Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DNAJC16	23341	broad.mit.edu	37	1	15855691	15855691	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15855691T>C	uc001aws.2	+	2	211	c.91T>C	c.(91-93)TAC>CAC	p.Y31H	DNAJC16_uc001awr.1_Missense_Mutation_p.Y31H|DNAJC16_uc001awt.2_Intron	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	31	Cytoplasmic (Potential).|J.				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TTTTGACCCATACAGAGTCCT	0.453													50	194	---	---	---	---	PASS
RNF19B	127544	broad.mit.edu	37	1	33402681	33402681	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33402681C>G	uc010oho.1	-	9	1925	c.1925G>C	c.(1924-1926)TGT>TCT	p.C642S	RNF19B_uc001bwm.3_3'UTR|RNF19B_uc010ohp.1_Missense_Mutation_p.C641S	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	642						integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TTTCTGTTCACAGCTTTGGTG	0.552													7	250	---	---	---	---	PASS
CYP4A11	1579	broad.mit.edu	37	1	47403749	47403749	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47403749A>G	uc001cqp.3	-	2	307	c.256T>C	c.(256-258)TGT>CGT	p.C86R	CYP4A11_uc001cqq.2_Missense_Mutation_p.C86R|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	86					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	CAATGAGGACAGGCACTTGGG	0.493													35	158	---	---	---	---	PASS
LPAR3	23566	broad.mit.edu	37	1	85279467	85279467	+	3'UTR	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85279467T>C	uc001dkl.2	-	2					LPAR3_uc009wcj.1_3'UTR	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						TAGAGACAGGTAATCATTCTT	0.408													4	25	---	---	---	---	PASS
GSTM2	2946	broad.mit.edu	37	1	110217413	110217413	+	Silent	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110217413C>A	uc001dyi.2	+	8	926	c.612C>A	c.(610-612)CTC>CTA	p.L204L	GSTM2_uc001dyj.2_Silent_p.L204L|GSTM2_uc010ovt.1_Intron|GSTM2_uc009wfk.2_Intron	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1	204	GST C-terminal.				glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	GCCGCTTCCTCCCAAGACCTG	0.582													5	193	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879387	144879387	+	Nonsense_Mutation	SNP	G	A	A	rs149886351		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879387G>A	uc001elw.3	-	27	4354	c.4063C>T	c.(4063-4065)CGA>TGA	p.R1355*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Nonsense_Mutation_p.R1311*|PDE4DIP_uc001elv.3_Nonsense_Mutation_p.R362*	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1355	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATGTCCTTTCGTAGGACCAAG	0.493			T	PDGFRB	MPD								8	734	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232650730	232650730	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650730C>G	uc001hvg.2	-	1	514	c.356G>C	c.(355-357)AGT>ACT	p.S119T		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	119					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ACTCTGGTCACTCTGCCCATT	0.502													69	273	---	---	---	---	PASS
FAM150B	285016	broad.mit.edu	37	2	283140	283140	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:283140C>A	uc002qwi.3	-	5	777	c.424G>T	c.(424-426)GCT>TCT	p.A142S	FAM150B_uc010ewf.1_Missense_Mutation_p.A142S	NM_001002919	NP_001002919	Q6UX46	F150B_HUMAN	hypothetical protein LOC285016 precursor	142						extracellular region					0	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.00091)|Epithelial(75;0.00656)|OV - Ovarian serous cystadenocarcinoma(76;0.00954)|GBM - Glioblastoma multiforme(21;0.128)		GGACTGACAGCCAGCCGGGTA	0.428													4	26	---	---	---	---	PASS
PPP1CB	5500	broad.mit.edu	37	2	29004771	29004771	+	Intron	SNP	A	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29004771A>C	uc002rmg.2	+						PPP1CB_uc010ymj.1_Intron|PPP1CB_uc010ymk.1_Missense_Mutation_p.I167L|PPP1CB_uc010yml.1_Intron|PPP1CB_uc002rmh.2_Intron|SPDYA_uc002rmi.2_5'Flank	NM_206876	NP_996759	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta						cell cycle|cell division|glycogen metabolic process|triglyceride catabolic process	MLL5-L complex|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|myosin phosphatase activity|myosin-light-chain-phosphatase activity|protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)					AATACCTATAATAATCAAGAG	0.313													10	35	---	---	---	---	PASS
RPL23AP32	56969	broad.mit.edu	37	2	54756736	54756736	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54756736T>C	uc010yot.1	+	1	378	c.254T>C	c.(253-255)TTT>TCT	p.F85S	SPTBN1_uc002rxu.2_Intron|SPTBN1_uc002rxv.1_Intron	NR_002229				SubName: Full=Putative uncharacterized protein DKFZp547I014;												0						ACCACTGAGTTTGCCATGAAG	0.483													3	77	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55253832	55253832	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55253832T>G	uc002rye.2	-	3	1701	c.1403A>C	c.(1402-1404)AAC>ACC	p.N468T	RTN4_uc002ryd.2_Missense_Mutation_p.N262T|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	468	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						TGCTGCTGGGTTAAAGGGAGC	0.378													33	385	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216236992	216236992	+	Silent	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216236992C>A	uc002vfa.2	-	40	6620	c.6354G>T	c.(6352-6354)GGG>GGT	p.G2118G	FN1_uc002vfb.2_Silent_p.G1937G|FN1_uc002vfc.2_Silent_p.G1912G|FN1_uc002vfd.2_Silent_p.G2093G|FN1_uc002vfe.2_Silent_p.G2027G|FN1_uc002vff.2_Silent_p.G2002G|FN1_uc002vfg.2_Silent_p.G1937G|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Silent_p.G2118G|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Silent_p.G312G|FN1_uc010zjp.1_Silent_p.G655G|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_Intron|FN1_uc010fvb.1_Intron|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Silent_p.G209G	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	2027	Connecting strand 3 (CS-3) (V region).			G -> R (in Ref. 4; CAD97965/CAD97964).	acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAGTGTCATACCCAGGGTGGG	0.498													47	141	---	---	---	---	PASS
PSMD6	9861	broad.mit.edu	37	3	64007994	64007994	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64007994T>G	uc003dma.1	-	2	376	c.351A>C	c.(349-351)AAA>AAC	p.K117N	PSMD6_uc003dlz.1_Missense_Mutation_p.K68N|PSMD6_uc003dmb.1_Missense_Mutation_p.K170N|PSMD6_uc003dmc.1_Missense_Mutation_p.K78N|PSMD6_uc003dmd.1_Missense_Mutation_p.K79N	NM_014814	NP_055629	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit,	117					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	ATPase activity|protein binding			central_nervous_system(1)|skin(1)	2		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		CTCTACTCACTTTGTCACCTA	0.423													58	161	---	---	---	---	PASS
MINA	84864	broad.mit.edu	37	3	97661478	97661478	+	3'UTR	SNP	T	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97661478T>A	uc003drz.1	-	10					CRYBG3_uc003drx.2_Intron|CRYBG3_uc010hoz.1_Intron|MINA_uc003dry.1_3'UTR|MINA_uc003dsa.1_3'UTR|MINA_uc003dsb.1_3'UTR|MINA_uc003dsc.1_3'UTR	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a						ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1						CAACAAAGCTTAGGGTTTTTG	0.299													5	3	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	143297454	143297454	+	Silent	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143297454C>A	uc003evn.2	-	7	1049	c.867G>T	c.(865-867)GGG>GGT	p.G289G	SLC9A9_uc011bnk.1_Silent_p.G163G	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	289	Helical; (Potential).				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						CATACGCAGACCCCATTGCAA	0.458													23	61	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148789134	148789134	+	Silent	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148789134G>T	uc003ewq.1	-	7	1017	c.799C>A	c.(799-801)CGA>AGA	p.R267R	HLTF_uc003ewr.1_Silent_p.R267R|HLTF_uc003ews.1_Silent_p.R267R|HLTF_uc010hve.1_Silent_p.R267R	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	267					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AAGTCATTTCGCTGTTCCCAG	0.393													3	118	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	843678	843678	+	Splice_Site	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:843678A>G	uc003gbm.3	-	27	4033	c.3834_splice	c.e27+1	p.K1278_splice	GAK_uc003gbn.3_Splice_Site_p.K1199_splice|GAK_uc003gbk.3_Splice_Site_p.K75_splice|GAK_uc010ibi.2_Splice_Site_p.K503_splice|GAK_uc010ibj.2_Splice_Site|GAK_uc003gbl.3_Splice_Site_p.K1131_splice	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		AGCTCTGCTCACCTTGTCGGG	0.517													5	14	---	---	---	---	PASS
FGF5	2250	broad.mit.edu	37	4	81207512	81207512	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81207512C>T	uc003hmd.2	+	3	730	c.493C>T	c.(493-495)CGT>TGT	p.R165C	FGF5_uc003hme.2_3'UTR	NM_004464	NP_004455	P12034	FGF5_HUMAN	fibroblast growth factor 5 isoform 1 precursor	165					cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	fibroblast growth factor receptor binding|growth factor activity			ovary(1)|breast(1)	2						GTTCAGGGAGCGTTTTCAAGA	0.398													5	381	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83970374	83970374	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83970374C>A	uc003hoa.2	+	3	349	c.210C>A	c.(208-210)TGC>TGA	p.C70*	COPS4_uc003hob.2_Nonsense_Mutation_p.C70*|COPS4_uc010ijw.2_Nonsense_Mutation_p.C70*|COPS4_uc010ijx.2_Nonsense_Mutation_p.C70*	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	70					cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				CTGATTTTTGCACACATCTTC	0.383													37	176	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87653571	87653571	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87653571T>C	uc003hpz.2	+	11	2107	c.1627T>C	c.(1627-1629)TTT>CTT	p.F543L	PTPN13_uc003hpy.2_Missense_Mutation_p.F543L|PTPN13_uc003hqa.2_Missense_Mutation_p.F543L|PTPN13_uc003hqb.2_Missense_Mutation_p.F543L	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	543						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TGGCCCTGAGTTTGTGAAAAT	0.279													8	15	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5209271	5209271	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5209271A>T	uc003jdl.2	+	10	1655	c.1517A>T	c.(1516-1518)AAA>ATA	p.K506I	ADAMTS16_uc003jdk.1_Missense_Mutation_p.K506I|ADAMTS16_uc003jdj.1_Missense_Mutation_p.K506I	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	506	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TATCCTGAGAAATTGCCAGGA	0.448													77	248	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16671643	16671643	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16671643G>C	uc003jft.3	-	38	5786	c.5318C>G	c.(5317-5319)GCC>GGC	p.A1773G	MYO10_uc011cnb.1_Missense_Mutation_p.A402G|MYO10_uc011cnc.1_Missense_Mutation_p.A652G|MYO10_uc011cnd.1_Missense_Mutation_p.A1130G|MYO10_uc011cne.1_Missense_Mutation_p.A1130G|MYO10_uc010itx.2_Missense_Mutation_p.A1395G	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	1773	FERM.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CTCGGATGTGGCAGCCAGCCT	0.498													6	44	---	---	---	---	PASS
CAMLG	819	broad.mit.edu	37	5	134079711	134079711	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134079711C>T	uc003kzt.2	+	3	773	c.668C>T	c.(667-669)GCG>GTG	p.A223V	CAMLG_uc003kzu.2_Silent_p.C69C	NM_001745	NP_001736	P49069	CAMLG_HUMAN	calcium modulating ligand	223	Extracellular (Potential).				defense response	endoplasmic reticulum|integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	TTACAACTTGCGTACATGGGA	0.269													5	31	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140869551	140869551	+	Silent	SNP	T	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140869551T>A	uc003lla.1	+	1	744	c.744T>A	c.(742-744)CGT>CGA	p.R248R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Silent_p.R248R	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	248	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTTCTACGTGTGGGAATCC	0.542													66	239	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147009293	147009293	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147009293T>G	uc003loq.1	-	15	2274	c.1892A>C	c.(1891-1893)GAT>GCT	p.D631A	JAKMIP2_uc011dbx.1_Missense_Mutation_p.D589A|JAKMIP2_uc003lor.1_Missense_Mutation_p.D610A|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.D631A	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	631						Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTATGAGATCAGGGATGTT	0.383													29	92	---	---	---	---	PASS
HIST1H4E	8367	broad.mit.edu	37	6	26205031	26205031	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26205031G>T	uc003ngy.2	+	1	159	c.159G>T	c.(157-159)GAG>GAT	p.E53D		NM_003545	NP_003536	P62805	H4_HUMAN	histone cluster 1, H4e	53					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1		all_hematologic(11;0.196)				TCATCTACGAGGAGACTCGCG	0.557													4	146	---	---	---	---	PASS
PHF1	5252	broad.mit.edu	37	6	33381505	33381505	+	Intron	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33381505C>A	uc003oeh.2	+						PHF1_uc011drh.1_Intron|PHF1_uc003oei.2_Intron|PHF1_uc010jux.2_5'UTR	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b						chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				TCCTGTGTTCCCCCTCAGGTG	0.572													4	68	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87966445	87966445	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87966445T>A	uc003plm.3	+	8	3139	c.3098T>A	c.(3097-3099)GTG>GAG	p.V1033E		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1033					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ACCTTTTCTGTGCAAAATCAG	0.323													24	87	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128505792	128505792	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128505792G>T	uc003qbk.2	-	7	1314	c.947C>A	c.(946-948)TCG>TAG	p.S316*	PTPRK_uc003qbj.2_Nonsense_Mutation_p.S316*|PTPRK_uc010kfc.2_Nonsense_Mutation_p.S316*|PTPRK_uc011ebu.1_Nonsense_Mutation_p.S316*|PTPRK_uc003qbl.1_Nonsense_Mutation_p.S186*|PTPRK_uc011ebv.1_Nonsense_Mutation_p.S316*	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	316	Fibronectin type-III 1.|Extracellular (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GCCAATGATCGAGTTGGCATT	0.473													5	315	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142691426	142691426	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142691426G>A	uc010khc.2	+	4	976	c.565G>A	c.(565-567)GCA>ACA	p.A189T	GPR126_uc010khd.2_Missense_Mutation_p.A189T|GPR126_uc010khe.2_Missense_Mutation_p.A189T|GPR126_uc010khf.2_Missense_Mutation_p.A189T|GPR126_uc003qix.2_Missense_Mutation_p.A189T	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	189	Pentaxin.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTGCTTTGAAGCAACCAAAGT	0.438													23	87	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161514051	161514051	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161514051C>G	uc003qtn.2	+	14	3453	c.3311C>G	c.(3310-3312)CCT>CGT	p.P1104R	MAP3K4_uc010kkc.1_Missense_Mutation_p.P1104R|MAP3K4_uc003qto.2_Missense_Mutation_p.P1104R|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.P557R|MAP3K4_uc003qtp.2_Missense_Mutation_p.P94R	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1104					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GCAATTGAACCTGCCTTTATT	0.353													4	192	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169648861	169648861	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169648861G>A	uc003qwt.2	-	4	508	c.260C>T	c.(259-261)ACG>ATG	p.T87M		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	87	TSP N-terminal.|Heparin-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GAGCTGGGCCGTGAGGAAGAA	0.617													4	127	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5568380	5568380	+	Intron	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5568380T>G	uc003sos.3	-						ACTB_uc003sor.3_5'UTR|ACTB_uc003sot.3_Intron|ACTB_uc003soq.3_Intron|ACTB_uc010ksy.2_Intron	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CATGTCACACTGGGGAAGCCA	0.552													6	43	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72856668	72856668	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72856668A>G	uc003tyc.2	-	19	4655	c.4310T>C	c.(4309-4311)GTG>GCG	p.V1437A		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1437					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				CAACAGAGCCACTAGACACTG	0.493													39	135	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100361427	100361427	+	Splice_Site	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100361427A>G	uc003uwj.2	+	21	4152	c.3987_splice	c.e21-2	p.E1329_splice	ZAN_uc003uwk.2_Splice_Site_p.E1329_splice|ZAN_uc003uwl.2_Splice_Site|ZAN_uc010lhh.2_Splice_Site|ZAN_uc010lhi.2_Splice_Site|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGTCTCTTGCAGGTGTCAGAA	0.587													46	158	---	---	---	---	PASS
ZC3HC1	51530	broad.mit.edu	37	7	129691164	129691164	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129691164C>A	uc003vpi.2	-	1	70	c.43G>T	c.(43-45)GAA>TAA	p.E15*		NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1	15					cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					CAATTCTTTTCAACCCCTACG	0.602													4	132	---	---	---	---	PASS
CASP2	835	broad.mit.edu	37	7	143002127	143002127	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143002127G>T	uc003wco.2	+	11	1469	c.1322G>T	c.(1321-1323)CGC>CTC	p.R441L	CASP2_uc003wcp.2_3'UTR|CASP2_uc011kta.1_Missense_Mutation_p.R325L|CASP2_uc003wcq.2_RNA|CASP2_uc011ktb.1_Missense_Mutation_p.R191L	NM_032982	NP_116764	P42575	CASP2_HUMAN	caspase 2 isoform 1 preproprotein	441					apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding			lung(2)|ovary(1)	3	Melanoma(164;0.059)					ACTCTGTGCCGCCACCTCTAC	0.562													3	85	---	---	---	---	PASS
TEK	7010	broad.mit.edu	37	9	27169513	27169513	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27169513G>A	uc003zqi.3	+	4	956	c.514G>A	c.(514-516)GAT>AAT	p.D172N	TEK_uc010mjc.1_Missense_Mutation_p.D25N|TEK_uc011lnn.1_Missense_Mutation_p.D172N|TEK_uc011lno.1_Missense_Mutation_p.D172N|TEK_uc011lnp.1_Missense_Mutation_p.D68N|TEK_uc003zqj.1_Missense_Mutation_p.D149N	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	172	Extracellular (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TGAAGTACCTGATATTCTAGA	0.512													7	400	---	---	---	---	PASS
FAM75A3	727830	broad.mit.edu	37	9	40702725	40702725	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40702725G>T	uc010mmj.2	+	4	411	c.382G>T	c.(382-384)GAA>TAA	p.E128*		NM_001083124	NP_001076593	Q5VYP0	F75A3_HUMAN	hypothetical protein LOC727830	128	Pro-rich.					integral to membrane				ovary(2)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGAGGTGGGCGAAAGAGCACC	0.602													4	179	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202844	84202844	+	Intron	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202844T>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						tgtgtgtgtgtgtgtgtgtgt	0.368													3	4	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202845	84202845	+	Intron	SNP	G	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202845G>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						gtgtgtgtgtgtgtgtgtgtg	0.368													3	3	---	---	---	---	PASS
NDUFA8	4702	broad.mit.edu	37	9	124910417	124910417	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124910417G>A	uc004blv.2	-	3	497	c.355C>T	c.(355-357)CGG>TGG	p.R119W		NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	119					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)	AGGTCAGGCCGCACCCAGCCC	0.512													5	193	---	---	---	---	PASS
ST6GALNAC4	27090	broad.mit.edu	37	9	130678760	130678760	+	5'UTR	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130678760T>G	uc004bss.2	-	2					ST6GALNAC4_uc004bst.2_Intron	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a						glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						TGGGAAGGGGTGGGAGCCGGG	0.607													7	35	---	---	---	---	PASS
TOR1A	1861	broad.mit.edu	37	9	132584984	132584984	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132584984C>T	uc004byl.2	-	2	397	c.320G>A	c.(319-321)GGC>GAC	p.G107D	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.G107D	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	107	ATP.				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)				GAAATTTTTGCCGGTGCCTGT	0.468													6	392	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5790396	5790396	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5790396T>G	uc001iij.2	+	15	5637	c.5012T>G	c.(5011-5013)GTA>GGA	p.V1671G	C10orf18_uc001iik.2_Missense_Mutation_p.V515G	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	1671										ovary(1)|central_nervous_system(1)	2						ACCCATTATGTAAGACCAATA	0.468													8	102	---	---	---	---	PASS
CBARA1	10367	broad.mit.edu	37	10	74128087	74128087	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74128087A>G	uc001jtb.1	-	13	1436	c.1303T>C	c.(1303-1305)TTT>CTT	p.F435L	CBARA1_uc010qjw.1_Missense_Mutation_p.F235L|CBARA1_uc010qjx.1_Missense_Mutation_p.F235L|CBARA1_uc009xqo.1_RNA	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1	433	EF-hand 2.				calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						ATGGAAACAAATTCCTTATTG	0.473													15	80	---	---	---	---	PASS
IFIT1	3434	broad.mit.edu	37	10	91162187	91162187	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91162187T>C	uc001kgi.2	+	2	303	c.155T>C	c.(154-156)GTG>GCG	p.V52A	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|IFIT1_uc009xtt.2_Missense_Mutation_p.V52A|IFIT1_uc001kgj.2_Missense_Mutation_p.V21A	NM_001548	NP_001539	P09914	IFIT1_HUMAN	interferon-induced protein with	52	TPR 1.				cellular response to exogenous dsRNA|intracellular transport of viral proteins in host cell|negative regulation of defense response to virus by host|negative regulation of helicase activity|negative regulation of protein binding|negative regulation of viral genome replication|positive regulation of viral genome replication|response to virus|type I interferon-mediated signaling pathway	cytoplasm	protein binding				0						AAATACAGTGTGGGAATACAC	0.403													4	120	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104176598	104176598	+	Silent	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104176598G>T	uc001kvg.1	-	2	725	c.198C>A	c.(196-198)CCC>CCA	p.P66P	PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Silent_p.P66P|PSD_uc001kvi.1_Silent_p.P66P|FBXL15_uc001kvj.1_5'Flank|FBXL15_uc001kvk.2_5'Flank	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	66	Pro-rich.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GAGGTGTACAGGGTGCTGTCA	0.687													4	114	---	---	---	---	PASS
TSG101	7251	broad.mit.edu	37	11	18541152	18541152	+	Splice_Site	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18541152T>G	uc001mor.2	-	2	169	c.43_splice	c.e2-1	p.Y15_splice	TSG101_uc001mos.1_Intron|TSG101_uc009yhs.1_Intron	NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101						cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0						GTATTTGTACTGAAAAGCAAA	0.303													5	257	---	---	---	---	PASS
ANKRD42	338699	broad.mit.edu	37	11	82905759	82905759	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82905759C>T	uc001ozz.1	+	1	469	c.47C>T	c.(46-48)ACT>ATT	p.T16I	uc009yvh.2_5'Flank|ANKRD42_uc009yvi.1_Missense_Mutation_p.T16I|ANKRD42_uc010rsv.1_Missense_Mutation_p.T16I|ANKRD42_uc001paa.2_Missense_Mutation_p.T16I|ANKRD42_uc001pab.1_Missense_Mutation_p.T16I	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	16										skin(1)	1						TCTAGGGAGACTGCAAACCCC	0.572													21	101	---	---	---	---	PASS
DDX10	1662	broad.mit.edu	37	11	108546412	108546412	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108546412G>A	uc001pkm.2	+	3	402	c.337G>A	c.(337-339)GCC>ACC	p.A113T	DDX10_uc001pkl.1_Missense_Mutation_p.A113T	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	113	ATP.|Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		ACTTGGAGCGGCCAAAACTGG	0.438			T	NUP98	AML*								4	227	---	---	---	---	PASS
SIK2	23235	broad.mit.edu	37	11	111591712	111591712	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111591712A>C	uc001plt.2	+	12	1988	c.1870A>C	c.(1870-1872)ATA>CTA	p.I624L		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	624					intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						GTATGAACAAATAGGACCGGA	0.507													34	143	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120276827	120276827	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120276827G>C	uc001pxl.1	+	2	40	c.33G>C	c.(31-33)AGG>AGC	p.R11S	ARHGEF12_uc009zat.2_Missense_Mutation_p.R11S|ARHGEF12_uc010rzn.1_5'UTR|ARHGEF12_uc009zau.1_5'UTR	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	11					apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTTGTTTCAGGTTTCCCCTCA	0.279			T	MLL	AML								3	102	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49447312	49447312	+	Silent	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49447312G>A	uc001rta.3	-	6	786	c.786C>T	c.(784-786)GCC>GCT	p.A262A		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	262	Cys-rich.|PHD-type 1.|RING-type 1; atypical.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CACGTTTGCGGGCAGTCAGAG	0.577			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	11	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49447313	49447313	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49447313G>T	uc001rta.3	-	6	785	c.785C>A	c.(784-786)GCC>GAC	p.A262D		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	262	Cys-rich.|PHD-type 1.|RING-type 1; atypical.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ACGTTTGCGGGCAGTCAGAGC	0.577			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	11	---	---	---	---	PASS
EFHA1	221154	broad.mit.edu	37	13	22067484	22067484	+	Silent	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22067484T>C	uc001uof.2	-	12	1231	c.1209A>G	c.(1207-1209)CAA>CAG	p.Q403Q	EFHA1_uc010tct.1_Silent_p.Q193Q	NM_152726	NP_689939	Q8IYU8	EFHA1_HUMAN	EF-hand domain family, member A1	403							calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)		TACTCTGATGTTGTGGTACCT	0.333													21	81	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32910986	32910986	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32910986G>A	uc001uub.1	+	11	2721	c.2494G>A	c.(2494-2496)GAG>AAG	p.E832K		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	832	Interaction with NPM1.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TAAAAACGTTGAGCTGTTGCC	0.308			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			28	99	---	---	---	---	PASS
JKAMP	51528	broad.mit.edu	37	14	59954452	59954452	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59954452C>G	uc001xei.3	+	3	701	c.199C>G	c.(199-201)CCT>GCT	p.P67A	JKAMP_uc001xef.3_Missense_Mutation_p.P53A|JKAMP_uc001xeh.3_Missense_Mutation_p.P47A|JKAMP_uc001xeg.3_Missense_Mutation_p.P61A|JKAMP_uc010try.1_5'UTR|JKAMP_uc001xej.3_5'UTR	NM_001098625	NP_001092095	Q9P055	JKAMP_HUMAN	JNK1-associated membrane protein isoform 2	68	Lumenal (Potential).				ER-associated protein catabolic process|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ubiquitin protein ligase binding			breast(1)	1						CACAGAATCTCCTGAACTTTA	0.373													75	293	---	---	---	---	PASS
SLC10A1	6554	broad.mit.edu	37	14	70242936	70242936	+	3'UTR	SNP	T	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70242936T>A	uc001xlr.2	-	5						NM_003049	NP_003040	Q14973	NTCP_HUMAN	solute carrier family 10, member 1						bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(1)	1				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)		CTGCTCTCTCTAGTTTACCAC	0.517													31	113	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104219383	104219383	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104219383G>A	uc001yof.1	-	7	1065	c.782C>T	c.(781-783)ACG>ATG	p.T261M	PPP1R13B_uc001yog.1_Missense_Mutation_p.T128M	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	261	Gln-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CGCTGGTCCCGTCAATTTGCC	0.408													4	204	---	---	---	---	PASS
NDUFAF1	51103	broad.mit.edu	37	15	41679610	41679610	+	3'UTR	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41679610T>C	uc001znx.2	-	5					NDUFAF1_uc010bcf.2_RNA	NM_016013	NP_057097	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|protein complex assembly	mitochondrial respiratory chain complex I	unfolded protein binding			ovary(1)	1		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		CTAGTACCCTTAGATTAGTAA	0.284													46	137	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78208916	78208916	+	Missense_Mutation	SNP	C	G	G	rs56290535	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78208916C>G	uc010bky.2	-	14	1581	c.817G>C	c.(817-819)GAA>CAA	p.E273Q	LOC645752_uc010umq.1_5'Flank|uc002bcw.1_5'Flank|uc002bcx.1_5'Flank	NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						TCCAGATGTTCTCCTCCATCT	0.627													3	139	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28990815	28990815	+	Intron	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28990815G>A	uc010vdi.1	+						uc010vct.1_Intron|SPNS1_uc002dry.2_Missense_Mutation_p.G229E|SPNS1_uc002drx.2_Intron|SPNS1_uc002dsa.2_Intron|SPNS1_uc002drz.2_Intron|SPNS1_uc010byp.2_Intron|SPNS1_uc010byq.1_Intron	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1						lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						TTGGCCTGGGGGTAGGTCAGC	0.483													3	100	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46706216	46706216	+	Silent	SNP	A	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46706216A>G	uc002eef.3	-	11	1428	c.1329T>C	c.(1327-1329)AAT>AAC	p.N443N	VPS35_uc002eed.2_Silent_p.N264N|VPS35_uc002eee.2_Silent_p.N404N	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	443					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AATCCAGAACATTACTAAGCA	0.348													4	180	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64984901	64984901	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64984901C>A	uc002eoi.2	-	12	2097	c.1663G>T	c.(1663-1665)GCC>TCC	p.A555S	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.A555S|CDH11_uc010vin.1_Missense_Mutation_p.A429S	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	555	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCACGCCGGGCGTACACGCCT	0.592			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			3	63	---	---	---	---	PASS
TPPP3	51673	broad.mit.edu	37	16	67425086	67425086	+	5'UTR	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67425086T>C	uc002esz.2	-	1					TPPP3_uc002eta.2_Intron|TPPP3_uc002etb.2_Intron	NM_016140	NP_057224	Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family						microtubule bundle formation	cytoplasm|microtubule	calcium ion binding|tubulin binding			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		GCCCAGAACATCCCAGCCTCT	0.632													4	5	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8706674	8706674	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8706674C>A	uc002glq.1	-	21	2422	c.2182G>T	c.(2182-2184)GGG>TGG	p.G728W	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	728					platelet activation	cytosol					0						TCCTGTTGCCCATGCAAATTG	0.567													4	114	---	---	---	---	PASS
FNDC8	54752	broad.mit.edu	37	17	33456486	33456486	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33456486C>A	uc002hix.2	+	3	713	c.631C>A	c.(631-633)CAG>AAG	p.Q211K		NM_017559	NP_060029	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	211	Fibronectin type-III.									ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		CAGTTTCTACCAGCTCCTGTT	0.532													4	112	---	---	---	---	PASS
JUP	3728	broad.mit.edu	37	17	39919273	39919273	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39919273T>G	uc002hxq.2	-	8	1736	c.1459A>C	c.(1459-1461)AAG>CAG	p.K487Q	JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Missense_Mutation_p.K487Q|JUP_uc002hxs.2_Missense_Mutation_p.K487Q	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	487	ARM 7.				adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TTGAGCAGCTTCACGATGGCT	0.592													23	66	---	---	---	---	PASS
SGCA	6442	broad.mit.edu	37	17	48252717	48252717	+	Silent	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48252717C>G	uc002iqi.2	+	9	1119	c.1083C>G	c.(1081-1083)CCC>CCG	p.P361P	SGCA_uc002iqj.2_Silent_p.P237P|SGCA_uc010wmi.1_RNA|HILS1_uc010wmj.1_5'Flank|HILS1_uc002iqk.2_Intron|HILS1_uc002iql.2_5'Flank	NM_000023	NP_000014	Q16586	SGCA_HUMAN	sarcoglycan, alpha isoform 1 precursor	361	Cytoplasmic (Potential).				muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(2)	2						CCACCCTGCCCATGTTCAATG	0.662													12	38	---	---	---	---	PASS
MC2R	4158	broad.mit.edu	37	18	13884733	13884733	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13884733C>T	uc002ksp.1	-	2	962	c.785G>A	c.(784-786)GGC>GAC	p.G262D		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	262	Helical; Name=7; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	GATCAACATGCCGTTCACCTG	0.517													4	157	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48581143	48581143	+	Intron	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48581143C>T	uc010xdp.1	+						SMAD4_uc010xdo.1_Intron|SMAD4_uc002lfb.3_5'UTR	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4						BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(3)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		gtttaattttCTATATAGCTC	0.303									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				19	65	---	---	---	---	PASS
KLF1	10661	broad.mit.edu	37	19	12997970	12997970	+	5'UTR	SNP	A	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12997970A>C	uc002mvo.2	-	1						NM_006563	NP_006554	Q13351	KLF1_HUMAN	erythroid Kruppel-like factor						erythrocyte differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGTGCCCACCCTGGGCCT	0.637													6	59	---	---	---	---	PASS
CBLC	23624	broad.mit.edu	37	19	45284600	45284600	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45284600G>C	uc002ozs.2	+	3	700	c.637G>C	c.(637-639)GTC>CTC	p.V213L	CBLC_uc010ejt.2_Missense_Mutation_p.V213L	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral	213	EF-hand-like.|Cbl-PTB.				cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CGAGTTCGACGTCTTCACCAG	0.423			M		AML								22	117	---	---	---	---	PASS
DKKL1	27120	broad.mit.edu	37	19	49878170	49878170	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49878170G>A	uc002pnk.2	+	5	828	c.614G>A	c.(613-615)CGC>CAC	p.R205H		NM_014419	NP_055234	Q9UK85	DKKL1_HUMAN	dickkopf-like 1 precursor	205					anatomical structure morphogenesis	extracellular space	protein binding|signal transducer activity				0		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		GATGGACTCCGCAAGGGGACC	0.652													4	73	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52942423	52942423	+	Missense_Mutation	SNP	T	A	A	rs112113280		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52942423T>A	uc002pzk.2	+	4	1810	c.1749T>A	c.(1747-1749)AAT>AAA	p.N583K	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.N570K	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	583	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACATAGGAATATTCATACTG	0.438													3	23	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58967919	58967919	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58967919C>A	uc002qsv.1	+	4	1715	c.1608C>A	c.(1606-1608)AGC>AGA	p.S536R	ZNF324B_uc002qsu.1_Missense_Mutation_p.S526R|ZNF324B_uc010euq.1_Missense_Mutation_p.S536R	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	536					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GGAAGCCAAGCCCAGTCCTGA	0.607													16	66	---	---	---	---	PASS
VAPB	9217	broad.mit.edu	37	20	57015985	57015985	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57015985T>C	uc002xza.2	+	5	690	c.419T>C	c.(418-420)ATT>ACT	p.I140T	VAPB_uc002xzb.2_RNA|VAPB_uc010zzo.1_Missense_Mutation_p.I17T|VAPB_uc002xzc.2_Intron	NM_004738	NP_004729	O95292	VAPB_HUMAN	VAMP-associated protein B/C	140	Cytoplasmic (Potential).				cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity			kidney(1)	1	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			ATAAATAAAATTATATCCACA	0.338													21	62	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641252	33641252	+	3'UTR	SNP	T	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641252T>C	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						tttttttttcttttttttttt	0.159													4	27	---	---	---	---	PASS
BID	637	broad.mit.edu	37	22	18220987	18220987	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18220987G>C	uc002znd.1	-	5	542	c.372C>G	c.(370-372)AAC>AAG	p.N124K	BID_uc002znc.1_Missense_Mutation_p.N170K|BID_uc002zne.1_Missense_Mutation_p.N28K|BID_uc010gra.1_RNA|BID_uc002znf.1_Missense_Mutation_p.N28K|BID_uc010grb.1_Missense_Mutation_p.N124K|BID_uc010grc.1_Missense_Mutation_p.N28K	NM_001196	NP_001187	P55957	BID_HUMAN	BH3 interacting domain death agonist isoform 2	124					activation of pro-apoptotic gene products|establishment of protein localization in membrane|induction of apoptosis by intracellular signals|induction of apoptosis via death domain receptors|neuron apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|release of cytochrome c from mitochondria	cytosol|membrane fraction|mitochondrial outer membrane	death receptor binding				0		all_epithelial(15;0.198)		Lung(27;0.0419)		CCAGGTCCCTGTTCCGGTCCT	0.557													19	90	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123540242	123540242	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123540242C>G	uc004euj.2	-	25	5123	c.5059G>C	c.(5059-5061)GAT>CAT	p.D1687H	ODZ1_uc011muj.1_Missense_Mutation_p.D1693H|ODZ1_uc010nqy.2_Missense_Mutation_p.D1694H	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1687	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTGGAAGTATCTAGCTCCACT	0.458													3	199	---	---	---	---	PASS
L1CAM	3897	broad.mit.edu	37	X	153135050	153135050	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153135050C>T	uc004fjb.2	-	10	1300	c.1192G>A	c.(1192-1194)GAC>AAC	p.D398N	L1CAM_uc004fjc.2_Missense_Mutation_p.D398N|L1CAM_uc010nuo.2_Missense_Mutation_p.D393N|L1CAM_uc004fjd.1_Missense_Mutation_p.D212N	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	398	Extracellular (Potential).|Ig-like C2-type 4.				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCATTGTGTCACTGGGCTGC	0.612													3	7	---	---	---	---	PASS
ALPL	249	broad.mit.edu	37	1	21902749	21902764	+	Intron	DEL	TGGATGGATGGATGGG	-	-	rs67585448		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21902749_21902764delTGGATGGATGGATGGG	uc001bet.2	+						ALPL_uc010odn.1_Intron|ALPL_uc010odo.1_Intron|ALPL_uc010odp.1_Intron|ALPL_uc001beu.3_Intron	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase						response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	ggatggatgatggatggatggatgggtggatggatg	0.176													2	4	---	---	---	---	
CACHD1	57685	broad.mit.edu	37	1	65100058	65100065	+	Intron	DEL	TATGTATT	-	-	rs112905341		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65100058_65100065delTATGTATT	uc001dbo.1	+						CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_Intron	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2						tttatttatgtatgtatttatttattta	0.130													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228771344	228771345	+	IGR	DEL	CG	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228771344_228771345delCG								RNF187 (87456 upstream) : DUSP5P (9312 downstream)																							CGCGCTCGCACGCGCGCGCGCG	0.475													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237905568	237905569	+	Intron	INS	-	C	C	rs146179584	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237905568_237905569insC	uc001hyl.1	+						RYR2_uc010pya.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TATTCCTGTCTCCttttttttt	0.312													7	5	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241920951	241920951	+	Intron	DEL	G	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241920951delG	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			caatggatttgtttttttttt	0.000													7	4	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	61009700	61009700	+	Intron	DEL	A	-	-	rs113987431		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61009700delA	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron|PAPOLG_uc010fch.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			tcaaaaaaagaaaaaaaaaaa	0.129													3	4	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61643956	61643957	+	Intron	INS	-	G	G	rs28644388		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61643956_61643957insG	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TTTTTTTTTTTGGGGGGGGGGA	0.416													5	3	---	---	---	---	
EN1	2019	broad.mit.edu	37	2	119604102	119604103	+	Frame_Shift_Del	DEL	CG	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119604102_119604103delCG	uc002tlm.2	-	1	1657_1658	c.641_642delCG	c.(640-642)GCGfs	p.A214fs		NM_001426	NP_001417	Q05925	HME1_HUMAN	engrailed homeobox 1	214	Poly-Ala.				skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.A204_A215del(1)		large_intestine(1)|lung(1)	2						ctgctgcggccgccgccgccgc	0.426													4	2	---	---	---	---	
GAD1	2571	broad.mit.edu	37	2	171703992	171703992	+	Intron	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171703992delA	uc002ugi.2	+							NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	aaaggcaatcaaaaaatgttt	0.100													7	6	---	---	---	---	
PSMD1	5707	broad.mit.edu	37	2	231945156	231945156	+	Intron	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231945156delT	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TCATCTTGGATTTTTTTTTTT	0.323													4	2	---	---	---	---	
SLC33A1	9197	broad.mit.edu	37	3	155545820	155545820	+	Intron	DEL	A	-	-	rs75665348		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155545820delA	uc003fan.3	-						SLC33A1_uc003fao.1_3'UTR	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter						cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTGACAAGGCAAAAAAAAAAT	0.239													4	2	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47574662	47574663	+	Intron	DEL	GT	-	-	rs143303182		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47574662_47574663delGT	uc003gxk.1	+						ATP10D_uc003gxl.1_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TTGTGCGCACgtgtgtgtgtgt	0.188													16	7	---	---	---	---	
POU4F2	5458	broad.mit.edu	37	4	147560847	147560848	+	Intron	INS	-	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147560847_147560848insT	uc003ikv.2	+							NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor						estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					CTTTCTGTGGCTTCCCTCTTTT	0.490													5	3	---	---	---	---	
C4orf41	60684	broad.mit.edu	37	4	184618471	184618471	+	Intron	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184618471delA	uc003ivx.2	+						C4orf41_uc003ivw.2_Intron|C4orf41_uc010isc.2_Intron|C4orf41_uc003ivy.2_Intron	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a												0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		ctcccaaaggaaaaaaaaaaa	0.124													5	3	---	---	---	---	
MTX3	345778	broad.mit.edu	37	5	79279310	79279311	+	3'UTR	INS	-	TGA	TGA	rs3841613		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79279310_79279311insTGA	uc010jag.2	-	9					MTX3_uc010jah.2_3'UTR|MTX3_uc003kge.3_3'UTR	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3						protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AGCATTCTCTTTGTTATTAAAA	0.366													3	3	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						catacacacatacacacacaca	0.228													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165455505	165455505	+	IGR	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165455505delA								None (None upstream) : None (None downstream)																							TTTTTTTTTTATTTCAATCTG	0.274													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178836367	178836376	+	IGR	DEL	ACACACACAC	-	-	rs71811485		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178836367_178836376delACACACACAC								ADAMTS2 (64038 upstream) : RUFY1 (141195 downstream)																							CACTGCCCAGacacacacacacacacacac	0.424													4	3	---	---	---	---	
CANX	821	broad.mit.edu	37	5	179153578	179153578	+	Intron	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179153578delA	uc003mkk.2	+						CANX_uc011dgp.1_Intron|CANX_uc003mkl.2_Intron|CANX_uc011dgq.1_Intron	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	ctctgtctccaaaaaaaaaaa	0.119													5	4	---	---	---	---	
ELOVL5	60481	broad.mit.edu	37	6	53134248	53134249	+	Intron	INS	-	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53134248_53134249insT	uc003pbq.1	-						ELOVL5_uc003pbr.1_Intron|ELOVL5_uc011dwx.1_Intron|ELOVL5_uc003pbs.1_Intron	NM_021814	NP_068586	Q9NYP7	ELOV5_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Lung NSC(77;0.116)					ATCATTCTTCCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	75468290	75468291	+	IGR	INS	-	AAGG	AAGG	rs71685977		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75468290_75468291insAAGG								CD109 (930250 upstream) : COL12A1 (325752 downstream)																							aggaagaaagaaagaaagaaag	0.173													6	3	---	---	---	---	
GABRR1	2569	broad.mit.edu	37	6	89927156	89927156	+	5'UTR	DEL	A	-	-	rs34012805		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89927156delA	uc003pna.2	-	1					GABRR1_uc011dzv.1_5'UTR|GABRR1_uc011dzw.1_RNA	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	TTACTCATGCAAAAAAAAAAT	0.368													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37860763	37860764	+	Intron	DEL	TA	-	-	rs71554525		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37860763_37860764delTA	uc003tfl.2	+											Homo sapiens, clone IMAGE:3881224, mRNA.																		AAGTTGTGGTTATATATATATA	0.228													5	5	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39122394	39122395	+	Intron	INS	-	CA	CA	rs35710081		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39122394_39122395insCA	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						ACCATGTCATGcacacacacac	0.332													4	2	---	---	---	---	
URGCP	55665	broad.mit.edu	37	7	43921074	43921074	+	Intron	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43921074delT	uc003tiw.2	-						URGCP_uc003tiu.2_Intron|URGCP_uc003tiv.2_Intron|URGCP_uc003tix.2_Intron|URGCP_uc003tiy.2_Intron|URGCP_uc003tiz.2_Intron|URGCP_uc011kbj.1_Intron	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3						cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						cttcccaggGttttttttttt	0.174													4	3	---	---	---	---	
SBDSP1	155370	broad.mit.edu	37	7	72304629	72304630	+	Intron	INS	-	T	T	rs66937252		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72304629_72304630insT	uc003twg.2	+						SBDSP1_uc003twh.2_Intron|SBDSP1_uc003twe.2_Intron	NR_024110				Homo sapiens Shwachman-Bodian-Diamond syndrome pseudogene, mRNA (cDNA clone IMAGE:4329436).												0						ttttttttttcttttttttttt	0.109													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98130600	98130601	+	IGR	INS	-	TCCT	TCCT			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98130600_98130601insTCCT								BAIAP2L1 (100173 upstream) : NPTX2 (115996 downstream)																							ttttctttCTCtccttccttcc	0.089													6	4	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157363894	157363895	+	Intron	INS	-	AA	AA	rs56184271		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157363894_157363895insAA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_5'Flank	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		gcaacagagttaaaaaaaaaaa	0.149													6	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3443840	3443841	+	Intron	INS	-	A	A	rs11463049		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3443840_3443841insA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTTCTTTAGGAAAAAAAAAAA	0.342													5	4	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139648723	139648724	+	Intron	INS	-	AG	AG	rs72095793		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139648723_139648724insAG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			aagagaaggaagaaaggaaagg	0.248										HNSCC(7;0.00092)			5	3	---	---	---	---	
SMARCA2	6595	broad.mit.edu	37	9	2161562	2161562	+	Intron	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2161562delT	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron|SMARCA2_uc011llw.1_Intron|SMARCA2_uc003zhf.2_Intron|SMARCA2_uc011llx.1_Intron|SMARCA2_uc003zhe.2_Intron|SMARCA2_uc003zhg.2_Intron|SMARCA2_uc010mhb.2_Intron	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TAACTTTTACTTTTTTTTGGT	0.284													10	5	---	---	---	---	
STX17	55014	broad.mit.edu	37	9	102729746	102729747	+	Intron	INS	-	C	C	rs143893584	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102729746_102729747insC	uc004bal.3	+						STX17_uc010msx.2_Intron|STX17_uc011lvd.1_Intron	NM_017919	NP_060389	P56962	STX17_HUMAN	syntaxin 17						intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum|integral to membrane|nucleolus	SNAP receptor activity			large_intestine(1)	1		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AATAATTAAGACCCCCCCCTTT	0.361													5	3	---	---	---	---	
VIM	7431	broad.mit.edu	37	10	17272904	17272904	+	Intron	DEL	T	-	-	rs5783538		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17272904delT	uc001iou.2	+						uc001iot.1_5'Flank|VIM_uc001iov.1_Intron|VIM_uc001iow.1_Intron|VIM_uc001iox.1_Intron|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_Intron|VIM_uc001ipb.1_Intron|VIM_uc009xjv.1_Intron|VIM_uc001ipc.1_Intron	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin						cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CCTTGAGCGAttttttttttt	0.234											OREG0020050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CPN1	1369	broad.mit.edu	37	10	101829238	101829238	+	Intron	DEL	A	-	-	rs72232234		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101829238delA	uc001kql.2	-							NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor						proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		actctgtcttaaaaaaaaaaa	0.164													5	3	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTTTTGGGTCtttttttttt	0.393													4	3	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118247607	118247607	+	Intron	DEL	A	-	-	rs1784239		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118247607delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		catctctaccaaaaaaaaaaa	0.000													6	3	---	---	---	---	
PDZRN4	29951	broad.mit.edu	37	12	41961407	41961407	+	Intron	DEL	T	-	-	rs34848026		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41961407delT	uc010skn.1	+						PDZRN4_uc001rmq.3_Intron|PDZRN4_uc009zjz.2_Intron|PDZRN4_uc001rmr.2_Intron	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2								ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				ATAAGAGTCCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
TROAP	10024	broad.mit.edu	37	12	49719150	49719150	+	Intron	DEL	A	-	-	rs111795391		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49719150delA	uc001rtx.3	+						TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						tctatttcttaaaaaaaaaaa	0.199													5	3	---	---	---	---	
PLEKHG7	440107	broad.mit.edu	37	12	93155400	93155407	+	Intron	DEL	AAGAAAGA	-	-	rs71775186		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93155400_93155407delAAGAAAGA	uc001tcj.2	+							NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						agaaagaaagaagaaagaaagaaagaaa	0.077													5	3	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32606136	32606136	+	Intron	DEL	C	-	-	rs11272632		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32606136delC	uc001utx.2	+						FRY_uc010tdw.1_Intron|uc001utw.2_5'Flank	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		cttttcttttctctttctttc	0.274													3	7	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47270331	47270334	+	Intron	DEL	ACAC	-	-	rs67673562		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47270331_47270334delACAC	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GCATGTGTGTacacacacacacac	0.373													1	5	---	---	---	---	
TTC5	91875	broad.mit.edu	37	14	20760433	20760436	+	Intron	DEL	TTAA	-	-	rs72224555		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20760433_20760436delTTAA	uc001vwt.2	-						TTC5_uc001vwu.2_Intron	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5						DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		aaaatttaacttaattaaacttta	0.260													4	3	---	---	---	---	
PSMA6	5687	broad.mit.edu	37	14	35786223	35786224	+	Intron	INS	-	AAG	AAG	rs145297321	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35786223_35786224insAAG	uc001wtd.2	+						KIAA0391_uc001wta.2_Intron|PSMA6_uc010tpt.1_Intron|PSMA6_uc010tpu.1_Intron	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		ATCTGATGTCAAAGTAAACATT	0.129													4	3	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47669737	47669738	+	Intron	INS	-	T	T	rs10639284		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47669737_47669738insT	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						tttttcttttcttttttttttt	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	40772836	40772837	+	IGR	INS	-	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40772836_40772837insT								CHST14 (7483 upstream) : MRPL42P5 (50703 downstream)																							AAGGATGTTTCTTTTTTTTTTT	0.381													4	2	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600728	600729	+	Intron	INS	-	C	C			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600728_600729insC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				GTCGGTGAGGGTCCCCGTCGGT	0.743													4	2	---	---	---	---	
MGRN1	23295	broad.mit.edu	37	16	4732723	4732723	+	Intron	DEL	G	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4732723delG	uc002cwz.2	+						MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_Intron|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_Intron|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						GGTCCTGGCAGGCGTGTGCAG	0.657													18	9	---	---	---	---	
GSPT1	2935	broad.mit.edu	37	16	11984971	11984971	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11984971delT	uc002dbr.2	-	4	337	c.310delA	c.(310-312)AGGfs	p.R104fs	GSPT1_uc002dbu.2_Frame_Shift_Del_p.R241fs|GSPT1_uc002dbt.2_Frame_Shift_Del_p.R242fs|GSPT1_uc010bux.2_Frame_Shift_Del_p.R104fs	NM_001130007	NP_001123479	P15170	ERF3A_HUMAN	G1 to S phase transition 1 isoform 3	104					G1/S transition of mitotic cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation	intracellular	GTP binding|GTPase activity|protein binding|translation release factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						TCAAGCGTCCTTTTGTCAACC	0.294													4	2	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57946490	57946491	+	Intron	INS	-	T	T			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57946490_57946491insT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						gtgtgtgtgtgtgtgtgttgtg	0.233													4	2	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2888572	2888573	+	Intron	DEL	TG	-	-	rs146159488		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2888572_2888573delTG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						TAAACAGTGATGTTTTTTTTTT	0.391													7	7	---	---	---	---	
COX10	1352	broad.mit.edu	37	17	14110669	14110669	+	3'UTR	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14110669delT	uc002gof.3	+	7					COX10_uc010vvs.1_3'UTR|COX10_uc010vvt.1_3'UTR	NM_001303	NP_001294	Q12887	COX10_HUMAN	heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		CACTTGACAGttttttttttt	0.358													3	4	---	---	---	---	
CASC3	22794	broad.mit.edu	37	17	38296626	38296627	+	5'UTR	INS	-	ACAC	ACAC	rs146433128		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38296626_38296627insACAC	uc010cwt.1	+	1					CASC3_uc010cws.1_5'UTR|CASC3_uc002hue.2_5'UTR	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51						mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						cacacaccccaacacacacaca	0.347													4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544375	80544375	+	Intron	DEL	C	-	-	rs72318042		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544375delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			caaaggtgggccgggggggaa	0.095													6	3	---	---	---	---	
LPIN2	9663	broad.mit.edu	37	18	2960970	2960975	+	Intron	DEL	TATTAA	-	-	rs17881253		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2960970_2960975delTATTAA	uc002klo.2	-							NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TCATTAGCCTTATTAATTTTCAACCT	0.388													2	4	---	---	---	---	
HAUS1	115106	broad.mit.edu	37	18	43700206	43700206	+	Intron	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43700206delT	uc002lbu.2	+						HAUS1_uc002lbv.2_Intron	NM_138443	NP_612452	Q96CS2	HAUS1_HUMAN	coiled-coil domain containing 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole				ovary(1)	1						CTTTTCCAGCttttttttttt	0.169													6	3	---	---	---	---	
MED16	10025	broad.mit.edu	37	19	877295	877296	+	Intron	INS	-	CT	CT	rs140629440	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:877295_877296insCT	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Intron|MED16_uc010xfx.1_Intron|MED16_uc010xfy.1_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGCACGCCCGTGTGTGGGCC	0.649													4	3	---	---	---	---	
ZNF556	80032	broad.mit.edu	37	19	2878501	2878502	+	3'UTR	INS	-	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2878501_2878502insA	uc002lwp.1	+	4					ZNF556_uc002lwq.2_3'UTR	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ccgtctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ZNF99	7652	broad.mit.edu	37	19	22951832	22951832	+	Intron	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22951832delA	uc010xrh.1	-							NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				actctgtttcaaaaaaaaaaa	0.134													6	4	---	---	---	---	
LSR	51599	broad.mit.edu	37	19	35741698	35741699	+	Intron	INS	-	T	T	rs11404844		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35741698_35741699insT	uc002nyl.2	+						LSR_uc002nym.2_Intron|LSR_uc002nyn.2_Intron|LSR_uc002nyo.2_Intron|LSR_uc010xsr.1_Intron|LSR_uc002nyp.2_Intron	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor						embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGGAGCAAttcttttttttttt	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107427	42107428	+	IGR	INS	-	CA	CA	rs71928647		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107427_42107428insCA								CEACAM21 (14231 upstream) : CEACAM4 (17916 downstream)																							gcgcgcgcgcgcacacacacac	0.213													4	3	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													4	3	---	---	---	---	
TNNT1	7138	broad.mit.edu	37	19	55645048	55645049	+	Intron	INS	-	A	A			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55645048_55645049insA	uc002qjb.3	-						TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a						muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		gcagtctcaataaaaaaaaaaa	0.188													4	2	---	---	---	---	
NTSR1	4923	broad.mit.edu	37	20	61369419	61369420	+	Intron	INS	-	GCAT	GCAT	rs144837973	by1000genomes	TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61369419_61369420insGCAT	uc002ydf.2	+							NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1							endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CACGTCTGCCCCCCTCCCCCTC	0.653													4	2	---	---	---	---	
SLC2A11	66035	broad.mit.edu	37	22	24199260	24199260	+	Intron	DEL	T	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24199260delT	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_5'UTR|SLC2A11_uc011ajd.1_5'Flank|SLC2A11_uc002zyp.3_5'Flank	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						TGTGTGTGTGTGGGGGGGGGG	0.612													4	2	---	---	---	---	
DKC1	1736	broad.mit.edu	37	X	153994771	153994771	+	Intron	DEL	A	-	-			TCGA-A3-3365-01A-01D-0966-08	TCGA-A3-3365-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153994771delA	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital_Dyskeratosis				4	2	---	---	---	---	
