Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DVL1	1855	broad.mit.edu	37	1	1275427	1275427	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1275427C>A	uc001aer.3	-	8	947	c.900G>T	c.(898-900)ATG>ATT	p.M300I	DVL1_uc002quu.2_Missense_Mutation_p.M17I|DVL1_uc009vka.2_5'UTR|DVL1_uc001aeu.1_5'UTR	NM_004421	NP_004412	O14640	DVL1_HUMAN	dishevelled 1	300	PDZ.				canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCTGCAGCAACATGTCGCCGG	0.672													3	22	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11319454	11319454	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11319454C>G	uc001asd.2	-	2	134	c.13G>C	c.(13-15)GGA>CGA	p.G5R		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	5					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GCGGCAGGTCCGGTTCCAAGC	0.507													16	41	---	---	---	---	PASS
PRAMEF11	440560	broad.mit.edu	37	1	12885090	12885090	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12885090T>G	uc001auk.2	-	4	1217	c.1021A>C	c.(1021-1023)AAC>CAC	p.N341H		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	341	LRR 6.										0						CTGAAGGTGTTGAGCTCAAAG	0.522													6	101	---	---	---	---	PASS
PRAMEF6	440561	broad.mit.edu	37	1	13001258	13001258	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13001258C>T	uc001auq.2	-	3	511	c.425G>A	c.(424-426)AGA>AAA	p.R142K	PRAMEF5_uc001aur.2_Intron	NM_001010889	NP_001010889	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	142											0	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCTGTCCTCTCATCCTTGG	0.507													7	44	---	---	---	---	PASS
RSC1A1	6248	broad.mit.edu	37	1	15986370	15986370	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15986370T>C	uc010obn.1	+	1	7	c.7T>C	c.(7-9)TCA>CCA	p.S3P	DDI2_uc001awx.1_3'UTR|DDI2_uc009voj.1_3'UTR	NM_006511	NP_006502	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1,	3					negative regulation of transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	cell junction|Golgi apparatus|nucleus	ion channel inhibitor activity			ovary(1)	1		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAATGTCATCATTACCAAC	0.428													4	73	---	---	---	---	PASS
DEM1	64789	broad.mit.edu	37	1	40980259	40980259	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40980259T>G	uc001cfp.2	+	3	248	c.43T>G	c.(43-45)TCA>GCA	p.S15A	DEM1_uc001cfq.2_Missense_Mutation_p.S15A|DEM1_uc001cfr.2_Missense_Mutation_p.S15A|DEM1_uc001cfs.2_Missense_Mutation_p.S15A	NM_022774	NP_073611	Q9H790	EXO5_HUMAN	defects in morphology 1 homolog	15							DNA binding|exonuclease activity				0						AGCAGAAGCCTCAGGGTTCTC	0.488													19	107	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43770985	43770985	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43770985A>G	uc001ciu.2	+	3	534	c.455A>G	c.(454-456)AAG>AGG	p.K152R	TIE1_uc010okd.1_Missense_Mutation_p.K152R|TIE1_uc010oke.1_Missense_Mutation_p.K107R|TIE1_uc009vwq.2_Missense_Mutation_p.K152R|TIE1_uc010okf.1_5'UTR|TIE1_uc010okg.1_5'Flank|TIE1_uc010okb.1_Missense_Mutation_p.K152R|TIE1_uc010okc.1_Missense_Mutation_p.K152R	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	152	Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CACAAGGAGAAGCAGACAGAC	0.557													5	161	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145302696	145302696	+	Silent	SNP	C	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145302696C>G	uc001end.3	+	8	1169	c.1134C>G	c.(1132-1134)ACC>ACG	p.T378T	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Silent_p.T107T	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	378											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAGCTGACCCAGTTAAAGG	0.512													3	11	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155450200	155450200	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155450200A>G	uc009wqq.2	-	3	2941	c.2461T>C	c.(2461-2463)TCT>CCT	p.S821P	ASH1L_uc001fkt.2_Missense_Mutation_p.S821P|ASH1L_uc009wqr.1_Missense_Mutation_p.S821P	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	821					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TAAATATCAGACAAAAGGTCA	0.403													4	50	---	---	---	---	PASS
ITLN1	55600	broad.mit.edu	37	1	160853221	160853221	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160853221A>G	uc001fxc.2	-	3	270	c.154T>C	c.(154-156)TTT>CTT	p.F52L		NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor	52	Fibrinogen C-terminal.				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CACTCACCAAATGCACTAGGA	0.393													5	187	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186304555	186304555	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186304555C>T	uc001grv.2	-	34	5123	c.4826G>A	c.(4825-4827)CGA>CAA	p.R1609Q		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1609	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCGACTAATTCGACCTTCATA	0.418			T	NTRK1	papillary thyroid								5	280	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44104958	44104958	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44104958T>C	uc002rtq.2	+	13	2018	c.1928T>C	c.(1927-1929)ATC>ACC	p.I643T	ABCG8_uc010yoa.1_Missense_Mutation_p.I642T	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	643	ABC transmembrane type-2.|Helical; Name=6; (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTCTACGCCATCTACCTCATC	0.522											OREG0014582	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	254	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100625392	100625392	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100625392A>G	uc002tag.2	-	4	292	c.56T>C	c.(55-57)GTC>GCC	p.V19A	AFF3_uc002taf.2_Missense_Mutation_p.V44A|AFF3_uc010fiq.1_Missense_Mutation_p.V19A|AFF3_uc010yvr.1_Missense_Mutation_p.V173A|AFF3_uc002tah.1_Missense_Mutation_p.V44A|AFF3_uc010fir.1_Missense_Mutation_p.V96A|AFF3_uc002tai.2_5'Flank	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	19					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						TGGTTCATAGACACTGCATCA	0.403													6	374	---	---	---	---	PASS
ZRANB3	84083	broad.mit.edu	37	2	135976650	135976650	+	Silent	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135976650T>C	uc002tum.2	-	16	2466	c.2349A>G	c.(2347-2349)TCA>TCG	p.S783S	ZRANB3_uc002tuk.2_Silent_p.S326S|ZRANB3_uc002tul.2_Silent_p.S781S	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	783						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		TTCTTACCAGTGAGCGATATT	0.279													5	204	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160295545	160295545	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160295545T>C	uc002uao.2	-	7	1227	c.875A>G	c.(874-876)GAA>GGA	p.E292G	BAZ2B_uc002uap.2_Missense_Mutation_p.E290G|BAZ2B_uc002uas.1_Missense_Mutation_p.E229G|BAZ2B_uc002uau.1_Missense_Mutation_p.E290G|BAZ2B_uc002uaq.1_Missense_Mutation_p.E220G|BAZ2B_uc002uat.3_Missense_Mutation_p.E229G|BAZ2B_uc010fop.1_Missense_Mutation_p.E290G	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	292					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						ATGTTGTGCTTCACTCTCTGA	0.284													7	689	---	---	---	---	PASS
NAB1	4664	broad.mit.edu	37	2	191524231	191524231	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191524231C>T	uc002usb.2	+	4	901	c.329C>T	c.(328-330)TCC>TTC	p.S110F	NAB1_uc010fsc.2_Missense_Mutation_p.S110F|NAB1_uc010fsd.2_Missense_Mutation_p.S110F|NAB1_uc002usc.2_Missense_Mutation_p.S110F|NAB1_uc010zgh.1_Missense_Mutation_p.S110F	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1	110					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			CTGGGAATATCCTGCAGTAGT	0.488													17	57	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47058513	47058513	+	3'UTR	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47058513G>A	uc003cqs.2	-	21					SETD2_uc003cqv.2_3'UTR|SETD2_uc003cqr.2_3'UTR	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GGGACAGAAAGGCCCACAGGA	0.517			N|F|S|Mis		clear cell renal carcinoma								34	96	---	---	---	---	PASS
LOC100125556	100125556	broad.mit.edu	37	3	125647387	125647387	+	RNA	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125647387G>A	uc003eif.3	+	5		c.561G>A			LOC100125556_uc003eid.3_RNA|LOC100125556_uc003eie.3_RNA	NR_024251				Homo sapiens family with sequence similarity 86, member A pseudogene, mRNA (cDNA clone IMAGE:4425123).												0						ACCAGAAACTGTTTCCCTATG	0.502													4	82	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142037709	142037709	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142037709A>G	uc003eus.2	-	38	4505	c.4438T>C	c.(4438-4440)TTA>CTA	p.L1480L	XRN1_uc010huu.2_Silent_p.L947L|XRN1_uc003eut.2_Silent_p.L1480L|XRN1_uc003euu.2_Silent_p.L1481L	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	1480					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						TGTACCAGTAAGCCATTAGAT	0.388													41	150	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167525044	167525044	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167525044A>G	uc003ffa.3	+	6	1092	c.894A>G	c.(892-894)GAA>GAG	p.E298E	SERPINI1_uc003ffb.3_Silent_p.E298E	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	298					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						TCACAGTGGAACAGGAAATTG	0.338													5	84	---	---	---	---	PASS
GRK4	2868	broad.mit.edu	37	4	3024152	3024152	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3024152C>T	uc003ggn.1	+	10	1399	c.944C>T	c.(943-945)CCT>CTT	p.P315L	GRK4_uc003ggo.1_Missense_Mutation_p.P315L|GRK4_uc003ggp.1_Missense_Mutation_p.P283L|GRK4_uc003ggq.1_Missense_Mutation_p.P283L	NM_182982	NP_892027	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4 isoform	315	Protein kinase.					cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GACTTGAAGCCTGAGAATATT	0.443													9	708	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52948673	52948673	+	Silent	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52948673T>C	uc003gzl.2	+	10	1754	c.1476T>C	c.(1474-1476)GCT>GCC	p.A492A	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Silent_p.A460A|SPATA18_uc003gzk.1_Silent_p.A492A	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	492					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GGAGAGGGGCTTTTGTACGGT	0.438													5	152	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36104078	36104078	+	3'UTR	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36104078A>G	uc003jkb.1	-	18					uc003jka.1_5'Flank	NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2							integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATTCTAGGGTACACAGATGTT	0.343													4	148	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54641002	54641002	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54641002A>G	uc003jpy.3	+	10	1352	c.1086A>G	c.(1084-1086)AAA>AAG	p.K362K	SKIV2L2_uc011cqi.1_Silent_p.K261K	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	362					maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GAGACCAGAAAGGGCGGAAAG	0.358													5	188	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135692564	135692564	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135692564G>A	uc003lbn.1	-	1	512	c.509C>T	c.(508-510)GCG>GTG	p.A170V	TRPC7_uc010jef.1_Missense_Mutation_p.A162V|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.A162V|TRPC7_uc010jei.1_Missense_Mutation_p.A162V|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	171	Cytoplasmic (Potential).|ANK 4.				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCAGTGCGCCGCCAGGATGAT	0.632													6	62	---	---	---	---	PASS
GPR110	266977	broad.mit.edu	37	6	46984392	46984392	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46984392A>G	uc003oyt.2	-	8	923	c.724T>C	c.(724-726)TTT>CTT	p.F242L	GPR110_uc011dwl.1_5'UTR	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	242	SEA.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						TCTAATGGAAACAGCTTGTGA	0.458													4	53	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146678723	146678723	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146678723A>T	uc010khw.1	+	6	1965	c.1495A>T	c.(1495-1497)ACC>TCC	p.T499S	GRM1_uc010khv.1_Missense_Mutation_p.T499S|GRM1_uc003qll.2_Missense_Mutation_p.T499S|GRM1_uc011edz.1_Missense_Mutation_p.T499S|GRM1_uc011eea.1_Missense_Mutation_p.T499S	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	499	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	GCACGTTGGAACCTGGCATGA	0.433													7	226	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152674510	152674510	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152674510A>G	uc010kiw.2	-	69	11743	c.11141T>C	c.(11140-11142)CTC>CCC	p.L3714P	SYNE1_uc003qot.3_Missense_Mutation_p.L3699P|SYNE1_uc003qou.3_Missense_Mutation_p.L3714P|SYNE1_uc010kja.1_Missense_Mutation_p.L419P	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3714	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATAGGAACTGAGGGATGATTC	0.373										HNSCC(10;0.0054)			6	208	---	---	---	---	PASS
WDR27	253769	broad.mit.edu	37	6	170060934	170060934	+	Intron	SNP	C	T	T	rs56186829	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170060934C>T	uc003qwx.2	-						WDR27_uc003qwv.1_5'Flank|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc003qwz.1_Intron|WDR27_uc011egw.1_Intron|WDR27_uc003qxa.1_RNA			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CGTGCGCCCCCTGGCCTGGCT	0.577													3	19	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	79082528	79082528	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79082528C>T	uc003ugx.2	-	1	363	c.109G>A	c.(109-111)GAG>AAG	p.E37K	MAGI2_uc003ugy.2_Missense_Mutation_p.E37K|uc010lea.1_5'Flank	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	37	PDZ 1.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGTCCATTCTCGGCGCCCCCC	0.577													3	36	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82580448	82580448	+	Silent	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82580448C>T	uc003uhx.2	-	6	9745	c.9456G>A	c.(9454-9456)ACG>ACA	p.T3152T	PCLO_uc003uhv.2_Silent_p.T3152T|PCLO_uc010lec.2_Silent_p.T117T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3083					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTGCAATGTCCGTTTCAGATG	0.428													7	90	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86493685	86493685	+	3'UTR	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86493685T>C	uc003uid.2	+	6					GRM3_uc010lef.2_Silent_p.S527S|GRM3_uc010leg.2_3'UTR|GRM3_uc010leh.2_3'UTR	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor						synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGAATTGCAGTTCAGTTCTTG	0.453													6	310	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678988	100678988	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678988G>A	uc003uxp.1	+	3	4344	c.4291G>A	c.(4291-4293)GCT>ACT	p.A1431T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1431	Extracellular (Potential).|Ser-rich.|22.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GACCACTTCTGCTGAAGCCAC	0.488													6	124	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67546846	67546846	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67546846A>G	uc003xwn.2	-	3	3818	c.3559T>C	c.(3559-3561)TTT>CTT	p.F1187L		NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	1187					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CTTGTGGCAAAGGCTGCTCCC	0.448													5	174	---	---	---	---	PASS
ANGPT1	284	broad.mit.edu	37	8	108334357	108334357	+	Splice_Site	SNP	C	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108334357C>G	uc003ymn.2	-	4	1044	c.576_splice	c.e4-1	p.S192_splice	ANGPT1_uc011lhv.1_Splice_Site|ANGPT1_uc003ymo.2_Splice_Site_p.S192_splice|ANGPT1_uc003ymp.3_Splice_Site	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding	p.?(1)		ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TTCTAATAAACTACAAGGAAG	0.294													62	249	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120592368	120592368	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120592368C>T	uc003yot.1	-	19	1854	c.1768G>A	c.(1768-1770)GGG>AGG	p.G590R	ENPP2_uc011lic.1_Missense_Mutation_p.G103R|ENPP2_uc003yor.1_Missense_Mutation_p.G225R|ENPP2_uc003yos.1_Missense_Mutation_p.G642R|ENPP2_uc010mdd.1_Missense_Mutation_p.G590R	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	590					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TCTGTAGACCCTTTTGTATGA	0.358													4	302	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145737152	145737152	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145737152C>A	uc003zdj.2	-	21	3446	c.3414G>T	c.(3412-3414)CAG>CAT	p.Q1138H		NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	1138					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CGCAGCGGACCTGGTCCTCCC	0.642			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				4	15	---	---	---	---	PASS
KANK1	23189	broad.mit.edu	37	9	744590	744590	+	Splice_Site	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:744590G>T	uc003zgl.1	+	15	4645	c.3996_splice	c.e15+1	p.P1332_splice	KANK1_uc003zgn.1_Splice_Site_p.P1332_splice|KANK1_uc003zgs.1_Splice_Site_p.P1174_splice|KANK1_uc010mgx.1_Splice_Site_p.P310_splice|KANK1_uc010mgy.1_Splice_Site_p.P244_splice|KANK1_uc003zgt.1_Missense_Mutation_p.V245F	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CCAGTCTCCGGTCAGTGTTGT	0.502													5	148	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15777711	15777711	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777711A>G	uc003zmd.2	+	19	3100	c.2785A>G	c.(2785-2787)AGG>GGG	p.R929G	C9orf93_uc003zme.2_Missense_Mutation_p.R844G|C9orf93_uc011lmu.1_Missense_Mutation_p.R937G|C9orf93_uc003zmf.1_Missense_Mutation_p.R237G	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	929											0				GBM - Glioblastoma multiforme(50;4.84e-07)		GCACAGTAGCAGGAGTATTAC	0.408													24	123	---	---	---	---	PASS
PLAA	9373	broad.mit.edu	37	9	26907861	26907861	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26907861A>G	uc003zqd.2	-	13	2218	c.1793T>C	c.(1792-1794)ATT>ACT	p.I598T	PLAA_uc003zqe.2_Missense_Mutation_p.I598T	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	598	PUL.				phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTTCCACAAAATCTGAAGTTG	0.333													10	309	---	---	---	---	PASS
NFX1	4799	broad.mit.edu	37	9	33338532	33338532	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33338532G>T	uc003zsq.2	+	12	2121	c.2060G>T	c.(2059-2061)CGG>CTG	p.R687L	SUGT1P1_uc010mjq.1_Intron|NFX1_uc011lnw.1_Missense_Mutation_p.R687L|NFX1_uc003zso.2_Missense_Mutation_p.R687L|NFX1_uc003zsp.1_Missense_Mutation_p.R687L|NFX1_uc010mjr.1_Missense_Mutation_p.R688L|NFX1_uc003zsr.2_Missense_Mutation_p.R688L	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	687					inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		TGTGACAAGCGGTGTAACAAG	0.363													5	439	---	---	---	---	PASS
GALT	2592	broad.mit.edu	37	9	34647664	34647664	+	Silent	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34647664T>C	uc003zve.2	+	4	406	c.339T>C	c.(337-339)GAT>GAC	p.D113D	GALT_uc003zvf.2_Intron|GALT_uc003zvg.2_5'UTR|GALT_uc003zvh.2_Silent_p.D65D|GALT_uc011lop.1_Silent_p.D65D	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	113			D -> N (in GALCT).		galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GACCCAGTGATCATCCCCTTT	0.517									Galactosemia				6	309	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66499764	66499764	+	Silent	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499764C>T	uc004aee.1	+	1	574	c.574C>T	c.(574-576)CTG>TTG	p.L192L	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						GGTGGGCAACCTGGTGGCCAT	0.582													4	17	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121929960	121929960	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121929960T>A	uc004bkc.2	-	8	2144	c.1688A>T	c.(1687-1689)TAT>TTT	p.Y563F		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	563					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GGGGTTGACATAGACAAAGAA	0.557													5	15	---	---	---	---	PASS
FAM190B	54462	broad.mit.edu	37	10	86185556	86185556	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86185556G>T	uc001kdh.1	+	5	1969	c.1775G>T	c.(1774-1776)TGG>TTG	p.W592L	FAM190B_uc010qmd.1_Missense_Mutation_p.W592L|FAM190B_uc001kdi.1_5'UTR|FAM190B_uc010qme.1_Missense_Mutation_p.W19L	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14	592										ovary(3)|skin(1)	4						GAAGGTTTTTGGAAAAGGCCA	0.468													4	181	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124377809	124377809	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124377809T>A	uc001lgk.1	+	38	4887	c.4781T>A	c.(4780-4782)CTC>CAC	p.L1594H	DMBT1_uc001lgl.1_Missense_Mutation_p.L1584H|DMBT1_uc001lgm.1_Missense_Mutation_p.L966H|DMBT1_uc009xzz.1_Missense_Mutation_p.L1594H|DMBT1_uc010qtx.1_Missense_Mutation_p.L445H|DMBT1_uc009yab.1_Missense_Mutation_p.L297H|DMBT1_uc009yac.1_5'Flank	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1594	SRCR 12.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AATGGCTGGCTCTCCCACAAC	0.552													6	75	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093448	1093448	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093448C>A	uc001lsx.1	+	31	12380	c.12353C>A	c.(12352-12354)ACC>AAC	p.T4118N		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4118						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtgaccccaaccccgacaccc	0.000													8	185	---	---	---	---	PASS
CAPRIN1	4076	broad.mit.edu	37	11	34112160	34112160	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34112160A>G	uc001mvh.1	+	14	1678	c.1489A>G	c.(1489-1491)ACA>GCA	p.T497A	CAPRIN1_uc001mvg.2_Missense_Mutation_p.T497A|CAPRIN1_uc001mvi.2_Missense_Mutation_p.T497A|CAPRIN1_uc001mvj.1_Missense_Mutation_p.T416A	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker	497					negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TCAGGCTGGGACAAGCAAACC	0.408													5	168	---	---	---	---	PASS
EHF	26298	broad.mit.edu	37	11	34673138	34673138	+	Silent	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34673138C>A	uc001mvr.1	+	5	567	c.456C>A	c.(454-456)ACC>ACA	p.T152T	EHF_uc009yke.1_Silent_p.T152T|EHF_uc009ykf.1_Silent_p.T155T	NM_012153	NP_036285	Q9NZC4	EHF_HUMAN	ets homologous factor	152					cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			TATATGACACCAACTATGGTA	0.423													4	154	---	---	---	---	PASS
FAM86C	55199	broad.mit.edu	37	11	71502813	71502813	+	Intron	SNP	A	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71502813A>C	uc001oqv.3	+						FAM86C_uc009ysr.2_Missense_Mutation_p.H63P|FAM86C_uc001oqw.3_Intron|FAM86C_uc009yss.2_RNA|FAM86C_uc010rqq.1_Intron	NM_018172	NP_060642	Q9NVL1	FA86C_HUMAN	hypothetical protein LOC55199 isoform 1												0						TGTGTGAAGCACCCGCCGTCA	0.522													8	162	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71727565	71727565	+	Silent	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71727565T>C	uc001orl.1	-	14	1303	c.1131A>G	c.(1129-1131)GAA>GAG	p.E377E	NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Silent_p.E377E|NUMA1_uc001orm.1_Silent_p.E377E|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Silent_p.E377E|NUMA1_uc001oro.1_Silent_p.E377E	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	377	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CGTTCTTCTCTTCAAGGCATT	0.512			T	RARA	APL								6	281	---	---	---	---	PASS
C11orf57	55216	broad.mit.edu	37	11	111946306	111946306	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111946306G>A	uc001pmr.3	+	2	689	c.8G>A	c.(7-9)CGG>CAG	p.R3Q	PIH1D2_uc009yyl.2_5'Flank|PIH1D2_uc001pmq.3_5'Flank|PIH1D2_uc001pmp.3_5'Flank|PIH1D2_uc010rws.1_5'Flank|C11orf57_uc001pmu.2_Missense_Mutation_p.R3Q|C11orf57_uc001pmw.3_Missense_Mutation_p.R3Q|C11orf57_uc001pmt.3_Missense_Mutation_p.R3Q|C11orf57_uc001pmv.3_Missense_Mutation_p.R3Q|C11orf57_uc001pms.3_5'UTR	NM_001082970	NP_001076439	Q6ZUT1	CK057_HUMAN	hypothetical protein LOC55216 isoform b	3										breast(2)|ovary(1)	3		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AGAATGTCCCGGATTCCACTG	0.388													28	117	---	---	---	---	PASS
C11orf63	79864	broad.mit.edu	37	11	122795703	122795703	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122795703A>G	uc001pym.2	+	4	1260	c.963A>G	c.(961-963)AGA>AGG	p.R321R		NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	321										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GGCATCAAAGAGCACAACAGC	0.403													6	145	---	---	---	---	PASS
NOP2	4839	broad.mit.edu	37	12	6669891	6669891	+	Silent	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6669891G>T	uc001qph.1	-	13	1578	c.1398C>A	c.(1396-1398)TCC>TCA	p.S466S	NOP2_uc009zeq.1_Silent_p.S182S|NOP2_uc001qpi.1_Silent_p.S466S|NOP2_uc001qpj.1_5'UTR	NM_001033714	NP_001028886	P46087	NOP2_HUMAN	nucleolar protein 1, 120kDa	470					positive regulation of cell proliferation|rRNA processing	nucleolus	protein binding|RNA binding|S-adenosylmethionine-dependent methyltransferase activity			ovary(2)	2						CTGGATCCTTGGAGATGACCC	0.557													16	59	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21028229	21028229	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028229T>C	uc001rek.2	+	8	914	c.788T>C	c.(787-789)CTT>CCT	p.L263P	SLCO1B3_uc001rel.2_Missense_Mutation_p.L263P|SLCO1B3_uc010sil.1_Missense_Mutation_p.L263P|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.L88P	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	263	Helical; Name=6; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					CTTGGTTTCCTTGTGTCTGGA	0.363													7	672	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57970082	57970082	+	Silent	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57970082C>A	uc001sor.1	+	19	2327	c.2119C>A	c.(2119-2121)CGG>AGG	p.R707R	KIF5A_uc010srr.1_Silent_p.R618R	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	707					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						GGAGAGTCACCGGGAGGCCCA	0.602													4	115	---	---	---	---	PASS
PTPRR	5801	broad.mit.edu	37	12	71286694	71286694	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71286694A>G	uc001swi.1	-	2	538	c.122T>C	c.(121-123)GTA>GCA	p.V41A		NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	41	Extracellular (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		ATAAATGAATACCGGCTTCCC	0.398													6	415	---	---	---	---	PASS
EEA1	8411	broad.mit.edu	37	12	93195377	93195377	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93195377T>C	uc001tck.2	-	20	3036	c.2771A>G	c.(2770-2772)GAG>GGG	p.E924G		NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD	924	Potential.				early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						AAATCTTACCTCCTTCTCTTT	0.299													7	409	---	---	---	---	PASS
TXNRD1	7296	broad.mit.edu	37	12	104712708	104712708	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104712708A>G	uc010swk.1	+	8	770	c.748A>G	c.(748-750)AGA>GGA	p.R250G	TXNRD1_uc010swl.1_Missense_Mutation_p.R100G|TXNRD1_uc010swm.1_Missense_Mutation_p.R152G|TXNRD1_uc010swn.1_Missense_Mutation_p.R100G|TXNRD1_uc010swo.1_Missense_Mutation_p.R100G|TXNRD1_uc010swp.1_Missense_Mutation_p.R62G|TXNRD1_uc010swq.1_Missense_Mutation_p.R150G|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Missense_Mutation_p.R166G	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	250					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						TGATTGGGACAGAATGATAGA	0.388													12	204	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111908450	111908450	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111908450G>T	uc001tsj.2	-	19	3257	c.3095C>A	c.(3094-3096)CCA>CAA	p.P1032Q	ATXN2_uc001tsh.2_Missense_Mutation_p.P767Q|ATXN2_uc001tsi.2_Missense_Mutation_p.P743Q|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Missense_Mutation_p.P220Q|ATXN2_uc001tsl.1_Missense_Mutation_p.P51Q	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	1032	Pro-rich.				cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						GGAGTAAGCTGGTGGGGTGGC	0.552													5	218	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124841254	124841254	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124841254G>A	uc010tba.1	-	23	3316	c.3199C>T	c.(3199-3201)CCC>TCC	p.P1067S	NCOR2_uc010tay.1_Missense_Mutation_p.P1066S|NCOR2_uc010taz.1_Missense_Mutation_p.P1050S|NCOR2_uc010tbb.1_Missense_Mutation_p.P1059S|NCOR2_uc010tbc.1_Missense_Mutation_p.P1049S|NCOR2_uc001ugj.1_Missense_Mutation_p.P1067S	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	1067					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ACCTCACGGGGGGGCACGGGG	0.667													5	22	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25276072	25276072	+	Splice_Site	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25276072G>T	uc001upp.2	+	14	2069	c.1882_splice	c.e14-1	p.V628_splice	ATP12A_uc010aaa.2_Splice_Site_p.V634_splice	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A						ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	CTTTGCTCTAGGTTATTATGG	0.483													18	265	---	---	---	---	PASS
RNF6	6049	broad.mit.edu	37	13	26788800	26788800	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26788800G>T	uc001uqo.2	-	5	1510	c.1219C>A	c.(1219-1221)CGT>AGT	p.R407S	RNF6_uc001uqn.1_Intron|RNF6_uc010aak.2_Missense_Mutation_p.R407S|RNF6_uc001uqp.2_Missense_Mutation_p.R407S|RNF6_uc001uqq.2_Missense_Mutation_p.R407S|RNF6_uc010tdk.1_Missense_Mutation_p.R51S	NM_183044	NP_898865	Q9Y252	RNF6_HUMAN	ring finger protein 6	407	Arg-rich.				negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TCTCCAGGACGGATCCTTCTC	0.443													4	194	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28608527	28608527	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28608527G>T	uc001urw.2	-	13	1697	c.1615C>A	c.(1615-1617)CAA>AAA	p.Q539K	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.Q539K	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	539	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	ATGTTGTCTTGGATGAAAGGG	0.383			Mis|O		AML|ALL								30	91	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	29001982	29001982	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29001982C>T	uc001usb.3	-	9	1468	c.1183G>A	c.(1183-1185)GTA>ATA	p.V395I	FLT1_uc010aar.1_Missense_Mutation_p.V395I|FLT1_uc001usc.3_Missense_Mutation_p.V395I|FLT1_uc010tdp.1_Missense_Mutation_p.V395I	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	395	Ig-like C2-type 4.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TCTTCAGTTACGTCCTTGATA	0.388													11	165	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101795570	101795570	+	Missense_Mutation	SNP	T	C	C	rs34004464		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101795570T>C	uc001vox.1	-	17	2168	c.1979A>G	c.(1978-1980)GAG>GGG	p.E660G	NALCN_uc001voy.2_Missense_Mutation_p.E375G	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	660	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CATAAAACTCTCCCTTTGCAA	0.463													6	326	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	55005104	55005104	+	3'UTR	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55005104A>G	uc001xay.2	+	6					CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						CTCTTTGAAGACATCGTAACA	0.373													4	27	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28446698	28446698	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28446698A>G	uc001zbj.2	-	48	7726	c.7620T>C	c.(7618-7620)TCT>TCC	p.S2540S	HERC2_uc001zbk.1_Silent_p.S75S	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2540					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGCACCAGTAGACTGCAAGA	0.333													55	232	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	30771310	30771310	+	RNA	SNP	A	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30771310A>C	uc001zeh.1	+	3		c.770A>C								Homo sapiens cDNA clone IMAGE:4804281.																		GGAAAAACTTAAGCTAATGCT	0.408													9	64	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43299453	43299453	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43299453A>C	uc001zqq.2	-	30	3305	c.3239T>G	c.(3238-3240)ATT>AGT	p.I1080S		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1080					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ACCCAAAGCAATTCTAGAGTA	0.418													19	84	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48062848	48062848	+	Silent	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48062848G>A	uc010bek.2	+	19	2448	c.2088G>A	c.(2086-2088)AAG>AAA	p.K696K	SEMA6D_uc001zvw.2_Silent_p.K634K|SEMA6D_uc001zvy.2_Silent_p.K696K|SEMA6D_uc001zvz.2_Silent_p.K640K|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Silent_p.K634K|SEMA6D_uc001zwc.2_Silent_p.K621K	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	696	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AAAACAGAAAGATCCATAAAG	0.463													5	119	---	---	---	---	PASS
CLK3	1198	broad.mit.edu	37	15	74900704	74900704	+	5'Flank	SNP	C	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74900704C>G	uc002ayg.3	+						CLK3_uc002ayf.1_RNA|CLK3_uc002ayh.3_5'Flank	NM_003992	NP_003983	P49761	CLK3_HUMAN	CDC-like kinase 3 isoform b							acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2						GCCTCTAGCTCTTTCCTGAGG	0.552													7	16	---	---	---	---	PASS
SYNM	23336	broad.mit.edu	37	15	99670374	99670374	+	Silent	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99670374T>C	uc002bup.2	+	6	1929	c.1809T>C	c.(1807-1809)GCT>GCC	p.A603A	SYNM_uc002buo.2_Silent_p.A603A|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	603	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						TGAAGGATGCTGGTGGTGGGA	0.552													15	48	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12142415	12142415	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12142415T>C	uc002dbw.1	+	7	748	c.686T>C	c.(685-687)ATC>ACC	p.I229T		NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	229										ovary(1)	1						GCCGTCTCCATCCTCATCAAA	0.577			T	CIITA	PMBL|Hodgkin Lymphona|								36	146	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15100357	15100357	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15100357T>C	uc002dda.3	+	6	720	c.496T>C	c.(496-498)TTC>CTC	p.F166L	PDXDC1_uc010uzl.1_Missense_Mutation_p.F151L|PDXDC1_uc010uzm.1_Missense_Mutation_p.F75L|PDXDC1_uc010bvc.1_Missense_Mutation_p.F107L|PDXDC1_uc002dcz.2_Missense_Mutation_p.F166L|PDXDC1_uc002ddb.3_Missense_Mutation_p.F139L|PDXDC1_uc010uzn.1_Missense_Mutation_p.F138L|PDXDC1_uc002ddc.2_Missense_Mutation_p.F166L	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	166					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AGTGGATGGCTTCAATGTGTT	0.423													6	280	---	---	---	---	PASS
SULT1A1	6817	broad.mit.edu	37	16	28617099	28617099	+	3'UTR	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28617099T>C	uc002dqi.2	-	7					uc010vct.1_Intron|SULT1A1_uc002dqj.2_3'UTR|SULT1A1_uc002dqk.2_3'UTR|SULT1A1_uc002dql.2_3'UTR|SULT1A1_uc002dqm.2_3'UTR|SULT1A1_uc002dqn.2_3'UTR|SULT1A1_uc002dqo.2_3'UTR|SULT1A1_uc002dqp.2_3'UTR	NM_177534	NP_803878	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A,						3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0						CTTGGTCAGGTTTGATTCGCA	0.373													8	140	---	---	---	---	PASS
HTA	283902	broad.mit.edu	37	16	73127625	73127625	+	RNA	SNP	A	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73127625A>T	uc010vmq.1	+	3		c.1031A>T				NR_027756				Homo sapiens cDNA clone IMAGE:4544545, partial cds.												0						CGGCGTTCCCAGGAAAATTCT	0.398													4	5	---	---	---	---	PASS
METT10D	79066	broad.mit.edu	37	17	2323872	2323872	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2323872G>A	uc002fut.2	-	10	1229	c.1081C>T	c.(1081-1083)CCC>TCC	p.P361S	METT10D_uc002fuu.3_RNA|METT10D_uc010cka.2_RNA|METT10D_uc002fuv.2_Intron|METT10D_uc010vqx.1_RNA|METT10D_uc010vqy.1_Missense_Mutation_p.P143S	NM_024086	NP_076991	Q86W50	MET16_HUMAN	methyltransferase 10 domain containing	361							methyltransferase activity				0						TTTCCACAGGGAACTCGTTTA	0.398													9	24	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11656197	11656197	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11656197G>A	uc002gne.2	+	33	6726	c.6658G>A	c.(6658-6660)GGG>AGG	p.G2220R	DNAH9_uc010coo.2_Missense_Mutation_p.G1514R	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2220	AAA 2 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CACCCATGATGGGCCCAAGTG	0.423													4	159	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29587458	29587458	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29587458A>G	uc002hgg.2	+	34	4835	c.4502A>G	c.(4501-4503)GAC>GGC	p.D1501G	NF1_uc002hgh.2_Missense_Mutation_p.D1480G|NF1_uc002hgi.1_Missense_Mutation_p.D513G	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1501					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTCATAAGTGACGGCAATGTG	0.383			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			5	121	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49108860	49108860	+	Intron	SNP	G	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49108860G>T	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron|SPAG9_uc002itg.2_3'UTR	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			ATAAATTACAGATTGCAGTAA	0.323													3	18	---	---	---	---	PASS
ANKRD30B	374860	broad.mit.edu	37	18	14831446	14831446	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14831446A>G	uc010dlo.2	+	28	2662	c.2482A>G	c.(2482-2484)ACT>GCT	p.T828A		NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	913										ovary(1)|skin(1)	2						CTTTAATCTTACTACCAAGGT	0.303													4	137	---	---	---	---	PASS
ADNP2	22850	broad.mit.edu	37	18	77894266	77894266	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77894266C>A	uc002lnw.2	+	4	1425	c.970C>A	c.(970-972)CCT>ACT	p.P324T		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	324	Pro-rich.				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TCATTCCCCCCCTGCTGCTGG	0.627													7	41	---	---	---	---	PASS
LRRC8E	80131	broad.mit.edu	37	19	7964517	7964517	+	Silent	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7964517C>T	uc002mir.2	+	3	1211	c.1110C>T	c.(1108-1110)ATC>ATT	p.I370I		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	370						integral to membrane				lung(1)|pancreas(1)	2						TGCACCTCATCGATCAGTACG	0.577													3	23	---	---	---	---	PASS
DDA1	79016	broad.mit.edu	37	19	17425185	17425185	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17425185C>A	uc002ngd.2	+	3	250	c.123C>A	c.(121-123)TAC>TAA	p.Y41*	DDA1_uc002nge.2_5'UTR	NM_024050	NP_076955	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1	41										ovary(1)	1						CCCGCGAGTACCCGTCTGAAC	0.617													6	16	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21992038	21992038	+	Silent	SNP	A	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21992038A>G	uc002nqj.2	-	4	931	c.801T>C	c.(799-801)TTT>TTC	p.F267F	ZNF43_uc010ecv.2_Silent_p.F261F|ZNF43_uc002nql.2_Silent_p.F261F|ZNF43_uc002nqm.2_Silent_p.F261F|ZNF43_uc002nqk.2_Silent_p.F197F	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	267	C2H2-type 4; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AGGACTTGTTAAAAGCTTTGC	0.348													6	69	---	---	---	---	PASS
UQCRFS1	7386	broad.mit.edu	37	19	29699033	29699033	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29699033T>C	uc002nsd.2	-	2	358	c.247A>G	c.(247-249)ATC>GTC	p.I83V		NM_006003	NP_005994	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske	83					respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex III	2 iron, 2 sulfur cluster binding|metal ion binding|ubiquinol-cytochrome-c reductase activity				0	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			GGCACCTTGATGTCTGTGTGG	0.423													4	26	---	---	---	---	PASS
SNRPA	6626	broad.mit.edu	37	19	41257287	41257287	+	5'UTR	SNP	T	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41257287T>A	uc002ooz.2	+	1					C19orf54_uc002oou.1_5'Flank|C19orf54_uc002oow.1_5'Flank|C19orf54_uc002oox.1_5'Flank|C19orf54_uc002ooy.1_5'Flank|C19orf54_uc010xvs.1_5'Flank	NM_004596	NP_004587	P09012	SNRPA_HUMAN	small nuclear ribonucleoprotein polypeptide A							nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding			skin(2)|ovary(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TTTTCCTCCTTTAAGACTTAC	0.478													18	66	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533104	41533104	+	Intron	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533104G>A	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CATCATGTCCGCACAGCACCA	0.632													4	39	---	---	---	---	PASS
FAM182A	284800	broad.mit.edu	37	20	26063752	26063752	+	RNA	SNP	T	C	C	rs78544920	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26063752T>C	uc010gdq.2	+	5		c.1310T>C				NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0						CACCTGGGGATTGGGTATCCA	0.537													4	24	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38507750	38507750	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38507750G>A	uc002yvz.2	+	18	1619	c.1514G>A	c.(1513-1515)CGT>CAT	p.R505H	TTC3_uc011aee.1_Missense_Mutation_p.R195H|TTC3_uc002ywa.2_Missense_Mutation_p.R505H|TTC3_uc002ywb.2_Missense_Mutation_p.R505H|TTC3_uc010gnf.2_Missense_Mutation_p.R270H|TTC3_uc002ywc.2_Missense_Mutation_p.R195H|TTC3_uc011aed.1_Missense_Mutation_p.R195H|TTC3_uc010gne.1_Missense_Mutation_p.R505H	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	505					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TTGGAGCAGCGTTGCCGCAGC	0.373													8	143	---	---	---	---	PASS
SSX7	280658	broad.mit.edu	37	X	52682455	52682455	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52682455T>C	uc004dqx.1	-	2	227	c.68A>G	c.(67-69)AAG>AGG	p.K23R		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	23	KRAB-related.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					TCACCTCACCTTTTGGATCTT	0.562													10	727	---	---	---	---	PASS
FAM3A	60343	broad.mit.edu	37	X	153736831	153736831	+	Silent	SNP	C	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153736831C>T	uc004fls.1	-	4	526	c.249G>A	c.(247-249)GGG>GGA	p.G83G	FAM3A_uc004flt.1_Silent_p.G97G|FAM3A_uc011mzp.1_Silent_p.G83G|FAM3A_uc004flu.1_Silent_p.G97G|FAM3A_uc011mzq.1_Silent_p.G83G|FAM3A_uc004flw.1_Silent_p.G83G	NM_021806	NP_068578	P98173	FAM3A_HUMAN	family 3, member A protein precursor	83						extracellular region				large_intestine(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGATCTTGGGCCCAATGACGT	0.667													10	31	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11227303	11227303	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11227303delA	uc001asd.2	-							NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						aagtataattaaaaaaaaaaa	0.169													4	2	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19408294	19408295	+	Intron	INS	-	C	C	rs138774040	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19408294_19408295insC	uc001bbi.2	-						UBR4_uc001bbf.2_5'Flank|UBR4_uc010ocv.1_Intron|UBR4_uc009vph.2_Intron|UBR4_uc010ocw.1_Intron|UBR4_uc001bbg.2_Intron|UBR4_uc001bbh.2_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTCTTCCCTGGCCCCATGTCTA	0.545													4	6	---	---	---	---	
RAP1GAP	5909	broad.mit.edu	37	1	21950322	21950322	+	Intron	DEL	G	-	-	rs829407	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21950322delG	uc001bex.2	-						RAP1GAP_uc001bew.2_Intron|RAP1GAP_uc001bey.2_Intron|RAP1GAP_uc001bez.1_5'Flank	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CACTGCCCCCGGGGGAGGCGA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47855148	47855149	+	IGR	INS	-	TG	TG	rs141721243	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47855148_47855149insTG								CMPK1 (10638 upstream) : FOXE3 (26595 downstream)																							CTCCTGGCTTATGTGTGTGTGT	0.332													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	50865017	50865017	+	IGR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50865017delT								ELAVL4 (197477 upstream) : DMRTA2 (18212 downstream)																							CACTGAGCACttttttttttc	0.204													4	3	---	---	---	---	
GADD45A	1647	broad.mit.edu	37	1	68152765	68152765	+	Intron	DEL	T	-	-	rs76383027		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68152765delT	uc001ddz.1	+						GADD45A_uc009wbb.1_Intron|GADD45A_uc009wbc.1_Intron|GADD45A_uc009wbd.1_Intron	NM_001924	NP_001915	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha						apoptosis|cell cycle arrest|cellular response to ionizing radiation|cellular response to mechanical stimulus|DNA repair|positive regulation of reactive oxygen species metabolic process|regulation of cyclin-dependent protein kinase activity|signal transduction in response to DNA damage	nucleus	protein binding			ovary(1)	1						TTAATGGCTCTTTTTTTTTTT	0.318													4	2	---	---	---	---	
IFI44	10561	broad.mit.edu	37	1	79128268	79128268	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79128268delT	uc001dip.3	+							NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN	interferon-induced, hepatitis C-associated						response to virus	cytoplasm				ovary(1)|central_nervous_system(1)	2						CAGATCTCCATTTTTTTCCAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156595558	156595559	+	IGR	DEL	GT	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156595558_156595559delGT								HAPLN2 (41 upstream) : BCAN (16181 downstream)																							GCGTGGAGGGGTGTGTGTGTGT	0.584											OREG0013879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
ADCY10	55811	broad.mit.edu	37	1	167787697	167787697	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167787697delT	uc001ger.2	-						ADCY10_uc009wvj.2_Intron|ADCY10_uc009wvk.2_Intron|ADCY10_uc010plj.1_Intron	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						AAATAATAAATTTTTTTGATG	0.363													2	4	---	---	---	---	
RGS13	6003	broad.mit.edu	37	1	192616885	192616886	+	Intron	INS	-	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192616885_192616886insC	uc001gsj.2	+						RGS13_uc001gsk.2_Intron	NM_002927	NP_002918	O14921	RGS13_HUMAN	regulator of G-protein signalling 13							plasma membrane	GTPase activator activity|signal transducer activity				0						aatttaaatagtaaaaataaaa	0.183													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201864963	201864963	+	IGR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201864963delT								SHISA4 (3537 upstream) : LMOD1 (622 downstream)																							CCTCTCTAAGTTTTAGGAAAG	0.498											OREG0014092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TMEM63A	9725	broad.mit.edu	37	1	226035959	226035960	+	Intron	INS	-	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226035959_226035960insG	uc001hpm.1	-							NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					ACTGAAACCAAGGGGGATGGCC	0.465													4	2	---	---	---	---	
TRIM58	25893	broad.mit.edu	37	1	248030914	248030915	+	Intron	INS	-	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248030914_248030915insA	uc001ido.2	+						OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ggctgaggcagggaggtggagg	0.010													4	3	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28855623	28855623	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28855623delA	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rme.1_Intron|PLB1_uc002rmf.1_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					actccgtctcaaaaaaaaaga	0.139													4	2	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29117522	29117522	+	5'Flank	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29117522delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CCGGTGCGCCTGCGCACGGAC	0.746													4	2	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46270798	46270798	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46270798delT	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TGGAGCAGGGTTTTAGGCAAC	0.448													4	2	---	---	---	---	
APLF	200558	broad.mit.edu	37	2	68804685	68804685	+	Intron	DEL	G	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68804685delG	uc002sep.2	+						APLF_uc002seq.1_Intron|APLF_uc002ser.1_Intron	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						ATGGGAAGATGGGATGTTGTG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	83763763	83763763	+	IGR	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83763763delC								None (None upstream) : FUNDC2P2 (754043 downstream)																							GTTTGGTTAACAAAAGGAAAG	0.348													4	2	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85529896	85529896	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85529896delT	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						agccttgtcattttttttttc	0.000													6	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87601654	87601654	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87601654delC	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						AAAAAAaaaacaagtctttct	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127592049	127592050	+	IGR	INS	-	ATC	ATC	rs143740629	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127592049_127592050insATC								GYPC (137804 upstream) : BIN1 (213557 downstream)																							ccgtcataactatcgtcacaac	0.064													4	2	---	---	---	---	
TMEM163	81615	broad.mit.edu	37	2	135219138	135219138	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135219138delA	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		GCCCAGTCCCAATAGCAACAA	0.473													4	2	---	---	---	---	
PSMD14	10213	broad.mit.edu	37	2	162199131	162199131	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162199131delT	uc002ubu.2	+						uc002ubv.3_5'Flank	NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						tgtgttttgcttttttttttt	0.000													6	3	---	---	---	---	
SCN2A	6326	broad.mit.edu	37	2	166151105	166151105	+	Intron	DEL	C	-	-	rs111503921		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166151105delC	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_5'Flank	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ATTTAAATGACAACTCTGACT	0.318													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													2	7	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													3	7	---	---	---	---	
CCDC150	284992	broad.mit.edu	37	2	197504242	197504243	+	5'Flank	INS	-	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197504242_197504243insT	uc002utp.1	+						CCDC150_uc002uto.1_5'Flank|CCDC150_uc010zgq.1_5'Flank|CCDC150_uc010zgr.1_5'Flank|CCDC150_uc010zgs.1_5'Flank	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150												0						CGCTCGCGAGCACAGTGGAGCC	0.703													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227574124	227574124	+	IGR	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227574124delC								KIAA1486 (978653 upstream) : IRS1 (21910 downstream)																							ggcacaacaTCCACACATCCC	0.204													4	2	---	---	---	---	
SPHKAP	80309	broad.mit.edu	37	2	228987518	228987518	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228987518delT	uc002vpq.2	-						SPHKAP_uc002vpp.2_Intron|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein							cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGAGGTTTTCTTAGATGGTGA	0.468													4	2	---	---	---	---	
DLEC1	9940	broad.mit.edu	37	3	38125995	38125997	+	Intron	DEL	GTA	-	-	rs62240745		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38125995_38125997delGTA	uc003cho.1	+						DLEC1_uc003chp.1_Intron|DLEC1_uc010hgv.1_Intron|DLEC1_uc010hgw.1_Intron|DLEC1_uc003chq.1_Intron	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform						negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		agtagtagtggtagtagtagtag	0.000													4	2	---	---	---	---	
GATA2	2624	broad.mit.edu	37	3	128205185	128205185	+	Frame_Shift_Del	DEL	G	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128205185delG	uc003ekm.3	-	4	691	c.256delC	c.(256-258)CGCfs	p.R86fs	GATA2_uc003ekn.3_Frame_Shift_Del_p.R86fs|GATA2_uc003eko.2_Frame_Shift_Del_p.R86fs|uc003ekp.2_5'Flank	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	86					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		AAGTGTGGGCGGCACATCTGG	0.667			Mis		AML(CML blast transformation)								4	2	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170446972	170446973	+	Intron	DEL	TA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170446972_170446973delTA	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TTTTATATCTTATCATCATTAT	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	43588321	43588321	+	IGR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43588321delT								GRXCR1 (555648 upstream) : KCTD8 (587601 downstream)																							TAATAATACCTTTTTTTTTCA	0.333													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49246087	49246087	+	IGR	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49246087delC								CWH43 (181994 upstream) : None (None downstream)																							CAAAAACAAACAAAAAAAAAT	0.249													5	3	---	---	---	---	
KDR	3791	broad.mit.edu	37	4	55987656	55987656	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55987656delA	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CGGGACATTGAAACCAAATGA	0.413			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			4	2	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	93588139	93588139	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93588139delC	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	agaacagtgtccttactgccc	0.000													4	2	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95444717	95444718	+	Intron	INS	-	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95444717_95444718insA	uc003hti.2	+						PDLIM5_uc003htf.2_Intron|PDLIM5_uc003htg.2_Intron|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		GAATTTTATCTTTACATGCTAA	0.223													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	166288213	166288215	+	IGR	DEL	CTA	-	-	rs72464783		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166288213_166288215delCTA								SC4MOL (23989 upstream) : CPE (11882 downstream)																							tttaacatggctactatttaaca	0.099													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6674477	6674477	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6674477delA								SRD5A1 (4804 upstream) : PAPD7 (40241 downstream)																							taaatctattaaAAAAAAAAC	0.219													6	3	---	---	---	---	
SSBP2	23635	broad.mit.edu	37	5	80742368	80742369	+	Intron	INS	-	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80742368_80742369insC	uc003kho.2	-						RNU5E_uc011cto.1_Intron|SSBP2_uc010jar.2_Intron|SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		TTTATTCAGAAATTTTCTAAAT	0.277													3	4	---	---	---	---	
LNPEP	4012	broad.mit.edu	37	5	96331904	96331904	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96331904delA	uc003kmv.1	+						LNPEP_uc003kmw.1_Intron	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		ttttatttttaaagtaaattt	0.204													4	2	---	---	---	---	
SLCO4C1	353189	broad.mit.edu	37	5	101572310	101572313	+	3'UTR	DEL	GTGT	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101572310_101572313delGTGT	uc003knm.2	-	13						NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,						cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		gtgtgtgttcgtgtgtgtgtgtgt	0.230													4	2	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132267660	132267660	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132267660delA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron|AFF4_uc003kyf.3_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			caacaacaacaaaaaaAAACA	0.134													4	2	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11188797	11188798	+	Intron	INS	-	A	A	rs142091958	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11188797_11188798insA	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			ATCTCATATATAATGTTCTTTT	0.401													2	4	---	---	---	---	
PGBD1	84547	broad.mit.edu	37	6	28252199	28252200	+	Intron	INS	-	C	C	rs146325210	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28252199_28252200insC	uc003nky.2	+						PGBD1_uc003nkz.2_Intron	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1						viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						GGAAGTGCATTCCCCCCCCCCA	0.208													4	2	---	---	---	---	
RNF39	80352	broad.mit.edu	37	6	30040952	30040952	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30040952delT	uc003npe.2	-	3	726	c.664delA	c.(664-666)ATGfs	p.M222fs	RNF39_uc003npd.2_Frame_Shift_Del_p.M222fs	NM_025236	NP_079512	Q9H2S5	RNF39_HUMAN	ring finger protein 39 isoform 1	222	B30.2/SPRY.					cytoplasm	zinc ion binding				0						CTATGAAGCATTTTTTTGACC	0.408													4	2	---	---	---	---	
GLYATL3	389396	broad.mit.edu	37	6	49494127	49494127	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49494127delA	uc003ozi.2	+							NM_001010904	NP_001010904	Q5SZD4	GLYL3_HUMAN	glycine N-acyltransferase-like protein 3							mitochondrion	glycine N-acyltransferase activity				0						ctgtgtctcgaaaaaaaaaaT	0.199													6	3	---	---	---	---	
MYO6	4646	broad.mit.edu	37	6	76577044	76577045	+	Intron	DEL	AA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76577044_76577045delAA	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTTGGTTCTTAACATATCTGAT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108398338	108398339	+	IGR	DEL	AG	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108398338_108398339delAG								OSTM1 (2397 upstream) : NR2E1 (88876 downstream)																							TCAGAGGCCCAGAGAGAGGTGT	0.505													4	2	---	---	---	---	
PLEKHG1	57480	broad.mit.edu	37	6	150980427	150980427	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150980427delT	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CTCCAAGGCATTTTTTTTTTC	0.363													3	4	---	---	---	---	
SLC22A3	6581	broad.mit.edu	37	6	160875654	160875654	+	3'UTR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160875654delT	uc003qti.2	+	11					SLC22A3_uc011efx.1_RNA	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3							integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		GTTTGTGTACTTTTTGCTTTT	0.313													4	2	---	---	---	---	
C7orf27	221927	broad.mit.edu	37	7	2593671	2593671	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2593671delT	uc003smi.2	-						C7orf27_uc003smj.1_Intron	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor						response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		TGTTCACGCCTTCTGTAGAAC	0.388													4	2	---	---	---	---	
RABGEF1	27342	broad.mit.edu	37	7	66255156	66255156	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66255156delC	uc011kee.1	+						RABGEF1_uc003tvf.2_Intron|RABGEF1_uc003tvg.2_Intron|RABGEF1_uc010lag.2_Intron|RABGEF1_uc003tvh.2_Intron|RABGEF1_uc003tvi.2_Intron	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						TTGGAGAAGGCAACACAGTGT	0.438													4	2	---	---	---	---	
WBSCR22	114049	broad.mit.edu	37	7	73111776	73111776	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111776delA	uc003tyt.2	+						WBSCR22_uc003tyu.2_Intron|WBSCR22_uc003tyv.2_Intron|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22							nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGGTGTCCAGAGCGGGGAATT	0.582													9	4	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	105029227	105029228	+	Intron	INS	-	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105029227_105029228insT	uc003vcv.2	-						SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						ggcgcgccgcgggccACTCACC	0.495													5	3	---	---	---	---	
DLD	1738	broad.mit.edu	37	7	107559201	107559201	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107559201delC	uc003vet.2	+						DLD_uc011kmg.1_Intron|DLD_uc011kmh.1_Intron|DLD_uc011kmi.1_Intron	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor						branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	ggtgaagaaactgaatgaagc	0.025													4	3	---	---	---	---	
CFTR	1080	broad.mit.edu	37	7	117176896	117176896	+	Intron	DEL	G	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117176896delG	uc003vjd.2	+						CFTR_uc011knq.1_Intron	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	TCACTTTCATGGGCTGTAGTT	0.338									Cystic_Fibrosis				4	2	---	---	---	---	
TRIM24	8805	broad.mit.edu	37	7	138203703	138203703	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138203703delC	uc003vuc.2	+						TRIM24_uc003vub.2_Intron	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha						cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						TACTCCTGAACTAATGTTAAT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148347109	148347109	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148347109delA								C7orf33 (34158 upstream) : CUL1 (47897 downstream)																							accctgtctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9129332	9129335	+	IGR	DEL	CAGG	-	-	rs34372345		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9129332_9129335delCAGG								PPP1R3B (120248 upstream) : TNKS (284110 downstream)																							TCTTTCCAGCCAGGCAGATGGCAG	0.554													5	7	---	---	---	---	
DOK2	9046	broad.mit.edu	37	8	21766658	21766659	+	3'UTR	DEL	GT	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21766658_21766659delGT	uc003wzy.1	-	5					DOK2_uc003wzx.1_Intron|DOK2_uc003wzz.1_3'UTR|DOK2_uc010lth.1_3'UTR	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CTTTGGGATGGTGACTCACCCA	0.589													4	2	---	---	---	---	
DPYSL2	1808	broad.mit.edu	37	8	26505464	26505464	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26505464delA	uc003xfb.1	+						DPYSL2_uc003xfa.2_Intron|DPYSL2_uc010luk.1_Intron|DPYSL2_uc011lah.1_Intron	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		ATTTGCTGGGAAAAGAATAGT	0.403													4	2	---	---	---	---	
UNC5D	137970	broad.mit.edu	37	8	35588293	35588293	+	Intron	DEL	A	-	-	rs111463518		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35588293delA	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron|UNC5D_uc003xju.1_Intron	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GACTTAAAATAAAAAAAAAAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61545577	61545578	+	IGR	INS	-	A	A	rs147827887	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61545577_61545578insA								RAB2A (11948 upstream) : CHD7 (45761 downstream)																							GTTTGCTGAAGAAAAAAAAAAT	0.163													5	5	---	---	---	---	
XKR9	389668	broad.mit.edu	37	8	71618924	71618925	+	Intron	DEL	GG	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71618924_71618925delGG	uc003xyq.2	+						XKR9_uc010lze.2_Intron|XKR9_uc010lzd.2_Intron	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			aagatgaaatgggattatgtat	0.079													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	27778129	27778129	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27778129delA								C9orf72 (204287 upstream) : LINGO2 (170399 downstream)																							GCATTTAAATAAAAAAAATCC	0.279													4	2	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736882	37736883	+	Intron	DEL	GC	-	-	rs151329428		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736882_37736883delGC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgtatgtgtgCGCACACACAC	0.376													7	5	---	---	---	---	
AQP7P1	375719	broad.mit.edu	37	9	67273773	67273774	+	Intron	INS	-	A	A	rs149463181	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67273773_67273774insA	uc004aem.1	-						AQP7P1_uc004aen.1_Intron|AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens aquaporin 7 pseudogene 1, mRNA (cDNA clone IMAGE:6191443).												0						gaggaacacagaggcgatggct	0.153													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417574	68417575	+	IGR	INS	-	AT	AT	rs66587720		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417574_68417575insAT								FAM27B (623385 upstream) : MIR1299 (584664 downstream)																							TAGGAATAAAACATCAGTGATA	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430746	68430746	+	IGR	DEL	T	-	-	rs113456947		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430746delT								FAM27B (636557 upstream) : MIR1299 (571493 downstream)																							TTTTACTAGCTTCTTATATCC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69823467	69823468	+	IGR	INS	-	G	G	rs145426386	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69823467_69823468insG								LOC100133920 (158518 upstream) : FOXD4L5 (352241 downstream)																							GTGTTTAGAGAGAAACTGTCTC	0.361													10	5	---	---	---	---	
PALM2-AKAP2	445815	broad.mit.edu	37	9	112918958	112918958	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112918958delA	uc004bej.3	+						PALM2-AKAP2_uc004bek.3_Intron|AKAP2_uc011lwi.1_Intron|AKAP2_uc004bem.2_Intron|AKAP2_uc011lwj.1_Intron|PALM2-AKAP2_uc004ben.2_Intron	NM_007203	NP_009134	Q9Y2D5	AKAP2_HUMAN	PALM2-AKAP2 protein isoform 1								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						TGCCTGTTTCAAAAAAAAATT	0.433													4	2	---	---	---	---	
CCDC3	83643	broad.mit.edu	37	10	13040200	13040201	+	Intron	DEL	GA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13040200_13040201delGA	uc001ilq.1	-						CCDC3_uc009xjb.1_Intron|CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron	NM_031455	NP_113643	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3 precursor							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			GGGATAGCAGGAGAGAGAGAGG	0.416													4	2	---	---	---	---	
MKX	283078	broad.mit.edu	37	10	27962806	27962806	+	3'UTR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27962806delA	uc001ity.3	-	7					MKX_uc001itx.3_3'UTR	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox						muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTTCCAGTTTAAAAAAAAAAT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42772066	42772067	+	IGR	DEL	GC	-	-	rs113788856		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42772066_42772067delGC								None (None upstream) : LOC441666 (55248 downstream)																							TGTAGGCTGTGCTAGGTCCTCT	0.391													9	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47058662	47058663	+	Intron	DEL	AT	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47058662_47058663delAT	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						acagccacacatatcacacaca	0.050													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69634691	69634691	+	IGR	DEL	A	-	-	rs34328489		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69634691delA								DNAJC12 (36754 upstream) : SIRT1 (9736 downstream)																							AAAGAGGGAGAAAAAAAAAag	0.214													8	4	---	---	---	---	
RUFY2	55680	broad.mit.edu	37	10	70136913	70136913	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70136913delT	uc001job.2	-						RUFY2_uc001jnz.1_Intron|RUFY2_uc001joa.2_5'UTR	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1						TGTTTTGTGATTTTTTTTTTT	0.308													6	3	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73566233	73566233	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73566233delA	uc001jrx.3	+						CDH23_uc001jsg.3_Intron|CDH23_uc001jsh.3_Intron|CDH23_uc001jsi.3_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ttgagcgctgaaaaaaaaaaa	0.219													5	3	---	---	---	---	
SUFU	51684	broad.mit.edu	37	10	104365490	104365490	+	Intron	DEL	G	-	-	rs150925800		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104365490delG	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron|SUFU_uc009xxe.1_Intron|SUFU_uc009xxf.1_Intron	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		TTCTTTCTCTGGAAAGTTCAG	0.537			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114919470	114919470	+	Intron	DEL	T	-	-	rs71946744		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114919470delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron|TCF7L2_uc010qrv.1_Intron|TCF7L2_uc010qrw.1_Intron|TCF7L2_uc010qrx.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TGACTTTTACTTTTTTTTTTT	0.274													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	128555562	128555562	+	IGR	DEL	C	-	-	rs12240805	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128555562delC								C10orf90 (196483 upstream) : DOCK1 (38461 downstream)																							AGCTGGCGTGCGGGTGGGACA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133167596	133167596	+	IGR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133167596delT								TCERG1L (57612 upstream) : PPP2R2D (580364 downstream)																							tctaaggttctcccgtcACCC	0.214													4	2	---	---	---	---	
SCGB1C1	147199	broad.mit.edu	37	11	193481	193481	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:193481delC	uc001loa.1	+							NM_145651	NP_663626	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCCTGGTGATCCCAGGGAATG	0.478													4	2	---	---	---	---	
INSC	387755	broad.mit.edu	37	11	15173153	15173155	+	Intron	DEL	TGA	-	-	rs76310204	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15173153_15173155delTGA	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						TCTGGGATGCTGATCTTCTTGTT	0.562													4	2	---	---	---	---	
FBXO3	26273	broad.mit.edu	37	11	33792013	33792013	+	Intron	DEL	G	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33792013delG	uc001muz.2	-						FBXO3_uc001muy.2_Intron|FBXO3_uc009ykb.2_Intron|FBXO3_uc001mva.1_Intron|FBXO3_uc001mvb.1_Intron|FBXO3_uc010rek.1_Intron	NM_012175	NP_036307	Q9UK99	FBX3_HUMAN	F-box only protein 3 isoform 1						proteolysis	nucleus	ubiquitin-protein ligase activity			pancreas(1)	1		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		agacctcagtggggaagtcag	0.040													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131712483	131712483	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131712483delC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						GCATCCAGGACAAAAAAATCT	0.353													4	2	---	---	---	---	
DERA	51071	broad.mit.edu	37	12	16135558	16135558	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16135558delT	uc001rde.2	+						DERA_uc010shx.1_Intron	NM_015954	NP_057038	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase-like						deoxyribonucleoside catabolic process|deoxyribonucleotide catabolic process	cytoplasm	deoxyribose-phosphate aldolase activity|protein binding				0		Hepatocellular(102;0.121)				TTCTTCCACATTTTTTTTTGT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24737258	24737263	+	5'Flank	DEL	CCCCCA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737258_24737263delCCCCCA	uc001rgb.1	-											Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																		CTTCGATTAGcccccacccccacccc	0.432													8	4	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56565988	56565989	+	Intron	INS	-	A	A			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56565988_56565989insA	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			acttagcctcctgagtagctgg	0.119													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88473719	88473722	+	Intron	DEL	CTTC	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88473719_88473722delCTTC	uc001tar.2	-						CEP290_uc001taq.2_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TTTTTCCTAACTTCATATAGATAA	0.250													7	4	---	---	---	---	
VEZT	55591	broad.mit.edu	37	12	95660507	95660507	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95660507delA	uc001tdz.2	+						VEZT_uc009zsy.1_Intron|VEZT_uc001tdr.2_Intron|VEZT_uc001tds.2_Intron|VEZT_uc001tdt.2_Intron|VEZT_uc009zsz.1_Intron|VEZT_uc001tdv.2_Intron|VEZT_uc001tdw.1_Intron|VEZT_uc009zta.1_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						CATTTATAGGAAAAAAAAGTG	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25319109	25319109	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25319109delA								ATP12A (33192 upstream) : RNF17 (19192 downstream)																							GAGTGGGGGGAAAAAATAAGA	0.527													4	2	---	---	---	---	
TFDP1	7027	broad.mit.edu	37	13	114287754	114287755	+	Intron	INS	-	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114287754_114287755insG	uc001vtw.2	+						TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Intron|TFDP1_uc001vtx.2_Intron|TFDP1_uc010agx.2_Intron	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			AAGTGTGTGCCGGGGCCGAGAG	0.450										TSP Lung(29;0.18)			9	5	---	---	---	---	
PPP2R5E	5529	broad.mit.edu	37	14	63949193	63949193	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63949193delA	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron|PPP2R5E_uc001xgg.3_Intron	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		caacaacaacaaaaaaaaaCT	0.159													6	3	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100599303	100599303	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100599303delC	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				CAGCAGCAGGCCTGCCCTCAC	0.682													6	4	---	---	---	---	
TUBGCP5	114791	broad.mit.edu	37	15	22862068	22862068	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22862068delT	uc001yur.3	+						TUBGCP5_uc001yuq.2_Intron|TUBGCP5_uc010axz.1_Intron	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ttctttttccttttttttttt	0.159													3	3	---	---	---	---	
FSIP1	161835	broad.mit.edu	37	15	40068417	40068418	+	Intron	INS	-	GGAGGGAA	GGAGGGAA	rs55639610	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40068417_40068418insGGAGGGAA	uc001zki.2	-							NM_152597	NP_689810	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1											ovary(2)|skin(1)	3		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		gagggagggagggaaggaATGG	0.153													4	2	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40241088	40241089	+	Intron	INS	-	ATGT	ATGT	rs4270150		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40241088_40241089insATGT	uc001zkm.1	+						EIF2AK4_uc001zkl.2_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TTTTTATTTACCTAGGTAATGA	0.287													4	4	---	---	---	---	
USP50	373509	broad.mit.edu	37	15	50831311	50831311	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50831311delT	uc001zyq.3	-							NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50						ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		tttggttttgttttttttttt	0.159													4	3	---	---	---	---	
C15orf44	81556	broad.mit.edu	37	15	65878243	65878243	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65878243delA	uc002apd.2	-						C15orf44_uc010uix.1_Intron|C15orf44_uc010uiz.1_Intron|C15orf44_uc010uja.1_Intron|C15orf44_uc010ujb.1_Intron|C15orf44_uc002ape.3_Intron|C15orf44_uc010uiy.1_Intron	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2											ovary(1)	1						ACTCCTCCATAAAATACTGGC	0.423													4	2	---	---	---	---	
CLN6	54982	broad.mit.edu	37	15	68515469	68515469	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68515469delA	uc002arf.2	-						CLN6_uc010ujy.1_Intron|CLN6_uc010ujz.1_Intron	NM_017882	NP_060352	Q9NWW5	CLN6_HUMAN	CLN6 protein						cell death|cholesterol metabolic process|ganglioside metabolic process|glycosaminoglycan metabolic process|lysosomal lumen acidification|positive regulation of proteolysis|protein catabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	protein homodimerization activity				0						ataaatactgaaaaaaaaaaa	0.229													7	4	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	86118135	86118135	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86118135delT	uc002blv.1	+						AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AAGAACATTGTTAGGGCTAGG	0.363													4	2	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90616185	90616186	+	Intron	INS	-	C	C			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90616185_90616186insC	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AAGAGACATTTCCCAGAAAGTG	0.515													4	2	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10782946	10782946	+	Intron	DEL	T	-	-	rs75922928		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10782946delT	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						atcaggactcttttttttttt	0.169													5	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18893710	18893710	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18893710delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TGttttaaataaaaaaaaaaa	0.338													5	3	---	---	---	---	
GTF3C1	2975	broad.mit.edu	37	16	27475142	27475143	+	Intron	INS	-	GC	GC			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27475142_27475143insGC	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CCAGGCCCGGACAAGCCCCACA	0.599													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	63103807	63103808	+	IGR	DEL	TG	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63103807_63103808delTG								None (None upstream) : None (None downstream)																							CTAAATGTGTTGTGATTACAAG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21227696	21227697	+	IGR	DEL	AG	-	-	rs149665353		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21227696_21227697delAG								MAP2K3 (9147 upstream) : KCNJ12 (52002 downstream)																							acacagaaacagagagtcacat	0.084													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21562526	21562526	+	IGR	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21562526delC								C17orf51 (84795 upstream) : FAM27L (262844 downstream)																							TTTTTTTTAACCACTGGCAAT	0.289													4	2	---	---	---	---	
FLJ36000	284124	broad.mit.edu	37	17	21904445	21904446	+	Intron	DEL	TG	-	-	rs111648393		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904445_21904446delTG	uc002gza.2	+							NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						TCTTTCCCTCtgtgtgtgtgtg	0.455													8	4	---	---	---	---	
LRRC37A2	474170	broad.mit.edu	37	17	44628370	44628370	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44628370delA	uc002ikn.1	+						ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor							integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GGCATTGTCTAAATAGGTCCA	0.413													4	2	---	---	---	---	
SMAD7	4092	broad.mit.edu	37	18	46447624	46447624	+	3'UTR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46447624delA	uc002ldg.2	-	4					SMAD7_uc002ldf.2_3'UTR|SMAD7_uc010xde.1_3'UTR	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7						adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					ACCAACAAACAAAAAAAAAAC	0.393													4	2	---	---	---	---	
MEX3C	51320	broad.mit.edu	37	18	48702708	48702709	+	3'UTR	DEL	TA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48702708_48702709delTA	uc002lfc.3	-	2						NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2							cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		AGTATTTATGTATATATATATA	0.371													4	2	---	---	---	---	
GCDH	2639	broad.mit.edu	37	19	13004060	13004060	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13004060delA	uc002mvq.2	+						GCDH_uc010xms.1_Intron|GCDH_uc002mvp.2_Intron|GCDH_uc010xmt.1_Intron|GCDH_uc010xmu.1_Intron	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a						lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						ttctcaagtgatcctcttgcc	0.020													7	7	---	---	---	---	
FARSA	2193	broad.mit.edu	37	19	13044117	13044117	+	Intron	DEL	A	-	-	rs33919090		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13044117delA	uc002mvs.2	-						FARSA_uc002mvt.2_Intron|FARSA_uc010xmv.1_Intron|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit						phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	agcaaccgcgacttcctcgtc	0.114													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20635102	20635102	+	IGR	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20635102delT								ZNF826 (27340 upstream) : ZNF737 (85697 downstream)																							CAGGTAGGTGTTTTTTTTGCT	0.343													6	4	---	---	---	---	
CLPTM1	1209	broad.mit.edu	37	19	45489593	45489593	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45489593delA	uc002pai.2	+						CLPTM1_uc010ejv.1_Intron|CLPTM1_uc010xxf.1_Intron|CLPTM1_uc010xxg.1_Intron	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane						cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		cccatctcagaaaaaaaagaa	0.224													4	2	---	---	---	---	
CCDC9	26093	broad.mit.edu	37	19	47768322	47768322	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47768322delT	uc010xym.1	+							NM_015603	NP_056418	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9												0		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		AGCACAGGACttttttttttt	0.294													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53529645	53529646	+	IGR	DEL	CT	-	-	rs146852334		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53529645_53529646delCT								ZNF702P (32861 upstream) : ZNF160 (40222 downstream)																							CTTCAAACAACTCTCTCCCACA	0.163													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	218255	218256	+	IGR	INS	-	G	G	rs150696288	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:218255_218256insG								DEFB129 (7729 upstream) : DEFB132 (20121 downstream)																							TGctcactgcaataaaaagaac	0.257													3	5	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9453218	9453219	+	Intron	INS	-	G	G			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9453218_9453219insG	uc002wnf.2	+						PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron|PLCB4_uc002wnh.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TAAACATGGCAAAACATTAAAA	0.163													4	2	---	---	---	---	
DTD1	92675	broad.mit.edu	37	20	18626091	18626092	+	Intron	DEL	GA	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18626091_18626092delGA	uc002wrf.3	+							NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						CTGGAAAAATGAGATAGACTTA	0.460													4	2	---	---	---	---	
RIN2	54453	broad.mit.edu	37	20	19926328	19926328	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19926328delT	uc002wro.1	+						RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Intron	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						TTTCTTATCATTTTTTTTTTC	0.383													4	2	---	---	---	---	
MYLK2	85366	broad.mit.edu	37	20	30414943	30414943	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30414943delA	uc002wwq.2	+						MYLK2_uc002wws.2_Intron	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase						cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			agagggggggaaaaaaaaaag	0.134													4	2	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32499730	32499731	+	Intron	INS	-	T	T			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32499730_32499731insT	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						ATGGACCGAACttttttttttt	0.193													3	3	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32812784	32812784	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32812784delA	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						CTTGGCCTTTAAAAAAAAGTC	0.353													4	2	---	---	---	---	
DSCR4	10281	broad.mit.edu	37	21	39493079	39493080	+	Intron	DEL	AC	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39493079_39493080delAC	uc002ywp.2	-						DSCR8_uc002ywt.3_5'Flank|DSCR8_uc010gnp.2_5'Flank|DSCR8_uc010gnq.2_5'Flank|DSCR8_uc010gnr.2_5'Flank|DSCR8_uc010gns.2_5'Flank	NM_005867	NP_005858	P56555	DSCR4_HUMAN	Down syndrome critical region protein 4											ovary(1)	1						CAACATTAAAACACACACACAC	0.163													9	4	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19386139	19386139	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19386139delC	uc002zpf.1	-						HIRA_uc011agx.1_Intron|HIRA_uc010grn.1_Intron|HIRA_uc010gro.1_Intron|HIRA_uc010grp.2_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					TATGGAGCCTCCAAACAGAAT	0.289													4	2	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19424344	19424345	+	Intron	INS	-	A	A	rs145454736	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19424344_19424345insA	uc010gro.1	-						HIRA_uc010grp.2_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					CTCAAATGGGGAAAAAAAAATG	0.436													6	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26147524	26147524	+	Intron	DEL	G	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26147524delG	uc003abz.1	+							NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						GAGCATGTGTGGGAggagtca	0.284													4	2	---	---	---	---	
RFPL2	10739	broad.mit.edu	37	22	32595898	32595899	+	Intron	INS	-	C	C	rs150809092	by1000genomes	TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32595898_32595899insC	uc003amg.3	-						RFPL2_uc003amf.3_Intron|RFPL2_uc003amh.3_Intron	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2								zinc ion binding			skin(1)	1						CCGCTCGCCCACTCACAGGCCA	0.634													3	3	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2778180	2778180	+	Intron	DEL	T	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2778180delT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTGGCGTGGTTTTTTTTTGA	0.423													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48297697	48297697	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48297697delA								SSX4 (44912 upstream) : SLC38A5 (19231 downstream)																							agtgtaatttaaaaaaaaaaC	0.005													4	2	---	---	---	---	
MAGED1	9500	broad.mit.edu	37	X	51638054	51638054	+	Intron	DEL	C	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51638054delC	uc004dpm.2	+						MAGED1_uc004dpn.2_Intron|MAGED1_uc004dpo.2_Intron|MAGED1_uc011mnx.1_Intron	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b						apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)					CCGCCTGCAGCTCCGCTGCTG	0.647										Multiple Myeloma(10;0.10)			4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	126524429	126524429	+	IGR	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126524429delA								CXorf64 (568663 upstream) : ACTRT1 (660514 downstream)																							GACAAAAATGAAACACATACT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	133688716	133688716	+	Intron	DEL	A	-	-	rs66470540		TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133688716delA	uc004exn.1	+											Homo sapiens cDNA FLJ12932 fis, clone NT2RP2004897.																		gaaagaagagaaaaaaaaaaa	0.413													5	3	---	---	---	---	
BRCC3	79184	broad.mit.edu	37	X	154327848	154327848	+	Intron	DEL	A	-	-			TCGA-AK-3429-01A-02D-1386-10	TCGA-AK-3429-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154327848delA	uc004fna.2	+						BRCC3_uc004fnb.2_Intron	NM_024332	NP_077308	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3						double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(3)|ovary(1)|large_intestine(1)|breast(1)	6	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tgtctttgctaaaaatggaca	0.035													4	2	---	---	---	---	
