Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DPH2	1802	broad.mit.edu	37	1	44436377	44436377	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44436377G>A	uc001ckz.2	+	2	452	c.257G>A	c.(256-258)GGC>GAC	p.G86D	DPH2_uc001cla.2_Missense_Mutation_p.G86D|DPH2_uc010okk.1_Missense_Mutation_p.A26T|DPH2_uc001clb.2_Missense_Mutation_p.G10D	NM_001384	NP_001375	Q9BQC3	DPH2_HUMAN	diphthamide biosynthesis protein 2 isoform a	86					peptidyl-diphthamide biosynthetic process from peptidyl-histidine	cytoplasm				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ACAGCCTACGGCAGGTGTGAA	0.562													21	204	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202743819	202743819	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202743819C>G	uc001gyf.2	-	3	443	c.327G>C	c.(325-327)AAG>AAC	p.K109N	KDM5B_uc009xag.2_Missense_Mutation_p.K109N|KDM5B_uc001gyg.1_5'UTR	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	109	ARID.				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						ACTCCCAGTACTTTGCAATCT	0.358													37	70	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20511383	20511383	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20511383A>T	uc002rds.1	-	4	413	c.390T>A	c.(388-390)GAT>GAA	p.D130E	PUM2_uc002rdt.1_Missense_Mutation_p.D130E|PUM2_uc002rdr.2_Missense_Mutation_p.D69E|PUM2_uc010yjy.1_Missense_Mutation_p.D130E|PUM2_uc002rdu.1_Missense_Mutation_p.D130E|PUM2_uc010yjz.1_Missense_Mutation_p.D69E	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	130	Interaction with SNAPIN.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCTTTTTGATCTCCTTTCT	0.383													24	104	---	---	---	---	PASS
CGREF1	10669	broad.mit.edu	37	2	27324236	27324236	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27324236T>G	uc010eys.1	-	7	954	c.812A>C	c.(811-813)GAG>GCG	p.E271A	CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_Intron|CGREF1_uc002riq.2_Missense_Mutation_p.E288A|CGREF1_uc010eyr.1_Missense_Mutation_p.E393A|CGREF1_uc002rir.1_Missense_Mutation_p.E271A|CGREF1_uc002ris.2_Silent_p.R272R	NM_006569	NP_006560	Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	271					cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCTTGGCCTCCTCTCCATT	0.577													37	542	---	---	---	---	PASS
PREPL	9581	broad.mit.edu	37	2	44556213	44556213	+	Silent	SNP	A	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44556213A>C	uc002ruf.2	-	9	1427	c.1392T>G	c.(1390-1392)ACT>ACG	p.T464T	PREPL_uc002rug.2_Silent_p.T398T|PREPL_uc002ruh.2_Silent_p.T402T|PREPL_uc010fax.2_Silent_p.T464T|PREPL_uc002rui.3_Silent_p.T375T|PREPL_uc002ruj.1_Silent_p.T375T|PREPL_uc002ruk.1_Silent_p.T464T	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C	464					proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTCAGAGTCAGTTTTGTGGA	0.378													52	136	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90229252	90229252	+	Intron	SNP	C	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90229252C>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GATTTGACATCCAGATGATCC	0.443													16	186	---	---	---	---	PASS
ITPRIPL1	150771	broad.mit.edu	37	2	96992895	96992895	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96992895G>T	uc002svx.2	+	3	861	c.526G>T	c.(526-528)GTC>TTC	p.V176F	ITPRIPL1_uc010yuk.1_Missense_Mutation_p.V168F|ITPRIPL1_uc002svy.2_Missense_Mutation_p.V184F|ITPRIPL1_uc010yul.1_Missense_Mutation_p.V168F	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	176	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						CAAACACTATGTCCAAAATGC	0.552													57	185	---	---	---	---	PASS
ALPP	250	broad.mit.edu	37	2	233246013	233246013	+	Silent	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233246013C>T	uc002vsq.2	+	10	1410	c.1245C>T	c.(1243-1245)TAC>TAT	p.Y415Y	ALPP_uc002vsr.2_RNA	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	415						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCCTCCTATACGGAAACGGTC	0.632													13	75	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121207746	121207746	+	Silent	SNP	T	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121207746T>A	uc003eee.3	-	16	4161	c.4032A>T	c.(4030-4032)GCA>GCT	p.A1344A	POLQ_uc003eed.2_Silent_p.A516A	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1344					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TGGTGTCCTTTGCTCCTAGTT	0.413								DNA_polymerases_(catalytic_subunits)					98	200	---	---	---	---	PASS
DNAJB8	165721	broad.mit.edu	37	3	128181497	128181497	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128181497G>A	uc003ekk.1	-	3	2253	c.592C>T	c.(592-594)CGC>TGC	p.R198C	uc003ekl.1_5'Flank	NM_153330	NP_699161	Q8NHS0	DNJB8_HUMAN	DnaJ homolog, subfamily B, member 8	198					protein folding		heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(114;0.177)		TCCACGATGCGCTTGGTGGTG	0.602													47	110	---	---	---	---	PASS
LIAS	11019	broad.mit.edu	37	4	39472863	39472863	+	Silent	SNP	T	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39472863T>C	uc003guf.2	+	9	964	c.891T>C	c.(889-891)CGT>CGC	p.R297R	LIAS_uc003gug.2_Silent_p.R297R|LIAS_uc003guh.2_Silent_p.R254R	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor	297					inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	CAGCACTTCGTGAGGCAGATG	0.333													17	102	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114267059	114267059	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114267059C>T	uc003ibe.3	+	35	4352	c.4252C>T	c.(4252-4254)CGC>TGC	p.R1418C	ANK2_uc003ibd.3_Missense_Mutation_p.R1409C|ANK2_uc003ibf.3_Missense_Mutation_p.R1418C|ANK2_uc011cgc.1_Missense_Mutation_p.R594C|ANK2_uc003ibg.3_Missense_Mutation_p.R413C|ANK2_uc003ibh.3_Missense_Mutation_p.R92C|ANK2_uc011cgb.1_Missense_Mutation_p.R1433C	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1385					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTCAAGGTACGCGATACGAC	0.398													13	99	---	---	---	---	PASS
LOC100133050	100133050	broad.mit.edu	37	5	99715528	99715528	+	RNA	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99715528C>T	uc011cuw.1	-	4		c.382G>A				NR_027503				Homo sapiens glucuronidase, beta pseudogene (LOC100133050), non-coding RNA.												0						AGCGGACAGTCGAAGCCCTTC	0.607													7	22	---	---	---	---	PASS
SLC36A1	206358	broad.mit.edu	37	5	150867782	150867782	+	Silent	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150867782C>T	uc003luc.2	+	11	1615	c.1398C>T	c.(1396-1398)CCC>CCT	p.P466P	GM2A_uc011dcs.1_Intron	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 member 1	466	Extracellular (Potential).				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)	GCAATGCTCCCATCTTCATCA	0.557													37	99	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150948075	150948075	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150948075C>A	uc003lue.3	-	1	431	c.418G>T	c.(418-420)GAC>TAC	p.D140Y	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.D140Y	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	140	Extracellular (Potential).|Cadherin 1.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATTCTGGTCCAGGATGTGG	0.547													30	310	---	---	---	---	PASS
VPS52	6293	broad.mit.edu	37	6	33231657	33231657	+	Splice_Site	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33231657C>T	uc003odm.1	-	16	1831	c.1621_splice	c.e16-1	p.V541_splice	VPS52_uc003odn.1_Splice_Site_p.V352_splice	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52						protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						CCACCTCCACCTGAAAAGGCA	0.542													20	60	---	---	---	---	PASS
APOBEC2	10930	broad.mit.edu	37	6	41021140	41021140	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41021140G>A	uc003opl.2	+	1	201	c.54G>A	c.(52-54)GGG>GGA	p.G18G	UNC5CL_uc010jxe.1_Intron|APOBEC2_uc010jxf.2_RNA	NM_006789	NP_006780	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	18					DNA demethylation|mRNA processing		cytidine deaminase activity|RNA binding|zinc ion binding				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCAGAATGGGGAGGATCTGG	0.597													23	66	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46849806	46849806	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46849806G>A	uc003oyo.3	-	7	940	c.651C>T	c.(649-651)GGC>GGT	p.G217G	GPR116_uc003oyp.3_Silent_p.G217G|GPR116_uc003oyq.3_Silent_p.G217G|GPR116_uc010jzi.1_5'Flank|GPR116_uc003oyr.2_Silent_p.G217G	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	217	SEA.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			TCACAGTCACGCCCTTGAAGC	0.388													51	249	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152599304	152599304	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152599304G>A	uc010kiw.2	-	98	19095	c.18493C>T	c.(18493-18495)CTG>TTG	p.L6165L	SYNE1_uc010kiv.2_Silent_p.L689L|SYNE1_uc003qos.3_Silent_p.L689L|SYNE1_uc003qot.3_Silent_p.L6094L|SYNE1_uc003qou.3_Silent_p.L6165L|SYNE1_uc010kiy.1_Silent_p.L344L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6165	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTCCAGCCAGCTGCTCGGCC	0.572										HNSCC(10;0.0054)			15	225	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8178473	8178473	+	Missense_Mutation	SNP	C	G	G	rs143861719	byFrequency	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8178473C>G	uc003srm.2	-	12	1124	c.1057G>C	c.(1057-1059)GGT>CGT	p.G353R	ICA1_uc010ktr.2_Missense_Mutation_p.G382R|ICA1_uc003srl.2_Missense_Mutation_p.G341R|ICA1_uc003srn.3_Missense_Mutation_p.G279R|ICA1_uc003srp.3_Missense_Mutation_p.G352R|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Missense_Mutation_p.G353R|ICA1_uc003srr.2_Missense_Mutation_p.G352R|ICA1_uc003sro.3_Missense_Mutation_p.G353R	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	353					neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		ATCTTACCACCTTCCTCAGAT	0.289													19	187	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20768032	20768032	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20768032G>A	uc003suw.3	+	14	2032	c.1486G>A	c.(1486-1488)GCC>ACC	p.A496T	ABCB5_uc010kuh.2_Missense_Mutation_p.A941T|ABCB5_uc003sux.1_Missense_Mutation_p.A119T	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	496	Extracellular (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						TCGATTTGGAGCCTATTTAAT	0.348													60	108	---	---	---	---	PASS
KBTBD2	25948	broad.mit.edu	37	7	32909021	32909021	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909021A>G	uc003tdb.2	-	4	2467	c.1808T>C	c.(1807-1809)TTT>TCT	p.F603S	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	603											0			GBM - Glioblastoma multiforme(11;0.0499)			ATCCGTTGAAAAAAGATAAGT	0.483													57	102	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104752966	104752966	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104752966A>G	uc003vcm.2	+	27	5297	c.4763A>G	c.(4762-4764)CAA>CGA	p.Q1588R	MLL5_uc010ljc.2_Missense_Mutation_p.Q1588R|MLL5_uc010ljf.1_Intron|MLL5_uc010ljg.2_Missense_Mutation_p.Q322R	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	1588	Pro-rich.				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						GGACCAAATCAAGCACTTCCT	0.448													71	122	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150693640	150693640	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150693640G>T	uc003wif.2	+	4	715	c.419G>T	c.(418-420)AGG>ATG	p.R140M	NOS3_uc011kuy.1_Intron|NOS3_uc011kuz.1_Missense_Mutation_p.R140M|NOS3_uc011kva.1_Missense_Mutation_p.R140M|NOS3_uc011kvb.1_Missense_Mutation_p.R140M	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	140	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	TCCATTAAGAGGTGACAGCTT	0.498													8	31	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14823201	14823201	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14823201C>G	uc003zlm.2	-	13	2884	c.2294G>C	c.(2293-2295)TGC>TCC	p.C765S	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	765	CSPG 5.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AATGTTAAAGCAGATCCCATG	0.443													73	123	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790192	78790192	+	Intron	SNP	C	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790192C>G	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.R683G|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatcgaatcgaatc	0.129													3	7	---	---	---	---	PASS
HEMGN	55363	broad.mit.edu	37	9	100693156	100693156	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100693156G>T	uc004axy.2	-	3	629	c.521C>A	c.(520-522)CCT>CAT	p.P174H	HEMGN_uc004axz.2_Missense_Mutation_p.P174H	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	174					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GTACATTTTAGGAGAGAGGTC	0.373													177	385	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64957276	64957276	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64957276C>T	uc001jmn.2	-	13	5839	c.5539G>A	c.(5539-5541)GAT>AAT	p.D1847N	JMJD1C_uc001jml.2_Missense_Mutation_p.D1628N|JMJD1C_uc001jmm.2_Missense_Mutation_p.D1559N|JMJD1C_uc010qiq.1_Missense_Mutation_p.D1665N|JMJD1C_uc009xpi.2_Missense_Mutation_p.D1665N|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Missense_Mutation_p.D745N	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1847	C6-type (Potential).				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TCACATGCATCACACATCTCC	0.403													66	117	---	---	---	---	PASS
FAM190B	54462	broad.mit.edu	37	10	86132205	86132205	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86132205G>A	uc001kdh.1	+	2	1591	c.1397G>A	c.(1396-1398)TGG>TAG	p.W466*	FAM190B_uc001kdg.1_Nonsense_Mutation_p.W466*|FAM190B_uc010qmd.1_Nonsense_Mutation_p.W466*	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14	466										ovary(3)|skin(1)	4						ACTGATGAATGGATAGATATA	0.313													26	146	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99655168	99655168	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99655168G>A	uc001kou.1	-	11	1676	c.1320C>T	c.(1318-1320)GGC>GGT	p.G440G	CRTAC1_uc001kov.2_Silent_p.G429G|CRTAC1_uc001kot.1_Silent_p.G230G	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	440						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TGTTGTTGAAGCCCTGCAGAG	0.483													8	81	---	---	---	---	PASS
HPS1	3257	broad.mit.edu	37	10	100177390	100177390	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100177390G>A	uc010qpf.1	-	20	2280	c.2034C>T	c.(2032-2034)GAC>GAT	p.D678D	PYROXD2_uc001kpc.2_5'Flank|PYROXD2_uc001kpd.2_5'Flank|PYROXD2_uc010qpe.1_5'Flank|HPS1_uc001kpi.1_Silent_p.D679D|HPS1_uc001kpj.1_3'UTR|HPS1_uc001kpk.1_Silent_p.D503D	NM_000195	NP_000186	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1 protein isoform a	678					lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity			skin(1)	1		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GCACCAGCAGGTCAGTGGGGA	0.667									Hermansky-Pudlak_syndrome				17	33	---	---	---	---	PASS
GAL3ST3	89792	broad.mit.edu	37	11	65810470	65810470	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65810470G>A	uc001ogv.2	-	2	964	c.804C>T	c.(802-804)AAC>AAT	p.N268N	GAL3ST3_uc001ogw.2_Silent_p.N268N	NM_033036	NP_149025	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	268	Lumenal (Potential).				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(1)	1						CGGCGCGCGCGTTGAGCTTGG	0.577													4	25	---	---	---	---	PASS
PACS1	55690	broad.mit.edu	37	11	65983684	65983684	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65983684C>G	uc001oha.1	+	5	889	c.755C>G	c.(754-756)TCC>TGC	p.S252C	PACS1_uc001ogz.1_Missense_Mutation_p.S252C	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	252					interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						AAGATCTACTCCCTGTCCAGC	0.512													28	65	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66472813	66472813	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66472813C>T	uc001ojd.2	-	14	2006	c.1934G>A	c.(1933-1935)CGT>CAT	p.R645H		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	645	Spectrin 4.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CCAGAGGAAACGCCAGAGCCG	0.701													10	18	---	---	---	---	PASS
COPS7A	50813	broad.mit.edu	37	12	6837091	6837091	+	Splice_Site	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6837091G>C	uc001qqj.2	+	3	402	c.163_splice	c.e3-1	p.L55_splice	COPS7A_uc009zex.2_Splice_Site|COPS7A_uc001qqk.2_Splice_Site_p.L55_splice|COPS7A_uc001qql.2_Intron|COPS7A_uc001qqh.2_Splice_Site_p.L55_splice|COPS7A_uc001qqi.2_Splice_Site_p.L55_splice|COPS7A_uc001qqm.2_Intron|COPS7A_uc001qqn.3_Splice_Site_p.L55_splice|COPS7A_uc001qqo.2_Splice_Site_p.L55_splice	NM_001164094	NP_001157566	Q9UBW8	CSN7A_HUMAN	COP9 complex subunit 7a						cullin deneddylation	cytoplasm|signalosome				ovary(1)	1						CATTCTCGCAGCTGGCTGAGA	0.542													14	112	---	---	---	---	PASS
ALG10B	144245	broad.mit.edu	37	12	38714340	38714340	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38714340G>T	uc001rln.3	+	3	886	c.747G>T	c.(745-747)ATG>ATT	p.M249I	ALG10B_uc001rlo.3_Missense_Mutation_p.M219I|ALG10B_uc010skk.1_Missense_Mutation_p.M189I	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	249	Cytoplasmic (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	p.M249I(1)		ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				ACTTGAGTATGCTTTTCTGTT	0.378													48	468	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88483261	88483261	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88483261G>C	uc001tar.2	-	31	3921	c.3577C>G	c.(3577-3579)CAG>GAG	p.Q1193E	CEP290_uc001taq.2_Missense_Mutation_p.Q253E	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1193	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TCATCAGACTGTGCCTGatat	0.328													3	6	---	---	---	---	PASS
NTN4	59277	broad.mit.edu	37	12	96052753	96052753	+	3'UTR	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96052753A>G	uc001tei.2	-	10					NTN4_uc009ztf.2_3'UTR|NTN4_uc009ztg.2_3'UTR	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor						axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AAACATTTCTATATGTTTTGG	0.348													19	41	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112147537	112147537	+	Intron	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112147537G>A	uc001tsq.2	+						ACAD10_uc009zvw.2_3'UTR|ACAD10_uc001tso.3_Intron|ACAD10_uc001tsp.2_Intron|ACAD10_uc009zvx.2_Intron|ACAD10_uc001tsr.2_5'Flank	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						AGCCACTAATGCAATGTTTCT	0.373													14	26	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19414102	19414102	+	RNA	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19414102C>T	uc010tcj.1	-	1		c.32008G>A				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GAATTTTTACCAAAGATTGAT	0.274													5	23	---	---	---	---	PASS
KIAA1704	55425	broad.mit.edu	37	13	45578485	45578485	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45578485A>C	uc001uzq.2	+	2	237	c.134A>C	c.(133-135)GAT>GCT	p.D45A	KIAA1704_uc010tfo.1_RNA|KIAA1704_uc001uzr.1_Missense_Mutation_p.D45A|KIAA1704_uc001uzs.2_5'UTR|KIAA1704_uc001uzt.2_5'Flank	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425	45	Poly-Ser.									pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		AGTAGTTCAGATTCATCAGAC	0.408													53	120	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	51948840	51948840	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51948840G>A	uc001vfk.2	-	14	2436	c.1822C>T	c.(1822-1824)CAG>TAG	p.Q608*	INTS6_uc001vfi.2_Nonsense_Mutation_p.Q292*|INTS6_uc001vfj.2_Nonsense_Mutation_p.Q595*|INTS6_uc001vfl.2_Nonsense_Mutation_p.Q430*	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a	608					snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		CTTCGTGGCTGATCAGGATCA	0.398													32	82	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20444063	20444063	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20444063A>G	uc010tkx.1	+	1	386	c.386A>G	c.(385-387)CAT>CGT	p.H129R		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	129	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTCTTTGTTCATCTCTTCACT	0.453													20	270	---	---	---	---	PASS
RNASE9	390443	broad.mit.edu	37	14	21024885	21024885	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21024885A>C	uc010aho.2	-	4	503	c.344T>G	c.(343-345)ATC>AGC	p.I115S	RNASE9_uc001vxq.3_Missense_Mutation_p.I120S|RNASE9_uc010ahp.2_Missense_Mutation_p.I120S|RNASE9_uc010ahq.2_Missense_Mutation_p.I120S|RNASE9_uc010ahr.2_Missense_Mutation_p.I120S|RNASE9_uc010ahs.2_Missense_Mutation_p.I115S|RNASE9_uc010aht.2_Missense_Mutation_p.I115S|RNASE9_uc010ahu.2_Missense_Mutation_p.I115S	NM_001110357	NP_001103827	P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	115						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(2)	2	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		GTTGTAACAGATTTTTTGGAG	0.358													9	107	---	---	---	---	PASS
WDR89	112840	broad.mit.edu	37	14	64066630	64066630	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64066630G>A	uc001xgh.2	-	3	277	c.31C>T	c.(31-33)CTG>TTG	p.L11L	WDR89_uc001xgi.2_Silent_p.L11L	NM_001008726	NP_001008726	Q96FK6	WDR89_HUMAN	WD repeat domain 89	11											0				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		ACAATGTGCAGATTAGCAAAT	0.348													12	119	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99932086	99932086	+	Silent	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99932086A>G	uc001ygc.2	-	2	227	c.57T>C	c.(55-57)ACT>ACC	p.T19T	SETD3_uc001ygd.2_Silent_p.T19T|SETD3_uc001ygf.2_Silent_p.T19T	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	19					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TTGGTGACACAGTTGCTGTAG	0.448													28	43	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35176806	35176806	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35176806T>C	uc001ziv.2	-	26	3128	c.2947A>G	c.(2947-2949)AAA>GAA	p.K983E		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	983						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GATCTTCCTTTAAAAATGGGT	0.368													58	102	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43109262	43109262	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43109262G>C	uc001zqo.2	-	7	1010	c.571C>G	c.(571-573)CGT>GGT	p.R191G	TTBK2_uc010bcy.2_Missense_Mutation_p.R122G|TTBK2_uc001zqp.2_Missense_Mutation_p.R191G|TTBK2_uc010bcz.1_Missense_Mutation_p.R156G	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	191	Protein kinase.				cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GATGCATAACGAACTGTCCCT	0.398													10	25	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49320719	49320719	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49320719G>T	uc001zxe.1	-	5	959	c.825C>A	c.(823-825)TGC>TGA	p.C275*	SECISBP2L_uc001zxd.1_Nonsense_Mutation_p.C275*|SECISBP2L_uc010bep.1_Nonsense_Mutation_p.C37*|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	275										breast(1)|skin(1)	2						GTTTGGGACTGCAGTAACCAC	0.493													52	103	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63948032	63948032	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63948032G>A	uc002amp.2	-	50	10141	c.9993C>T	c.(9991-9993)AAC>AAT	p.N3331N		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3331					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TTACAACAAAGTTTGGGGAGG	0.428													8	22	---	---	---	---	PASS
NOX5	79400	broad.mit.edu	37	15	69328249	69328249	+	Silent	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69328249C>T	uc002ars.1	+	7	1181	c.1161C>T	c.(1159-1161)TCC>TCT	p.S387S	NOX5_uc002arp.1_Silent_p.S369S|NOX5_uc002arq.1_Silent_p.S341S|NOX5_uc010bid.1_Silent_p.S352S|NOX5_uc002arr.1_Silent_p.S359S|NOX5_uc010bie.1_Silent_p.S187S|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	387	Ferric oxidoreductase.|Cytoplasmic (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						GCTCCAGTTCCTGCATCCGCA	0.597													28	113	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79051886	79051886	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79051886G>A	uc002bej.3	-	24	5149	c.4938C>T	c.(4936-4938)TGC>TGT	p.C1646C		NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1646	PLAC.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GCAGCGTCTCGCAGAACCCGA	0.701													5	15	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25266607	25266607	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25266607C>A	uc002dod.3	-	2	913	c.506G>T	c.(505-507)CGG>CTG	p.R169L	ZKSCAN2_uc010vcl.1_5'UTR|ZKSCAN2_uc002doe.2_Missense_Mutation_p.R169L	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	169					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		AGGTTCCTCCCGAGACACCGC	0.617													28	84	---	---	---	---	PASS
ZNF720	124411	broad.mit.edu	37	16	31724673	31724673	+	5'UTR	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31724673G>C	uc002ecn.3	+	1					ZNF720_uc010vfs.1_5'UTR|ZNF720_uc002eco.2_RNA|ZNF720_uc002ecp.1_5'UTR|ZNF720_uc002ecq.2_5'UTR	NM_001130913	NP_001124385	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						TCTGAGAATAGACAGAACCTC	0.592													5	14	---	---	---	---	PASS
ZDHHC1	29800	broad.mit.edu	37	16	67429119	67429119	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67429119G>T	uc010vjm.1	-	10	1320	c.1016C>A	c.(1015-1017)TCT>TAT	p.S339Y	TPPP3_uc002eta.2_5'Flank|TPPP3_uc002etb.2_5'Flank	NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	339						integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GGCAGGGCGAGAGTGTCTGGG	0.657													5	12	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72830806	72830806	+	Silent	SNP	A	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72830806A>T	uc002fck.2	-	9	6448	c.5775T>A	c.(5773-5775)GGT>GGA	p.G1925G	ZFHX3_uc002fcl.2_Silent_p.G1011G	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1925					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GCTCAGAACCACCCCCTGGTG	0.587													39	85	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3213905	3213905	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3213905C>T	uc002fvi.2	+	1	367	c.301C>T	c.(301-303)CTC>TTC	p.L101F		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						TAAGGCCTGCCTCTCCGAGCT	0.557													24	84	---	---	---	---	PASS
C17orf74	201243	broad.mit.edu	37	17	7330515	7330515	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7330515C>T	uc002ggw.2	+	3	1278	c.1205C>T	c.(1204-1206)GCC>GTC	p.A402V	FGF11_uc010vtw.1_Intron	NM_175734	NP_783861	Q0P670	CQ074_HUMAN	hypothetical protein LOC201243	402						integral to membrane					0		Prostate(122;0.157)				ACTACCTCTGCCTCCCTCACG	0.672													16	45	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38859817	38859817	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38859817G>A	uc002hvd.2	-	1	186	c.129C>T	c.(127-129)TTC>TTT	p.F43F		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	43	Head.|Gly-rich.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				CTCCTCCTCGGAAGCCCTGGG	0.652													21	70	---	---	---	---	PASS
DIRAS1	148252	broad.mit.edu	37	19	2717570	2717570	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2717570C>A	uc002lwf.3	-	2	393	c.235G>T	c.(235-237)GGC>TGC	p.G79C		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	79					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity	p.G79G(1)		ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCGTGGCCCTTGGAGATG	0.622													9	34	---	---	---	---	PASS
PRAM1	84106	broad.mit.edu	37	19	8564274	8564274	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8564274G>C	uc002mkd.2	-	2	438	c.418C>G	c.(418-420)CCA>GCA	p.P140A	PRAM1_uc002mkc.2_Missense_Mutation_p.P140A	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	188	Pro-rich.						lipid binding|protein binding				0						GGCTTCCTTGGAAACGGAGTG	0.662													8	93	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23406130	23406130	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23406130C>G	uc010xri.1	-	4	1035	c.917G>C	c.(916-918)GGA>GCA	p.G306A						SubName: Full=cDNA FLJ56866, moderately similar to Zinc finger protein 43;																		GGGCTTCTCTCCAGCATGAAT	0.353													7	21	---	---	---	---	PASS
PLEKHG2	64857	broad.mit.edu	37	19	39913384	39913384	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39913384G>A	uc010xuz.1	+	18	2015	c.1690G>A	c.(1690-1692)GAC>AAC	p.D564N	PLEKHG2_uc010xuy.1_Missense_Mutation_p.D505N|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.D342N	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	564					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GTCCACCCATGACATTCCCAA	0.448													36	45	---	---	---	---	PASS
PPP5C	5536	broad.mit.edu	37	19	46890487	46890487	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46890487G>C	uc002pem.2	+	8	1102	c.1042G>C	c.(1042-1044)GTG>CTG	p.V348L	PPP5C_uc010xya.1_Missense_Mutation_p.V215L|PPP5C_uc002pen.2_Missense_Mutation_p.V326L|PPP5C_uc010xyb.1_Missense_Mutation_p.V206L	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	348	Catalytic.				mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CAACGGCAAAGTGCTGGTGAG	0.617													16	17	---	---	---	---	PASS
NTN5	126147	broad.mit.edu	37	19	49173943	49173943	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173943G>A	uc002pkb.2	-	2	397	c.301C>T	c.(301-303)CCC>TCC	p.P101S	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Missense_Mutation_p.P101S	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor	101						extracellular region				large_intestine(1)|pancreas(1)	2						AGCCTCCAGGGACCCCCTGAG	0.677													8	21	---	---	---	---	PASS
ZNF583	147949	broad.mit.edu	37	19	56934784	56934784	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56934784G>A	uc010ygl.1	+	5	922	c.757G>A	c.(757-759)GCA>ACA	p.A253T	ZNF583_uc002qnc.2_Missense_Mutation_p.A253T|ZNF583_uc010ygm.1_Missense_Mutation_p.A253T	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	253	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		CAGCCAGAGTGCAAACTTGGC	0.443													54	81	---	---	---	---	PASS
SIRPB2	284759	broad.mit.edu	37	20	1460670	1460670	+	Silent	SNP	T	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1460670T>C	uc002wfg.2	-	2	354	c.126A>G	c.(124-126)CTA>CTG	p.L42L	SIRPB2_uc002wfh.3_Silent_p.L42L|SIRPB2_uc010zpr.1_5'UTR	NM_001122962	NP_001116434	Q5JXA9	SIRB2_HUMAN	signal-regulatory protein beta 2 isoform 1	42	Ig-like V-type 1.|Extracellular (Potential).					integral to membrane					0						CCTCGGGCTGTAGCACCTGCC	0.542													10	32	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42574588	42574588	+	Silent	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42574588G>A	uc002xlf.3	+	1	53	c.36G>A	c.(34-36)GCG>GCA	p.A12A	TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	12					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TCGCGGGCGCGTTCTCTCGCT	0.527													24	66	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769082	57769082	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769082G>A	uc002yan.2	+	1	3008	c.3008G>A	c.(3007-3009)AGC>AAC	p.S1003N		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1003						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					GAGGCGGACAGCATCCTGGAG	0.642													16	84	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22370819	22370819	+	5'UTR	SNP	G	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22370819G>A	uc002yld.1	+	1					NCAM2_uc011acb.1_5'UTR	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GGCAGCGAAAGGTTCTCTCTC	0.423													5	23	---	---	---	---	PASS
KRTAP13-4	284827	broad.mit.edu	37	21	31802847	31802847	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31802847T>G	uc011acw.1	+	1	254	c.254T>G	c.(253-255)CTA>CGA	p.L85R		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	85	4.|4 X 10 AA approximate repeats.					intermediate filament					0						TCTGGATCTCTAGGCTTTCGG	0.577													8	78	---	---	---	---	PASS
RAI2	10742	broad.mit.edu	37	X	17819213	17819213	+	Silent	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17819213C>T	uc004cyf.2	-	3	1488	c.918G>A	c.(916-918)ACG>ACA	p.T306T	RAI2_uc004cyg.2_Silent_p.T306T|RAI2_uc010nfa.2_Silent_p.T306T|RAI2_uc004cyh.3_Silent_p.T306T|RAI2_uc011miy.1_Silent_p.T256T	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	306					embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					TCTTAATGACCGTGTGGCGGC	0.542													56	171	---	---	---	---	PASS
GSPT2	23708	broad.mit.edu	37	X	51487802	51487802	+	Silent	SNP	C	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51487802C>T	uc004dpl.2	+	1	1306	c.1080C>T	c.(1078-1080)ATC>ATT	p.I360I		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	360					cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)					ATTGGAGCATCGAGAGATATG	0.393													24	109	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53675215	53675215	+	Silent	SNP	A	C	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53675215A>C	uc004dsp.2	-	5	486	c.84T>G	c.(82-84)GTT>GTG	p.V28V		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	28					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CATCATTACAAACTTTGAGTT	0.398													28	93	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108708503	108708503	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108708503G>T	uc004eod.3	-	3	1176	c.900C>A	c.(898-900)AAC>AAA	p.N300K	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	300	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						GCTTTGGGTTGTTCCTTAGGA	0.478													54	230	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123020288	123020288	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123020288A>G	uc010nqu.2	+	2	902	c.776A>G	c.(775-777)AAT>AGT	p.N259S	XIAP_uc004etx.2_Missense_Mutation_p.N259S|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	259				N->D: Reduced interaction with PRSS25; when associated with S-314.	anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						CTTCCAAGAAATCCATCCATG	0.383									X-linked_Lymphoproliferative_syndrome				58	168	---	---	---	---	PASS
NECAP2	55707	broad.mit.edu	37	1	16782519	16782520	+	Intron	INS	-	T	T	rs139186833		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16782519_16782520insT	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		Gttttcttttcttttttttttt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30196525	30196526	+	IGR	INS	-	CAT	CAT			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30196525_30196526insCAT								PTPRU (543210 upstream) : MATN1 (987600 downstream)																							accaccatcaccaccaccatca	0.000													4	2	---	---	---	---	
NRD1	4898	broad.mit.edu	37	1	52310598	52310598	+	Intron	DEL	C	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52310598delC	uc001ctc.3	-						NRD1_uc001ctd.3_Intron|NRD1_uc001cte.2_Intron|NRD1_uc001ctf.2_Intron|NRD1_uc010ong.1_Intron|NRD1_uc009vzc.1_Intron	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a						cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						aacttctagaccccagagctg	0.000													4	2	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													4	3	---	---	---	---	
TBX15	6913	broad.mit.edu	37	1	119435949	119435950	+	Intron	INS	-	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119435949_119435950insA	uc001ehl.1	-						TBX15_uc009whj.1_Intron	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		aagaaagaaagaagaaagaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184081557	184081558	+	IGR	INS	-	GGAA	GGAA			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184081557_184081558insGGAA								TSEN15 (38216 upstream) : C1orf21 (274592 downstream)																							GGGggaaggagggaaggaagga	0.223													4	3	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215814186	215814186	+	Intron	DEL	C	-	-	rs78797010		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215814186delC	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAATCCaaacaaaaaaaaaa	0.318										HNSCC(13;0.011)			4	2	---	---	---	---	
PPM1G	5496	broad.mit.edu	37	2	27605696	27605697	+	Intron	INS	-	T	T	rs111310967		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27605696_27605697insT	uc002rkl.2	-						ZNF513_uc002rkj.2_5'Flank|ZNF513_uc002rkk.2_5'Flank|PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698	O15355	PPM1G_HUMAN	protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					agtcttttttgttttttttttt	0.025													4	3	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29543532	29543532	+	Intron	DEL	G	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29543532delG	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	CCCTGCAGGTGGGGTGAAGTC	0.547			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				154	89	---	---	---	---	
FOXN2	3344	broad.mit.edu	37	2	48586020	48586023	+	Intron	DEL	ATCC	-	-	rs138339553		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48586020_48586023delATCC	uc002rwh.1	+							NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CATAGGATGAATCCCTTTTAGTCA	0.333													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57947592	57947593	+	IGR	INS	-	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57947592_57947593insG								None (None upstream) : VRK2 (187193 downstream)																							gaaggaaggaagaaggaaggaa	0.084													3	4	---	---	---	---	
ELMOD3	84173	broad.mit.edu	37	2	85587801	85587802	+	Intron	INS	-	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85587801_85587802insT	uc002spf.3	+						ELMOD3_uc010fgg.2_Intron|ELMOD3_uc002spg.3_Intron|ELMOD3_uc002sph.3_Intron|ELMOD3_uc010ysn.1_Intron|ELMOD3_uc010yso.1_Intron|ELMOD3_uc010ysp.1_Intron	NM_001135021	NP_001128493	Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3 isoform b						phagocytosis	cytoskeleton				ovary(2)	2						TGCCTTAATGATTTTTTTTTTC	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103483368	103483368	+	IGR	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103483368delT								TMEM182 (49232 upstream) : None (None downstream)																							AAAGAGCTGGTTTTTTTTTTT	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106219011	106219018	+	Intron	DEL	GAAGGAAG	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106219011_106219018delGAAGGAAG	uc002tdf.2	-											Homo sapiens hypothetical protein LOC285000, mRNA (cDNA clone IMAGE:3925223), partial cds.																		gagagagagagaaggaaggaaggaagga	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129793083	129793086	+	IGR	DEL	AGGA	-	-	rs146372644	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129793083_129793086delAGGA								HS6ST1 (716912 upstream) : LOC389033 (887349 downstream)																							ggagggagggaggaaggaaggaag	0.000													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133010779	133010779	+	Intron	DEL	G	-	-	rs111517614		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133010779delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						AAGTGCATTCGAAGAGTCGAT	0.537													4	2	---	---	---	---	
TBR1	10716	broad.mit.edu	37	2	162276925	162276927	+	Intron	DEL	TCT	-	-	rs145401096		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162276925_162276927delTCT	uc002ubw.1	+						TBR1_uc010foy.2_Intron	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						ttcttcttcctcttctttttttt	0.315													6	3	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216197389	216197390	+	Intron	INS	-	AC	AC			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216197389_216197390insAC	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	TAAAATCTGATACACACACACA	0.292			T	ALK	ALCL								2	5	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216287904	216287905	+	Intron	DEL	CA	-	-	rs146148439		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216287904_216287905delCA	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vfl.2_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GATGTAACATcacacacacaca	0.193													6	3	---	---	---	---	
CCDC108	255101	broad.mit.edu	37	2	219878185	219878186	+	Intron	DEL	GC	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219878185_219878186delGC	uc002vjl.1	-							NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCCTGTCCAGCCAGCCCCCTC	0.599													6	5	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126216641	126216645	+	Intron	DEL	GGCTT	-	-	rs71797104		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126216641_126216645delGGCTT	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		GGAGGGCAGAGGCTTGGTGTGGGTG	0.590													3	4	---	---	---	---	
ARMC8	25852	broad.mit.edu	37	3	137983254	137983254	+	Intron	DEL	C	-	-	rs73227566		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137983254delC	uc003esa.1	+						TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Intron|TXNDC6_uc003ese.1_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_Intron|ARMC8_uc003esc.1_Intron|ARMC8_uc003esf.1_Intron	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2								binding				0						GATTTTCtttctttttttttt	0.189													3	3	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													4	5	---	---	---	---	
WDR49	151790	broad.mit.edu	37	3	167247185	167247185	+	Intron	DEL	G	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167247185delG	uc003fev.1	-						WDR49_uc003feu.1_Intron|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49											large_intestine(1)|ovary(1)|skin(1)	3						aatataaaatggaggtgacgc	0.249													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49155592	49155592	+	IGR	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49155592delA								CWH43 (91499 upstream) : None (None downstream)																							attcgggttgattccattcca	0.000													4	2	---	---	---	---	
ADAMTS3	9508	broad.mit.edu	37	4	73280847	73280850	+	Intron	DEL	TAAT	-	-	rs146478222		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73280847_73280850delTAAT	uc003hgk.1	-							NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TAACTATCAATAATTAATTCATAT	0.260													5	5	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123257265	123257266	+	Intron	INS	-	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123257265_123257266insT	uc003ieh.2	+						KIAA1109_uc003iem.2_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ACTTTGCTTGATTAAACTTTAA	0.272													15	8	---	---	---	---	
RNASEN	29102	broad.mit.edu	37	5	31449242	31449242	+	Intron	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31449242delA	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						accctgtctcaaaaaaaaaaa	0.179													6	3	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35086663	35086664	+	Intron	DEL	GT	-	-	rs73767508	byFrequency	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35086663_35086664delGT	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CATTTTGCTGgtgtgtgtgtgt	0.386													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43818645	43818646	+	IGR	INS	-	TTCC	TTCC	rs67260689		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43818645_43818646insTTCC								NNT (112978 upstream) : FGF10 (486451 downstream)																							tctttctttctttccttccttc	0.124													4	2	---	---	---	---	
RAD50	10111	broad.mit.edu	37	5	131939960	131939961	+	Intron	INS	-	TTT	TTT			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131939960_131939961insTTT	uc003kxi.2	+						RAD50_uc003kxh.2_Intron	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ttctcttttccttttttttttt	0.153								Homologous_recombination					4	2	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145889882	145889882	+	Intron	DEL	A	-	-	rs67804115		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145889882delA	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aatttttcttaaaaaaaaaaa	0.010													10	6	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176701699	176701700	+	Intron	DEL	TG	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176701699_176701700delTG	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		acttatcctttgtgtgtgtgtg	0.005			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	3	---	---	---	---	
SSR1	6745	broad.mit.edu	37	6	7295793	7295793	+	Intron	DEL	A	-	-	rs142657056	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7295793delA	uc003mxf.3	-						SSR1_uc003mxg.3_Intron|SSR1_uc010jny.2_Intron	NM_003144	NP_003135	P43307	SSRA_HUMAN	signal sequence receptor, alpha precursor						cotranslational protein targeting to membrane|positive regulation of cell proliferation	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Ovarian(93;0.0398)					AAAagagttgaggtcttgcta	0.144													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	147964881	147964884	+	IGR	DEL	GAAG	-	-	rs71792072		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147964881_147964884delGAAG								SAMD5 (73724 upstream) : SASH1 (698845 downstream)																							gggaaggaaagaaggaaggaagga	0.132													3	3	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7477250	7477251	+	Intron	INS	-	A	A	rs146114839	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7477250_7477251insA	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron|COL28A1_uc003sre.1_5'Flank	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		gcatcttttgtaaccactgcta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	16772117	16772120	+	IGR	DEL	CCTC	-	-	rs1626439		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16772117_16772120delCCTC								BZW2 (25969 upstream) : TSPAN13 (21231 downstream)																							ttccttccttcctcccttctttcc	0.000													4	2	---	---	---	---	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20824941_20824943delGCC	uc003suy.2	-	3	680_682	c.439_441delGGC	c.(439-441)GGCdel	p.G147del	SP8_uc003suz.2_In_Frame_Del_p.G165del	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor isoform 2	147					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						GCGCGGAGGAgccgccgccgccg	0.493													4	2	---	---	---	---	
DTX2	113878	broad.mit.edu	37	7	76100473	76100473	+	Intron	DEL	C	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76100473delC	uc003uff.3	+						DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Intron|DTX2_uc003ufh.3_Intron|FDPSL2A_uc003ufi.2_RNA	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a						Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						TCCATTCGttctttttttttt	0.224													4	2	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104719584	104719584	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104719584delT	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron|MLL5_uc003vco.1_Intron|MLL5_uc010ljd.1_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						CTATGAAGTCttttttttttt	0.204													6	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	4985367	4985367	+	IGR	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4985367delT								CSMD1 (133039 upstream) : None (None downstream)																							ctgacgcttcttttttttttt	0.224													4	4	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17739342	17739343	+	Intron	INS	-	A	A	rs113353024		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17739342_17739343insA	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Intron|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		gactccgcctcaaaaaaaaaaa	0.129													6	3	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40389934	40389935	+	Intron	DEL	AA	-	-	rs35797324		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40389934_40389935delAA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CTGTATATATAAAATATCTCCA	0.302													4	3	---	---	---	---	
FAM110B	90362	broad.mit.edu	37	8	59026073	59026073	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59026073delT	uc003xtj.1	+							NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362							microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GTGTCAGCTCTTTGGAAAGAG	0.423													7	6	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460728	110460728	+	Intron	DEL	G	-	-	rs1673406		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460728delG	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATTTCTAGTGttttttttgt	0.129										HNSCC(38;0.096)			8	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99924731	99924732	+	IGR	INS	-	G	G	rs145342037	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99924731_99924732insG								LOC340508 (80504 upstream) : ZNF322B (32901 downstream)																							AACTCTACAAAGAAATTGCCGT	0.267													5	6	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140268130	140268132	+	Intron	DEL	TTT	-	-	rs66959515		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140268130_140268132delTTT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CGCAGAGAGGTTTTTTAAAATTT	0.571													5	7	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49392912	49392912	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49392912delT	uc001jgi.2	-	19	2479	c.2372delA	c.(2371-2373)AATfs	p.N791fs	FRMPD2_uc001jgh.2_Frame_Shift_Del_p.N759fs|FRMPD2_uc001jgj.2_Frame_Shift_Del_p.N769fs	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	791	PDZ 1.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CTCTCCCTCATTAATGACAAA	0.318													50	24	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACATAATAAttttttttttt	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77474615	77474616	+	IGR	INS	-	CCTT	CCTT	rs58384755	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77474615_77474616insCCTT								MIR606 (162304 upstream) : C10orf11 (67903 downstream)																							ctccctccctcccttccttcct	0.114													6	5	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97131603	97131604	+	Intron	INS	-	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97131603_97131604insA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ATTACCTAACCAAAAAAAAAAA	0.262													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	103955705	103955705	+	IGR	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103955705delT								NOLC1 (32078 upstream) : ELOVL3 (30438 downstream)																							ctttcctttcttttttttgag	0.015													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130245599	130245602	+	IGR	DEL	TTCT	-	-	rs56876189		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130245599_130245602delTTCT								MKI67 (321131 upstream) : None (None downstream)																							ccttccttccttctttccttcctt	0.000													3	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69998441	69998441	+	Intron	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69998441delA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						actccatctcaaaaaaaaaaa	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86736370	86736371	+	IGR	INS	-	C	C	rs138581182	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736370_86736371insC								FZD4 (69937 upstream) : TMEM135 (12694 downstream)																							agagtgagactccatctcaaaa	0.134													6	5	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072082	99072082	+	Intron	DEL	T	-	-	rs151051937	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072082delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		cttcctttcctttccttcctt	0.000													8	5	---	---	---	---	
ROBO3	64221	broad.mit.edu	37	11	124750448	124750453	+	In_Frame_Del	DEL	CGGAGT	-	-	rs71859853		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124750448_124750453delCGGAGT	uc001qbc.2	+	27	4285_4290	c.4093_4098delCGGAGT	c.(4093-4098)CGGAGTdel	p.RS1367del	ROBO3_uc001qbd.2_In_Frame_Del_p.RS292del|ROBO3_uc010sar.1_In_Frame_Del_p.RS416del|ROBO3_uc001qbe.2_In_Frame_Del_p.RS292del|ROBO3_uc001qbf.1_In_Frame_Del_p.RS251del	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	1367_1368	Cytoplasmic (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGgccggagccggagtcggagtcaga	0.519													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5141557	5141557	+	IGR	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5141557delT								KCNA1 (114137 upstream) : KCNA5 (11528 downstream)																							ctttcccttcttTTTTTTTTT	0.174													4	2	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	22081232	22081248	+	Intron	DEL	GGAAGGGAGGGTGGGAG	-	-	rs150948526	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22081232_22081248delGGAAGGGAGGGTGGGAG	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron|ABCC9_uc001rfk.2_Intron|ABCC9_uc001rfl.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	aaggaaggaaggaagggagggtgggagggaaggaagg	0.009													4	2	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32520417	32520417	+	Intron	DEL	A	-	-	rs63514564		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520417delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGTATTTAAGAAAAAAAAAAA	0.303													3	5	---	---	---	---	
TROAP	10024	broad.mit.edu	37	12	49719150	49719150	+	Intron	DEL	A	-	-	rs111795391		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49719150delA	uc001rtx.3	+						TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						tctatttcttaaaaaaaaaaa	0.199													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19931395	19931396	+	IGR	INS	-	A	A	rs138883225	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19931395_19931396insA								LOC100101938 (12282 upstream) : TPTE2 (65625 downstream)																							ttattttttttaaagaatttga	0.000													5	3	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32868431	32868431	+	Intron	DEL	T	-	-	rs11400232		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32868431delT	uc001utx.2	+						FRY_uc010tdw.1_Intron|FRY_uc001utz.2_Intron|FRY_uc010tdx.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CATAAGATCCTTTTTTTTTCC	0.353													8	4	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	35747666	35747668	+	In_Frame_Del	DEL	TCT	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35747666_35747668delTCT	uc001uvb.2	+	27	4695_4697	c.4489_4491delTCT	c.(4489-4491)TCTdel	p.S1498del	NBEA_uc010abi.2_In_Frame_Del_p.S186del	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1498						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGGAAATAAATCTTCCCATGGAA	0.350													47	29	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48933996	48933996	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48933996delT	uc001vcb.2	+						RB1_uc010acs.1_Intron|RB1_uc010act.1_5'Flank	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(3)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTAAAACAGATTTTTTTTTTT	0.229		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49785471	49785471	+	IGR	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49785471delA								FNDC3A (1557 upstream) : MLNR (9003 downstream)																							aaatgataataaaaaaaaaaa	0.214													4	2	---	---	---	---	
ABCD4	5826	broad.mit.edu	37	14	74754978	74754979	+	Intron	INS	-	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74754978_74754979insT	uc001xpr.2	-						ABCD4_uc001xps.2_Intron|ABCD4_uc001xpt.2_Intron|ABCD4_uc010tur.1_Intron	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4							ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		ACAGACCCAGAGGGCAGGATGT	0.545													16	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102082421	102082422	+	IGR	INS	-	GAAG	GAAG			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102082421_102082422insGAAG								DIO3 (52632 upstream) : C14orf72 (114352 downstream)																							ggaaaagaaaagaaggaaggaa	0.000													3	3	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45434936	45434937	+	Intron	DEL	AG	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45434936_45434937delAG	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		aaagaaagaaagagagagagag	0.089													4	2	---	---	---	---	
NEDD4	4734	broad.mit.edu	37	15	56140568	56140568	+	Splice_Site	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56140568delA	uc002adj.2	-	13	3099	c.2799_splice	c.e13+1	p.P933_splice	NEDD4_uc002adl.2_Splice_Site_p.P514_splice|NEDD4_uc002adi.2_Splice_Site_p.P861_splice|NEDD4_uc010ugj.1_Splice_Site_p.P917_splice|NEDD4_uc010bfm.2_Splice_Site_p.P916_splice|NEDD4_uc002adk.2_Splice_Site	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGAGAGACTTACTGGTCCAGT	0.453													202	100	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73723875	73723876	+	IGR	INS	-	CTTT	CTTT	rs113067423	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73723875_73723876insCTTT								HCN4 (62270 upstream) : C15orf60 (11623 downstream)																							ttccttccttcctttctttctt	0.000													4	3	---	---	---	---	
TPSAB1	7177	broad.mit.edu	37	16	1291717	1291718	+	Intron	INS	-	G	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1291717_1291718insG	uc002ckz.2	+						TPSAB1_uc010uux.1_Intron	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor						defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				CTGGGGACAGTGGAGGTGGGGC	0.703													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15843830	15843830	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15843830delT	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002dea.1_3'UTR	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						CCCTTCCTCCTTTTCCTCCAG	0.488			T	CBFB	AML								10	6	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		tttttttttcttttttttttt	0.209													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	30688639	30688646	+	IGR	DEL	AAGGAAGG	-	-	rs8054519	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30688639_30688646delAAGGAAGG								FBRS (6509 upstream) : SRCAP (21816 downstream)																							gaaagaaagaaaggaaggaaggaaggaa	0.024													3	5	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70154770	70154771	+	Intron	INS	-	T	T	rs141843737	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70154770_70154771insT	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCTGAATTTTGTTTAAGGATGA	0.317													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74419892	74419892	+	Intron	DEL	T	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419892delT	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		cctttctctcttttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255984	87255986	+	Intron	DEL	CAC	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255984_87255986delCAC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ccaccaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26680546	26680547	+	Intron	INS	-	A	A	rs11454138		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680546_26680547insA	uc002haz.2	-						POLDIP2_uc010wag.1_Intron	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		gactccatatcaaaaaaaaaaa	0.248													4	3	---	---	---	---	
LRRC37B2	147172	broad.mit.edu	37	17	28961189	28961189	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28961189delA	uc002hfl.3	+	5	883	c.652delA	c.(652-654)AAAfs	p.K218fs	LRRC37B2_uc010csj.1_Intron|LRRC37B2_uc010wbq.1_RNA|LRRC37B2_uc010csi.2_RNA					RecName: Full=Putative LRRC37B-like protein 2;												0						CCACAAACTGAAAACCAACGT	0.323													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29369492	29369493	+	IGR	DEL	CA	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29369492_29369493delCA								RNF135 (42567 upstream) : NF1 (52502 downstream)																							cacaggcaagcacacacacaca	0.203													4	2	---	---	---	---	
TMEM132E	124842	broad.mit.edu	37	17	32965285	32965286	+	3'UTR	INS	-	A	A	rs28442132	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32965285_32965286insA	uc002hif.2	+	10						NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor							integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		ACCCCCCCCCCCAACGGGGTCA	0.639											OREG0024325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CYTH1	9267	broad.mit.edu	37	17	76696613	76696614	+	Intron	INS	-	T	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76696613_76696614insT	uc002jvw.2	-						CYTH1_uc010wtw.1_Intron|CYTH1_uc010wtx.1_Intron	NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						ttttttttttcttttttttttt	0.193													4	2	---	---	---	---	
MEP1B	4225	broad.mit.edu	37	18	29779622	29779633	+	Intron	DEL	CTTTCGTTCGTT	-	-	rs2161824		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29779622_29779633delCTTTCGTTCGTT	uc002kxj.3	+							NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor						digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						cctttttttcctttcgttcgttccttccttcc	0.080													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66123858	66123869	+	IGR	DEL	AAATAAATAAAT	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66123858_66123869delAAATAAATAAAT								DSEL (939891 upstream) : TMX3 (217058 downstream)																							CTGCAAGCACaaataaataaataaataaataa	0.377													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	11384355	11384356	+	IGR	INS	-	TCTC	TCTC			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11384355_11384356insTCTC								DOCK6 (11198 upstream) : TSPAN16 (22468 downstream)																							ctccctctctctctttctttct	0.025													4	3	---	---	---	---	
KLK5	25818	broad.mit.edu	37	19	51448302	51448316	+	Intron	DEL	TCCTTCCTTTCTTTC	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51448302_51448316delTCCTTCCTTTCTTTC	uc002pue.2	-						KLK5_uc002puf.2_Intron|KLK5_uc002pug.2_Intron	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein						epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		tctttctccttccttcctttctttctccttccttc	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19831683	19831698	+	IGR	DEL	AAGGAAGGAAGGAGAA	-	-	rs11475764		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831683_19831698delAAGGAAGGAAGGAGAA								SLC24A3 (128143 upstream) : RIN2 (38512 downstream)																							ggaaggaaggaaggaaggaaggagaaagaaaggaag	0.079													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961024	23961025	+	IGR	INS	-	AC	AC	rs146633246	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961024_23961025insAC								CST5 (100644 upstream) : GGTLC1 (4666 downstream)																							cactcacacatacacacacaaa	0.000													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29647450	29647451	+	Intron	INS	-	GAAA	GAAA	rs71674043		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647450_29647451insGAAA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGAGAGggaaggaaggaaggaa	0.045													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55448116	55448122	+	IGR	DEL	AAAAAGA	-	-	rs138402881	by1000genomes	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55448116_55448122delAAAAAGA								TFAP2C (233780 upstream) : BMP7 (295687 downstream)																							agagagaaagaaaaagaaagaaggaaa	0.000													4	2	---	---	---	---	
SLMO2	51012	broad.mit.edu	37	20	57609945	57609946	+	3'UTR	INS	-	AA	AA	rs138739647		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57609945_57609946insAA	uc002yam.2	-	6					ATP5E_uc002yal.2_5'Flank|SLMO2_uc010zzv.1_3'UTR	NM_016045	NP_057129	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2											skin(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			ACCAACTTATCAAAAAAAAAAA	0.297													6	3	---	---	---	---	
ADAMTS5	11096	broad.mit.edu	37	21	28337583	28337583	+	Intron	DEL	C	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28337583delC	uc002ymg.2	-							NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						AGCGCTGGGACCCCCGCATCC	0.552													86	60	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	22985692	22985693	+	IGR	INS	-	CA	CA	rs68105277		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22985692_22985693insCA								ZNF645 (693118 upstream) : DDX53 (32394 downstream)																							ACATCCCCCATcacacacacac	0.371													4	2	---	---	---	---	
ARHGEF9	23229	broad.mit.edu	37	X	62864048	62864048	+	Intron	DEL	A	-	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62864048delA	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						cttgaaatacaaaaaaaaaaa	0.015													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82254421	82254422	+	IGR	INS	-	A	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82254421_82254422insA								None (None upstream) : POU3F4 (508847 downstream)																							CAGTTTCTCAGAAAAAAAAAAA	0.366													4	2	---	---	---	---	
