Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3A	55210	broad.mit.edu	37	1	1459280	1459280	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1459280G>A	uc001afz.1	+	10	1263	c.1169G>A	c.(1168-1170)CGC>CAC	p.R390H	ATAD3A_uc001aga.1_Missense_Mutation_p.R342H|ATAD3A_uc001agb.1_Missense_Mutation_p.R263H	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	390							ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		AAGAAGAACCGCAGCCTGTAC	0.627													19	51	---	---	---	---	PASS
KLHDC7A	127707	broad.mit.edu	37	1	18807868	18807868	+	Silent	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18807868G>A	uc001bax.2	+	1	445	c.393G>A	c.(391-393)TCG>TCA	p.S131S	KLHDC7A_uc009vpg.2_5'UTR	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	131						integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAGGGCTCGGACTCTGAGC	0.632													18	23	---	---	---	---	PASS
PIGC	5279	broad.mit.edu	37	1	172411549	172411549	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172411549A>T	uc001gil.2	-	2	495	c.214T>A	c.(214-216)TGG>AGG	p.W72R	PIGC_uc001gii.1_Intron|PIGC_uc001gij.1_Intron|C1orf105_uc001gik.2_Intron|PIGC_uc001gin.2_Missense_Mutation_p.W72R|PIGC_uc001gio.2_Missense_Mutation_p.W72R	NM_153747	NP_714969	Q92535	PIGC_HUMAN	phosphatidylinositol glycan, class C	72					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity			lung(1)	1						ATATACCACCAGATAACCACA	0.458													50	175	---	---	---	---	PASS
NCF2	4688	broad.mit.edu	37	1	183532672	183532672	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183532672T>A	uc001gqj.3	-	12	1350	c.1075A>T	c.(1075-1077)AAG>TAG	p.K359*	NCF2_uc010pod.1_Nonsense_Mutation_p.K314*|NCF2_uc010poe.1_Nonsense_Mutation_p.K278*|NCF2_uc001gqk.3_Nonsense_Mutation_p.K359*	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	359	OPR.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						ACCGTGTACTTGTAGTGCACC	0.542													69	214	---	---	---	---	PASS
DEGS1	8560	broad.mit.edu	37	1	224377767	224377767	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224377767G>A	uc001hoj.2	+	2	682	c.571G>A	c.(571-573)GTG>ATG	p.V191M	DEGS1_uc001hoi.2_Missense_Mutation_p.V170M	NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid	191	Helical; (Potential).				sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		TATCAATACCGTGGCACAGGT	0.393													105	374	---	---	---	---	PASS
OR2T10	127069	broad.mit.edu	37	1	248756885	248756885	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248756885A>C	uc010pzn.1	-	1	185	c.185T>G	c.(184-186)TTT>TGT	p.F62C		NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T,	62	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGGTTTATAAAGAAGTACAT	0.408													31	85	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27457500	27457500	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27457500G>A	uc002rji.2	+	23	3895	c.3733G>A	c.(3733-3735)GAA>AAA	p.E1245K	CAD_uc010eyw.2_Missense_Mutation_p.E1182K	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1245	CPSase B.|CPSase (Carbamoyl-phosphate synthase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CATCATGGGGGAAGAAGTGGA	0.517													33	65	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	45879259	45879259	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45879259T>A	uc002rut.2	+	1	217	c.20T>A	c.(19-21)CTT>CAT	p.L7H		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	7	C2.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TTCAATGGCCTTCTTAAGATC	0.652													19	56	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64160992	64160992	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64160992T>C	uc002scq.2	-	12	1717	c.1554A>G	c.(1552-1554)ATA>ATG	p.I518M	VPS54_uc002scp.2_Missense_Mutation_p.I506M|VPS54_uc002sco.2_Missense_Mutation_p.I3M|VPS54_uc010fct.2_Missense_Mutation_p.I365M	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	518					protein transport|retrograde transport, endosome to Golgi						0						ATGCATCACTTATAAACATGC	0.423													37	99	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179664360	179664360	+	Silent	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179664360C>T	uc002und.2	-	6	993	c.768G>A	c.(766-768)AGG>AGA	p.R256R	TTN_uc010zfg.1_Silent_p.R256R|TTN_uc010zfh.1_Silent_p.R256R|TTN_uc010zfi.1_Silent_p.R256R|TTN_uc010zfj.1_Silent_p.R256R|TTN_uc002unb.2_Silent_p.R256R			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	256							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R256_K260>K(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCGGAGGAATCCTGGGAGGTG	0.532													41	93	---	---	---	---	PASS
DES	1674	broad.mit.edu	37	2	220290785	220290785	+	3'UTR	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220290785C>T	uc002vll.2	+	9						NM_001927	NP_001918	P17661	DESM_HUMAN	desmin						cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGCCTTCTTCCATCCCAGGAC	0.612													5	14	---	---	---	---	PASS
ZDHHC23	254887	broad.mit.edu	37	3	113667569	113667569	+	Intron	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113667569C>T	uc003eau.2	+						ZDHHC23_uc003eav.2_5'UTR	NM_173570	NP_775841	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC domain containing 23							integral to membrane	acyltransferase activity|zinc ion binding			ovary(2)	2						AGGCGTGGACCTATTTACGAG	0.498													8	15	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20255582	20255582	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20255582C>G	uc003gpr.1	+	1	348	c.144C>G	c.(142-144)AGC>AGG	p.S48R	SLIT2_uc003gps.1_Missense_Mutation_p.S48R	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	48	LRRNT.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						CGCTGCGCAGCGTGCCCAGGA	0.667													7	120	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62362891	62362891	+	5'UTR	SNP	T	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62362891T>C	uc010ihh.2	+	1					LPHN3_uc003hcq.3_5'UTR|LPHN3_uc010ihg.1_5'UTR	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ATTCTTTTTCTTTTTAATTTG	0.269													2	9	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66213782	66213782	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66213782G>C	uc003hcy.2	-	15	2841	c.2648C>G	c.(2647-2649)ACC>AGC	p.T883S	EPHA5_uc003hcx.2_Missense_Mutation_p.T815S|EPHA5_uc003hcz.2_Missense_Mutation_p.T861S|EPHA5_uc011cah.1_Missense_Mutation_p.T884S|EPHA5_uc011cai.1_Missense_Mutation_p.T862S|EPHA5_uc003hda.2_Missense_Mutation_p.T884S	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	883	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						ATCTTGATTGGTCATCTCCCA	0.398										TSP Lung(17;0.13)			57	184	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71510239	71510239	+	Silent	SNP	C	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71510239C>A	uc011caw.1	+	9	3377	c.3096C>A	c.(3094-3096)GGC>GGA	p.G1032G		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	1032					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			ATCCAGAAGGCATCCAAAGTC	0.428													41	103	---	---	---	---	PASS
F11	2160	broad.mit.edu	37	4	187208887	187208887	+	Silent	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187208887C>T	uc003iza.1	+	14	1959	c.1626C>T	c.(1624-1626)AAC>AAT	p.N542N	uc003izb.1_Intron	NM_000128	NP_000119	P03951	FA11_HUMAN	coagulation factor XI precursor	542	Peptidase S1.				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity				0		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TAGTGACCAACGAAGAGTGCC	0.378													35	75	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43555964	43555964	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43555964A>T	uc003job.2	-	2	650	c.403T>A	c.(403-405)TTT>ATT	p.F135I	PAIP1_uc003joa.2_Missense_Mutation_p.F56I|PAIP1_uc010ivp.2_Missense_Mutation_p.F56I|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.F23I	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	135	PABPC1-interacting motif-2 (PAM2).				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					GAAGGGTAAAATTCAGGGGCA	0.418													93	362	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140230078	140230078	+	Silent	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140230078G>A	uc003lhu.2	+	1	2722	c.1998G>A	c.(1996-1998)CTG>CTA	p.L666L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.L666L	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	666	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACTGTGCTGGTGTCGCTGG	0.687													30	43	---	---	---	---	PASS
SLC25A2	83884	broad.mit.edu	37	5	140682821	140682821	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140682821T>G	uc003ljf.2	-	1	792	c.612A>C	c.(610-612)AAA>AAC	p.K204N		NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2	204					mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CTAGTTCATCTTTTGATCTCC	0.438													47	220	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28227271	28227271	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28227271C>T	uc003nkt.2	+	1	174	c.122C>T	c.(121-123)TCC>TTC	p.S41F	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	41										upper_aerodigestive_tract(1)|ovary(1)	2						GATGGCTGTTCCCGCTCTCAC	0.652													17	71	---	---	---	---	PASS
CCHCR1	54535	broad.mit.edu	37	6	31112350	31112350	+	Intron	SNP	C	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31112350C>A	uc003nsr.3	-						CCHCR1_uc011dne.1_Intron|CCHCR1_uc003nsq.3_Intron|CCHCR1_uc003nsp.3_Intron|CCHCR1_uc010jsk.1_3'UTR	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform						cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						CTCCTGGATACCTTCATTACT	0.249													10	72	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32943251	32943251	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32943251A>G	uc003ocn.3	+	4	2125	c.424A>G	c.(424-426)ATG>GTG	p.M142V	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.M142V|BRD2_uc003ocp.3_Missense_Mutation_p.M22V|BRD2_uc010juh.2_Missense_Mutation_p.M142V	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	142	Bromo 1.			MQ->AA: Loss of homodimerization.	spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						TTCAGAGTGTATGCAAGATTT	0.333													20	98	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36930968	36930968	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36930968G>A	uc003ona.2	+	5	1178	c.850G>A	c.(850-852)GTA>ATA	p.V284I	PI16_uc003omz.1_Intron|PI16_uc003onb.2_Intron|PI16_uc011dts.1_Missense_Mutation_p.V55I	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	284	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						TCCACCTTGCGTAACAACTGA	0.567													8	93	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84894950	84894950	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84894950T>C	uc010kbp.2	-	13	1715	c.1618A>G	c.(1618-1620)AAA>GAA	p.K540E	KIAA1009_uc003pkj.3_Missense_Mutation_p.K464E|KIAA1009_uc003pkk.2_Missense_Mutation_p.K540E|KIAA1009_uc003pki.3_5'UTR	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	540					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CTCAAGTTTTTGCTTTTTATA	0.348													18	125	---	---	---	---	PASS
GPRC6A	222545	broad.mit.edu	37	6	117113395	117113395	+	Silent	SNP	A	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117113395A>G	uc003pxj.1	-	6	2713	c.2691T>C	c.(2689-2691)GAT>GAC	p.D897D	GPRC6A_uc003pxk.1_Silent_p.D722D|GPRC6A_uc003pxl.1_Silent_p.D826D	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	897	Cytoplasmic (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GTGCCTGAAGATCTTTGCTTT	0.448													20	246	---	---	---	---	PASS
PNPLA8	50640	broad.mit.edu	37	7	108155092	108155092	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108155092A>C	uc003vff.1	-	4	1251	c.844T>G	c.(844-846)TCA>GCA	p.S282A	PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.S282A|PNPLA8_uc003vfi.1_Missense_Mutation_p.S182A|PNPLA8_uc003vfj.1_Missense_Mutation_p.S282A|PNPLA8_uc003vfk.1_Missense_Mutation_p.S182A	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	282					fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						TGTTTAGTTGAAACTTGAAGA	0.433													45	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428250	12428250	+	Intron	SNP	C	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428250C>G	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		AAGTAACCATCGGTAGTCCTG	0.383													4	22	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068103	38068103	+	3'UTR	SNP	G	T	T	rs111385150	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068103G>T	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GCCTGTTGATGACAAGAAGCA	0.338													4	17	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068124	38068124	+	3'UTR	SNP	G	A	A	rs80041165	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068124G>A	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				ATACATTCCAGCTTTCCTTTG	0.338													4	12	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145007369	145007369	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145007369G>A	uc003zaf.1	-	13	1995	c.1825C>T	c.(1825-1827)CGC>TGC	p.R609C	PLEC_uc003zab.1_Missense_Mutation_p.R472C|PLEC_uc003zac.1_Missense_Mutation_p.R476C|PLEC_uc003zad.2_Missense_Mutation_p.R472C|PLEC_uc003zae.1_Missense_Mutation_p.R440C|PLEC_uc003zag.1_Missense_Mutation_p.R450C|PLEC_uc003zah.2_Missense_Mutation_p.R458C|PLEC_uc003zaj.2_Missense_Mutation_p.R499C	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	609	Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCCCACCTGCGGTACATCTGC	0.662													9	18	---	---	---	---	PASS
IL2RA	3559	broad.mit.edu	37	10	6054846	6054846	+	Silent	SNP	T	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6054846T>G	uc001iiz.1	-	8	967	c.808A>C	c.(808-810)AGA>CGA	p.R270R	IL2RA_uc009xih.1_Silent_p.R198R	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor	270	Cytoplasmic (Potential).				cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TAGATTGTTCTTCTACTCTTC	0.388													41	122	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127705804	127705804	+	3'UTR	SNP	A	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127705804A>T	uc001ljk.2	-	23					ADAM12_uc010qul.1_3'UTR|ADAM12_uc001ljj.1_5'Flank	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GCTGAAAGATAGTGCAAACTT	0.398													4	17	---	---	---	---	PASS
B4GALNT4	338707	broad.mit.edu	37	11	379656	379656	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:379656C>T	uc001lpb.2	+	15	2452	c.2443C>T	c.(2443-2445)CGC>TGC	p.R815C		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	815	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCGGCCACTGCGCCTGGCCTG	0.721													3	7	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56231452	56231452	+	Missense_Mutation	SNP	G	A	A	rs113058577	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56231452G>A	uc001sib.2	-	8	1196	c.1075C>T	c.(1075-1077)CGC>TGC	p.R359C	MMP19_uc001sia.2_Missense_Mutation_p.R73C|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Intron	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	359	Hemopexin-like 2.				angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						TTAATGTAGCGCCACACCTTG	0.483													7	166	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39451280	39451280	+	Silent	SNP	T	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39451280T>C	uc001uwv.2	+	21	8880	c.8571T>C	c.(8569-8571)TTT>TTC	p.F2857F		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2857	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGCTGAGTTTAGCTTGAACA	0.438													37	150	---	---	---	---	PASS
GOLGA8C	729786	broad.mit.edu	37	15	20771686	20771686	+	5'UTR	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20771686C>T	uc010tzc.1	+	5					uc001ytn.2_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E											skin(1)	1						ATGTCTCTTGCAGTACCATCT	0.572													4	22	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42035185	42035185	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42035185C>G	uc010ucy.1	+	15	5208	c.5027C>G	c.(5026-5028)CCT>CGT	p.P1676R	MGA_uc010ucz.1_Intron|MGA_uc010uda.1_Missense_Mutation_p.P292R	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	1676	Thr-rich.					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		GTTGCTTTTCCTAAGTCTTTG	0.483													20	66	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59506883	59506883	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59506883A>G	uc002aga.2	-	11	1516	c.1144T>C	c.(1144-1146)TAC>CAC	p.Y382H		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	382	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		CCAATGTTGTATTCTTCATGG	0.423													87	272	---	---	---	---	PASS
NGRN	51335	broad.mit.edu	37	15	90815014	90815014	+	Silent	SNP	A	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90815014A>G	uc002bpf.1	+	3	920	c.870A>G	c.(868-870)AGA>AGG	p.R290R	TTLL13_uc002bpe.1_RNA|NGRN_uc002bpg.1_Silent_p.R218R	NM_001033088	NP_001028260	Q9NPE2	NGRN_HUMAN	neugrin	290					neuron differentiation	extracellular region|nucleus				large_intestine(2)|ovary(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TCCTGTACAGAATTTGAGTCG	0.493													25	84	---	---	---	---	PASS
SPNS3	201305	broad.mit.edu	37	17	4381896	4381896	+	Silent	SNP	G	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4381896G>C	uc002fxt.2	+	9	1187	c.1143G>C	c.(1141-1143)CTG>CTC	p.L381L	SPNS3_uc002fxu.2_Silent_p.L254L|SPNS3_uc002fxv.2_Silent_p.L65L	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3	381	Helical; (Potential).				lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						AGCTGCTTCTGTCCTGCAACT	0.637													2	3	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319528	21319528	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319528G>A	uc002gyv.1	+	3	1579	c.874G>A	c.(874-876)GAC>AAC	p.D292N		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	292	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GGAGACGGACGACTTTGAGAT	0.612										Prostate(3;0.18)			23	105	---	---	---	---	PASS
TBC1D16	125058	broad.mit.edu	37	17	77926601	77926601	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77926601C>G	uc002jxj.2	-	4	912	c.796G>C	c.(796-798)GAC>CAC	p.D266H	TBC1D16_uc002jxh.2_5'Flank|TBC1D16_uc002jxi.2_5'Flank|TBC1D16_uc002jxk.1_5'Flank	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	266						intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			AGGCCGGCGTCGGAGCTGGAC	0.672													16	44	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6898615	6898615	+	Intron	SNP	G	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898615G>T	uc010wzi.1	+						ARHGAP28_uc002knc.2_3'UTR|ARHGAP28_uc002knd.2_3'UTR|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_3'UTR			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AGGGATTTGGGTATCCAGTAG	0.363													7	85	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16536069	16536069	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16536069G>A	uc002ndz.1	-	9	623	c.617C>T	c.(616-618)CCG>CTG	p.P206L	EPS15L1_uc002ndx.2_Missense_Mutation_p.P206L|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Missense_Mutation_p.P96L|EPS15L1_uc010xpf.1_Missense_Mutation_p.P109L|EPS15L1_uc002nea.1_Missense_Mutation_p.P206L|EPS15L1_uc010eah.1_Missense_Mutation_p.P206L|EPS15L1_uc002neb.1_Missense_Mutation_p.P52L|EPS15L1_uc002nec.1_Missense_Mutation_p.P206L	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	206	EH 2.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						GATGAGGGACGGGGGCAGGGC	0.652													16	24	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33604579	33604579	+	Intron	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33604579C>T	uc002nug.1	+						GPATCH1_uc002nuh.1_5'UTR	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					TTTAGTCATGCAGAAGAGGTG	0.373													10	23	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36046428	36046428	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36046428C>G	uc002oal.1	-	14	2100	c.2071G>C	c.(2071-2073)GAG>CAG	p.E691Q	ATP4A_uc010eee.1_5'UTR	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	691	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	CGCAGGGCCTCGACCAGTTCC	0.652													13	35	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38985048	38985048	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38985048G>A	uc002oit.2	+	39	6461	c.6331G>A	c.(6331-6333)GTG>ATG	p.V2111M	RYR1_uc002oiu.2_Missense_Mutation_p.V2111M|RYR1_uc002oiv.1_5'Flank	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2111	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGAGGACTTCGTGCAGAGCCC	0.667													11	50	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39008218	39008218	+	Missense_Mutation	SNP	C	A	A	rs139289204		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39008218C>A	uc002oit.2	+	66	10035	c.9905C>A	c.(9904-9906)CCA>CAA	p.P3302Q	RYR1_uc002oiu.2_Missense_Mutation_p.P3302Q|RYR1_uc002oiv.1_Missense_Mutation_p.P222Q|RYR1_uc010xuf.1_Missense_Mutation_p.P222Q	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3302					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GGCGCCCCCCCACCCTGCACA	0.652													17	18	---	---	---	---	PASS
ZNF234	10780	broad.mit.edu	37	19	44660625	44660625	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44660625G>C	uc002oym.2	+	6	763	c.456G>C	c.(454-456)GAG>GAC	p.E152D	ZNF234_uc002oyl.3_Missense_Mutation_p.E152D	NM_006630	NP_006621	Q14588	ZN234_HUMAN	zinc finger protein 234	152	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				AATGTGATGAGTACAAAAAAT	0.403													12	134	---	---	---	---	PASS
ZNF473	25888	broad.mit.edu	37	19	50549932	50549932	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50549932G>C	uc002prn.2	+	5	2469	c.2232G>C	c.(2230-2232)GAG>GAC	p.E744D	ZNF473_uc002prm.2_Missense_Mutation_p.E744D|ZNF473_uc010ybo.1_Missense_Mutation_p.E732D	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473	744	C2H2-type 16.				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TGAGTGCTGAGCTTGTCCGCC	0.507											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	122	---	---	---	---	PASS
POLD1	5424	broad.mit.edu	37	19	50905747	50905747	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50905747G>A	uc002psb.3	+	7	851	c.795G>A	c.(793-795)TGG>TGA	p.W265*	POLD1_uc002psc.3_Nonsense_Mutation_p.W265*|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Nonsense_Mutation_p.W265*	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	265					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GCTGCAACTGGCTGGAGCTCC	0.667								DNA_polymerases_(catalytic_subunits)					9	13	---	---	---	---	PASS
PROCR	10544	broad.mit.edu	37	20	33762727	33762727	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33762727G>T	uc002xbt.2	+	2	477	c.293G>T	c.(292-294)CGC>CTC	p.R98L	EDEM2_uc010zuv.1_Intron|PROCR_uc010zuw.1_Missense_Mutation_p.R135L	NM_006404	NP_006395	Q9UNN8	EPCR_HUMAN	endothelial protein C receptor precursor	98	Extracellular (Potential).				antigen processing and presentation|blood coagulation|immune response	integral to plasma membrane|MHC class I protein complex	receptor activity				0			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GGCCTCGTGCGCCTGGTGCAC	0.498													4	7	---	---	---	---	PASS
PCIF1	63935	broad.mit.edu	37	20	44567623	44567623	+	Translation_Start_Site	SNP	C	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44567623C>A	uc002xqs.2	+	3	299	c.-15C>A	c.(-17--13)TCCTG>TCATG			NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1							nucleus				skin(1)	1						GTGGCAGGTCCTGTGTGGGTG	0.612													7	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	228267	228267	+	Translation_Start_Site	SNP	G	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:228267G>A	uc004cpd.1	-	1	529	c.-82C>T	c.(-84--80)GACGG>GATGG		uc004cpe.1_Missense_Mutation_p.T86M	NM_012227	NP_036359			pseudoautosomal GTP-binding protein-like																		GGCATCGCCCGTCAGTGCCTT	0.677													7	77	---	---	---	---	PASS
PRDX4	10549	broad.mit.edu	37	X	23704501	23704501	+	3'UTR	SNP	C	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23704501C>T	uc004dam.2	+	7						NM_006406	NP_006397	Q13162	PRDX4_HUMAN	peroxiredoxin 4						cell redox homeostasis|I-kappaB phosphorylation		thioredoxin peroxidase activity			upper_aerodigestive_tract(1)	1						ATAAAGTTCACGGTTTCATTA	0.348													17	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4274160	4274163	+	IGR	DEL	CTTT	-	-	rs11801817		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4274160_4274163delCTTT								LOC100133612 (440283 upstream) : LOC284661 (197948 downstream)																							tccttccttcctttcttccttcct	0.078													6	3	---	---	---	---	
FNDC5	252995	broad.mit.edu	37	1	33330043	33330043	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33330043delT	uc001bwf.1	-						FNDC5_uc001bwe.2_Intron	NM_153756	NP_715637	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5							integral to membrane|peroxisomal membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CACTCACTGCTTTTTTTTTTT	0.383													5	3	---	---	---	---	
C1orf175	374977	broad.mit.edu	37	1	55174883	55174886	+	Intron	DEL	TTTG	-	-	rs72066570		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55174883_55174886delTTTG	uc010ooe.1	+						C1orf175_uc001cxq.2_Intron|C1orf175_uc001cxs.2_Intron|C1orf175_uc010ood.1_Intron|C1orf175_uc010oof.1_Intron|C1orf175_uc001cxr.1_Intron|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_Intron|C1orf175_uc009vzr.1_Intron	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977							integral to membrane	binding				0						GTACTAgttttttgtttgtttgtt	0.225													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	63822076	63822083	+	IGR	DEL	AAGGAAGG	-	-	rs149481228		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63822076_63822083delAAGGAAGG								FOXD3 (31279 upstream) : ALG6 (11178 downstream)																							gaaggaaggaaaggaaggaaggaaggaa	0.005													5	3	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487406	67487407	+	Intron	DEL	AG	-	-	rs71711790		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487406_67487407delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acacagacacagacacacacac	0.248													4	4	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149921365	149921365	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149921365delT	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTCCCAACCCTTTTTTTTTTT	0.358													6	3	---	---	---	---	
LYSMD1	388695	broad.mit.edu	37	1	151133973	151133973	+	Intron	DEL	A	-	-	rs33999172		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151133973delA	uc001ewy.2	-						LYSMD1_uc010pcr.1_Intron	NM_212551	NP_997716	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			accccgtctcaaaaaaaaaaa	0.209													7	4	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATGTCTCCACCCCCCCCCCA	0.527													4	2	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169319460	169319461	+	Intron	INS	-	AAAG	AAAG			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169319460_169319461insAAAG	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_Intron	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					agaaagggagaaaagaaagaaa	0.089													4	2	---	---	---	---	
MTR	4548	broad.mit.edu	37	1	236983888	236983888	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236983888delA	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron|MTR_uc009xgj.1_Intron	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TCAGTTTCTTAAAAAAAAAAA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106105748	106105749	+	IGR	INS	-	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106105748_106105749insA								FHL2 (50518 upstream) : NCK2 (255605 downstream)																							aggaaggaaggaaggaaggaag	0.000													5	3	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325998	232325998	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325998delA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		aaaaaaatttaaaaaaaaaaa	0.119													3	4	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11483142	11483143	+	Intron	DEL	TA	-	-	rs58648167		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11483142_11483143delTA	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						tttttttttttaattttttttt	0.168													4	2	---	---	---	---	
LTF	4057	broad.mit.edu	37	3	46487788	46487804	+	Intron	DEL	TTGCACCCTTAAAATTA	-	-	rs56343354		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46487788_46487804delTTGCACCCTTAAAATTA	uc003cpq.2	-						LTF_uc003fzr.2_Intron|LTF_uc010hjh.2_Intron|LTF_uc003cpr.2_Intron	NM_002343	NP_002334	P02788	TRFL_HUMAN	lactotransferrin precursor						cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity			central_nervous_system(2)|ovary(1)|lung(1)	4				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	Pefloxacin(DB00487)	TGTGAATTATTTGCACCCTTAAAATTATTGCTCCTAG	0.253													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151297663	151297663	+	IGR	DEL	A	-	-	rs145031240	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151297663delA								IGSF10 (121166 upstream) : AADACL2 (154041 downstream)																							gggaggaaggaaaggaaggaa	0.000													3	3	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20308668	20308671	+	Intron	DEL	CCTT	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20308668_20308671delCCTT	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						tttttacctaccttccttccttcc	0.039													5	3	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20619357	20619357	+	Intron	DEL	A	-	-	rs71653889		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20619357delA	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						agaaaaagtgaaaaaaaaaaa	0.303													4	5	---	---	---	---	
GBA3	57733	broad.mit.edu	37	4	22749783	22749784	+	Intron	INS	-	TA	TA	rs150133210	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749783_22749784insTA	uc003gqp.3	+						GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Intron	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a						glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						ACAGGCatatgtatatatatat	0.332													4	2	---	---	---	---	
YIPF7	285525	broad.mit.edu	37	4	44651969	44651969	+	Intron	DEL	A	-	-	rs35447406		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44651969delA	uc010ifx.1	-						YIPF7_uc010ify.1_Intron	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7							endoplasmic reticulum membrane|integral to membrane					0						agactctgtcaaaaaaaaaaa	0.179													6	3	---	---	---	---	
CEP135	9662	broad.mit.edu	37	4	56890991	56890992	+	Intron	INS	-	T	T	rs113118558		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56890991_56890992insT	uc003hbi.2	+						CEP135_uc003hbj.2_Intron	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4						centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					acagtgtatgcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181389664	181389665	+	IGR	INS	-	TTG	TTG	rs143129728	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181389664_181389665insTTG								None (None upstream) : None (None downstream)																							ggcgtttttctttgttgttgtt	0.000													3	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5235002	5235002	+	Intron	DEL	G	-	-	rs79385715		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5235002delG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						aaaaaaaaaagaaTCCACTTT	0.134													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13830525	13830525	+	Intron	DEL	A	-	-	rs112224533		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13830525delA	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AAGGAATATCAAAAAAAAGTC	0.338									Kartagener_syndrome				6	4	---	---	---	---	
NDUFS4	4724	broad.mit.edu	37	5	52942409	52942410	+	Intron	DEL	AA	-	-	rs10571887		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52942409_52942410delAA	uc003jpe.2	+							NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4						brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	ATATTCAGATAAGTGTGGCTTA	0.327													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54258645	54258646	+	IGR	DEL	TA	-	-	rs35693314		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54258645_54258646delTA								SNX18 (416230 upstream) : ESM1 (15050 downstream)																							tgtgtgtgtgtatgtgtgtgtg	0.193													3	3	---	---	---	---	
MIER3	166968	broad.mit.edu	37	5	56224818	56224819	+	Intron	INS	-	CACACA	CACACA	rs146870702		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56224818_56224819insCACACA	uc003jrd.1	-						MIER3_uc003jqz.1_Intron|MIER3_uc003jra.1_Intron|MIER3_uc003jrb.1_Intron|MIER3_uc003jrc.1_Intron	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		actctctctctcacacacacac	0.233													4	4	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137909330	137909331	+	Intron	INS	-	AAA	AAA	rs55663873		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137909330_137909331insAAA	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			agactgtctccaaaaaaaaaaa	0.149													5	4	---	---	---	---	
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139889894	139889894	+	Intron	DEL	C	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139889894delC	uc003lfs.1	+						ANKHD1_uc003lfq.1_Intron|ANKHD1_uc003lfr.2_Intron|ANKHD1_uc003lft.1_Intron|ANKHD1_uc003lfu.1_Intron|ANKHD1_uc003lfv.1_Intron|ANKHD1-EIF4EBP3_uc011czh.1_Intron|ANKHD1_uc003lfw.2_Intron	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein							cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTTCCAttctttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12348462	12348465	+	IGR	DEL	TCTT	-	-	rs71754709		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12348462_12348465delTCTT								EDN1 (51036 upstream) : PHACTR1 (368423 downstream)																							cttcctttcctctttctttctttc	0.000													5	3	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26465762	26465762	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26465762delA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron|BTN2A1_uc010jqk.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						ctgtttaattaaaaaaaaaaa	0.199													4	3	---	---	---	---	
PGM3	5238	broad.mit.edu	37	6	83900377	83900377	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83900377delA	uc003pjv.2	-						PGM3_uc003pjw.2_Intron|PGM3_uc011dyz.1_Intron|RWDD2A_uc003pjx.3_5'Flank|RWDD2A_uc011dza.1_5'Flank	NM_015599	NP_056414	O95394	AGM1_HUMAN	phosphoglucomutase 3						dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TCATGCTCTTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
ULBP2	80328	broad.mit.edu	37	6	150267343	150267343	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150267343delA	uc003qno.2	+						ULBP2_uc011eeh.1_Intron|ULBP2_uc010kij.2_Intron	NM_025217	NP_079493	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2 precursor						antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|cell surface|extracellular space|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		accctttctcaaaaaaaaaaa	0.189													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67839407	67839408	+	IGR	DEL	CC	-	-	rs57872519		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67839407_67839408delCC								None (None upstream) : None (None downstream)																							ttccttccttccccttccttcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152144400	152144400	+	IGR	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152144400delT								FABP5L3 (4302 upstream) : LOC100128822 (16809 downstream)																							AGTTCTCGAAttttttttttt	0.149													4	2	---	---	---	---	
SNX31	169166	broad.mit.edu	37	8	101585896	101585896	+	3'UTR	DEL	T	-	-	rs75299360		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101585896delT	uc003yjr.2	-	14					SNX31_uc011lha.1_3'UTR|SNX31_uc011lhb.1_3'UTR	NM_152628	NP_689841	Q8N9S9	SNX31_HUMAN	sorting nexin 31						cell communication|protein transport		phosphatidylinositol binding				0	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			AACTTGGTTCTTTTTTTTTTT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125850042	125850043	+	IGR	INS	-	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125850042_125850043insT								MTSS1 (109312 upstream) : LOC157381 (101841 downstream)																							tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
CBWD1	55871	broad.mit.edu	37	9	162575	162575	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:162575delA	uc003zga.3	-						CBWD1_uc010mgs.2_Intron|CBWD1_uc003zgb.3_Intron|CBWD1_uc003zgc.3_Intron|CBWD1_uc011llr.1_Intron	NM_018491	NP_060961	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1 isoform 1								ATP binding|protein binding			ovary(1)	1	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TTCAGTTCACAAATACTACTC	0.274													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93513509	93513509	+	IGR	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513509delA								DIRAS2 (108401 upstream) : SYK (50503 downstream)																							TCTTACCCACACAAGAAAAAG	0.453													4	2	---	---	---	---	
FANCC	2176	broad.mit.edu	37	9	97933210	97933211	+	Intron	DEL	AA	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97933210_97933211delAA	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				AAAACTCACCAATTTGCTATGT	0.297			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	3	---	---	---	---	
KIAA0368	23392	broad.mit.edu	37	9	114170786	114170786	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114170786delA	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0						AACTGCACCTAAAAAAAAAAA	0.348													3	3	---	---	---	---	
WDR34	89891	broad.mit.edu	37	9	131397627	131397627	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131397627delA	uc004bvq.1	-						WDR34_uc004bvs.1_Intron|WDR34_uc004bvr.1_Intron	NM_052844	NP_443076	Q96EX3	WDR34_HUMAN	WD repeat domain 34							cytoplasm				central_nervous_system(2)|skin(1)	3						CTCTTCCAGGAAAAAAAAAAA	0.622											OREG0019522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140268130	140268132	+	Intron	DEL	TTT	-	-	rs66959515		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140268130_140268132delTTT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CGCAGAGAGGTTTTTTAAAATTT	0.571													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8524662	8524665	+	IGR	DEL	TCCC	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8524662_8524665delTCCC								GATA3 (407500 upstream) : None (None downstream)																							cttccttccttccctccctccctc	0.088													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16193948	16193949	+	IGR	INS	-	AGAAA	AGAAA	rs146831092	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16193948_16193949insAGAAA								FAM188A (291429 upstream) : PTER (285018 downstream)																							aagaaagaaagagaaaagaaag	0.059													5	4	---	---	---	---	
TRDMT1	1787	broad.mit.edu	37	10	17203599	17203603	+	Intron	DEL	AAAGT	-	-	rs3833985		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17203599_17203603delAAAGT	uc001iop.2	-						TRDMT1_uc001ioq.2_Intron|TRDMT1_uc001ior.2_Intron|TRDMT1_uc001ios.2_Intron|TRDMT1_uc009xjt.2_Intron|TRDMT1_uc010qcc.1_Intron|TRDMT1_uc010qcd.1_Intron|TRDMT1_uc009xjs.1_Intron|TRDMT1_uc009xju.1_Intron	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform						tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						CTAAGAAGAAAAAGTAAAGAAAATC	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385340	42385362	+	IGR	DEL	GAATTATCTAATGCAATCGAATA	-	-	rs66510027		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385340_42385362delGAATTATCTAATGCAATCGAATA								None (None upstream) : LOC441666 (441953 downstream)																							gaatcgaagggaattatctaatgcaatcgaatagaattatcga	0.000													4	2	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634779	45634780	+	Intron	DEL	AC	-	-	rs71659798		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634779_45634780delAC	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						AAAAAAAAAAACAAAATTTGTA	0.163													7	5	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298314	57298315	+	Intron	INS	-	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298314_57298315insT	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tccttccttcctcctttccttc	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	65402008	65402008	+	IGR	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65402008delT								REEP3 (20037 upstream) : None (None downstream)																							ccttccttccttttttttttt	0.000													4	2	---	---	---	---	
DNMBP	23268	broad.mit.edu	37	10	101731006	101731007	+	Intron	DEL	TA	-	-	rs141324797		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101731006_101731007delTA	uc001kqj.2	-							NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ATACAGTAGGTAAACACAAAAG	0.317													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9652950	9652950	+	IGR	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9652950delT								WEE1 (41639 upstream) : SWAP70 (32678 downstream)																							TTGTAtttccttttttttttt	0.169													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14284600	14284601	+	Intron	DEL	AA	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14284600_14284601delAA	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		GGACCTGTTTaaaaaaaaaaaa	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33859071	33859072	+	IGR	INS	-	AAGGAAGG	AAGGAAGG	rs138077545	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33859071_33859072insAAGGAAGG								FBXO3 (63000 upstream) : LMO2 (21053 downstream)																							tcaaaaaaagaaaggaaggaag	0.000													5	3	---	---	---	---	
FOXR1	283150	broad.mit.edu	37	11	118840283	118840286	+	5'Flank	DEL	GAAG	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118840283_118840286delGAAG	uc001pui.2	+						FOXR1_uc001puj.2_5'Flank	NM_181721	NP_859072	Q6PIV2	FOXR1_HUMAN	forkhead box R1						embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		agggaaggaagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121144374	121144381	+	IGR	DEL	CTTCCTTC	-	-	rs57803831		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121144374_121144381delCTTCCTTC								TECTA (82861 upstream) : SC5DL (19007 downstream)																							ctttttctttcttccttccttccttcct	0.000													5	4	---	---	---	---	
TFCP2	7024	broad.mit.edu	37	12	51489596	51489597	+	Intron	INS	-	A	A	rs34105291		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51489596_51489597insA	uc001rxw.2	-						TFCP2_uc001rxv.1_Intron|TFCP2_uc009zlx.1_Intron|TFCP2_uc001rxx.2_Intron	NM_005653	NP_005644	Q12800	TFCP2_HUMAN	transcription factor CP2						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						gactctgtttcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
KRT7	3855	broad.mit.edu	37	12	52631511	52631514	+	Intron	DEL	TGTG	-	-	rs149565720		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52631511_52631514delTGTG	uc001saa.1	+						KRT7_uc009zmf.1_Intron	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7						cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		ggtgcgtgtatgtgtgtgtgtgtg	0.279													5	3	---	---	---	---	
C12orf10	60314	broad.mit.edu	37	12	53696705	53696706	+	Intron	INS	-	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53696705_53696706insT	uc001scp.3	+						C12orf10_uc010sof.1_Intron|C12orf10_uc009zmx.2_Intron|C12orf10_uc001scq.3_Intron	NM_021640	NP_067653	Q86UA3	Q86UA3_HUMAN	MYG1 protein precursor											ovary(2)	2						tccttaatgtctaataaaacat	0.134													99	45	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72290306	72290307	+	Intron	INS	-	A	A	rs148885326	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72290306_72290307insA	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						GATCTAGAAGTAAAAAACAAGA	0.327													4	7	---	---	---	---	
C12orf51	283450	broad.mit.edu	37	12	112685782	112685783	+	Intron	DEL	AC	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112685782_112685783delAC	uc009zwc.2	-							NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TATTTTACCTacacacacacac	0.277													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127308110	127308110	+	IGR	DEL	C	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127308110delC								LOC100128554 (350780 upstream) : None (None downstream)																							tcttcagtgtccccagtgtct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131792640	131792641	+	IGR	INS	-	ACA	ACA			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131792640_131792641insACA								LOC116437 (95165 upstream) : SFRS8 (402994 downstream)																							cacacacacacacatcacacTG	0.193													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	53733073	53733076	+	IGR	DEL	CCTT	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53733073_53733076delCCTT								OLFM4 (106887 upstream) : None (None downstream)																							ctccctcccaccttccttccttcc	0.078													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103775352	103775353	+	IGR	INS	-	GAAA	GAAA	rs138743388	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103775352_103775353insGAAA								TNFAIP2 (171576 upstream) : EIF5 (25140 downstream)																							aaggaaggaaggaaggaaggaa	0.139													3	6	---	---	---	---	
POTEB	339010	broad.mit.edu	37	15	22077299	22077299	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22077299delT	uc010tzr.1	-						POTEB_uc010tzq.1_Intron	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,												0						AAATTCAGTGTTTTTTTTTTT	0.259													4	3	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27633306	27633309	+	Intron	DEL	AAGG	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633306_27633309delAAGG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		ggaaggaagaaaggaaggaaggaa	0.000													7	4	---	---	---	---	
GPT2	84706	broad.mit.edu	37	16	46950267	46950267	+	Intron	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46950267delA	uc002eel.2	+						GPT2_uc002eem.2_Intron	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1						2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	caaaaaaattaaaaaaaaaaa	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48826940	48826941	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs142315097	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48826940_48826941insTTCCTTCC								N4BP1 (182820 upstream) : CBLN1 (485270 downstream)																							Ttttctttcttttccttccttc	0.129													2	4	---	---	---	---	
PSMB6	5694	broad.mit.edu	37	17	4696906	4696915	+	5'Flank	DEL	AGAAAAGAAA	-	-	rs145922777		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4696906_4696915delAGAAAAGAAA	uc002fzb.2	+							NM_002798	NP_002789	P28072	PSB6_HUMAN	proteasome beta 6 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity			ovary(2)	2						aaagaaaaggagaaaagaaaagaaaagaaa	0.000													3	3	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307104	7307105	+	Intron	DEL	CC	-	-	rs71383487		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307104_7307105delCC	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				AGAAAGGGCACCCCCCCCCCCG	0.624													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	31275022	31275023	+	IGR	INS	-	T	T			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31275022_31275023insT								TMEM98 (6357 upstream) : SPACA3 (43859 downstream)																							CAGAGAGCCAGTTTTTTTTTtt	0.257													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33893887	33893887	+	IGR	DEL	A	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33893887delA								SLFN14 (8777 upstream) : SNORD7 (6789 downstream)																							CTTTCATTTCAAAAAAAAAAA	0.383													4	2	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						cacacacacagacacacacaca	0.183													4	3	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21469682	21469689	+	Intron	DEL	AAGGAAGA	-	-	rs112936521	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21469682_21469689delAAGGAAGA	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	gggaggaaggaaggaagaaaggaaggaa	0.106													4	3	---	---	---	---	
PIP5K1C	23396	broad.mit.edu	37	19	3648501	3648528	+	Intron	DEL	GGCGCCCACCTGTGGGGCTGCAGACCCG	-	-	rs9676740		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3648501_3648528delGGCGCCCACCTGTGGGGCTGCAGACCCG	uc002lyj.1	-						PIP5K1C_uc010xhq.1_Intron|PIP5K1C_uc010xhr.1_Intron	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		TGCAGACCCAGGCGCCCACCTGTGGGGCTGCAGACCCGGGCGCCCACC	0.715													6	3	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6856887	6856888	+	Intron	DEL	GT	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6856887_6856888delGT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						gaggtaatgggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14761748	14761748	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14761748delT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						GGAAAATGTCTTTTTTTTTTT	0.413													5	3	---	---	---	---	
ZNF420	147923	broad.mit.edu	37	19	37617892	37617893	+	Intron	INS	-	TAT	TAT	rs143864812	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37617892_37617893insTAT	uc002ofl.2	+							NM_144689	NP_653290	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGAAAGGTAGGTATTATATGTC	0.262													2	4	---	---	---	---	
PRR12	57479	broad.mit.edu	37	19	50123757	50123757	+	Intron	DEL	G	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50123757delG	uc002poo.3	+							NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12								DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ctggggaggaggggggggggc	0.249													3	3	---	---	---	---	
ISOC2	79763	broad.mit.edu	37	19	55964546	55964547	+	3'UTR	INS	-	C	C	rs139098245	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55964546_55964547insC	uc002qlb.2	-	6					ISOC2_uc002qla.2_3'UTR|ISOC2_uc002qlc.2_3'UTR	NM_001136201	NP_001129673	Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2 isoform 1						protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		GCAGCACCCTGCCCCCCCCACA	0.639													2	4	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332880	1332880	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332880delT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	ccttccttcctttccttcctt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755961	44755961	+	IGR	DEL	C	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755961delC								CRYAA (163048 upstream) : SIK1 (78437 downstream)																							accatcaccaccatcaccacc	0.000													5	3	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30032866	30032867	+	Splice_Site	DEL	GT	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30032866_30032867delGT	uc003age.3	+	2	683	c.240_splice	c.e2+1	p.K80_splice	NF2_uc003afy.3_Splice_Site_p.K80_splice|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Splice_Site_p.K80_splice|NF2_uc003agb.3_5'UTR|NF2_uc003agc.3_Splice_Site_p.K42_splice|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Splice_Site_p.K80_splice|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Splice_Site_p.K80_splice|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Splice_Site_p.K80_splice|NF2_uc003agk.3_Splice_Site_p.K42_splice	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(3)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GGACAAGAAGGTTGGGCTAGAA	0.535			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				57	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48839400	48839427	+	IGR	DEL	GAAGGAGGGAAGGAAGGAAGGAAGGAAG	-	-	rs67070371	by1000genomes	TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48839400_48839427delGAAGGAGGGAAGGAAGGAAGGAAGGAAG								None (None upstream) : FAM19A5 (45861 downstream)																							gggagggaaagaaggagggaaggaaggaaggaaggaaggaaggaagga	0.039													5	4	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GGTGCTAAATTCCTGACCATCTGTCCTGGGGCA	0.620													4	4	---	---	---	---	
CDKL5	6792	broad.mit.edu	37	X	18613311	18613312	+	Intron	INS	-	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18613311_18613312insA	uc004cym.2	+						CDKL5_uc004cyn.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5						neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					caaaaacaaacaaaaaaaaaTA	0.173													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													4	2	---	---	---	---	
GAGE2A	729447	broad.mit.edu	37	X	49208295	49208296	+	Intron	INS	-	TAT	TAT			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49208295_49208296insTAT	uc004dnr.3	+						GAGE12J_uc004dnl.3_Intron|GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_In_Frame_Ins_p.9_10insY|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Intron|GAGE2D_uc004dnp.3_Intron|GAGE2C_uc004dno.3_Intron|GAGE8_uc011mnh.1_Intron|GAGE2C_uc004dnu.3_In_Frame_Ins_p.9_10insY|GAGE2D_uc010njc.2_In_Frame_Ins_p.9_10insY|GAGE2D_uc004dnt.3_In_Frame_Ins_p.9_10insY|GAGE8_uc011mni.1_In_Frame_Ins_p.9_10insY	NM_001127212	NP_001120684	Q6NT46	GAG2A_HUMAN	G antigen 2A												0	Ovarian(276;0.236)					GAAGATCGACCTATCGGCCTAG	0.465													4	2	---	---	---	---	
HMGN5	79366	broad.mit.edu	37	X	80377126	80377145	+	5'UTR	DEL	AAATGAGTTTTCAATGAACT	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80377126_80377145delAAATGAGTTTTCAATGAACT	uc004eee.1	-	2						NM_030763	NP_110390	P82970	HMGN5_HUMAN	high-mobility group nucleosome binding domain 5						chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|nucleolus	chromatin binding|DNA binding			lung(1)	1						CTCCAAGAGCAAATGAGTTTTCAATGAACTAACTGCAGCA	0.427													12	15	---	---	---	---	
KLHL4	56062	broad.mit.edu	37	X	86924520	86924521	+	3'UTR	INS	-	A	A			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86924520_86924521insA	uc004efb.2	+	11					KLHL4_uc004efa.2_3'UTR	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1							cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						ATGCAATATAGAAAAAAAAACC	0.361													4	2	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-BP-4986-01A-01D-1462-08	TCGA-BP-4986-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCTGAACttcttttttttttt	0.139													4	3	---	---	---	---	
