|RPS6KA6_uc010nmo.1_RNA	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	232	Protein kinase 1.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						ACCACAAAATGAGTAAGCCTT	0.373													5	61	---	---	---	---	PASS
TMEM201	199953	broad.mit.edu	37	1	9652075	9652076	+	Intron	DEL	CT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9652075_9652076delCT	uc001apz.2	+						TMEM201_uc001apy.2_Intron	NM_001130924	NP_001124396	Q5SNT2	TM201_HUMAN	transmembrane protein 201 isoform 1							integral to membrane|nuclear inner membrane					0	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GTGGTGCTTGCTTAACTGATGG	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18293097	18293098	+	IGR	INS	-	CTC	CTC	rs142027860	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18293097_18293098insCTC								ACTL8 (139541 upstream) : IGSF21 (141142 downstream)																							TGGGTGGCGTTCTCTGTGCAAC	0.332													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24062400	24062400	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24062400delA								RPL11 (39487 upstream) : TCEB3 (7456 downstream)																							cttcatctccaaaaaaaaaaa	0.224													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35717668	35717669	+	IGR	INS	-	AA	AA	rs141708068	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35717668_35717669insAA								SFPQ (58925 upstream) : ZMYM4 (16899 downstream)																							gtgataaacagaaaaaaaaaat	0.000													5	3	---	---	---	---	
NRD1	4898	broad.mit.edu	37	1	52282215	52282215	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52282215delG	uc001ctc.3	-						NRD1_uc009vzb.2_Intron|NRD1_uc001ctd.3_Intron|NRD1_uc001cte.2_Intron|NRD1_uc001ctf.2_Intron|NRD1_uc010ong.1_Intron|NRD1_uc009vzc.1_Intron	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a						cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						TTTAGTAGCAGGAAGATAAAA	0.274													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62544890	62544890	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62544890delC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron|hsa-mir-3116-2|MI0014129_5'Flank	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						TTTTATCTTTCCTCCCTTCCT	0.398													4	2	---	---	---	---	
ZRANB2	9406	broad.mit.edu	37	1	71536851	71536852	+	Intron	INS	-	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71536851_71536852insG	uc001dft.2	-						ZRANB2_uc001dfs.2_Intron	NM_203350	NP_976225	O95218	ZRAB2_HUMAN	zinc finger protein 265 isoform 1						mRNA processing|RNA splicing	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						tagagacttgacaactttgtct	0.010													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80719038	80719038	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80719038delA								None (None upstream) : None (None downstream)																							CAACCACATTAAAAAACAAAA	0.214													4	2	---	---	---	---	
C1orf52	148423	broad.mit.edu	37	1	85725354	85725360	+	5'UTR	DEL	CCGGAAA	-	-	rs112918702		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85725354_85725360delCCGGAAA	uc001dkv.2	-	1					C1orf52_uc001dkw.2_5'UTR|C1orf52_uc001dkx.3_5'UTR|C1orf52_uc009wcn.2_5'UTR	NM_198077	NP_932343	Q8N6N3	CA052_HUMAN	hypothetical protein LOC148423											ovary(1)	1				all cancers(265;0.0105)|Epithelial(280;0.0293)		CCGCCGGAAGCCGGAAACCGGAAACCG	0.671											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	6	---	---	---	---	
NTNG1	22854	broad.mit.edu	37	1	107715291	107715291	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107715291delT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTGACTATGCTTTTAAAAGTT	0.368													4	2	---	---	---	---	
KCNC4	3749	broad.mit.edu	37	1	110765294	110765294	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110765294delG	uc001dzh.2	+						KCNC4_uc001dzf.2_Intron|KCNC4_uc009wfr.2_Intron|KCNC4_uc001dzg.2_Intron|KCNC4_uc001dzi.2_Intron	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel						synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGTCAGAGGTGGGCAGAGCTA	0.284													4	2	---	---	---	---	
FAM46C	54855	broad.mit.edu	37	1	118152693	118152693	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118152693delT	uc001ehe.2	+							NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855												0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		CAGCCTTTTCTCTCTCTCTGT	0.502										Multiple Myeloma(3;1.13e-06)			4	2	---	---	---	---	
SPAG17	200162	broad.mit.edu	37	1	118498194	118498195	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118498194_118498195insT	uc001ehk.2	-						WDR3_uc001ehi.2_Intron|WDR3_uc010oxe.1_Intron	NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		gcttttaaggacaaataaaggg	0.099													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145579573	145579573	+	Intron	DEL	T	-	-	rs66680279		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145579573delT	uc001emp.3	+						PIAS3_uc010oyy.1_Intron|PIAS3_uc001eoc.1_Intron|PIAS3_uc001eod.1_5'Flank	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ttcttttttgttttttttttt	0.189													4	2	---	---	---	---	
TUFT1	7286	broad.mit.edu	37	1	151553160	151553160	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151553160delG	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512	Q9NNX1	TUFT1_HUMAN	tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			aaaaaaaaaagaaCTGTATGT	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156666770	156666770	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156666770delA								NES (19581 upstream) : CRABP2 (2640 downstream)																							tacccccttcaaaaatccttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	175891380	175891380	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175891380delC								TNR (178628 upstream) : RFWD2 (22587 downstream)																							ACAACAACAACaaaaaagtgt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213028506	213028516	+	IGR	DEL	CAAGCTCAGTG	-	-	rs67975633		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213028506_213028516delCAAGCTCAGTG								C1orf227 (7515 upstream) : LQK1 (1431 downstream)																							AGTGAGCAGCCAAGCTCAGTGCAACCTCCAG	0.531													4	2	---	---	---	---	
IARS2	55699	broad.mit.edu	37	1	220315525	220315525	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220315525delT	uc001hmc.2	+						IARS2_uc001hmd.2_Intron	NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	AGAAATCACCTTTTTTCTTAA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236121183	236121183	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236121183delT								LYST (74243 upstream) : NID1 (17958 downstream)																							AGCGCTAACCTTTTTTTTTTG	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248570551	248570552	+	IGR	INS	-	GAGT	GAGT	rs77025916		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570551_248570552insGAGT								OR2T1 (147 upstream) : OR2T2 (45547 downstream)																							tcataactccatagttatgatg	0.124													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248570553	248570554	+	IGR	INS	-	T	T	rs146850247	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570553_248570554insT								OR2T1 (149 upstream) : OR2T2 (45545 downstream)																							ataactccatagttatgatgtt	0.119													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	249240214	249240217	+	IGR	DEL	AGGG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249240214_249240217delAGGG								PGBD2 (26870 upstream) : None (None downstream)																							ggttagggttagggtagggttagg	0.000													4	2	---	---	---	---	
PQLC3	130814	broad.mit.edu	37	2	11318225	11318235	+	3'UTR	DEL	CCATTTTGAGG	-	-	rs3832137		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11318225_11318235delCCATTTTGAGG	uc002rbc.2	+	7					PQLC3_uc010yjk.1_3'UTR	NM_152391	NP_689604	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3 precursor							integral to membrane					0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		TCCAAGAAGCCCATTTTGAGGCCATTTTGAG	0.412													3	4	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26152486	26152486	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26152486delT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATAGGCTCttttttttttt	0.294													9	4	---	---	---	---	
C2orf39	92749	broad.mit.edu	37	2	26646887	26646888	+	Intron	DEL	TG	-	-	rs67134348		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26646887_26646888delTG	uc002rhg.2	+						C2orf39_uc010eym.1_Intron	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					cgcgtgtgtatgtgtgtgtgtg	0.243													4	2	---	---	---	---	
CAPN14	440854	broad.mit.edu	37	2	31410299	31410300	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31410299_31410300insA	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594	A8MX76	CAN14_HUMAN	calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						CACCCCCCACCCCCTGTCCCAC	0.540													4	2	---	---	---	---	
CAPN14	440854	broad.mit.edu	37	2	31410300	31410301	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31410300_31410301insA	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594	A8MX76	CAN14_HUMAN	calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						ACCCCCCACCCCCTGTCCCACT	0.545													4	2	---	---	---	---	
TTC27	55622	broad.mit.edu	37	2	32892037	32892037	+	Intron	DEL	T	-	-	rs66516618		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32892037delT	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1						AAAACTGGTGTTTTTTTTTTC	0.308													4	3	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42867708	42867708	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42867708delG	uc002rso.1	+						MTA3_uc002rsp.1_Intron|MTA3_uc002rsq.2_Intron|MTA3_uc002rsr.2_Intron	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TTTTGTTTTTGTTTTTATTTC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	46425452	46425452	+	IGR	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46425452delG								PRKCE (10324 upstream) : EPAS1 (99111 downstream)																							tctccttcctgcctcagcttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801333	91801334	+	IGR	INS	-	C	C	rs147402585		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801333_91801334insC								None (None upstream) : LOC654342 (3858 downstream)																							gttcatgactaccattagctcc	0.000													4	2	---	---	---	---	
PROM2	150696	broad.mit.edu	37	2	95944215	95944215	+	Intron	DEL	G	-	-	rs115610809	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95944215delG	uc002suh.1	+						PROM2_uc002sui.2_Intron|PROM2_uc002suj.2_Intron|PROM2_uc002suk.2_Intron|PROM2_uc002sul.2_5'UTR	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor							apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						GCAGTTGTGTGGAGGGCGGCT	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96592948	96592949	+	Intron	INS	-	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96592948_96592949insC	uc002sva.1	-						uc002svc.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		ATTAAATGTGTTTTGCAAAATT	0.282													4	2	---	---	---	---	
ANKRD36B	57730	broad.mit.edu	37	2	98162491	98162492	+	Intron	INS	-	AAGC	AAGC			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98162491_98162492insAAGC	uc010yvc.1	-							NM_025190	NP_079466	Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B												0						AATACACTGAAAAAAGGGAATA	0.381													4	2	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100081650	100081651	+	Intron	DEL	AT	-	-	rs28369940		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100081650_100081651delAT	uc002tad.2	-						REV1_uc002tac.2_Intron|REV1_uc002tae.1_5'Flank	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						CCTCCTACACATGTTTAAATTG	0.297								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					8	4	---	---	---	---	
SEPT10	151011	broad.mit.edu	37	2	110350356	110350356	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110350356delA	uc002tew.2	-						SEPT10_uc010ywu.1_Intron|SEPT10_uc002tex.2_Intron|SEPT10_uc002tey.2_Intron|SEPT10_uc010ywv.1_Intron	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1						cell cycle|cell division	septin complex	GTP binding				0						gactctgtctaaaaaaaaaaa	0.090													2	4	---	---	---	---	
LOC150776	150776	broad.mit.edu	37	2	132273427	132273431	+	5'Flank	DEL	GAGTC	-	-	rs147707520		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132273427_132273431delGAGTC	uc002tsz.3	+						LOC150776_uc010zaz.1_Intron|LOC150776_uc010fna.2_Intron|LOC150776_uc002tsy.3_Intron					Homo sapiens cDNA FLJ41352 fis, clone BRAWH2014645.												0						AGGGTGAGGGGAGTCCCTTTCTGTT	0.654													11	6	---	---	---	---	
PRKRA	8575	broad.mit.edu	37	2	179306614	179306614	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179306614delC	uc002umf.2	-						PRKRA_uc002umc.2_Intron|PRKRA_uc002umd.2_Intron|PRKRA_uc002ume.2_Intron|PRKRA_uc002umg.2_Intron	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			GCTATTAAttctttttttttt	0.139													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179631532	179631532	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179631532delT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_5'Flank|TTN_uc002unb.2_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACATAAACTTCTCTTGTAG	0.338													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													2	13	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													2	13	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198318518	198318518	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198318518delT	uc002uuh.1	+						COQ10B_uc010fsl.1_5'Flank	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGGAGAAGGCTTTTTTTTGCG	0.562													6	3	---	---	---	---	
INO80D	54891	broad.mit.edu	37	2	206874082	206874083	+	Intron	INS	-	A	A	rs144079921	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206874082_206874083insA	uc002vaz.3	-							NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D						DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						AAGTCAGTTTCGCGTCTGTTCT	0.203													3	3	---	---	---	---	
WDFY1	57590	broad.mit.edu	37	2	224770386	224770386	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224770386delG	uc002vnq.2	-							NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1							cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		tgtaTGAAGAGTAGTGTGTGT	0.144													8	5	---	---	---	---	
CUL3	8452	broad.mit.edu	37	2	225364873	225364874	+	Intron	DEL	TC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225364873_225364874delTC	uc002vny.2	-						CUL3_uc010zls.1_Intron|CUL3_uc010fwy.1_Intron|CUL3_uc002vnz.1_Intron	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AAACAATCTTTCTAGAGATAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233377511	233377512	+	IGR	INS	-	TG	TG	rs139297672	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233377511_233377512insTG								ECEL1 (24979 upstream) : CHRND (13410 downstream)																							gtgcgtgtgtatgtgtgtgtgt	0.401													4	5	---	---	---	---	
NEK10	152110	broad.mit.edu	37	3	27157891	27157892	+	Intron	DEL	GT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27157891_27157892delGT	uc010hfk.2	-						NEK10_uc010hfj.2_Intron			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;								ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						AAAGTTAGAGGTGTGTGTGTGT	0.401													4	2	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37360894	37360894	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37360894delT	uc003cgv.2	+						GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ACACACtttcttttttttatg	0.179													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51347313	51347314	+	Intron	DEL	CC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51347313_51347314delCC	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AGGGGCCATGCCCCAGAAAATG	0.416													4	2	---	---	---	---	
RAD54L2	23132	broad.mit.edu	37	3	51620448	51620448	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51620448delT	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GTTGCCTTTGTTTTTTTTTTT	0.209													3	4	---	---	---	---	
ITIH4	3700	broad.mit.edu	37	3	52856900	52856900	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52856900delA	uc003dfz.2	-						ITIH4_uc011bel.1_Intron|ITIH4_uc003dfy.2_Intron|ITIH4_uc011bem.1_Intron|ITIH4_uc011ben.1_Intron	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4						acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ctcctccaggaagccctccct	0.000													4	2	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	55886563	55886563	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55886563delT	uc003dhr.1	-						ERC2_uc003dhq.1_Intron|ERC2_uc003dht.1_Intron	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TACAAGGGaattttttaaatt	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72360983	72360983	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72360983delT								PROK2 (526626 upstream) : RYBP (62768 downstream)																							CCCATGATGATTTTTTTTGCT	0.403													4	2	---	---	---	---	
WDR52	55779	broad.mit.edu	37	3	113120684	113120685	+	Intron	INS	-	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113120684_113120685insC	uc003eae.1	-							NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2											central_nervous_system(1)	1						AAAAGTCATTTCTTTTTCTTTC	0.302													4	3	---	---	---	---	
NMNAT3	349565	broad.mit.edu	37	3	139292815	139292815	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139292815delA	uc003etj.2	-						NMNAT3_uc003etk.2_Intron|NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						AATATTTCTCAAAAAAAAAAG	0.194													4	3	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168830318	168830318	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168830318delA	uc003ffi.3	-						MECOM_uc010hwk.1_Intron|MECOM_uc003ffj.3_Intron|MECOM_uc011bpi.1_Intron|MECOM_uc003ffn.3_Intron|MECOM_uc003ffk.2_Intron|MECOM_uc003ffl.2_Intron|MECOM_uc011bpj.1_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TGCTCACTCCAAAATGCACTT	0.308													4	2	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169846305	169846305	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169846305delT	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AACAATGGCATTTTTTTTTTT	0.303													3	3	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186038536	186038536	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186038536delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGAGAATGTTAAAAAAAAAAG	0.398													5	3	---	---	---	---	
ZNF141	7700	broad.mit.edu	37	4	368319	368319	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:368319delA	uc003gab.2	+							NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						CATTCTGGGGAAAAAAATGCT	0.373													4	2	---	---	---	---	
STK32B	55351	broad.mit.edu	37	4	5194199	5194201	+	Intron	DEL	GCT	-	-	rs62290536	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5194199_5194201delGCT	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						ACACACACACGCTACAGAAAGTC	0.340													4	2	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79390990	79390991	+	Intron	INS	-	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79390990_79390991insG	uc003hlb.2	+							NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAGGATGATAAGGGATGGGAAC	0.416													4	2	---	---	---	---	
PRKG2	5593	broad.mit.edu	37	4	82095750	82095750	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82095750delT	uc003hmh.2	-						PRKG2_uc011cch.1_Intron	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II						platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						atagaaattattcagcacata	0.104													4	2	---	---	---	---	
ARHGAP24	83478	broad.mit.edu	37	4	86491519	86491519	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86491519delC	uc003hpk.2	+						ARHGAP24_uc003hpi.1_Intron|ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		ctttctttctctttctttctt	0.149													4	2	---	---	---	---	
ARHGAP24	83478	broad.mit.edu	37	4	86491528	86491528	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86491528delT	uc003hpk.2	+						ARHGAP24_uc003hpi.1_Intron|ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		tctttctttctttctttcttt	0.129													3	3	---	---	---	---	
PLK4	10733	broad.mit.edu	37	4	128819987	128819987	+	3'UTR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128819987delA	uc003ifo.2	+	16					PLK4_uc011cgs.1_3'UTR|PLK4_uc011cgt.1_3'UTR	NM_014264	NP_055079	O00444	PLK4_HUMAN	polo-like kinase 4						G2/M transition of mitotic cell cycle|positive regulation of centriole replication|trophoblast giant cell differentiation	centriole|cleavage furrow|cytosol|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						GCAAAAATGTAAATGATGTGT	0.328													4	2	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186242257	186242258	+	Intron	DEL	AT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186242257_186242258delAT	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGAGATTGAATTTAGTTTTGG	0.292													4	2	---	---	---	---	
PDLIM3	27295	broad.mit.edu	37	4	186423169	186423169	+	3'UTR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186423169delA	uc003ixw.3	-	8					PDLIM3_uc003ixx.3_3'UTR|PDLIM3_uc010isi.2_RNA	NM_014476	NP_055291	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain protein 3 isoform a							sarcomere	zinc ion binding			ovary(2)	2		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		ATATACATGTAAATTGTGGAG	0.303													4	2	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186556308	186556308	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186556308delC	uc003iyl.2	-						SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Intron|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Intron|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TGATTCTTCACCCAGAGTCCA	0.343													6	3	---	---	---	---	
AHRR	57491	broad.mit.edu	37	5	345057	345058	+	Intron	DEL	GG	-	-	rs116563511	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:345057_345058delGG	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_Intron	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			agctgtgtgtggggggggtgtg	0.064													4	3	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1052736	1052740	+	Intron	DEL	GAGCA	-	-	rs142533833		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1052736_1052740delGAGCA	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGGCGGGGAGGAGCAGGGCAGGGGA	0.605													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1381426	1381426	+	5'Flank	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1381426delG	uc003jci.1	-						uc003jcj.1_5'Flank					Homo sapiens cDNA clone IMAGE:4830758.																		TGCTTCCCCTGTGCGCTTCTC	0.512													4	2	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7678454	7678455	+	Intron	DEL	TG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7678454_7678455delTG	uc003jdz.1	+						ADCY2_uc011cmo.1_Intron	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CGCTTGGACTTGTACCTACAGA	0.436													4	2	---	---	---	---	
LHFPL2	10184	broad.mit.edu	37	5	77940319	77940319	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77940319delG	uc003kfo.2	-						LHFPL2_uc003kfp.1_5'Flank	NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		ATGGTAGGCCGGGATGTTCTG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	111780617	111780617	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111780617delA								FLJ11235 (23944 upstream) : APC (262601 downstream)																							ctctgaatctacttcctctga	0.000													4	2	---	---	---	---	
PRDM6	93166	broad.mit.edu	37	5	122425712	122425712	+	Frame_Shift_Del	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122425712delG	uc003kti.2	+	2	392	c.3delG	c.(1-3)ATGfs	p.M1fs	PRDM6_uc003ktj.2_RNA	NM_001136239	NP_001129711	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	1					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding				0						CGCCGGACATGCTGAAGCCCG	0.692													4	2	---	---	---	---	
NDFIP1	80762	broad.mit.edu	37	5	141523853	141523854	+	Intron	INS	-	TA	TA			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141523853_141523854insTA	uc003lmi.3	+						NDFIP1_uc003lmj.1_Intron	NM_030571	NP_085048	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis|negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endosome membrane|extracellular region|Golgi membrane|integral to membrane|perinuclear region of cytoplasm	signal transducer activity				0		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAATGAGGCTTTCATATGTAAA	0.267													3	3	---	---	---	---	
NDFIP1	80762	broad.mit.edu	37	5	141523856	141523857	+	Intron	INS	-	AT	AT			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141523856_141523857insAT	uc003lmi.3	+						NDFIP1_uc003lmj.1_Intron	NM_030571	NP_085048	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis|negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endosome membrane|extracellular region|Golgi membrane|integral to membrane|perinuclear region of cytoplasm	signal transducer activity				0		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGGCTTTCATATGTAAATGT	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	149808859	149808860	+	IGR	DEL	TC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149808859_149808860delTC								CD74 (16527 upstream) : RPS14 (14934 downstream)																							GTGGGGTTGGTCTCTGGTGGGG	0.609													4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170672134	170672134	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170672134delA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ctctgtctccaaaaaaaaaag	0.000			T	TRD@	ALL								4	2	---	---	---	---	
CDHR2	54825	broad.mit.edu	37	5	176018774	176018776	+	Intron	DEL	TGG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176018774_176018776delTGG	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						atgatgacgatggtggtggtggt	0.010													3	3	---	---	---	---	
EIF4E1B	253314	broad.mit.edu	37	5	176071977	176071978	+	Intron	INS	-	G	G			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176071977_176071978insG	uc010jkf.1	+						TSPAN17_uc003mes.3_5'Flank|TSPAN17_uc003met.2_5'Flank|TSPAN17_uc003meu.2_5'Flank|TSPAN17_uc003mev.2_5'Flank|TSPAN17_uc003mew.2_5'Flank	NM_001099408	NP_001092878	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTGAGTGGCTGGGGGTGGAAC	0.535													4	2	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176722543	176722543	+	3'UTR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176722543delA	uc003mfr.3	+	23					NSD1_uc003mft.3_3'UTR|NSD1_uc011dfx.1_3'UTR	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTTCCCCCTTAAAAAAAAACA	0.443			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			5	3	---	---	---	---	
ATXN1	6310	broad.mit.edu	37	6	16669637	16669637	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16669637delT	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ACCACAAAGGTGGGGGAAAGG	0.393													4	2	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35927057	35927057	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35927057delT	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						ATCTTGTGCCTTTTTTTTTTC	0.413													8	4	---	---	---	---	
ZNF451	26036	broad.mit.edu	37	6	57016783	57016784	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57016783_57016784insA	uc003pdm.1	+						ZNF451_uc003pdl.2_Intron|ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTGATTTTGCCTAATATCCATG	0.356													6	3	---	---	---	---	
ZNF451	26036	broad.mit.edu	37	6	57016785	57016786	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57016785_57016786insT	uc003pdm.1	+						ZNF451_uc003pdl.2_Intron|ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GATTTTGCCTAATATCCATGTG	0.361													5	4	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65767270	65767273	+	Intron	DEL	GGTG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65767270_65767273delGGTG	uc011dxu.1	-							NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TGGTTTCATTGGTGACCTTTCAAA	0.275													3	4	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123868673	123868673	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123868673delG	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|TRDN_uc010keo.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CAGTTTTTAAGTATAAAGTTT	0.219													4	2	---	---	---	---	
L3MBTL3	84456	broad.mit.edu	37	6	130387432	130387433	+	Intron	DEL	TA	-	-	rs66543366		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130387432_130387433delTA	uc003qbt.2	+						L3MBTL3_uc003qbu.2_Intron	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		tatttttgtgtatatatatata	0.257													4	2	---	---	---	---	
ENPP3	5169	broad.mit.edu	37	6	131992164	131992165	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131992164_131992165insA	uc003qcu.3	+						ENPP3_uc010kfn.1_Intron|ENPP3_uc011ecc.1_Intron|ENPP3_uc010kfo.1_Intron|ENPP3_uc010kfp.1_Intron|ENPP3_uc010kfq.2_Intron|ENPP3_uc003qcv.2_Intron	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ggctcttccagaaaaaAATCTA	0.198													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152460890	152460890	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152460890delA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		gaaagaaaagaaaaaaaagaa	0.189										HNSCC(10;0.0054)			6	3	---	---	---	---	
RBM16	22828	broad.mit.edu	37	6	155153061	155153062	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155153061_155153062insT	uc003qqa.2	+						TIAM2_uc003qqb.2_5'Flank|RBM16_uc011efj.1_Intron|RBM16_uc011efk.1_Intron|RBM16_uc003qpz.2_Intron|RBM16_uc010kji.2_Intron	NM_014892	NP_055707	Q9UPN6	SCAF8_HUMAN	RNA-binding motif protein 16						mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)		TTCTCTCTCTCTTTTTTTTTAG	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169719614	169719614	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169719614delC								THBS2 (65477 upstream) : WDR27 (137693 downstream)																							ACCTGCTCAACCCCAGGTTTG	0.512													4	2	---	---	---	---	
CYP2W1	54905	broad.mit.edu	37	7	1023995	1023996	+	Intron	INS	-	G	G	rs140406976	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1023995_1023996insG	uc003sjq.1	+						CYP2W1_uc003sjr.1_Intron	NM_017781	NP_060251	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W,						xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		AGGGGACCTAAGGGGGGTCTTG	0.678													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	7601192	7601192	+	IGR	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7601192delG								COL28A1 (25732 upstream) : MIOS (5424 downstream)																							actcctcaaagacctaaaaac	0.000													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47588189	47588189	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47588189delT	uc003tnw.2	-							NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						ccccgtgccctacctcactgg	0.000													4	2	---	---	---	---	
KRIT1	889	broad.mit.edu	37	7	91865513	91865514	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91865513_91865514insA	uc003ulq.1	-						KRIT1_uc010lev.1_5'UTR|KRIT1_uc003ulr.1_Intron|KRIT1_uc003uls.1_Intron|KRIT1_uc003ult.1_Intron|KRIT1_uc003ulu.1_Intron|KRIT1_uc003ulv.1_Intron	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1						angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGTTTACCATTTCTGAAAAATA	0.267									Familial_Cerebral_Cavernous_Angioma				4	4	---	---	---	---	
CYP3A5	1577	broad.mit.edu	37	7	99263087	99263088	+	Intron	DEL	CT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99263087_99263088delCT	uc003urq.2	-						ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_Intron|CYP3A5_uc003urr.2_Intron|CYP3A5_uc011kiy.1_Intron|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000777	NP_000768	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A,						alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	CATCTACTCCCTCAGAAGGTGG	0.351													4	2	---	---	---	---	
SPAM1	6677	broad.mit.edu	37	7	123594822	123594822	+	Intron	DEL	T	-	-	rs79082445		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594822delT	uc003vld.2	+						SPAM1_uc003vle.2_Intron|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Intron|SPAM1_uc010lku.2_Intron	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2						binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	ACTCAGTTTCTTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	138912151	138912151	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138912151delC								TTC26 (37601 upstream) : UBN2 (4080 downstream)																							caaatatgttcctaaaaaagt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	144711991	144711992	+	IGR	DEL	AC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144711991_144711992delAC								TPK1 (178845 upstream) : None (None downstream)																							TGATGTGGTGACATGGTGACTC	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148964886	148964887	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964886_148964887insA	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		agacttcatctaaaaaaaaaaa	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8538928	8538931	+	IGR	DEL	AAAG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8538928_8538931delAAAG								SGK223 (299671 upstream) : CLDN23 (20735 downstream)																							GATCTGGGCCAAAGAAAGAAAGAA	0.559													4	2	---	---	---	---	
C8orf79	57604	broad.mit.edu	37	8	12870490	12870490	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12870490delA	uc010lsq.2	+						C8orf79_uc011kxw.1_Intron|C8orf79_uc003wwj.3_Intron|C8orf79_uc010lsr.2_Intron	NM_020844	NP_065895	Q9P272	K1456_HUMAN	hypothetical protein LOC57604 isoform 1								methyltransferase activity				0						tatctaatttaaaaaaattGT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21313949	21313949	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21313949delT								None (None upstream) : GFRA2 (235581 downstream)																							GGCGAGATCCttttttttttt	0.388													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48676524	48676525	+	Intron	DEL	AT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48676524_48676525delAT	uc003xqg.1	+									Q14159	K0146_HUMAN	Homo sapiens cDNA FLJ38459 fis, clone FEBRA2020566.												0		Lung NSC(58;0.175)				gatgtgtgtgatgtgtgtgtgg	0.000													3	3	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48676534	48676537	+	Intron	DEL	GGTG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48676534_48676537delGGTG	uc003xqg.1	+									Q14159	K0146_HUMAN	Homo sapiens cDNA FLJ38459 fis, clone FEBRA2020566.												0		Lung NSC(58;0.175)				atgtgtgtgtggtgtgtgtgtgat	0.000													3	3	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72982042	72982042	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72982042delA	uc003xza.2	-							NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	agagagagagaagagaacgag	0.129													4	2	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95840262	95840262	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95840262delT	uc003yhb.2	+						INTS8_uc003yha.1_Intron|INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_5'Flank	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					AGCAGTCAAGttttttttttt	0.224													3	4	---	---	---	---	
EBAG9	9166	broad.mit.edu	37	8	110565856	110565857	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110565856_110565857insA	uc003ynf.2	+						EBAG9_uc010mcn.1_Intron|EBAG9_uc003yng.2_Intron	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated						apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			GTTTATAATTCTGAGTCCTAAG	0.252													4	2	---	---	---	---	
KCNK9	51305	broad.mit.edu	37	8	140712181	140712182	+	Intron	DEL	AG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140712181_140712182delAG	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			GCTCAAGGTTAGATTAAAAATC	0.480													4	2	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	741986	741986	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:741986delA	uc003zgl.1	+						KANK1_uc003zgn.1_Intron|KANK1_uc003zgs.1_Intron|KANK1_uc010mgx.1_Intron|KANK1_uc010mgy.1_Intron|KANK1_uc003zgt.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CCTCCACGCTAAAATGAAGTT	0.418													4	2	---	---	---	---	
PLAA	9373	broad.mit.edu	37	9	26906080	26906080	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26906080delA	uc003zqd.2	-							NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		AATATCTATTAAAAAAAAAAA	0.328													5	3	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32472759	32472760	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32472759_32472760insT	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ACACATATACAACacacacctc	0.069													4	2	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32472775	32472776	+	Intron	INS	-	TTCT	TTCT			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32472775_32472776insTTCT	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		cacctctcatatatatgtataa	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	39768198	39768199	+	IGR	DEL	AG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39768198_39768199delAG								LOC653501 (259310 upstream) : FAM74A1 (132001 downstream)																							TATTATTATTAGAAACATACCC	0.381													4	2	---	---	---	---	
AQP7P1	375719	broad.mit.edu	37	9	67273773	67273774	+	Intron	INS	-	A	A	rs149463181	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67273773_67273774insA	uc004aem.1	-						AQP7P1_uc004aen.1_Intron|AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens aquaporin 7 pseudogene 1, mRNA (cDNA clone IMAGE:6191443).												0						gaggaacacagaggcgatggct	0.153													6	3	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74344537	74344537	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74344537delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ctgtctcgagaaaaaaaaaaa	0.134													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	86821334	86821334	+	IGR	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86821334delG								RMI1 (202352 upstream) : SLC28A3 (71758 downstream)																							gggggtggttgggggggtgtg	0.000													5	4	---	---	---	---	
CORO2A	7464	broad.mit.edu	37	9	100894116	100894116	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100894116delC	uc004ayl.2	-						CORO2A_uc004aym.2_Intron	NM_003389	NP_003380	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A						actin cytoskeleton organization|intracellular signal transduction	actin cytoskeleton|transcriptional repressor complex	actin filament binding			skin(2)|ovary(1)|pancreas(1)	4		Acute lymphoblastic leukemia(62;0.0559)				AGCTCCTTCTCCCCATACCCG	0.557													4	2	---	---	---	---	
LMX1B	4010	broad.mit.edu	37	9	129374341	129374342	+	5'Flank	DEL	AC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129374341_129374342delAC	uc004bqj.2	+						LMX1B_uc004bqi.2_5'Flank|LMX1B_uc011maa.1_5'Flank	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta						dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						Ccacacacaaacacacacacac	0.465									Nail-Patella_Syndrome		OREG0019495	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
FNBP1	23048	broad.mit.edu	37	9	132673126	132673127	+	Intron	INS	-	TG	TG	rs142696317	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132673126_132673127insTG	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc011mbu.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TGACTCTCTAAtgtgtgtgtgt	0.342			T	MLL	AML								3	6	---	---	---	---	
C9orf98	158067	broad.mit.edu	37	9	135750762	135750763	+	Intron	INS	-	G	G	rs138418096	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135750762_135750763insG	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron|C9orf9_uc004cbx.1_5'Flank	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		CAGAGGCATGAGGGGGGCCACG	0.619													26	15	---	---	---	---	
BRD3	8019	broad.mit.edu	37	9	136898971	136899008	+	Intron	DEL	TTGAAATTAATCAGGTCAACAAGACTATCTGAATATAC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136898971_136899008delTTGAAATTAATCAGGTCAACAAGACTATCTGAATATAC	uc004cew.2	-							NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		TAAGTATTTATTGAAATTAATCAGGTCAACAAGACTATCTGAATATACTTGAGACAGG	0.466			T	NUT|C15orf55	lethal midline carcinoma of young people								8	6	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138676329	138676348	+	Intron	DEL	CTCCCTCCCTCCCTCCCTCC	-	-	rs11268164		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138676329_138676348delCTCCCTCCCTCCCTCCCTCC	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron|KCNT1_uc004cgo.1_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CTCACTGTGGctccctccctccctccctccctccctccct	0.523													6	4	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140681665	140681665	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140681665delA	uc011mfc.1	+						EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ATCTCTCATTAAAAAAAAATG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8662653	8662653	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8662653delA								GATA3 (545491 upstream) : None (None downstream)																							TCCTAGTAAGAAAATAACCCA	0.368													4	2	---	---	---	---	
CDC123	8872	broad.mit.edu	37	10	12280124	12280124	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12280124delC	uc001ill.2	+						CDC123_uc001ilm.2_Intron	NM_006023	NP_006014	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest|cell division|positive regulation of cell proliferation|regulation of mitotic cell cycle	cytoplasm				central_nervous_system(1)	1						GTGATTGATGCCCGTTTCACT	0.373													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24554876	24554877	+	Intron	INS	-	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24554876_24554877insC	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						ACTCTAGATTTCCCTTTAAAGG	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	25989441	25989441	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25989441delT	uc001isl.1	+											Homo sapiens cDNA FLJ41446 fis, clone BRSTN2003590.																		gcccggccCATTTGTGCAATG	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34153550	34153550	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34153550delA								NRP1 (529544 upstream) : PARD3 (246548 downstream)																							GGGTCATATTAAAAAAAATAA	0.423													4	2	---	---	---	---	
ANXA8L2	244	broad.mit.edu	37	10	47744741	47744743	+	5'Flank	DEL	CAA	-	-	rs149005438	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47744741_47744743delCAA	uc001jem.2	+						ANXA8L2_uc009xnh.1_5'Flank|ANXA8L2_uc010qgb.1_5'Flank|ANXA8L2_uc001jen.2_5'Flank|ANXA8L2_uc001jeo.1_5'Flank	NM_001630	NP_001621	Q5VT79	AXA82_HUMAN	annexin A8L2								calcium ion binding|calcium-dependent phospholipid binding			pancreas(1)	1						ACCCATGCAGCAAAAAGTCTGGA	0.483													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55948945	55948945	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55948945delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ctttaaaatatttttaaattt	0.199										HNSCC(58;0.16)			4	2	---	---	---	---	
SGPL1	8879	broad.mit.edu	37	10	72628413	72628414	+	Intron	DEL	CC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72628413_72628414delCC	uc001jrm.2	+						SGPL1_uc009xqk.2_5'Flank	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1						apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	TCCCGCCCCACCCCCAGATCAT	0.396													4	2	---	---	---	---	
DLG5	9231	broad.mit.edu	37	10	79603069	79603069	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79603069delA	uc001jzk.2	-						DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_Intron|DLG5_uc001jzl.3_5'Flank	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			ATTCAGTGTCAAAAAAAAATG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85841305	85841305	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85841305delA								None (None upstream) : GHITM (57880 downstream)																							GCCCAAGCCTAAAAATGCCCC	0.373													4	2	---	---	---	---	
SFXN2	118980	broad.mit.edu	37	10	104496011	104496011	+	Intron	DEL	T	-	-	rs11298009		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104496011delT	uc001kwb.2	+						SFXN2_uc001kwc.2_Intron|SFXN2_uc001kwd.2_Intron	NM_178858	NP_849189	Q96NB2	SFXN2_HUMAN	sideroflexin 2						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity				0		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GGTTTTTAACttttttttttt	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262667	130262667	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262667delC								MKI67 (338199 upstream) : None (None downstream)																							tcctcctcctccaccatcctc	0.119													4	2	---	---	---	---	
ECHS1	1892	broad.mit.edu	37	10	135186665	135186665	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135186665delG	uc001lmu.2	-							NM_004092	NP_004083	P30084	ECHM_HUMAN	mitochondrial short-chain enoyl-coenzyme A						fatty acid beta-oxidation	mitochondrial matrix	enoyl-CoA hydratase activity|protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		TCAGGTGGGAGGGGGGTGCGG	0.617													5	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1989801	1989803	+	IGR	DEL	TGC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1989801_1989803delTGC								MRPL23 (11964 upstream) : LOC100133545 (14637 downstream)																							GCTGTGGGGATGCAAGGGCAGGC	0.690													4	2	---	---	---	---	
CARS	833	broad.mit.edu	37	11	3065966	3065967	+	Intron	DEL	GA	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3065966_3065967delGA	uc001lxh.2	-						CARS_uc001lxe.2_Intron|CARS_uc001lxf.2_Intron|CARS_uc001lxg.2_Intron|CARS_uc010qxo.1_Intron|CARS_uc010qxp.1_Intron	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b						cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CACATTCGTTGATTCCAGAGTC	0.322			T	ALK	ALCL								4	2	---	---	---	---	
PPFIBP2	8495	broad.mit.edu	37	11	7625792	7625793	+	Intron	DEL	CA	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7625792_7625793delCA	uc001mfj.3	+						PPFIBP2_uc010rbb.1_Intron|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Intron|PPFIBP2_uc010rbd.1_Intron|PPFIBP2_uc010rbe.1_Intron|PPFIBP2_uc001mfl.3_5'Flank	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		acacacaccccacacacacacC	0.248													4	2	---	---	---	---	
FERMT3	83706	broad.mit.edu	37	11	63990997	63990997	+	3'UTR	DEL	C	-	-	rs34304595		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63990997delC	uc001nyl.2	+	15					FERMT3_uc001nym.2_3'UTR|NUDT22_uc009ypd.2_5'Flank|NUDT22_uc001nyp.3_5'Flank|NUDT22_uc009ype.2_5'Flank|NUDT22_uc001nyq.3_5'Flank	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form						integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						CTGCTCACCACCCTGTCACAG	0.662													11	9	---	---	---	---	
MTL5	9633	broad.mit.edu	37	11	68485067	68485067	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68485067delG	uc001ooc.2	-							NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform						cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			CGAGAGAACTGGCGTGGCAGA	0.408													4	2	---	---	---	---	
LRTOMT	220074	broad.mit.edu	37	11	71820659	71820659	+	3'UTR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71820659delA	uc010rqv.1	+	9					LRTOMT_uc010rqw.1_3'UTR|LRTOMT_uc001ors.3_3'UTR|C11orf51_uc009ytc.1_Intron|C11orf51_uc001orv.2_3'UTR|C11orf51_uc001orw.2_3'UTR	NM_001145309	NP_001138781	Q96E66	LRC51_HUMAN	leucine rich transmembrane and							cytoplasm					0						TGTCTTTATTAAAGAAACTTA	0.502													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78443807	78443807	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78443807delT	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TAGAAAGCAGTTTTTTTTTAC	0.398													4	2	---	---	---	---	
CTSC	1075	broad.mit.edu	37	11	88035225	88035226	+	Intron	DEL	CT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88035225_88035226delCT	uc001pck.3	-						CTSC_uc001pcl.3_Intron	NM_001814	NP_001805	P53634	CATC_HUMAN	cathepsin C isoform a preproprotein						immune response	lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACTCACTTCCTCTCTCTCTCT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89804293	89804294	+	IGR	DEL	TC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89804293_89804294delTC								TRIM64 (97055 upstream) : UBTFL1 (14824 downstream)																							GGAGTCGTTTTCTCTCTCTCTC	0.292													11	5	---	---	---	---	
RDX	5962	broad.mit.edu	37	11	110135839	110135840	+	Intron	INS	-	G	G	rs12576698		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110135839_110135840insG	uc001pku.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		tttttgttttttttttttttgt	0.079													4	3	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118241926	118241927	+	Intron	DEL	AG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118241926_118241927delAG	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CACACAGAATAGTAGATTTCAC	0.248													4	2	---	---	---	---	
RASSF8	11228	broad.mit.edu	37	12	26216131	26216131	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26216131delT	uc001rgx.2	+						RASSF8_uc001rgy.2_Intron|RASSF8_uc001rgz.2_Intron|RASSF8_uc009zjd.1_Intron|RASSF8_uc009zje.1_Intron	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family						signal transduction						0	Colorectal(261;0.0847)					GCAGCGTTGGTTTTTTTTCTT	0.294													4	2	---	---	---	---	
ESPL1	9700	broad.mit.edu	37	12	53679493	53679493	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53679493delA	uc001sck.2	+						ESPL1_uc001scj.2_Intron|ESPL1_uc010soe.1_Intron	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase						apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						actccatctcaaaaaaaaaag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68868822	68868822	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68868822delA								MDM1 (142661 upstream) : RAP1B (135830 downstream)																							GTAACATCATAAAAATTAGTA	0.259													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101779167	101779168	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101779167_101779168insA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						ACATAGAGGCTAGTTTTATATC	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114088592	114088592	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114088592delC								LHX5 (178715 upstream) : RBM19 (165951 downstream)																							TGGGATTTTTCTGCCTTCCTT	0.383													4	2	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114280617	114280617	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114280617delA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					ttatcaggttaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116068588	116068588	+	IGR	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116068588delG								TBX3 (946619 upstream) : MED13L (327795 downstream)																							GGACAGATCTGGGTCTGATTG	0.294													4	2	---	---	---	---	
COQ5	84274	broad.mit.edu	37	12	120960838	120960838	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120960838delA	uc001tyn.2	-						COQ5_uc001tyo.2_Intron|COQ5_uc010szj.1_Intron	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase						ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGATTCTTATAAAAAAAAAAG	0.249													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121481808	121481808	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121481808delT								OASL (5028 upstream) : P2RX7 (88870 downstream)																							gtgcaggtgataagcagtgag	0.000													4	2	---	---	---	---	
LOC116437	116437	broad.mit.edu	37	12	131696762	131696762	+	RNA	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131696762delG	uc001uiw.2	+	5		c.1759delG				NR_026670				Homo sapiens mRNA; cDNA DKFZp434L2430 (from clone DKFZp434L2430).												0						TCCTGGCACTGCTGGACCTGT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27375813	27375813	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27375813delC								GPR12 (40891 upstream) : USP12 (266625 downstream)																							GCTCAGCGGTCAGCACAGGGT	0.552													4	2	---	---	---	---	
FLJ10357	55701	broad.mit.edu	37	14	21553307	21553307	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21553307delG	uc001vzp.2	+						FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_Intron|FLJ10357_uc010tln.1_Intron	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		AGAACACTTAGGAGGCATTCC	0.468													4	2	---	---	---	---	
DHRS4	10901	broad.mit.edu	37	14	24433596	24433597	+	Intron	DEL	AC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24433596_24433597delAC	uc001wla.2	+						DHRS4_uc010aky.2_Intron|DHRS4_uc001wlb.2_Intron|DHRS4_uc010akz.2_Intron|DHRS4_uc001wlc.3_Intron|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	actttaaaaaacacacacacac	0.040													4	2	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92090985	92090986	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92090985_92090986insA	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				actccattgccaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97420759	97420759	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97420759delC								VRK1 (72809 upstream) : C14orf64 (971188 downstream)																							gggtttgcttcccctgcctct	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99319818	99319818	+	IGR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99319818delC								C14orf177 (135721 upstream) : BCL11B (315809 downstream)																							ACCTTACACACCCCCAACCCT	0.438													4	2	---	---	---	---	
WDR20	91833	broad.mit.edu	37	14	102680581	102680582	+	3'UTR	INS	-	C	C	rs144764550	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102680581_102680582insC	uc001ylc.2	+	4					WDR20_uc001yld.2_Intron|WDR20_uc001yle.2_Intron			Q8TBZ3	WDR20_HUMAN	SubName: Full=WDR20 protein;												0						AGCCTGCAGGGCCCCCCCTTGT	0.599													6	6	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106993634	106993634	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993634delC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TGGAGAAGTTCCCTGGGGAAA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20463737	20463737	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20463737delT								None (None upstream) : GOLGA6L6 (273357 downstream)																							ATGGGGTAACTTTataaacac	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23685464	23685465	+	IGR	INS	-	TCT	TCT	rs74199194		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23685464_23685465insTCT								GOLGA8E (237041 upstream) : MKRN3 (124989 downstream)																							tctgctcctgatctcctgctcc	0.089													5	3	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43340386	43340386	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43340386delA	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		tctgtcttcgaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70658343	70658344	+	IGR	DEL	AC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70658343_70658344delAC								TLE3 (268087 upstream) : UACA (288551 downstream)																							gcatcacactacctaacttcaa	0.000													4	2	---	---	---	---	
PTPN9	5780	broad.mit.edu	37	15	75815801	75815801	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75815801delA	uc002bal.2	-							NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						CTGTGGTAAGAAAAAAAAAAC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	77268161	77268161	+	IGR	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77268161delG								RCN2 (25561 upstream) : PSTPIP1 (18860 downstream)																							GGGTTAAGGCGGGGGGGATGT	0.542													4	2	---	---	---	---	
HOMER2	9455	broad.mit.edu	37	15	83612797	83612798	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83612797_83612798insT	uc002bjg.2	-						HOMER2_uc002bjh.2_Intron|HOMER2_uc002bjj.2_Intron|HOMER2_uc002bji.2_Intron	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN	homer 2 isoform 2						metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0						ATGaataaaaatttttttttta	0.327													5	3	---	---	---	---	
CACNA1H	8912	broad.mit.edu	37	16	1214182	1214182	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1214182delT	uc002cks.2	+						CACNA1H_uc002ckt.2_Intron	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,						aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	TTCAGTTATGTTTGGATTTCA	0.557													4	2	---	---	---	---	
IFT140	9742	broad.mit.edu	37	16	1631916	1631917	+	Intron	INS	-	A	A			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1631916_1631917insA	uc002cmb.2	-						IFT140_uc002clz.2_Intron	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				TGTTAGCAGAGAAAAAAAAATG	0.421													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15131655	15131655	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15131655delA	uc002ddc.2	+							NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ATTACCGACCAAAAAAAAAAC	0.343													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33041068	33041068	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33041068delA								SLC6A10P (144605 upstream) : MIR1826 (924440 downstream)																							actctatgataaaaaaaaatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46406301	46406301	+	IGR	DEL	C	-	-	rs144220282		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46406301delC								None (None upstream) : ANKRD26P1 (96948 downstream)																							ttccattcgaccatgattgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55291618	55291619	+	IGR	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55291618_55291619insT								IRX5 (323225 upstream) : IRX6 (66852 downstream)																							TTTGAAAAACATTTTTTTTGTA	0.297													4	3	---	---	---	---	
NUP93	9688	broad.mit.edu	37	16	56866494	56866494	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56866494delA	uc002eka.2	+						NUP93_uc002ekb.2_Intron|NUP93_uc010vhi.1_Intron	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						AGAAATACATAAAACTTATAT	0.338													4	2	---	---	---	---	
TSNAXIP1	55815	broad.mit.edu	37	16	67854645	67854645	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67854645delA	uc002euj.2	+						TSNAXIP1_uc010cep.2_Intron|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Intron|TSNAXIP1_uc010vkb.1_Intron|TSNAXIP1_uc002eug.3_Intron|TSNAXIP1_uc002euh.3_Intron|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'Flank	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein						cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		agactgtctcaaaaaaaaaaa	0.254													7	5	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71026339	71026339	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71026339delT	uc002ezr.2	-							NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				gcccaacttctttcctctgag	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4278573	4278573	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4278573delT								UBE2G1 (8604 upstream) : SPNS3 (58646 downstream)																							gtttttcttatttttttttcc	0.005													4	3	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5038289	5038289	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5038289delA	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|uc002gay.1_5'Flank|uc002gba.2_5'Flank|uc002gbb.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						tgtgcaaaagaaaaaaaaaat	0.169			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								8	4	---	---	---	---	
PIK3R5	23533	broad.mit.edu	37	17	8812614	8812614	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8812614delT	uc002glt.2	-						PIK3R5_uc010vuz.1_Intron|PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Intron|PIK3R5_uc010cob.1_Intron	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5						platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						TGGAACACTCttttttttttt	0.249													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14613995	14613995	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14613995delA								HS3ST3B1 (364503 upstream) : PMP22 (519102 downstream)																							TATTTTCATGATTGTTTGGTG	0.254													4	2	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20227833	20227833	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20227833delT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AAGAAAAAGAttttttttttt	0.104													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21328243	21328243	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21328243delA								KCNJ12 (5064 upstream) : C17orf51 (103329 downstream)																							TGCTGACTCCAAGTGTGATAG	0.393													12	7	---	---	---	---	
SUZ12	23512	broad.mit.edu	37	17	30267721	30267721	+	Intron	DEL	T	-	-	rs11361726		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30267721delT	uc002hgs.2	+						SUZ12_uc002hgt.2_Intron	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1						negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TGTTATTAGCTTTTTTTTTTT	0.199			T	JAZF1	endometrial stromal tumours								8	4	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47104066	47104069	+	Intron	DEL	CCTT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47104066_47104069delCCTT	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						tgccttcctgccttcctgccttcc	0.005													12	6	---	---	---	---	
SGCA	6442	broad.mit.edu	37	17	48244180	48244181	+	Intron	INS	-	CA	CA	rs141068814	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48244180_48244181insCA	uc002iqi.2	+						SGCA_uc010wmh.1_Intron|SGCA_uc002iqj.2_Intron|SGCA_uc010wmi.1_Intron	NM_000023	NP_000014	Q16586	SGCA_HUMAN	sarcoglycan, alpha isoform 1 precursor						muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(2)	2						acacacaccgtcacacacacac	0.000													5	5	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59480290	59480291	+	Intron	DEL	AT	-	-	rs61046721		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480290_59480291delAT	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						ggaagaaCCGATagagagagag	0.139													9	5	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67444745	67444745	+	Intron	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67444745delT	uc002jij.2	+						MAP2K6_uc002jii.2_Intron	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					TTCTTTCTGCTTTTTTTTTTC	0.532													4	2	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72444942	72444943	+	Intron	DEL	TC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72444942_72444943delTC	uc002jkt.2	+						GPRC5C_uc002jku.2_Intron	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						tcagagtagttctaccgccccc	0.173													4	2	---	---	---	---	
CDR2L	30850	broad.mit.edu	37	17	72995903	72995903	+	Intron	DEL	T	-	-	rs34311244		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72995903delT	uc002jml.3	+							NM_014603	NP_055418	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like												0	all_lung(278;0.226)					CACAACTAGAttttttttttt	0.249													6	5	---	---	---	---	
SLC26A11	284129	broad.mit.edu	37	17	78224945	78224945	+	Intron	DEL	A	-	-	rs11868423	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78224945delA	uc002jyb.1	+						SLC26A11_uc002jyc.1_Intron|SLC26A11_uc002jyd.1_Intron|SLC26A11_uc010dhv.1_Intron	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			acaaaaaattaaaaaaaaaaa	0.239													10	7	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10704208	10704209	+	5'Flank	INS	-	T	T	rs137933102	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10704208_10704209insT	uc002kor.3	-							NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B							integral to membrane	ion channel activity			ovary(1)	1						AGAATTGCGAGTGCTAGGTAAC	0.322													2	4	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21744703	21744703	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21744703delA	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					gagatttcttaaaaaaactta	0.000													5	3	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	35139298	35139299	+	Intron	DEL	CA	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35139298_35139299delCA	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CTCCAACACCCACACAGGCTGC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46520994	46520994	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46520994delT								SMAD7 (43913 upstream) : DYM (49178 downstream)																							AATACATCTGTTTTTTTCTTC	0.398													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59958503	59958504	+	Intron	DEL	CG	-	-	rs140675120	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59958503_59958504delCG	uc002lil.2	+						KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				ttaattgttacgctcactttat	0.000													4	2	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5278194	5278195	+	Intron	INS	-	A	A	rs111490914		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5278194_5278195insA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron|PTPRS_uc002mbz.1_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		TAGAAACTGCCAAAAAAAAAAA	0.332													7	5	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11529441	11529441	+	Frame_Shift_Del	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11529441delC	uc002mrp.2	-	2	117	c.53delG	c.(52-54)GGTfs	p.G18fs	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Frame_Shift_Del_p.G18fs|RGL3_uc002mrq.2_Frame_Shift_Del_p.G18fs	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	18					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						GGTCTCTTCACCCCAGTCCTG	0.731													4	2	---	---	---	---	
CD97	976	broad.mit.edu	37	19	14499040	14499040	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14499040delA	uc002myl.2	+						CD97_uc002mym.2_Intron|CD97_uc002myn.2_Intron	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor						cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						agcctgtgtcaaaaaaaaaac	0.209													9	5	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17740402	17740403	+	Intron	DEL	CT	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17740402_17740403delCT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ACAAGATGACCTGATCTCAAAT	0.431													4	2	---	---	---	---	
ZNF676	163223	broad.mit.edu	37	19	22362316	22362316	+	3'UTR	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22362316delC	uc002nqs.1	-	3						NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAAAGGCTTGCCACATTCTTC	0.378													4	2	---	---	---	---	
COX6B1	1340	broad.mit.edu	37	19	36142434	36142435	+	Intron	INS	-	T	T			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36142434_36142435insT	uc002oav.2	+							NM_001863	NP_001854	P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1						respiratory electron transport chain	mitochondrial inner membrane|mitochondrial intermembrane space	cytochrome-c oxidase activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCCTGCAATGatttttttttta	0.257													6	3	---	---	---	---	
WDR62	284403	broad.mit.edu	37	19	36587619	36587620	+	Intron	DEL	AG	-	-	rs10853946	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36587619_36587620delAG	uc002odc.2	+						WDR62_uc002odd.2_Intron	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2						cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			tctcaaaaaaagaaaaaaaaag	0.000													8	4	---	---	---	---	
NFKBIB	4793	broad.mit.edu	37	19	39395119	39395120	+	Intron	INS	-	TCTT	TCTT	rs145766902	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39395119_39395120insTCTT	uc002ojw.2	+						NFKBIB_uc010egk.1_Intron|NFKBIB_uc002ojx.2_Intron|NFKBIB_uc002ojy.2_Intron	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			tttggcaactctgttttgtact	0.000													5	4	---	---	---	---	
NFKBIB	4793	broad.mit.edu	37	19	39395390	39395393	+	Intron	DEL	TTGT	-	-	rs68113781		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39395390_39395393delTTGT	uc002ojw.2	+						NFKBIB_uc010egk.1_Intron|NFKBIB_uc002ojx.2_Intron|NFKBIB_uc002ojy.2_Intron	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			cgtctgactcttgtttgtttgttt	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47746997	47746999	+	IGR	DEL	GTC	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47746997_47746999delGTC								BBC3 (10974 upstream) : CCDC9 (12732 downstream)																							gtctctcccagtctctgtctcca	0.054													4	3	---	---	---	---	
LIG1	3978	broad.mit.edu	37	19	48668516	48668516	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48668516delA	uc002pia.1	-						LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron|LIG1_uc010xzh.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	actccaactcaaaaaaaaaaa	0.000								NER					5	3	---	---	---	---	
SLC6A16	28968	broad.mit.edu	37	19	49805149	49805150	+	Intron	DEL	CA	-	-	rs118168815	by1000genomes	TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49805149_49805150delCA	uc002pmz.2	-						SLC6A16_uc002pna.2_Intron	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16							integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GCACAGCTACCATGCATGTGCC	0.589											OREG0025619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
LILRB3	11025	broad.mit.edu	37	19	54723853	54723854	+	Intron	INS	-	CC	CC			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54723853_54723854insCC	uc002qef.1	-						LILRB3_uc002qee.1_Intron|LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CGGCTCCTCCTCCTGGCTGGGC	0.678													6	5	---	---	---	---	
PPP1R12C	54776	broad.mit.edu	37	19	55609586	55609586	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55609586delC	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		tcacgcatgacccctcataca	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55961401	55961402	+	IGR	DEL	TG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55961401_55961402delTG								SHISA7 (7171 upstream) : ISOC2 (2946 downstream)																							CAGGGCAGATTGTGTGTGTTTg	0.327													4	2	---	---	---	---	
JAG1	182	broad.mit.edu	37	20	10653814	10653815	+	Intron	INS	-	A	A	rs33929314		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10653814_10653815insA	uc002wnw.2	-							NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor						angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						GATTCCGGGGCAAAAAAAAAAA	0.584									Alagille_Syndrome				6	4	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32339924	32339925	+	Intron	DEL	CT	-	-	rs60694797		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32339924_32339925delCT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						gccCCCCCCCCTTTTTTTTTAA	0.183													4	2	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	33053846	33053847	+	Intron	INS	-	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33053846_33053847insC	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron|MIR644_hsa-mir-644|MI0003659_5'Flank	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						ctgttagatttttatatgtgcc	0.000													3	3	---	---	---	---	
VSTM2L	128434	broad.mit.edu	37	20	36572311	36572311	+	Intron	DEL	C	-	-	rs33961791		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36572311delC	uc002xhk.3	+							NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				GATCTTGGGACCCCCCCCCCC	0.418													14	10	---	---	---	---	
PREX1	57580	broad.mit.edu	37	20	47421120	47421121	+	Intron	DEL	GG	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47421120_47421121delGG	uc002xtw.1	-							NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			tgggtgaggtgggaggcagcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49974621	49974622	+	IGR	INS	-	TGGA	TGGA			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49974621_49974622insTGGA								KCNG1 (334946 upstream) : NFATC2 (33144 downstream)																							ggatgaatgggtggatggatgg	0.000													2	4	---	---	---	---	
TFAP2C	7022	broad.mit.edu	37	20	55208253	55208253	+	Intron	DEL	T	-	-	rs72357061		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55208253delT	uc002xya.2	+						TFAP2C_uc010zzi.1_Intron	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma						cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			actcttattattttttttttt	0.179													7	5	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839534	45839536	+	Intron	DEL	TGG	-	-	rs142846437		TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839534_45839536delTGG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gtgttggtgatggtggtagtgat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46670969	46670969	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46670969delG	uc002zgz.1	+											Homo sapiens C21orf89 protein (C21orf89) mRNA, complete cds.																		acttacccatggtggccggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29805741	29805741	+	IGR	DEL	T	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29805741delT								AP1B1 (21172 upstream) : RFPL1S (27265 downstream)																							ACAAATACAATTTTTTTGTTG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48728206	48728207	+	IGR	DEL	CA	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48728206_48728207delCA								None (None upstream) : FAM19A5 (157081 downstream)																							gcatacacaccacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	685638	685639	+	IGR	INS	-	C	C			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:685638_685639insC								SHOX (65493 upstream) : CRLF2 (629248 downstream)																							GCAGAGACCCTCCCCACCTGAG	0.584													6	5	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2658432	2658432	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2658432delC	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						AATAAAGTTTCCAAAACTTAA	0.363													4	2	---	---	---	---	
BMX	660	broad.mit.edu	37	X	15554697	15554697	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15554697delA	uc004cww.2	+						BMX_uc004cwx.3_Intron|BMX_uc004cwy.3_Intron	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase						cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					GATTTTCTTTAAAAAAAAAAA	0.313													3	3	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19713608	19713608	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19713608delA	uc004czm.2	-						SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						CAGTATAACCAAAAAAATACT	0.502													8	4	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53592345	53592345	+	Intron	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53592345delA	uc004dsp.2	-						HUWE1_uc004dsn.2_Intron	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TTTTGTTTAGAAAAAAAAAAT	0.353													4	4	---	---	---	---	
HDAC8	55869	broad.mit.edu	37	X	71549387	71549387	+	3'UTR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71549387delA	uc004eau.2	-	11					HDAC8_uc011mqe.1_3'UTR|HDAC8_uc011mqf.1_3'UTR|HDAC8_uc011mqg.1_3'UTR	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8						chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)	AGATTTTATTAAAAAAACCAA	0.448													4	2	---	---	---	---	
LRCH2	57631	broad.mit.edu	37	X	114364980	114364980	+	Intron	DEL	C	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114364980delC	uc010nqe.2	-						LRCH2_uc004epz.2_Intron	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)	1						ttatacagatcaagtaacatt	0.075													4	2	---	---	---	---	
STAG2	10735	broad.mit.edu	37	X	123184417	123184417	+	Intron	DEL	G	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123184417delG	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						GAAGGTAGTAGGAGTGAGGCA	0.333													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150684715	150684715	+	IGR	DEL	A	-	-			TCGA-A3-3349-01A-01D-1251-10	TCGA-A3-3349-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150684715delA								VMA21 (106880 upstream) : PASD1 (47292 downstream)																							CATGGTGATGAAAATAAAATG	0.468													4	2	---	---	---	---	
