Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3329021	3329021	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3329021G>T	uc001akf.2	+	9	2340	c.2260G>T	c.(2260-2262)GAG>TAG	p.E754*	PRDM16_uc001akc.2_Nonsense_Mutation_p.E754*|PRDM16_uc001akd.2_Nonsense_Mutation_p.E754*|PRDM16_uc001ake.2_Nonsense_Mutation_p.E754*|PRDM16_uc009vlh.2_Nonsense_Mutation_p.E455*	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	754	Mediates interaction with SKI and regulation of TGF-beta signaling.|Interaction with CTBP1 and CTBP2 (By similarity).				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GGTCAAGGCCGAGCCAAAGTC	0.642			T	EVI1	MDS|AML								3	91	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24419478	24419478	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24419478G>A	uc001bin.3	-	10	1212	c.1049C>T	c.(1048-1050)CCC>CTC	p.P350L	MYOM3_uc001bim.3_Missense_Mutation_p.P7L|MYOM3_uc001bio.2_Missense_Mutation_p.P350L|MYOM3_uc001bip.1_Missense_Mutation_p.P7L	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	350	Ig-like C2-type 2.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GGGTCCGAAGGGCGAGGGCAC	0.448													5	16	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144829025	144829025	+	Intron	SNP	A	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144829025A>G	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elr.3_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTGATCAGTCAGACATTTTAA	0.473													2	7	---	---	---	---	PASS
TROVE2	6738	broad.mit.edu	37	1	193029177	193029177	+	Intron	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193029177C>T	uc001gss.2	+						UCHL5_uc001gsm.2_5'Flank|UCHL5_uc001gsn.2_5'Flank|UCHL5_uc001gso.2_5'Flank|UCHL5_uc010pov.1_5'Flank|UCHL5_uc001gsp.2_5'Flank|UCHL5_uc001gsq.2_5'Flank|UCHL5_uc010pow.1_5'UTR|UCHL5_uc010pox.1_5'Flank|UCHL5_uc001gsr.1_5'UTR|TROVE2_uc001gst.1_Intron|TROVE2_uc001gsu.1_Intron|TROVE2_uc001gsv.1_5'UTR|TROVE2_uc001gsw.2_5'UTR|TROVE2_uc009wyp.2_5'UTR|TROVE2_uc009wyq.2_5'UTR	NM_004600	NP_004591	P10155	RO60_HUMAN	TROVE domain family, member 2 isoform 2						transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0						TGCTTGTCGGCATCGCTCCCC	0.667													5	17	---	---	---	---	PASS
TAF1B	9014	broad.mit.edu	37	2	10051037	10051037	+	Silent	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10051037C>T	uc002qzz.2	+	10	1228	c.1128C>T	c.(1126-1128)TTC>TTT	p.F376F	TAF1B_uc010exc.2_Silent_p.F376F|TAF1B_uc002qzy.3_Silent_p.F376F|TAF1B_uc010yja.1_Silent_p.F121F|TAF1B_uc010exd.2_Silent_p.F121F	NM_005680	NP_005671	Q53T94	TAF1B_HUMAN	TBP-associated factor 1B	376					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)|pancreas(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGACAGTTTCGAGTGGTAAG	0.328													35	96	---	---	---	---	PASS
PDIA6	10130	broad.mit.edu	37	2	10931989	10931989	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10931989C>G	uc002rau.2	-	6	654	c.516G>C	c.(514-516)AAG>AAC	p.K172N	PDIA6_uc010yjg.1_Missense_Mutation_p.K169N|PDIA6_uc002rav.2_Missense_Mutation_p.K224N|PDIA6_uc010yjh.1_Missense_Mutation_p.K177N|PDIA6_uc002raw.2_Missense_Mutation_p.K220N	NM_005742	NP_005733	Q15084	PDIA6_HUMAN	protein disulfide isomerase A6 precursor	172	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		CCAGAACATTCTTATCAAAGC	0.403													27	66	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74328533	74328533	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74328533G>T	uc002skb.3	+	9	4213	c.4213G>T	c.(4213-4215)GGG>TGG	p.G1405W		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	1405							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GCTGGGGGCAGGGGATTTCAA	0.637													4	37	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89082281	89082281	+	Splice_Site	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89082281T>C	uc010fhf.2	+	3		c.397_splice	c.e3+2		FLJ40330_uc010fhg.2_Splice_Site|FLJ40330_uc010fhh.2_Splice_Site					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						GCTGAGAAGGTAATTAAAGTC	0.323													3	76	---	---	---	---	PASS
ITPRIPL1	150771	broad.mit.edu	37	2	96993809	96993809	+	Silent	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993809C>T	uc002svx.2	+	3	1775	c.1440C>T	c.(1438-1440)TTC>TTT	p.F480F	ITPRIPL1_uc010yuk.1_Silent_p.F472F|ITPRIPL1_uc002svy.2_Silent_p.F488F|ITPRIPL1_uc010yul.1_Silent_p.F472F	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	480	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						TTCTCTGGTTCTTGGGCCGTG	0.527													43	112	---	---	---	---	PASS
SH3RF3	344558	broad.mit.edu	37	2	110053415	110053415	+	Silent	SNP	G	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110053415G>T	uc010ywt.1	+	7	1641	c.1641G>T	c.(1639-1641)GGG>GGT	p.G547G		NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	547							zinc ion binding			ovary(1)	1						TGGCCAAAGGGATAACCACAA	0.637													9	34	---	---	---	---	PASS
BZW1	9689	broad.mit.edu	37	2	201682967	201682967	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201682967C>G	uc010zhg.1	+	8	818	c.766C>G	c.(766-768)CAA>GAA	p.Q256E	BZW1_uc002uwc.2_Missense_Mutation_p.Q224E|BZW1_uc010zhh.1_Missense_Mutation_p.Q224E	NM_014670	NP_055485	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	224					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	protein binding				0						TGCCAATAAGCAAAGTGTTGA	0.348													4	19	---	---	---	---	PASS
AQP12A	375318	broad.mit.edu	37	2	241631411	241631411	+	Silent	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241631411C>A	uc002vzu.2	+	1	150	c.81C>A	c.(79-81)GCC>GCA	p.A27A	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	27						integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CCTCCAAGGCCCTGCTCCCAG	0.687													13	47	---	---	---	---	PASS
SLMAP	7871	broad.mit.edu	37	3	57913124	57913124	+	3'UTR	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57913124C>A	uc003dje.1	+	22					SLMAP_uc003djd.1_3'UTR|SLMAP_uc003djf.1_3'UTR|SLMAP_uc003djg.1_3'UTR|SLMAP_uc011bez.1_3'UTR|SLMAP_uc011bfa.1_3'UTR|SLMAP_uc003dji.1_3'UTR|SLMAP_uc011bfb.1_3'UTR|SLMAP_uc011bfc.1_3'UTR	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein						muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GAGAGCGTTCCTTGAGTCCGT	0.537													3	24	---	---	---	---	PASS
FRMD4B	23150	broad.mit.edu	37	3	69230103	69230103	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69230103G>A	uc003dnv.2	-	21	3088	c.2798C>T	c.(2797-2799)GCG>GTG	p.A933V	FRMD4B_uc003dnw.2_RNA|FRMD4B_uc003dnu.2_Missense_Mutation_p.A585V|FRMD4B_uc011bga.1_Missense_Mutation_p.A777V	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	933						cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TTGCAGCCCCGCAAACCCCAG	0.542													6	103	---	---	---	---	PASS
MYL5	4636	broad.mit.edu	37	4	674308	674308	+	Silent	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:674308C>T	uc003gav.2	+	5	408	c.303C>T	c.(301-303)GCC>GCT	p.A101A	MYL5_uc003gat.2_RNA|MYL5_uc003gau.2_RNA	NM_002477	NP_002468	Q02045	MYL5_HUMAN	myosin regulatory light chain 5	101	EF-hand 2.				regulation of muscle contraction	muscle myosin complex	calcium ion binding|structural constituent of muscle				0						GTACCGACGCCGAGGAGACCA	0.657													7	77	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13604991	13604991	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13604991G>C	uc003gmz.1	-	10	3650	c.3533C>G	c.(3532-3534)GCT>GGT	p.A1178G	BOD1L_uc010idr.1_Missense_Mutation_p.A515G	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1178							DNA binding			ovary(5)|breast(1)	6						ATAAGCTGGAGCTGTTGCTTT	0.393													83	210	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13604992	13604992	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13604992C>T	uc003gmz.1	-	10	3649	c.3532G>A	c.(3532-3534)GCT>ACT	p.A1178T	BOD1L_uc010idr.1_Missense_Mutation_p.A515T	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1178							DNA binding			ovary(5)|breast(1)	6						TAAGCTGGAGCTGTTGCTTTT	0.393													84	205	---	---	---	---	PASS
FAM134B	54463	broad.mit.edu	37	5	16475310	16475310	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16475310C>A	uc003jfs.2	-	9	1072	c.1034G>T	c.(1033-1035)AGA>ATA	p.R345I	FAM134B_uc003jfr.2_Missense_Mutation_p.R204I	NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1	345					sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						TGAAAGATCTCTAGAGAAAAC	0.388													22	74	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140257019	140257019	+	Silent	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140257019C>T	uc003lic.2	+	1	2089	c.1962C>T	c.(1960-1962)CAC>CAT	p.H654H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.H654H	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	654	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGGACCACGGTGAGCCCG	0.692													14	40	---	---	---	---	PASS
RNF130	55819	broad.mit.edu	37	5	179382657	179382657	+	Silent	SNP	A	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179382657A>G	uc003mll.1	-	9	1664	c.1257T>C	c.(1255-1257)TTT>TTC	p.F419F	RNF130_uc003mlm.1_3'UTR	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor	419	Cytoplasmic (Potential).				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTTCTTCAAAACCATTCTA	0.338													55	171	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76604578	76604578	+	Intron	SNP	A	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76604578A>G	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron|MYO6_uc003pij.1_5'UTR	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTTTCTATGTATGTCATATGT	0.269													4	3	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150004902	150004902	+	Silent	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150004902G>A	uc003qmu.1	-	4	1871	c.1323C>T	c.(1321-1323)GCC>GCT	p.A441A	LATS1_uc010kif.1_Silent_p.A336A|LATS1_uc003qmv.1_Silent_p.A441A|LATS1_uc003qmw.2_Silent_p.A441A|LATS1_uc010kig.1_Silent_p.A336A	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	441					cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GGGATGACTGGGCTGGAGCAG	0.428													8	346	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	153603666	153603666	+	IGR	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603666C>T								RGS17 (151277 upstream) : OPRM1 (727970 downstream)																							TGGGCAGAAGCTCTGGTTCCT	0.483													6	221	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567271	5567271	+	3'UTR	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567271C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		aaaaaaaaaaccaaaacaaaa	0.368													4	50	---	---	---	---	PASS
C7orf25	79020	broad.mit.edu	37	7	42949681	42949681	+	Silent	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42949681C>T	uc003thw.2	-	2	1283	c.819G>A	c.(817-819)GAG>GAA	p.E273E	C7orf25_uc010kxq.2_Silent_p.E273E|C7orf25_uc003thx.3_Silent_p.E331E|C7orf25_uc010kxr.2_Silent_p.E331E	NM_024054	NP_076959	Q9BPX7	CG025_HUMAN	hypothetical protein LOC79020 b	273										skin(1)	1						TGAGCACTTTCTCTTTGAAAA	0.428													58	174	---	---	---	---	PASS
ATP6V0A4	50617	broad.mit.edu	37	7	138417644	138417644	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138417644T>C	uc003vuf.2	-	16	2124	c.1886A>G	c.(1885-1887)AAC>AGC	p.N629S	ATP6V0A4_uc003vug.2_Missense_Mutation_p.N629S|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.N629S	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	629	Lumenal (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						GAGGGGTGCGTTGGAAGAGTC	0.373													5	37	---	---	---	---	PASS
PRSS37	136242	broad.mit.edu	37	7	141540818	141540818	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141540818G>A	uc003vws.1	-	1	404	c.32C>T	c.(31-33)GCT>GTT	p.A11V	PRSS37_uc011krk.1_Silent_p.L9L|PRSS37_uc011krl.1_Missense_Mutation_p.A11V|PRSS37_uc003vwt.1_5'UTR	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN	protease, serine, 37 precursor	11					proteolysis	extracellular region	serine-type endopeptidase activity			skin(1)	1						GTACATACCAGCGAGGACACC	0.473													22	142	---	---	---	---	PASS
RHEB	6009	broad.mit.edu	37	7	151188050	151188050	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151188050A>T	uc003wkh.1	-	2	516	c.103T>A	c.(103-105)TAC>AAC	p.Y35N		NM_005614	NP_005605	Q15382	RHEB_HUMAN	Ras homolog enriched in brain precursor	35	Effector region (By similarity).|GTP.				cell cycle arrest|insulin receptor signaling pathway|positive regulation of TOR signaling cascade|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|metal ion binding|protein binding			large_intestine(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		GTTGGATCGTAGGAGTCCACA	0.358													36	149	---	---	---	---	PASS
MTAP	4507	broad.mit.edu	37	9	21818193	21818193	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21818193C>G	uc003zph.2	+	4	452	c.339C>G	c.(337-339)TTC>TTG	p.F113L	MTAP_uc003zpi.1_Missense_Mutation_p.F113L|MTAP_uc010mit.2_RNA|MTAP_uc011lnk.1_Missense_Mutation_p.F130L|MTAP_uc011lnl.1_Missense_Mutation_p.F46L	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase	113					nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	TTGATCAGTTCATTGACAGGT	0.488													16	67	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107558674	107558674	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107558674A>C	uc004bcl.2	-	38	5466	c.5153T>G	c.(5152-5154)ATT>AGT	p.I1718S		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1718	Helical; (Potential).				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GAAGATGATAATGACCAGTGT	0.433													12	41	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115973865	115973865	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115973865A>C	uc004bgs.2	-	2	179	c.61T>G	c.(61-63)TTG>GTG	p.L21V	FKBP15_uc010muu.1_Missense_Mutation_p.L85V|FKBP15_uc011lxd.1_Intron|FKBP15_uc010mut.1_5'UTR|FKBP15_uc004bgt.2_Missense_Mutation_p.L21V	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	21					endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						AGTGAGGCCAATCTGGCACTG	0.423													3	7	---	---	---	---	PASS
WAC	51322	broad.mit.edu	37	10	28906668	28906668	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28906668C>A	uc001iuf.2	+	13	1914	c.1829C>A	c.(1828-1830)TCT>TAT	p.S610Y	WAC_uc001iud.2_Missense_Mutation_p.S565Y|WAC_uc001iue.2_Missense_Mutation_p.S300Y|WAC_uc001iug.2_Missense_Mutation_p.S507Y|WAC_uc001iuh.2_Missense_Mutation_p.S561Y	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil	610					cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						AATTTAAGATCTTTAGTCCGA	0.318													28	70	---	---	---	---	PASS
CPEB3	22849	broad.mit.edu	37	10	93841093	93841093	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93841093T>C	uc001khw.1	-	9	2026	c.1853A>G	c.(1852-1854)AAT>AGT	p.N618S	CPEB3_uc001khu.1_Missense_Mutation_p.N627S|CPEB3_uc001khv.1_Missense_Mutation_p.N604S|CPEB3_uc010qnn.1_Missense_Mutation_p.N604S	NM_014912	NP_055727	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding	618	RRM 2.						nucleotide binding|RNA binding				0		Colorectal(252;0.0869)				GTCAATGTCATTGTGCTGAAG	0.488													4	193	---	---	---	---	PASS
INPP5A	3632	broad.mit.edu	37	10	134523924	134523924	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134523924G>A	uc001llp.2	+	8	859	c.611G>A	c.(610-612)GGA>GAA	p.G204E	INPP5A_uc001llo.1_Missense_Mutation_p.G204E|INPP5A_uc001llq.2_Missense_Mutation_p.G156E	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A	204					cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GTGTACTCGGGAATCCGGCAC	0.333													6	50	---	---	---	---	PASS
MICALCL	84953	broad.mit.edu	37	11	12316358	12316358	+	Silent	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12316358T>C	uc001mkg.1	+	3	1671	c.1380T>C	c.(1378-1380)CCT>CCC	p.P460P		NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	460	Poly-Pro.				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		ctcctcctcctcctcctcctc	0.443													3	18	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71724868	71724868	+	Silent	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71724868G>A	uc001orl.1	-	15	3853	c.3681C>T	c.(3679-3681)ATC>ATT	p.I1227I	NUMA1_uc009ysw.1_Silent_p.I790I|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Silent_p.I1227I|NUMA1_uc001orn.2_Silent_p.I790I|NUMA1_uc009ysx.1_Silent_p.I1227I|NUMA1_uc001oro.1_Silent_p.I1227I	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1227	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CCAAGCTGCTGATGAGGCTAT	0.597			T	RARA	APL								5	147	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56650922	56650922	+	Intron	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56650922G>A	uc001skm.3	-						ANKRD52_uc001skn.1_RNA	NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						AGGTATGAAGGAAGCCAGTAA	0.502													5	13	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105538583	105538583	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105538583A>C	uc001tld.2	+	22	2354	c.2267A>C	c.(2266-2268)AAC>ACC	p.N756T	KIAA1033_uc010swr.1_Missense_Mutation_p.N757T|KIAA1033_uc010sws.1_Missense_Mutation_p.N568T	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	756					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						GAGATGAGAAACTTAGCTACT	0.388													71	217	---	---	---	---	PASS
CDC16	8881	broad.mit.edu	37	13	115007656	115007656	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115007656C>A	uc001vuk.1	+	6	640	c.442C>A	c.(442-444)CTG>ATG	p.L148M	CDC16_uc010tkm.1_Missense_Mutation_p.L148M|CDC16_uc001vul.1_Missense_Mutation_p.L148M|CDC16_uc001vum.1_Missense_Mutation_p.L54M|CDC16_uc001vun.1_Missense_Mutation_p.L147M|CDC16_uc001vuo.1_Missense_Mutation_p.L147M	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6	148	TPR 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			TAACCGAACCCTGGCTACCTA	0.398													33	217	---	---	---	---	PASS
P704P	641455	broad.mit.edu	37	14	20010458	20010458	+	Intron	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20010458T>C	uc001vwc.3	-						P704P_uc001vwb.3_Intron|uc001vwd.2_RNA	NM_001145442	NP_001138914	A6NI47	POTEM_HUMAN	prostate-specific P704P												0						CTCAGTGGGGTATTGCATAGC	0.348													2	1	---	---	---	---	PASS
GOLGA8A	23015	broad.mit.edu	37	15	34673466	34673466	+	3'UTR	SNP	T	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34673466T>A	uc001zii.2	-	16					GOLGA8A_uc001zih.2_3'UTR|uc001zil.2_5'Flank	NM_181077	NP_851422	A7E2F4	GOG8A_HUMAN	golgi autoantigen, golgin subfamily a, 8A							Golgi cisterna membrane					0		all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TTTTTACAAATAAACTTAAAC	0.318													2	3	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77406695	77406695	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77406695G>A	uc002bcm.2	-	6	5352	c.5044C>T	c.(5044-5046)CCT>TCT	p.P1682S		NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1682					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		ACTAGGCTAGGGCAGGCGGTG	0.552													16	109	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83935682	83935682	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83935682C>T	uc002bjt.1	-	3	429	c.341G>A	c.(340-342)CGG>CAG	p.R114Q	BNC1_uc010uos.1_Missense_Mutation_p.R102Q	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	114					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						ACTGAAGAGCCGGTCCAGTAG	0.502													24	133	---	---	---	---	PASS
MMP25	64386	broad.mit.edu	37	16	3100517	3100517	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3100517G>A	uc002cth.2	+	4	868	c.631G>A	c.(631-633)GAT>AAT	p.D211N	MMP25_uc002cti.1_Missense_Mutation_p.D147N	NM_022468	NP_071913	Q9NPA2	MMP25_HUMAN	matrix metalloproteinase 25 preproprotein	211					inflammatory response|proteolysis	anchored to membrane|cell surface|plasma membrane|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0						TCACTTTGACGATGAGGAGAC	0.532													30	73	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46633827	46633827	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46633827C>T	uc002eec.3	-	9	1301	c.1261G>A	c.(1261-1263)GAC>AAC	p.D421N		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	421										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				ACAAAAGTGTCGCCTTTGCCC	0.408													6	86	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46694354	46694354	+	3'UTR	SNP	T	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694354T>G	uc002eef.3	-	17					VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_3'UTR	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TGGATGTACATGGAAAGGAGT	0.453													13	92	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50733767	50733767	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50733767C>T	uc002egm.1	+	2	547	c.442C>T	c.(442-444)CAT>TAT	p.H148Y	NOD2_uc010cbj.1_Missense_Mutation_p.H121Y|NOD2_uc010cbk.1_Missense_Mutation_p.H121Y|NOD2_uc002egl.1_5'UTR	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	148	CARD 2.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				GCTCCACAGCCATGTGGAGAA	0.612													17	38	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72984616	72984616	+	Missense_Mutation	SNP	G	T	T	rs142600441	byFrequency	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72984616G>T	uc002fck.2	-	3	3641	c.2968C>A	c.(2968-2970)CGC>AGC	p.R990S	ZFHX3_uc002fcl.2_Missense_Mutation_p.R76S	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	990	C2H2-type 7; atypical.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GTGTTGTAGCGGCAGAGCTTG	0.602													3	81	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2596082	2596082	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2596082G>A	uc002fuy.1	-	20	3273	c.3187C>T	c.(3187-3189)CAG>TAG	p.Q1063*	KIAA0664_uc002fux.1_Nonsense_Mutation_p.Q996*|KIAA0664_uc010ckc.1_Nonsense_Mutation_p.Q49*	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	1063							binding			breast(2)	2						ACGTATTCCTGGATGGTGTTG	0.697													9	16	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61555382	61555382	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61555382G>A	uc002jau.1	+	2	362	c.340G>A	c.(340-342)GAC>AAC	p.D114N	ACE_uc010wph.1_Missense_Mutation_p.D114N|ACE_uc010wpi.1_Missense_Mutation_p.D114N|ACE_uc010ddu.1_5'UTR	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	114	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GAACTTCACGGACCCGCAGCT	0.647													7	20	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72346181	72346181	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72346181A>C	uc002llw.2	+	1	3263	c.3206A>C	c.(3205-3207)AAG>ACG	p.K1069T	ZNF407_uc010xfc.1_Missense_Mutation_p.K1069T|ZNF407_uc010dqu.1_Missense_Mutation_p.K1069T|ZNF407_uc002llu.2_Missense_Mutation_p.K1068T	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1069	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCAACAGAGAAGCACAAAATG	0.428													48	89	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8174199	8174199	+	Silent	SNP	G	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8174199G>T	uc002mjf.2	-	35	4551	c.4530C>A	c.(4528-4530)ATC>ATA	p.I1510I		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1510	TB 6.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CACCAACTCCGATCTCGGCAC	0.612													3	107	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8606866	8606866	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8606866C>T	uc002mkg.2	-	15	1648	c.1534G>A	c.(1534-1536)GAC>AAC	p.D512N		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	512	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						CCGCTGACGTCGTAGGAGACC	0.612													9	42	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11143976	11143976	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11143976C>G	uc002mqf.3	+	26	3841	c.3557C>G	c.(3556-3558)GCG>GGG	p.A1186G	SMARCA4_uc010dxp.2_Missense_Mutation_p.A1186G|SMARCA4_uc010dxo.2_Missense_Mutation_p.A1186G|SMARCA4_uc010dxq.2_Missense_Mutation_p.A1186G|SMARCA4_uc010dxr.2_Missense_Mutation_p.A1186G|SMARCA4_uc002mqj.3_Missense_Mutation_p.A1186G|SMARCA4_uc010dxs.2_Missense_Mutation_p.A1186G|SMARCA4_uc010dxt.1_Missense_Mutation_p.A406G|SMARCA4_uc002mqh.3_Missense_Mutation_p.A309G|SMARCA4_uc002mqi.1_Missense_Mutation_p.A389G	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	1186	Helicase C-terminal.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.A1186V(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GACCTGCAAGCGCAGGACCGA	0.622			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				25	52	---	---	---	---	PASS
KCNN1	3780	broad.mit.edu	37	19	18104303	18104303	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18104303C>T	uc002nht.2	+	10	1622	c.1312C>T	c.(1312-1314)CGG>TGG	p.R438W		NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance	438	Calmodulin-binding (By similarity).				synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						CCACAGGCTCCGGAGTGTGAA	0.647													4	29	---	---	---	---	PASS
C19orf55	148137	broad.mit.edu	37	19	36258775	36258775	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36258775C>A	uc002obq.1	+	9	1101	c.1028C>A	c.(1027-1029)CCT>CAT	p.P343H		NM_001039887	NP_001034976	Q2NL68	CS055_HUMAN	hypothetical protein LOC148137	343										ovary(1)	1	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAGCCACTCCTTCCCCTGGA	0.657													7	9	---	---	---	---	PASS
PNKP	11284	broad.mit.edu	37	19	50364761	50364761	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50364761C>G	uc002pqh.2	-	15	1445	c.1393G>C	c.(1393-1395)GAG>CAG	p.E465Q	PNKP_uc002pqg.2_Missense_Mutation_p.E246Q|PNKP_uc002pqi.2_Missense_Mutation_p.E426Q|PNKP_uc002pqj.2_Missense_Mutation_p.E465Q|PNKP_uc010enm.2_Missense_Mutation_p.E434Q|PNKP_uc002pqk.2_Missense_Mutation_p.R428T	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase	465					DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TCCGTCATCTCTCGAAACTGT	0.657								Other_BER_factors					10	49	---	---	---	---	PASS
ZNF473	25888	broad.mit.edu	37	19	50550275	50550275	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50550275C>G	uc002prn.2	+	5	2812	c.2575C>G	c.(2575-2577)CGC>GGC	p.R859G	ZNF473_uc002prm.2_Missense_Mutation_p.R859G|ZNF473_uc010ybo.1_Missense_Mutation_p.R847G	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473	859	C2H2-type 20.				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		GAGCCTCAGCCGCCATCAGCG	0.532											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	24	---	---	---	---	PASS
MIR515-1	574462	broad.mit.edu	37	19	54182305	54182305	+	RNA	SNP	C	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54182305C>T	hsa-mir-515-1|MI0003144	+			c.49C>T			uc010ydz.1_RNA|MIR519E_hsa-mir-519e|MI0003145_5'Flank																	0						TGTCTGAAAGCAGAGTGCCTT	0.403													12	71	---	---	---	---	PASS
RPRD1B	58490	broad.mit.edu	37	20	36686032	36686032	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36686032G>T	uc002xho.3	+	4	916	c.514G>T	c.(514-516)GCA>TCA	p.A172S		NM_021215	NP_067038	Q9NQG5	RPR1B_HUMAN	Regulation of nuclear pre-mRNA domain containing	172										pancreas(1)	1						GGATCCTTCTGCAGGACCCCT	0.512											OREG0025919	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	68	---	---	---	---	PASS
SPINLW1	57119	broad.mit.edu	37	20	44174554	44174554	+	Intron	SNP	C	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44174554C>A	uc002xou.2	-						SPINLW1_uc010zxc.1_Intron|SPINLW1_uc002xot.2_5'UTR|SPINLW1_uc002xov.1_Intron	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				AGGGCAGCCTCACTCATTTCC	0.522													6	12	---	---	---	---	PASS
SLC13A3	64849	broad.mit.edu	37	20	45239178	45239178	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45239178T>C	uc002xsf.1	-	3	486	c.448A>G	c.(448-450)ATG>GTG	p.M150V	SLC13A3_uc010ghn.1_Missense_Mutation_p.M119V|SLC13A3_uc010zxw.1_Missense_Mutation_p.M150V|SLC13A3_uc002xsg.1_Missense_Mutation_p.M103V|SLC13A3_uc010gho.1_Missense_Mutation_p.M103V|SLC13A3_uc010zxx.1_Missense_Mutation_p.M52V|SLC13A3_uc002xsi.3_Missense_Mutation_p.M103V	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	150	Helical; (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GGAAGCATCATGGCAGTGGAG	0.547													41	257	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11014987	11014987	+	RNA	SNP	A	G	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11014987A>G	uc002yis.1	-	7		c.1459T>C						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTATAGTTTCAATAGCAGACT	0.388													3	50	---	---	---	---	PASS
FBLN1	2192	broad.mit.edu	37	22	45960802	45960802	+	Intron	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45960802G>A	uc003bgj.1	+						FBLN1_uc003bgi.1_Missense_Mutation_p.G579E	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ACCCCAGCGGGATCAAGTAAA	0.532													13	54	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50728922	50728922	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50728922T>C	uc003bkv.3	-	3	198	c.92A>G	c.(91-93)GAG>GGG	p.E31G		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	31	Extracellular (Potential).|Sema.				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CAGCTCTTTCTCGCTGCGGAA	0.667													3	38	---	---	---	---	PASS
PAGE4	9506	broad.mit.edu	37	X	49598473	49598473	+	3'UTR	SNP	A	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49598473A>C	uc004don.1	+	5						NM_007003	NP_008934	O60829	GAGC1_HUMAN	G antigen, family C, 1												0	Ovarian(276;0.236)					TAAGTTAAAAAGAAGACAAGC	0.284													14	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14918	14918	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14918G>A	uc004coy.2	+	1	158	c.83G>A	c.(82-84)AGA>AAA	p.R28K	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		ACTACTCACCAGACGCCTCAA	0.507													3	4	---	---	---	---	PASS
SSU72	29101	broad.mit.edu	37	1	1510036	1510037	+	5'UTR	DEL	GC	-	-	rs70949599		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1510036_1510037delGC	uc001agd.2	-	1					SSU72_uc009vkg.1_5'UTR|SSU72_uc001age.1_5'UTR	NM_014188	NP_054907	Q9NP77	SSU72_HUMAN	Ssu72 RNA polymerase II CTD phosphatase homolog						mRNA processing	cytoplasm|nucleus	phosphoprotein phosphatase activity				0	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CCGGAAGCGGGCGACGCGAAAC	0.772													2	4	---	---	---	---	
SPEN	23013	broad.mit.edu	37	1	16265061	16265062	+	Intron	DEL	TT	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16265061_16265062delTT	uc001axk.1	+						SPEN_uc010obp.1_Intron	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAAAAAAAGCTTTTTTTTTTTT	0.361													6	3	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113666345	113666346	+	Intron	INS	-	TTTTTT	TTTTTT	rs139220276	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666345_113666346insTTTTTT	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCTGGTGGTGGTTTTtgtgtgt	0.287													4	3	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247063196	247063197	+	Intron	DEL	AT	-	-	rs148637144		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247063196_247063197delAT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron|AHCTF1_uc009xgs.1_5'Flank	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTTATAAAACATATAAATACTA	0.233													3	5	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247076400	247076400	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076400delT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTAAAATACCTTTTTTTTTTT	0.299													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6953876	6953879	+	IGR	DEL	GAGG	-	-	rs112872966		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6953876_6953879delGAGG								LOC400940 (825512 upstream) : CMPK2 (26624 downstream)																							gggagggagagagggagggaggaa	0.005													4	2	---	---	---	---	
C2orf61	285051	broad.mit.edu	37	2	47307648	47307648	+	Intron	DEL	T	-	-	rs11297773		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47307648delT	uc010fbd.2	-									Q8N801	CB061_HUMAN	Homo sapiens cDNA FLJ40172 fis, clone TESTI2016896.												0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ttctttcttcttttttttttt	0.035													4	3	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107021832	107021832	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021832delT	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						GGGGGGGttcttttttttttt	0.164													4	2	---	---	---	---	
ITGB6	3694	broad.mit.edu	37	2	161025664	161025668	+	Intron	DEL	GTTAA	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161025664_161025668delGTTAA	uc002ubh.2	-						ITGB6_uc010fow.1_Intron|ITGB6_uc010fou.2_Intron|ITGB6_uc010zcq.1_Intron|ITGB6_uc010fov.1_Intron	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						CAGAGTTAATGTTAAAGTTTCATGT	0.371													47	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	165708206	165708207	+	IGR	DEL	AC	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165708206_165708207delAC								COBLL1 (9528 upstream) : SLC38A11 (46605 downstream)																							taatccatttacacacacacac	0.000													3	3	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216287904	216287905	+	Intron	DEL	CA	-	-	rs146148439		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216287904_216287905delCA	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vfl.2_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GATGTAACATcacacacacaca	0.193													4	3	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53883546	53883547	+	Intron	INS	-	A	A	rs149695132	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53883546_53883547insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		ctacaaaaaacatttttttaat	0.208													4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	131017533	131017535	+	Intron	DEL	GGT	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131017533_131017535delGGT	uc003eny.2	+						NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						aatatgcctaggtggtggtggtg	0.000													4	2	---	---	---	---	
SLC34A2	10568	broad.mit.edu	37	4	25664605	25664605	+	Intron	DEL	T	-	-	rs34583336		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25664605delT	uc003grr.2	+						SLC34A2_uc003grs.2_Intron|SLC34A2_uc010iev.2_Intron	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),						cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				CCCTCTCATCttttttttttt	0.269													4	2	---	---	---	---	
AMBN	258	broad.mit.edu	37	4	71465156	71465157	+	Intron	INS	-	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71465156_71465157insA	uc003hfl.2	+							NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor						bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			gattccatctcaaaaaaaaaaa	0.079													9	4	---	---	---	---	
MRPL1	65008	broad.mit.edu	37	4	78815095	78815096	+	Intron	INS	-	G	G	rs144675206	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78815095_78815096insG	uc003hku.2	+						MRPL1_uc010iji.1_Intron	NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor								RNA binding				0						AGGATGTGGCTGTTTTTAAAGG	0.322													3	3	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166198916	166198917	+	Intron	INS	-	AC	AC			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166198916_166198917insAC	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		cacacacacacacacacacaca	0.361													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4824043	4824044	+	IGR	DEL	TG	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4824043_4824044delTG								None (None upstream) : LOC340094 (210428 downstream)																							catatctttttgtgtgtgtgtg	0.000													4	4	---	---	---	---	
TARS	6897	broad.mit.edu	37	5	33460134	33460134	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33460134delT	uc003jhy.2	+						TARS_uc011cob.1_Intron|TARS_uc010iup.1_Intron|TARS_uc011coc.1_Intron|TARS_uc003jhz.2_Intron|TARS_uc011cod.1_Intron	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase						threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	AGATCCCCACttttttttttt	0.159													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133390150	133390150	+	IGR	DEL	T	-	-	rs71887042		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133390150delT								VDAC1 (49326 upstream) : TCF7 (60252 downstream)																							ccttccttCCttttttttttt	0.129													5	3	---	---	---	---	
HIST1H2BE	8344	broad.mit.edu	37	6	26183914	26183915	+	5'Flank	INS	-	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26183914_26183915insA	uc003ngt.2	+							NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be						defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						AAATAACGAATCAGAGTTGGAG	0.411													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747257	134747257	+	IGR	DEL	T	-	-	rs11297460		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747257delT								SGK1 (108061 upstream) : ALDH8A1 (491272 downstream)																							ccttccttccttccttccttc	0.035													4	7	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157360877	157360878	+	Intron	INS	-	CCTT	CCTT	rs149720012	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157360877_157360878insCCTT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ctccctccctcccttccttcct	0.000													4	3	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8196560	8196578	+	Intron	DEL	AAAAAAAAAAAAAAAAAAA	-	-	rs71014766		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8196560_8196578delAAAAAAAAAAAAAAAAAAA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		CTGATGCAGTaaaaaaaaaaaaaaaaaaaaaaaaagaaa	0.347													3	4	---	---	---	---	
GPC2	221914	broad.mit.edu	37	7	99771214	99771217	+	Intron	DEL	TTTC	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99771214_99771217delTTTC	uc003utv.2	-						GPC2_uc010lgr.2_Intron|GPC2_uc003utw.1_3'UTR	NM_152742	NP_689955	Q8N158	GPC2_HUMAN	glypican 2 precursor							anchored to membrane|endoplasmic reticulum|extracellular space|plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)|pancreas(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					Atttctttcttttctttctttctt	0.005													5	3	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230357	100230357	+	Intron	DEL	G	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230357delG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaagaacctttttt	0.000													4	2	---	---	---	---	
FBXO32	114907	broad.mit.edu	37	8	124553112	124553112	+	Intron	DEL	C	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124553112delC	uc003yqr.2	-						FBXO32_uc010mdk.2_Intron	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1											skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TTCGCGGGGGCTGGAAGTTGG	0.682													15	7	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8388983	8388984	+	Intron	DEL	TT	-	-	rs148617282		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8388983_8388984delTT	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGAATATTCCtttttttttttt	0.312										TSP Lung(15;0.13)			4	2	---	---	---	---	
SLC35D2	11046	broad.mit.edu	37	9	99130723	99130723	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99130723delT	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Intron	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN	solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)				catttaattcttttttttttt	0.090													5	4	---	---	---	---	
OLFML2A	169611	broad.mit.edu	37	9	127549029	127549038	+	Intron	DEL	ACACACACAC	-	-	rs149733353		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127549029_127549038delACACACACAC	uc004bov.2	+						OLFML2A_uc010mwr.1_Intron	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor												0						AGAGACGTAGacacacacacacacacacac	0.171													4	2	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	tctttctttgttttttttttt	0.090													4	3	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140610840	140610842	+	Intron	DEL	TGT	-	-	rs142045955	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140610840_140610842delTGT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		gaggaagttgtgttggtgtcatg	0.000													6	3	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													3	3	---	---	---	---	
KIF20B	9585	broad.mit.edu	37	10	91488693	91488706	+	Intron	DEL	TGTGTGTGTGTGTA	-	-	rs71022581		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91488693_91488706delTGTGTGTGTGTGTA	uc001kgs.1	+						KIF20B_uc001kgr.1_Intron|KIF20B_uc001kgt.1_Intron	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1						cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						tgtgtgtgtgtgtgtgtgtgtgtatgtAATTTTT	0.140													3	4	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19639897	19639900	+	Intron	DEL	TTGC	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19639897_19639900delTTGC	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						gcttgatggattgctggatggatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	21747091	21747096	+	IGR	DEL	TGTGTT	-	-	rs141589228	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21747091_21747096delTGTGTT								NELL1 (149864 upstream) : ANO5 (467626 downstream)																							tgtgtgtgtgtgtgtttgtgtgtttg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	28870030	28870030	+	IGR	DEL	C	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28870030delC								METT5D1 (514976 upstream) : None (None downstream)																							ttccttccttccttccttcct	0.070													4	2	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199650	120199655	+	Intron	DEL	TGTGTT	-	-	rs72412112		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199650_120199655delTGTGTT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		tgtgtgtgtgtgtgtttgtgtatgtT	0.049													6	3	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126391451	126391451	+	Intron	DEL	C	-	-	rs35886498		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126391451delC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CAAGCAGGGGCCATTCTACAA	0.572													4	2	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1805564	1805565	+	Intron	INS	-	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1805564_1805565insT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			ttttttccttcttttttttttt	0.203													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16966790	16966790	+	IGR	DEL	C	-	-	rs56049732		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16966790delC								LMO3 (204032 upstream) : None (None downstream)																							ttccttccttcctttctctct	0.000													3	4	---	---	---	---	
TROAP	10024	broad.mit.edu	37	12	49719150	49719150	+	Intron	DEL	A	-	-	rs111795391		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49719150delA	uc001rtx.3	+						TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						tctatttcttaaaaaaaaaaa	0.199													6	3	---	---	---	---	
DPY19L2	283417	broad.mit.edu	37	12	63964389	63964390	+	Intron	INS	-	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63964389_63964390insT	uc001srp.1	-						DPY19L2_uc010sso.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GGTTATTGTCATTTTTTTTTAA	0.287													4	3	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	121011389	121011389	+	Intron	DEL	A	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121011389delA	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gtcatttatcaaaaaaaaaaa	0.025													5	3	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25448553	25448553	+	Intron	DEL	T	-	-	rs67456137		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25448553delT	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ccattgtagcttttttttttt	0.075													6	3	---	---	---	---	
ATP8A2	51761	broad.mit.edu	37	13	26154264	26154265	+	Intron	DEL	TC	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26154264_26154265delTC	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCATGGTCTTTCTGAAAGCTCT	0.366													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45168862	45168862	+	IGR	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45168862delT								TSC22D1 (18161 upstream) : NUFIP1 (344522 downstream)																							TTGTATTACCTTTTTTTTTTT	0.348													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19408019	19408019	+	IGR	DEL	A	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19408019delA								OR11H12 (29447 upstream) : POTEG (145346 downstream)																							CTGTGGAGCCAAAAAAAAAAT	0.393													6	5	---	---	---	---	
POTEG	404785	broad.mit.edu	37	14	19563209	19563210	+	Intron	INS	-	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19563209_19563210insT	uc001vuz.1	+						POTEG_uc001vva.1_Intron|POTEG_uc010ahc.1_Intron|uc001vvb.2_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											ovary(1)	1						AGATAAGAGGGTTTTTTTTTTG	0.347													4	2	---	---	---	---	
NF1P1	440225	broad.mit.edu	37	15	22146377	22146378	+	5'Flank	DEL	GT	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22146377_22146378delGT	uc010tzs.1	-											Human NF1-related locus DNA in A9 mouse DNA background.												0						tTGAgtgtgggtgtgtgtgtgt	0.233													3	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63928472	63928473	+	Intron	INS	-	T	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63928472_63928473insT	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AATTTCATTAGttttttttttt	0.173													4	2	---	---	---	---	
NOX5	79400	broad.mit.edu	37	15	69334835	69334844	+	Intron	DEL	CTCTCCAAGT	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69334835_69334844delCTCTCCAAGT	uc002ars.1	+						NOX5_uc002arp.1_Intron|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002arr.1_Intron|NOX5_uc010bie.1_Intron|NOX5_uc010bif.1_Intron	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5						angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						CAGAGATCAGCTCTCCAAGTCCTGTGGCTA	0.524													3	4	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18897123	18897123	+	Intron	DEL	A	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18897123delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						AGTTTTAGTTAAAAAAAAAAA	0.149													6	4	---	---	---	---	
CIAPIN1	57019	broad.mit.edu	37	16	57464912	57464912	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57464912delT	uc002ell.1	-						CIAPIN1_uc002elk.1_Intron|CIAPIN1_uc002elm.1_Intron|CIAPIN1_uc002eln.1_Intron|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Intron	NM_020313	NP_064709	Q6FI81	CPIN1_HUMAN	cytokine induced apoptosis inhibitor 1						anti-apoptosis|apoptosis	cytoplasm|nucleolus					0						gcctggctaattttttttttt	0.085													4	7	---	---	---	---	
KIFC3	3801	broad.mit.edu	37	16	57884886	57884887	+	Intron	INS	-	T	T	rs142877655		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57884886_57884887insT	uc002emr.1	-							NM_001130099	NP_001123571	Q9BVG8	KIFC3_HUMAN	kinesin family member C3 isoform 3						epithelial cell-cell adhesion|microtubule-based movement|visual perception|zonula adherens maintenance	centrosome|cytoplasmic vesicle membrane|kinesin complex|microtubule|zonula adherens	ATP binding|microtubule motor activity			central_nervous_system(2)|ovary(1)	3		all_neural(199;0.224)				tccttccttccttccttccttc	0.005													6	3	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													4	3	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701506	85701507	+	Intron	INS	-	GTCCA	GTCCA	rs148610400	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701506_85701507insGTCCA	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CAACAAAAATGGTCCACGTACC	0.436													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597919	11597922	+	Intron	DEL	CTTT	-	-	rs12946299		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597919_11597922delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TACCTCGGAGctttcttgctttct	0.270													6	3	---	---	---	---	
GSDMA	284110	broad.mit.edu	37	17	38121499	38121500	+	Intron	INS	-	AGGG	AGGG			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38121499_38121500insAGGG	uc002htl.1	+						GSDMA_uc002htm.1_5'Flank	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1						apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0						ggaaggaagaaagggagggagg	0.054													5	4	---	---	---	---	
MYST2	11143	broad.mit.edu	37	17	47876152	47876152	+	Intron	DEL	C	-	-	rs79375515		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47876152delC	uc002ipm.2	+						MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Intron|MYST2_uc010wme.1_Intron	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TTCAGTTTATCCTAGAGCTTT	0.373													5	8	---	---	---	---	
CSH2	1443	broad.mit.edu	37	17	61952924	61952925	+	5'Flank	INS	-	TT	TT			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61952924_61952925insTT	uc002jch.2	-						CSH2_uc002jcg.2_5'Flank|CSH2_uc002jci.2_5'Flank|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						ttctttctttctttctttcttt	0.000													4	2	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13445622	13445623	+	Intron	DEL	GT	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13445622_13445623delGT	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		gtgtgtgtgcgtgtgtgtgtga	0.050													4	2	---	---	---	---	
KIAA1543	57662	broad.mit.edu	37	19	7675204	7675204	+	Intron	DEL	A	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7675204delA	uc002mgv.3	+						KIAA1543_uc002mgu.3_Intron	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2						epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						actccatctcaaaaaaaaaaa	0.254													4	2	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9080282	9080283	+	Intron	DEL	AG	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9080282_9080283delAG	uc002mkp.2	-							NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						aaagaaagaaagagaaagaaag	0.015													4	4	---	---	---	---	
ANO8	57719	broad.mit.edu	37	19	17438221	17438222	+	Intron	INS	-	C	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17438221_17438222insC	uc002ngf.2	-						ANO8_uc010eap.2_Intron	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8							chloride channel complex	chloride channel activity			ovary(3)	3						CCTCCCAGCTGCCCCCGCCCCT	0.708													4	2	---	---	---	---	
ZNF880	400713	broad.mit.edu	37	19	52877717	52877717	+	Intron	DEL	T	-	-	rs77187934		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52877717delT	uc002pzc.2	+						ZNF880_uc002pzb.3_Intron	NM_001145434	NP_001138906	Q6PDB4	ZN880_HUMAN	zinc finger protein LOC400713						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						GGCCCCATAAttttttttttt	0.254													8	5	---	---	---	---	
WFDC8	90199	broad.mit.edu	37	20	44190379	44190380	+	Intron	DEL	GT	-	-	rs113635448		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44190379_44190380delGT	uc002xow.2	-						WFDC8_uc002xox.2_Intron	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				TTAAACTtgcgtgtgtgtgtgt	0.149													6	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074779	62074779	+	Intron	DEL	A	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074779delA	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	caccaccatcatcaccatcac	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11042388	11042389	+	Intron	INS	-	A	A	rs59739297		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11042388_11042389insA	uc002yit.1	-						TPTE_uc002yis.1_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		cacacacacaccccaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44245010	44245011	+	IGR	INS	-	AGTT	AGTT	rs74946251	by1000genomes	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44245010_44245011insAGTT								PDE9A (49394 upstream) : WDR4 (18195 downstream)																							ggaaggaaggaagttcaattaa	0.000													5	8	---	---	---	---	
TAB1	10454	broad.mit.edu	37	22	39815791	39815792	+	Intron	INS	-	A	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39815791_39815792insA	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_Intron|TAB1_uc003axu.1_Intron	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						gaccctgtctcaaaaaaaaaaa	0.248													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	448609	448612	+	IGR	DEL	AAGA	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:448609_448612delAAGA								PPP2R3B (100982 upstream) : SHOX (136467 downstream)																							aaggaaaaagaagaaagaaagaaa	0.025													9	5	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1543842	1543845	+	Intron	DEL	TCCA	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1543842_1543845delTCCA	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				aatccatctgtccatccatccatc	0.000													2	4	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774786	2774793	+	Intron	DEL	TATCTATG	-	-	rs80318590		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774786_2774793delTATCTATG	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atcatctatctatctatgtatctatcta	0.231													11	5	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118768991	118768991	+	Intron	DEL	G	-	-	rs67000312		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118768991delG	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						aaaaaaaaaagaaagaaaaGA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13524407	13524407	+	IGR	DEL	T	-	-			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13524407delT								None (None upstream) : None (None downstream)																							TGGAATGAGCTTTCTATGGAG	0.313													6	4	---	---	---	---	
