Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MXRA8	54587	broad.mit.edu	37	1	1289294	1289294	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1289294T>A	uc001aew.2	-	9	1268	c.1237A>T	c.(1237-1239)ATC>TTC	p.I413F	MXRA8_uc001aex.3_Missense_Mutation_p.I419F|MXRA8_uc001aey.3_Missense_Mutation_p.I413F|MXRA8_uc010nyl.1_Missense_Mutation_p.I413F|MXRA8_uc001aez.2_Missense_Mutation_p.I312F|MXRA8_uc001afa.2_Missense_Mutation_p.I404F	NM_032348	NP_115724	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8 precursor	413	Cytoplasmic (Potential).					integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCCTTCAGGATGTTGTTTTTG	0.642													3	34	---	---	---	---	PASS
NPPB	4879	broad.mit.edu	37	1	11918768	11918768	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11918768G>A	uc001atj.2	-	1	225	c.123C>T	c.(121-123)TCC>TCT	p.S41S		NM_002521	NP_002512	P16860	ANFB_HUMAN	natriuretic peptide precursor B preproprotein	41					body fluid secretion|cGMP biosynthetic process|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation	extracellular space	diuretic hormone activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)|Nesiritide(DB04899)|Testosterone(DB00624)	CCTGTAACCCGGACGTTTCCA	0.622													45	86	---	---	---	---	PASS
MED18	54797	broad.mit.edu	37	1	28661233	28661233	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28661233C>G	uc001bpt.3	+	3	624	c.379C>G	c.(379-381)CAT>GAT	p.H127D	MED18_uc009vtg.2_Missense_Mutation_p.H127D	NM_017638	NP_060108	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	127					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	identical protein binding				0		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCATGGACCATGAGTTTGT	0.512													18	49	---	---	---	---	PASS
YTHDF2	51441	broad.mit.edu	37	1	29069170	29069170	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29069170G>A	uc001brc.2	+	4	885	c.388G>A	c.(388-390)GAC>AAC	p.D130N	YTHDF2_uc001brd.2_Missense_Mutation_p.D127N|YTHDF2_uc010ofx.1_Missense_Mutation_p.D80N|YTHDF2_uc001bre.2_Missense_Mutation_p.D80N	NM_016258	NP_057342	Q9Y5A9	YTHD2_HUMAN	high glucose-regulated protein 8	130					humoral immune response					ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTGGGATTGACTTCTCAGC	0.478													18	98	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39715714	39715714	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39715714A>G	uc010ois.1	+	5	516	c.311A>G	c.(310-312)GAA>GGA	p.E104G	MACF1_uc001cda.1_Missense_Mutation_p.E12G|MACF1_uc010oit.1_Missense_Mutation_p.E67G	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	104	Actin-binding.|CH 1.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATCTTTATGAAGATCTGCGG	0.413													20	154	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76269428	76269428	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76269428G>T	uc001dhd.1	+	2	298	c.257G>T	c.(256-258)GGA>GTA	p.G86V		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	86					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						TCATACTTTGGAAACAAAAGA	0.289								MMR					6	37	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86289366	86289366	+	Splice_Site	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86289366A>G	uc001dlj.2	-	44	3777	c.3735_splice	c.e44+1	p.P1245_splice	COL24A1_uc001dli.2_Splice_Site_p.P381_splice|COL24A1_uc010osd.1_Splice_Site_p.P545_splice|COL24A1_uc001dlk.2_Splice_Site|COL24A1_uc010ose.1_Splice_Site|COL24A1_uc010osf.1_Splice_Site	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCAAAACATACTGGGGGTCC	0.353													28	200	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147124277	147124277	+	Silent	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147124277A>G	uc001epr.2	-	7	1320	c.856T>C	c.(856-858)TTG>CTG	p.L286L	ACP6_uc009wjj.1_3'UTR	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	286					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					AGTATGTACAAGGATGTGTCC	0.512													15	63	---	---	---	---	PASS
LASS2	29956	broad.mit.edu	37	1	150938559	150938559	+	3'UTR	SNP	A	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150938559A>C	uc001evy.2	-	11					LASS2_uc001evz.2_3'UTR|LASS2_uc009wmh.2_3'UTR	NM_181746	NP_859530	Q96G23	CERS2_HUMAN	LAG1 longevity assurance 2							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0	all_lung(15;8.07e-35)|Lung NSC(24;7.93e-31)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTGACCCTATAGCGCAGGGAG	0.478													30	77	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214818566	214818566	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214818566A>T	uc001hkm.2	+	13	5827	c.5653A>T	c.(5653-5655)AAT>TAT	p.N1885Y		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	1981	Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TATTGGAGATAATGTGGCCAA	0.423													28	66	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230839961	230839961	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230839961T>C	uc001hty.3	-	4	1755	c.1247A>G	c.(1246-1248)AAT>AGT	p.N416S	AGT_uc009xfe.2_Intron|AGT_uc009xff.2_Missense_Mutation_p.N388S	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	416					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	GATGCGGTCATTGCTCAATTT	0.577													24	51	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233372658	233372658	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233372658G>T	uc001hvl.2	-	9	2526	c.2291C>A	c.(2290-2292)GCC>GAC	p.A764D	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA|PCNXL2_uc001hvq.1_Missense_Mutation_p.A63D	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	764						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				GGCACTGACGGCAGGGTCCCC	0.532													4	150	---	---	---	---	PASS
STRN	6801	broad.mit.edu	37	2	37088370	37088370	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37088370C>T	uc002rpn.2	-	13	1583	c.1574G>A	c.(1573-1575)AGC>AAC	p.S525N	STRN_uc010ezx.2_Missense_Mutation_p.S488N	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	525	WD 2.				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				ACCATTGCTGCTCATTACCAC	0.408													26	83	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155295210	155295210	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155295210G>C	uc002tyr.3	+	12	2069	c.1502G>C	c.(1501-1503)GGA>GCA	p.G501A	GALNT13_uc002tyt.3_Missense_Mutation_p.G501A|GALNT13_uc010fod.2_Missense_Mutation_p.R233S|uc002tyu.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	501	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CATATGAGAGGAAATCAGTTA	0.333													29	103	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203378491	203378491	+	Silent	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203378491A>G	uc002uzf.3	+	4	1616	c.468A>G	c.(466-468)GCA>GCG	p.A156A	BMPR2_uc010ftr.2_Silent_p.A156A	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	156	Helical; (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						TTGCTTTGGCATCAGTCTCTG	0.289													9	132	---	---	---	---	PASS
USP40	55230	broad.mit.edu	37	2	234429716	234429716	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234429716A>C	uc010zmr.1	-	16	2279	c.2279T>G	c.(2278-2280)ATT>AGT	p.I760S	USP40_uc010zmt.1_Missense_Mutation_p.I404S	NM_018218	NP_060688	Q9NVE5	UBP40_HUMAN	ubiquitin thioesterase 40	748					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GAGCCAGTCAATCTCATTCAT	0.348													9	44	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235950115	235950115	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235950115G>A	uc002vvp.2	+	4	1095	c.702G>A	c.(700-702)CGG>CGA	p.R234R	SH3BP4_uc010fym.2_Silent_p.R234R|SH3BP4_uc002vvq.2_Silent_p.R234R	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	234					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CGGTCAGGCGGGACAACCCCT	0.577													28	176	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188290	10188290	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188290C>T	uc003bvc.2	+	2	646	c.433C>T	c.(433-435)CAG>TAG	p.Q145*	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	145	Involved in binding to CCT complex.		Q -> H (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.Q145fs*12(1)|p.Q145fs*30(1)|p.G144fs*14(1)|p.Q145H(1)|p.G144fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGTTGACGGACAGCCTATTTT	0.418		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				54	107	---	---	---	---	PASS
TRIM71	131405	broad.mit.edu	37	3	32933360	32933360	+	3'UTR	SNP	C	T	T	rs144286810	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32933360C>T	uc003cff.2	+	4						NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						ctctctctctctctctttctc	0.294													5	24	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36899166	36899166	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36899166C>T	uc003cgj.2	-	3	567	c.265G>A	c.(265-267)GGT>AGT	p.G89S		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	639					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TTGAATGAACCCTGGGACTTG	0.592													21	63	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52610715	52610715	+	Splice_Site	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52610715C>G	uc003des.2	-	22	3546	c.3534_splice	c.e22-1	p.R1178_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.R1178_splice|PBRM1_uc003der.2_Splice_Site_p.R1146_splice|PBRM1_uc003det.2_Splice_Site_p.R1193_splice|PBRM1_uc003deu.2_Splice_Site_p.R1193_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.R1178_splice|PBRM1_uc010hmk.1_Splice_Site_p.R1153_splice|PBRM1_uc003dey.2_Splice_Site_p.R1153_splice|PBRM1_uc003dez.1_Splice_Site_p.R1177_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTTTCAATTCTTGGGGAGGA	0.343			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								15	22	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123376191	123376191	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123376191T>A	uc003ego.2	-	24	4352	c.4070A>T	c.(4069-4071)TAT>TTT	p.Y1357F	MYLK_uc010hrr.2_5'UTR|MYLK_uc011bjv.1_Missense_Mutation_p.Y157F|MYLK_uc011bjw.1_Missense_Mutation_p.Y1357F|MYLK_uc003egp.2_Missense_Mutation_p.Y1288F|MYLK_uc003egq.2_Missense_Mutation_p.Y1357F|MYLK_uc003egr.2_Missense_Mutation_p.Y1288F|MYLK_uc003egs.2_Missense_Mutation_p.Y1181F	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1357	Actin-binding (calcium/calmodulin- insensitive) (By similarity).|Fibronectin type-III.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCCCCCATCATATGAGGAGCC	0.557													5	52	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126707544T>G	uc003ejg.2	+	1	43	c.39T>G	c.(37-39)GGT>GGG	p.G13G		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.567													6	22	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129276046	129276046	+	Silent	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129276046G>T	uc003emx.2	-	34	5566	c.5466C>A	c.(5464-5466)CTC>CTA	p.L1822L	PLXND1_uc003emw.2_5'UTR|PLXND1_uc011blb.1_Silent_p.L491L	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1822	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGGCGTAGAGGAGCTTGTTGG	0.557													25	64	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145799589	145799589	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145799589A>T	uc003evs.1	-	12	1800	c.1294T>A	c.(1294-1296)TTG>ATG	p.L432M	PLOD2_uc003evq.1_Missense_Mutation_p.L92M|PLOD2_uc011bnm.1_Missense_Mutation_p.L377M|PLOD2_uc003evr.1_Missense_Mutation_p.L432M	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	432					protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	TCAGGACTCAATGCTCCCCAG	0.388													13	49	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157031465	157031465	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157031465C>T	uc003fbj.1	-	11	2272	c.1955G>A	c.(1954-1956)GGG>GAG	p.G652E	VEPH1_uc003fbk.1_Missense_Mutation_p.G652E|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	652						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTGAGCACCCCCTGCCTGGGT	0.488													17	70	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	172060897	172060897	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172060897T>G	uc003fhy.2	+	18	2240	c.2068T>G	c.(2068-2070)TTA>GTA	p.L690V	FNDC3B_uc003fhz.3_Missense_Mutation_p.L690V	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	690	Fibronectin type-III 5.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGAAGTCCACTTAGAGTGGGG	0.438													19	23	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			11	69	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8588871	8588871	+	Silent	SNP	G	A	A	rs148589120		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8588871G>A	uc003glk.2	+	3	1292	c.873G>A	c.(871-873)CCG>CCA	p.P291P	CPZ_uc003gll.2_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	291	Helical; Name=7; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						TGGCCGACCCGTTCACGTACT	0.667													12	27	---	---	---	---	PASS
LOC650293	650293	broad.mit.edu	37	4	8951518	8951518	+	Silent	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8951518G>T	uc011bwm.1	+	1	42	c.42G>T	c.(40-42)CTG>CTT	p.L14L		NM_001040071	NP_001035160	Q8NGT4	Q8NGT4_HUMAN	seven transmembrane helix receptor	14						integral to membrane	olfactory receptor activity				0						TCAGTATCCTGGCTGTCAGCT	0.582													3	9	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10446325	10446325	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10446325T>C	uc003gmn.2	-	3	2115	c.1628A>G	c.(1627-1629)AAG>AGG	p.K543R		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	543					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						CAATAAGCCCTTTTCTCCAGA	0.408													3	124	---	---	---	---	PASS
RBM46	166863	broad.mit.edu	37	4	155719349	155719349	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155719349A>G	uc003ioo.2	+	3	711	c.538A>G	c.(538-540)AAG>GAG	p.K180E	RBM46_uc011cim.1_Missense_Mutation_p.K180E|RBM46_uc003iop.1_Missense_Mutation_p.K180E	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	180	RRM 2.						nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2	all_hematologic(180;0.24)	Renal(120;0.0854)				TGCAACTGATAAGACCAAAAA	0.363													28	79	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187538911	187538911	+	Silent	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187538911C>A	uc003izf.2	-	10	9017	c.8829G>T	c.(8827-8829)ACG>ACT	p.T2943T		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2943	Extracellular (Potential).|Cadherin 27.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AATCAGCATCCGTGGTACTTA	0.388										HNSCC(5;0.00058)			13	108	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32000300	32000300	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000300G>A	uc003jhl.2	+	5	1565	c.1177G>A	c.(1177-1179)GTC>ATC	p.V393I	PDZD2_uc003jhm.2_Missense_Mutation_p.V393I|PDZD2_uc011cnx.1_Missense_Mutation_p.V219I	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	393	PDZ 2.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TCATTTACTGGTCGGGCTCTC	0.527													11	46	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43615986	43615986	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43615986C>T	uc003joe.2	+	4	673	c.418C>T	c.(418-420)CAT>TAT	p.H140Y	NNT_uc003jof.2_Missense_Mutation_p.H140Y	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	140	Mitochondrial matrix.				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	ATTAGGTGTTCATGAAGCTGA	0.343													27	76	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50685733	50685733	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50685733G>A	uc003jor.2	+	4	1280	c.732G>A	c.(730-732)AAG>AAA	p.K244K		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	244	Gln-rich.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TCATGATGAAGCAACTCCAGC	0.587													6	18	---	---	---	---	PASS
CHSY3	337876	broad.mit.edu	37	5	129520719	129520719	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129520719C>G	uc003kvd.2	+	3	1884	c.1884C>G	c.(1882-1884)ATC>ATG	p.I628M		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	628	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TTCCTCTCATCGGAAGGTATG	0.358													41	76	---	---	---	---	PASS
NDST1	3340	broad.mit.edu	37	5	149932854	149932854	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149932854T>C	uc003lsk.3	+	15	3111	c.2609T>C	c.(2608-2610)CTT>CCT	p.L870P	NDST1_uc011dcj.1_Missense_Mutation_p.L813P	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	870	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCAGACACTTCCCACTTGG	0.562													70	424	---	---	---	---	PASS
BNIP1	662	broad.mit.edu	37	5	172578593	172578593	+	Intron	SNP	A	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172578593A>T	uc003mcj.3	+						BNIP1_uc003mci.3_Missense_Mutation_p.I68F|BNIP1_uc003mck.3_Missense_Mutation_p.I68F|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAGGGCATTTATTTGGACTGC	0.279													18	93	---	---	---	---	PASS
N4BP3	23138	broad.mit.edu	37	5	177547632	177547632	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177547632C>G	uc003mik.1	+	3	1031	c.784C>G	c.(784-786)CTG>GTG	p.L262V	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	262						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGAGCCGTGCTGCCCGAGAC	0.662													3	48	---	---	---	---	PASS
SOX4	6659	broad.mit.edu	37	6	21595027	21595027	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21595027G>A	uc003ndi.2	+	1	1056	c.262G>A	c.(262-264)GAG>AAG	p.E88K		NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	88	HMG box.				canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GCACAACGCCGAGATCTCCAA	0.607													5	10	---	---	---	---	PASS
NEU1	4758	broad.mit.edu	37	6	31828358	31828358	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31828358C>T	uc003nxq.3	-	4	812	c.656G>A	c.(655-657)GGC>GAC	p.G219D	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_RNA|NEU1_uc010jth.2_Missense_Mutation_p.G50D|NEU1_uc003nxs.3_Missense_Mutation_p.G219D	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	219			G -> A (in SIALIDOSIS; type 1; unable to reach the lysosomes).			cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	CGTCCCATGGCCACACACGAT	0.627													31	126	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31910854	31910854	+	5'Flank	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31910854C>T	uc003nyj.3	+						C2_uc003nyc.2_Silent_p.H233H|C2_uc011doo.1_Silent_p.H200H|C2_uc011dop.1_Silent_p.H232H|C2_uc003nyf.2_Silent_p.H446H|C2_uc010jtk.2_Silent_p.H314H|C2_uc011doq.1_Silent_p.H417H|C2_uc003nyg.2_Silent_p.H223H|CFB_uc011dor.1_Silent_p.H293H|C2_uc003nyh.1_Silent_p.H97H|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						AGGCTCTGCACCAGGTCTTTG	0.567													6	327	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146720724	146720724	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720724T>G	uc010khw.1	+	8	3019	c.2549T>G	c.(2548-2550)TTC>TGC	p.F850C	GRM1_uc010khv.1_Missense_Mutation_p.F850C|GRM1_uc003qll.2_Missense_Mutation_p.F850C|GRM1_uc011edz.1_Missense_Mutation_p.F850C|GRM1_uc011eea.1_Missense_Mutation_p.F850C	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	850	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CGCAGTGCCTTCACCACCTCT	0.527													4	56	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28610069	28610069	+	Silent	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28610069C>T	uc003szq.2	+	5	768	c.378C>T	c.(376-378)GAC>GAT	p.D126D	CREB5_uc003szo.2_Silent_p.D93D|CREB5_uc003szr.2_Silent_p.D119D	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	126					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						CCAACCATGACACCAACGTTG	0.587													8	75	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92734661	92734661	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92734661G>A	uc003umf.2	-	3	1006	c.750C>T	c.(748-750)ATC>ATT	p.I250I	SAMD9_uc003umg.2_Silent_p.I250I	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	250						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGGTGACTTTGATGCCAACAA	0.388													13	128	---	---	---	---	PASS
POP7	10248	broad.mit.edu	37	7	100304462	100304462	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100304462A>C	uc003uwh.3	+	2	271	c.9A>C	c.(7-9)GAA>GAC	p.E3D		NM_005837	NP_005828	O75817	POP7_HUMAN	processing of precursor 7	3					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity			ovary(1)	1	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCATGGCAGAAAACCGAGAGC	0.597													38	109	---	---	---	---	PASS
DLD	1738	broad.mit.edu	37	7	107556003	107556003	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107556003G>C	uc003vet.2	+	9	847	c.737G>C	c.(736-738)GGT>GCT	p.G246A	DLD_uc010ljm.1_RNA|DLD_uc011kmg.1_Missense_Mutation_p.G198A|DLD_uc011kmh.1_Missense_Mutation_p.G223A|DLD_uc011kmi.1_Missense_Mutation_p.G147A	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	246					branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	GAATTTTTAGGTCATGTAGGT	0.328													17	121	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127255616	127255616	+	5'UTR	SNP	A	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127255616A>C	uc010lld.1	-	1					PAX4_uc003vmf.2_5'UTR|PAX4_uc003vmg.1_Intron|PAX4_uc003vmh.2_5'UTR	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4						cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TCCACACACCACCTCTCCCAC	0.642													9	51	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134889161	134889161	+	Silent	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134889161A>G	uc003vsp.2	-	6	812	c.750T>C	c.(748-750)AAT>AAC	p.N250N	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	250										breast(2)|ovary(1)|skin(1)	4						AGAGGGAGGCATTCCTTTGGC	0.587													9	30	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67546928	67546928	+	Silent	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67546928T>C	uc003xwn.2	-	3	3736	c.3477A>G	c.(3475-3477)GAA>GAG	p.E1159E		NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	1159					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AAGGAAAAGATTCAGGCAAAC	0.433													39	128	---	---	---	---	PASS
OSGIN2	734	broad.mit.edu	37	8	90937536	90937536	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90937536A>G	uc003yeg.2	+	6	1640	c.1294A>G	c.(1294-1296)AAG>GAG	p.K432E	OSGIN2_uc003yeh.2_Missense_Mutation_p.K476E	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	432					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			CCTAGGCCATAAGTCAAGCCA	0.388													40	161	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118147534	118147534	+	Translation_Start_Site	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118147534C>T	uc003yoh.2	+	1	198	c.-32C>T	c.(-34--30)AACGA>AATGA		SLC30A8_uc010mcz.2_Intron|SLC30A8_uc011lia.1_Translation_Start_Site|SLC30A8_uc003yog.2_Translation_Start_Site	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8						insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCAACAACAACGACAACAACA	0.388													39	101	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141712777	141712777	+	Silent	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141712777G>T	uc003yvu.2	-	25	2489	c.2259C>A	c.(2257-2259)ATC>ATA	p.I753I	PTK2_uc011ljp.1_Silent_p.I61I|PTK2_uc003yvo.2_Silent_p.I381I|PTK2_uc011ljq.1_Silent_p.I448I|PTK2_uc003yvp.2_Silent_p.I421I|PTK2_uc003yvq.2_Silent_p.I279I|PTK2_uc003yvr.2_Silent_p.I693I|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Silent_p.I775I|PTK2_uc003yvv.2_Silent_p.I653I|PTK2_uc011ljr.1_Silent_p.I753I	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	753	Interaction with TGFB1I1.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CCATGGCTGTGATTCCATGTG	0.473													15	75	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144941623	144941623	+	Silent	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144941623C>A	uc003zaa.1	-	1	5812	c.5799G>T	c.(5797-5799)GCG>GCT	p.A1933A		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1933	Plectin 32.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCGGCCTGCGCCTCCAGCA	0.662													15	58	---	---	---	---	PASS
KIAA1432	57589	broad.mit.edu	37	9	5763502	5763502	+	Silent	SNP	G	A	A	rs149258225		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5763502G>A	uc003zji.2	+	18	2331	c.2238G>A	c.(2236-2238)CAG>CAA	p.Q746Q	KIAA1432_uc003zjh.2_Silent_p.Q746Q|KIAA1432_uc003zjl.3_Silent_p.Q709Q|KIAA1432_uc003zjj.1_Silent_p.Q288Q	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	825						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GAACCTCTCAGATCTACCTCC	0.478													13	92	---	---	---	---	PASS
IFNA14	3448	broad.mit.edu	37	9	21239700	21239700	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21239700C>A	uc010mis.2	-	1	279	c.235G>T	c.(235-237)GTC>TTC	p.V79F	IFNA14_uc003zoo.1_RNA	NM_002172	NP_002163	P01570	IFN14_HUMAN	interferon, alpha 14 precursor	79					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCATGGAGGACAGAGATGGCT	0.458													24	87	---	---	---	---	PASS
GALT	2592	broad.mit.edu	37	9	34649524	34649524	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34649524T>C	uc003zve.2	+	10	1089	c.1022T>C	c.(1021-1023)ATG>ACG	p.M341T	GALT_uc003zvf.2_Missense_Mutation_p.M232T|GALT_uc003zvg.2_Missense_Mutation_p.M213T|GALT_uc003zvh.2_Missense_Mutation_p.M293T|IL11RA_uc003zvi.2_5'Flank|IL11RA_uc011loq.1_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	341					galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GGCTACGAAATGCTTGCTCAG	0.577									Galactosemia				9	78	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96859671	96859671	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96859671C>T	uc004auf.1	+	7	1001	c.661C>T	c.(661-663)CGG>TGG	p.R221W	PTPDC1_uc004aug.1_Missense_Mutation_p.R221W|PTPDC1_uc004auh.1_Missense_Mutation_p.R273W|PTPDC1_uc010mrj.1_Missense_Mutation_p.R275W|PTPDC1_uc010mri.1_Missense_Mutation_p.R273W	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	221	Tyrosine-protein phosphatase.						protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						TATATTTGTGCGGGCAAAGCG	0.418													11	64	---	---	---	---	PASS
DNAJC25	548645	broad.mit.edu	37	9	114411754	114411754	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114411754T>C	uc004bfl.2	+	3	567	c.511T>C	c.(511-513)TAC>CAC	p.Y171H	DNAJC25-GNG10_uc004bfn.2_Intron|DNAJC25_uc004bfm.2_Missense_Mutation_p.Y49H	NM_001015882	NP_001015882	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	171					protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0						GTGGAATAGCTACAATAAGGC	0.398													10	10	---	---	---	---	PASS
ZNF883	169834	broad.mit.edu	37	9	115759684	115759684	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115759684T>G	uc011lwy.1	-	5	2095	c.856A>C	c.(856-858)ATT>CTT	p.I286L		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	286	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAAGAATGAATTTTTAGATGT	0.378													61	131	---	---	---	---	PASS
OLFML2A	169611	broad.mit.edu	37	9	127549409	127549409	+	Silent	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127549409G>T	uc004bov.2	+	2	359	c.246G>T	c.(244-246)TCG>TCT	p.S82S	OLFML2A_uc010mwr.1_Silent_p.S82S	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	82											0						CTGTGAGCTCGGGCACTGACT	0.627													3	40	---	---	---	---	PASS
ASS1	445	broad.mit.edu	37	9	133364742	133364742	+	Silent	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133364742C>A	uc004bzm.2	+	13	1217	c.861C>A	c.(859-861)GGC>GGA	p.G287G	ASS1_uc004bzn.2_Silent_p.G287G|ASS1_uc010mza.2_Silent_p.G363G|ASS1_uc004bzo.2_Silent_p.G268G|ASS1_uc010mzb.2_Silent_p.G325G|ASS1_uc004bzp.2_Silent_p.G287G|ASS1_uc010mzc.2_Silent_p.G287G	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	287					arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CCCCAGCAGGCACCATCCTTT	0.488													8	133	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49459680	49459680	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49459680G>C	uc001jgi.2	-	2	187	c.80C>G	c.(79-81)GCT>GGT	p.A27G	FRMPD2_uc001jgh.2_Missense_Mutation_p.A18G|FRMPD2_uc001jgj.2_Missense_Mutation_p.A27G	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	27	KIND.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CTCAGACAGAGCTTCACCCCT	0.572													14	34	---	---	---	---	PASS
IFIT2	3433	broad.mit.edu	37	10	91066668	91066668	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91066668G>T	uc009xts.2	+	2	1130	c.955G>T	c.(955-957)GCT>TCT	p.A319S	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron	NM_001547	NP_001538	P09913	IFIT2_HUMAN	interferon-induced protein with	319					negative regulation of protein binding|response to virus|type I interferon-mediated signaling pathway		protein binding			ovary(1)|skin(1)	2		Colorectal(252;0.0161)				AATAGGACACGCTGTGGCTCA	0.433													19	74	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5444324	5444324	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5444324C>A	uc010qzd.1	+	1	894	c.894C>A	c.(892-894)AAC>AAA	p.N298K	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGTAAAGAACAAGCAGATCC	0.423													4	62	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	67017906	67017906	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67017906C>T	uc001ojw.2	+	17	3269	c.2405C>T	c.(2404-2406)ACG>ATG	p.T802M	KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Missense_Mutation_p.T496M|KDM2A_uc010rpn.1_Missense_Mutation_p.T363M|KDM2A_uc001ojz.1_Missense_Mutation_p.T260M|KDM2A_uc001oka.2_5'Flank	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	802					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						CTCACTGTCACGCTACAGAGG	0.582													17	70	---	---	---	---	PASS
MRE11A	4361	broad.mit.edu	37	11	94169018	94169018	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94169018G>A	uc001peu.2	-	18	2163	c.1974C>T	c.(1972-1974)ACC>ACT	p.T658T	MRE11A_uc001pev.2_Silent_p.T630T|MRE11A_uc009ywj.2_Silent_p.T661T	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1	658					DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				TCTTTGAAGTGGTAGGAAAAA	0.338								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				25	69	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117647629	117647629	+	Silent	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117647629G>T	uc001prh.1	-	3	570	c.568C>A	c.(568-570)CGG>AGG	p.R190R	DSCAML1_uc001pri.1_5'UTR	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	130	Extracellular (Potential).|Ig-like C2-type 2.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TCCTCCACCCGGACGGTGTAG	0.532													13	45	---	---	---	---	PASS
PVRL1	5818	broad.mit.edu	37	11	119535865	119535865	+	Silent	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119535865C>T	uc001pwv.2	-	6	1318	c.1146G>A	c.(1144-1146)CGG>CGA	p.R382R	PVRL1_uc001pwu.1_Intron	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1	382	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		TGAAGGTGTGCCGGCGCCGAC	0.657													5	125	---	---	---	---	PASS
KLRD1	3824	broad.mit.edu	37	12	10467364	10467364	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10467364G>A	uc001qxw.3	+	7	709	c.512G>A	c.(511-513)CGT>CAT	p.R171H	KLRD1_uc001qxx.3_Missense_Mutation_p.R171H|KLRD1_uc001qxy.3_Missense_Mutation_p.R140H|KLRD1_uc009zhh.2_Missense_Mutation_p.R150H|KLRD1_uc009zhi.2_3'UTR|KLRD1_uc001qxz.3_Missense_Mutation_p.R172H	NM_001114396	NP_001107868	Q13241	KLRD1_HUMAN	killer cell lectin-like receptor subfamily D,	171	Extracellular (Potential).|C-type lectin.				cell surface receptor linked signaling pathway|regulation of immune response	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						GATAAAAATCGTTATATCTGT	0.333													7	92	---	---	---	---	PASS
RACGAP1P	83956	broad.mit.edu	37	12	45458035	45458035	+	RNA	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45458035C>A	uc001rol.2	-	1		c.1160G>T				NR_026583				Homo sapiens FKSG42 (FKSG42) mRNA, complete cds.												0						ATCTCATTTACACAATGCACA	0.473													10	33	---	---	---	---	PASS
SARNP	84324	broad.mit.edu	37	12	56211496	56211496	+	Translation_Start_Site	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56211496C>A	uc001sht.2	-	1	45	c.-10G>T	c.(-12--8)GAGGG>GATGG		SARNP_uc009zoa.2_RNA|SARNP_uc001shs.3_RNA|DNAJC14_uc001shu.1_Intron|SARNP_uc001shv.3_Translation_Start_Site|ORMDL2_uc001shw.1_5'Flank	NM_033082	NP_149073	P82979	SARNP_HUMAN	cytokine induced protein 29 kDa						regulation of transcription, DNA-dependent|regulation of translation|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding				0						CTTGTTACCCCTCACTCCACT	0.577													4	74	---	---	---	---	PASS
MYF6	4618	broad.mit.edu	37	12	81101888	81101888	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81101888G>A	uc001szf.1	+	1	443	c.390G>A	c.(388-390)AAG>AAA	p.K130K		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	130	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						GGCTGCCCAAGGTGGAGATTC	0.617													6	93	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81647354	81647354	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81647354C>T	uc001szl.1	+	15	1991	c.1900C>T	c.(1900-1902)CGA>TGA	p.R634*	ACSS3_uc001szm.1_Nonsense_Mutation_p.R633*|ACSS3_uc001szn.1_Nonsense_Mutation_p.R316*	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	634						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GGCTGCTTTTCGAAATGCAGT	0.428													14	92	---	---	---	---	PASS
ISCU	23479	broad.mit.edu	37	12	108960983	108960983	+	Silent	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108960983T>C	uc010sxc.1	+	4	462	c.357T>C	c.(355-357)ACT>ACC	p.T119T	ISCU_uc010sxa.1_Silent_p.T119T|ISCU_uc010sxb.1_Silent_p.T119T|ISCU_uc001tnc.3_Silent_p.T94T|ISCU_uc009zuy.2_Silent_p.T94T|ISCU_uc010sxd.1_Silent_p.T119T	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform	119					iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						AAGCCTTGACTATCAAAAACA	0.483													9	63	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33294008	33294008	+	3'UTR	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33294008C>A	uc001wrq.2	+	13						NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCATGAAAATCATCTCACTGA	0.383													21	53	---	---	---	---	PASS
HIF1A	3091	broad.mit.edu	37	14	62187224	62187224	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62187224C>A	uc001xfq.2	+	2	564	c.160C>A	c.(160-162)CTT>ATT	p.L54I	HIF1A_uc010tsc.1_Intron|HIF1A_uc001xfr.2_Missense_Mutation_p.L54I|HIF1A_uc001xfs.2_Missense_Mutation_p.L55I	NM_001530	NP_001521	Q16665	HIF1A_HUMAN	hypoxia-inducible factor 1, alpha subunit	54	Interaction with TSGA10 (By similarity).|Helix-loop-helix motif.				cellular response to hypoxia|collagen metabolic process|connective tissue replacement involved in inflammatory response wound healing|elastin metabolic process|epithelial to mesenchymal transition|oxygen homeostasis|positive regulation of chemokine production|positive regulation of epithelial cell migration|positive regulation of hormone biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|regulation of transforming growth factor-beta2 production	cytoplasm|nucleolus|transcription factor complex	histone acetyltransferase binding|Hsp90 protein binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			kidney(3)|lung(1)	4				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)		GAGTTCGCATCTTGATAAGGC	0.433													13	78	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70633462	70633462	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70633462C>T	uc001xly.2	-	2	2432	c.1678G>A	c.(1678-1680)GGT>AGT	p.G560S	SLC8A3_uc001xlw.2_Missense_Mutation_p.G560S|SLC8A3_uc001xlx.2_Missense_Mutation_p.G560S|SLC8A3_uc001xlz.2_Missense_Mutation_p.G560S|SLC8A3_uc010ara.2_RNA	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	560	Calx-beta 2.|Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATGACTGTACCCCGGGCACCT	0.483													9	61	---	---	---	---	PASS
NGB	58157	broad.mit.edu	37	14	77733013	77733013	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77733013T>A	uc001xtg.1	-	4	697	c.322A>T	c.(322-324)ACA>TCA	p.T108S		NM_021257	NP_067080	Q9NPG2	NGB_HUMAN	neuroglobin	108	Globin.					hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		TCACCCACTGTCTGCAGAGGC	0.453													10	38	---	---	---	---	PASS
SLC12A6	9990	broad.mit.edu	37	15	34547536	34547536	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34547536A>G	uc001zhw.2	-	7	967	c.803T>C	c.(802-804)GTT>GCT	p.V268A	SLC12A6_uc001zhv.2_Missense_Mutation_p.V217A|SLC12A6_uc001zhx.2_Missense_Mutation_p.V253A|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.V209A|SLC12A6_uc001zib.2_Missense_Mutation_p.V259A|SLC12A6_uc001zic.2_Missense_Mutation_p.V268A|SLC12A6_uc010bau.2_Missense_Mutation_p.V268A|SLC12A6_uc001zid.2_Missense_Mutation_p.V209A|SLC12A6_uc001zhu.2_Missense_Mutation_p.V80A	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	268					angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	GCAGAGGCCAACAGCCCCACC	0.448													27	90	---	---	---	---	PASS
DUOXA2	405753	broad.mit.edu	37	15	45408398	45408398	+	Silent	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45408398C>T	uc001zuo.2	+	3	562	c.282C>T	c.(280-282)CGC>CGT	p.R94R	DUOX2_uc010bea.2_5'Flank|DUOX2_uc001zun.2_5'Flank|DUOXA2_uc010beb.2_RNA	NM_207581	NP_997464	Q1HG44	DOXA2_HUMAN	dual oxidase activator 2	94	Extracellular (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane					0		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCGCAGCGCGCGTTACAGCCC	0.567													20	174	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053142	85053142	+	RNA	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053142C>T	uc002bkm.2	-	9		c.1905G>A			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						TTTTTCAATTCCTTGACCCGC	0.393													4	18	---	---	---	---	PASS
RLBP1	6017	broad.mit.edu	37	15	89760467	89760467	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89760467C>T	uc002bnl.2	-	5	610	c.230G>A	c.(229-231)GGG>GAG	p.G77E		NM_000326	NP_000317	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	77					response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity			central_nervous_system(1)	1	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	CAGCTCCTCCCCCGAGGCCGC	0.662													17	75	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19640036	19640036	+	Silent	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19640036C>T	uc002dgn.1	+	17	1473	c.1461C>T	c.(1459-1461)AAC>AAT	p.N487N	C16orf62_uc002dgo.1_Silent_p.N420N|C16orf62_uc002dgp.1_Silent_p.N236N	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	487						integral to membrane				ovary(1)	1						AGATTCTCAACGAAGCTTGGA	0.343													5	133	---	---	---	---	PASS
RABEP2	79874	broad.mit.edu	37	16	28916205	28916205	+	3'UTR	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28916205T>C	uc002drq.2	-	13					uc010vct.1_Intron|RABEP2_uc010vdf.1_3'UTR|RABEP2_uc010byn.2_3'UTR	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2						endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3						CGAGGCCTCATGGTTCAGGAG	0.657													5	9	---	---	---	---	PASS
LLGL1	3996	broad.mit.edu	37	17	18135884	18135884	+	Silent	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18135884C>T	uc002gsp.2	+	3	316	c.255C>T	c.(253-255)ACC>ACT	p.T85T		NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1	85	WD 2.				cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					ACTTCTTGACCGGCCAGGTGA	0.592													7	24	---	---	---	---	PASS
SMCR8	140775	broad.mit.edu	37	17	18220787	18220787	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18220787A>C	uc002gsy.3	+	1	2194	c.1684A>C	c.(1684-1686)AGT>CGT	p.S562R		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	562										central_nervous_system(1)	1						GGCAAGCATCAGTCCTCCAGA	0.493													62	188	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	T	T	rs425487	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274415C>T	uc002hvz.2	-	1	192	c.153G>A	c.(151-153)AGG>AGA	p.R51R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667													4	52	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61559982	61559982	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61559982C>T	uc002jau.1	+	8	1296	c.1274C>T	c.(1273-1275)GCG>GTG	p.A425V	ACE_uc010wpi.1_Missense_Mutation_p.A425V|ACE_uc010ddu.1_Missense_Mutation_p.A242V|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	425	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GACGTGCTGGCGCTCTCGGTC	0.622													34	130	---	---	---	---	PASS
ARSG	22901	broad.mit.edu	37	17	66303656	66303656	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66303656G>C	uc002jhc.2	+	2	818	c.22G>C	c.(22-24)GTT>CTT	p.V8L	ARSG_uc002jhb.1_Intron	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor	8					sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTTCTAAAGGTTTTGTTGGC	0.458													21	107	---	---	---	---	PASS
SS18	6760	broad.mit.edu	37	18	23619298	23619298	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23619298T>C	uc002kvm.2	-	6	808	c.730A>G	c.(730-732)ATG>GTG	p.M244V	SS18_uc002kvn.2_Missense_Mutation_p.M244V|SS18_uc010xbf.1_Missense_Mutation_p.M162V|SS18_uc010xbg.1_Missense_Mutation_p.M192V|SS18_uc010xbh.1_Missense_Mutation_p.M192V|SS18_uc010xbi.1_Missense_Mutation_p.M221V|SS18_uc010dlz.1_Missense_Mutation_p.M192V	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	244	Gln-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					TGACCCATCATATGATTGCCT	0.428			T	SSX1| SSX2	synovial sarcoma								53	134	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50994332	50994332	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50994332C>A	uc002lfe.1	+	25	4275	c.3688C>A	c.(3688-3690)CCC>ACC	p.P1230T	DCC_uc010dpf.1_Missense_Mutation_p.P865T	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	1230	Cytoplasmic (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACGCCGAGCCCCCCGGGCCAA	0.507													9	47	---	---	---	---	PASS
ZNF563	147837	broad.mit.edu	37	19	12433468	12433468	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12433468G>A	uc002mtp.2	-	2	299	c.61C>T	c.(61-63)CTG>TTG	p.L21L	ZNF563_uc002mtq.2_Silent_p.L21L	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	21	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GATGGACCCAGCAAAGCCCAT	0.448													4	120	---	---	---	---	PASS
ZNF793	390927	broad.mit.edu	37	19	38027920	38027920	+	Silent	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38027920G>A	uc010efm.2	+	8	802	c.360G>A	c.(358-360)GGG>GGA	p.G120G	ZNF793_uc010xts.1_Silent_p.G120G|ZNF793_uc010efo.2_Silent_p.G120G	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAAGTTTGGGAAAATATCAC	0.408													3	27	---	---	---	---	PASS
CEACAM3	1084	broad.mit.edu	37	19	42301589	42301589	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42301589G>A	uc002orn.1	+	2	209	c.133G>A	c.(133-135)GTC>ATC	p.V45I	CEACAM3_uc010eia.1_Missense_Mutation_p.V45I|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion	45	Ig-like V-type.|Extracellular (Potential).					integral to membrane				skin(1)	1						GCCGCTCAGTGTCGCAGAGGG	0.517													33	85	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55176277	55176277	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55176277C>T	uc002qgp.2	+	5	1045	c.683C>T	c.(682-684)CCC>CTC	p.P228L	LILRB4_uc002qgq.2_Missense_Mutation_p.P228L|LILRB4_uc010ers.1_Missense_Mutation_p.P141L|LILRB4_uc002qgr.2_Missense_Mutation_p.P269L|LILRB4_uc010ert.2_Missense_Mutation_p.P269L|LILRB4_uc010eru.2_Missense_Mutation_p.P257L	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	228	Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		AGGCCCTCACCCACAAGGTCC	0.557													4	17	---	---	---	---	PASS
MYLK2	85366	broad.mit.edu	37	20	30418677	30418677	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30418677T>G	uc002wwq.2	+	9	1382	c.1280T>G	c.(1279-1281)TTT>TGT	p.F427C	MYLK2_uc002wws.2_Missense_Mutation_p.F44C|MYLK2_uc010gdw.1_5'Flank	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	427	Protein kinase.				cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATCATTGACTTTGGCCTGGCA	0.617													65	179	---	---	---	---	PASS
APOL5	80831	broad.mit.edu	37	22	36123236	36123236	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36123236C>G	uc003aof.2	+	3	1121	c.1121C>G	c.(1120-1122)CCA>CGA	p.P374R		NM_030642	NP_085145	Q9BWW9	APOL5_HUMAN	apolipoprotein L5	374					lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding				0						GTGGTTAAACCAGAAGGTAGG	0.597													16	59	---	---	---	---	PASS
PRKX	5613	broad.mit.edu	37	X	3544459	3544459	+	Splice_Site	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3544459C>A	uc010nde.2	-	5	1182	c.815_splice	c.e5+1	p.K272_splice		NM_005044	NP_005035	P51817	PRKX_HUMAN	protein kinase, X-linked								ATP binding|cAMP-dependent protein kinase activity			skin(2)|lung(1)	3		all_lung(23;0.000396)|Lung NSC(23;0.00123)				GGTTTACTTACTTTACATGGA	0.378													3	61	---	---	---	---	PASS
FAM9B	171483	broad.mit.edu	37	X	9000447	9000447	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9000447C>G	uc011mhu.1	-	2	173	c.84G>C	c.(82-84)AGG>AGC	p.R28S	FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Missense_Mutation_p.R73S	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	28						nucleus					0		Hepatocellular(5;0.219)				CATCTTCCTCCCTTGTTTCTG	0.408													7	293	---	---	---	---	PASS
DUSP21	63904	broad.mit.edu	37	X	44703517	44703517	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44703517C>T	uc004dgd.2	+	1	269	c.139C>T	c.(139-141)CGC>TGC	p.R47C		NM_022076	NP_071359	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	47	Tyrosine-protein phosphatase.|Sufficient for mitochondrial localization (By similarity).					cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			large_intestine(1)|lung(1)	2						GTCCAGCAATCGCATCACCGC	0.522													24	94	---	---	---	---	PASS
SPIN3	169981	broad.mit.edu	37	X	57020876	57020876	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57020876C>G	uc010nkj.2	-	2	791	c.505G>C	c.(505-507)GAT>CAT	p.D169H	SPIN3_uc004duu.3_Intron|SPIN3_uc004duw.3_Intron|SPIN3_uc004duv.3_Intron|SPIN3_uc004dux.1_Missense_Mutation_p.D169H	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	169					gamete generation					ovary(1)|central_nervous_system(1)	2						AATACAGGATCTTTCTCATAG	0.423													23	144	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73961521	73961521	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73961521T>A	uc004eby.2	-	3	3488	c.2871A>T	c.(2869-2871)CAA>CAT	p.Q957H		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	957					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						CAGATGGGAGTTGGGTATCTT	0.433													51	152	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91134206	91134206	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91134206C>A	uc004efk.1	+	2	3812	c.2967C>A	c.(2965-2967)TAC>TAA	p.Y989*	PCDH11X_uc004efl.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc004efo.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc010nmv.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc004efm.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc004efn.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc004efh.1_Nonsense_Mutation_p.Y989*|PCDH11X_uc004efj.1_Nonsense_Mutation_p.Y989*	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	989	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CAGATCCCTACAGCGTTTCTG	0.483													5	203	---	---	---	---	PASS
TMEM31	203562	broad.mit.edu	37	X	102968576	102968576	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102968576C>T	uc004elh.2	+	3	348	c.157C>T	c.(157-159)CGA>TGA	p.R53*	GLRA4_uc011mse.1_Missense_Mutation_p.D319N	NM_182541	NP_872347	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	53						integral to membrane					0						ATCCAGATGTCGATTGCCTTC	0.473													10	73	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117700143	117700143	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117700143A>T	uc004eqp.2	+	8	932	c.869A>T	c.(868-870)CAA>CTA	p.Q290L	DOCK11_uc004eqq.2_Missense_Mutation_p.Q56L	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	290					blood coagulation	cytosol	GTP binding			ovary(3)	3						GAAACAGCACAAGGTCAGAAT	0.368													39	98	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117819736	117819736	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117819736G>A	uc004eqp.2	+	53	6251	c.6188G>A	c.(6187-6189)CGA>CAA	p.R2063Q	DOCK11_uc004eqq.2_Missense_Mutation_p.R1842Q	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	2063					blood coagulation	cytosol	GTP binding			ovary(3)	3						TCAAGTGACCGAGGTTATGGT	0.403													55	145	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130409627	130409627	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130409627G>T	uc004ewd.2	-	16	3247	c.3009C>A	c.(3007-3009)CAC>CAA	p.H1003Q	IGSF1_uc004ewe.3_Missense_Mutation_p.H997Q|IGSF1_uc004ewf.2_Missense_Mutation_p.H983Q	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	1003	Extracellular (Potential).|Ig-like C2-type 10.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						CTCCTTCTTTGTGCAGAATGT	0.527													12	159	---	---	---	---	PASS
MMGT1	93380	broad.mit.edu	37	X	135047254	135047254	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135047254A>T	uc004ezi.1	-	4	625	c.325T>A	c.(325-327)TCT>ACT	p.S109T	MMGT1_uc011mvw.1_Missense_Mutation_p.S174T	NM_173470	NP_775741	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1 precursor	109	Cytoplasmic (Potential).					early endosome membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	magnesium ion transmembrane transporter activity				0						TGGTTTGAAGAATTTGCTGTA	0.363													42	316	---	---	---	---	PASS
NAA10	8260	broad.mit.edu	37	X	153197360	153197360	+	Intron	SNP	C	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153197360C>T	uc004fjm.1	-						NAA10_uc004fjn.1_Intron|NAA10_uc011mzg.1_3'UTR	NM_003491	NP_003482	P41227	NAA10_HUMAN	alpha-N-acetyltransferase 1A						DNA packaging|internal protein amino acid acetylation|N-terminal protein amino acid acetylation	cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)	1						AACCATCAGCCGCCGAGTGAA	0.622													3	7	---	---	---	---	PASS
IFI6	2537	broad.mit.edu	37	1	27992800	27992801	+	3'UTR	INS	-	AAA	AAA	rs79131386		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27992800_27992801insAAA	uc001boo.1	-	5					IFI6_uc001bon.1_3'UTR|IFI6_uc001bop.1_3'UTR	NM_002038	NP_002029	P09912	IFI6_HUMAN	interferon, alpha-inducible protein 6 isoform a						anti-apoptosis|negative regulation of caspase activity|negative regulation of mitochondrial depolarization|release of cytochrome c from mitochondria|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion	protein binding			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;7.75e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		gaacccatctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
DBT	1629	broad.mit.edu	37	1	100671629	100671630	+	Intron	DEL	AA	-	-	rs67751973		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100671629_100671630delAA	uc001dta.2	-						DBT_uc010oug.1_Intron	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase						branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		acttaaagttaaaaaaaaaaaa	0.134													4	3	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185881056	185881057	+	Intron	INS	-	AGG	AGG	rs139177533	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185881056_185881057insAGG	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TAGGTGTTTGTAGGTGTCTTGA	0.351													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																							ATAATGCACCAtgtgtgtgtgtgtgtgtgtgtgtgt	0.255													4	2	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236760425	236760426	+	Intron	INS	-	AAA	AAA	rs66463182		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236760425_236760426insAAA	uc001hyd.1	-							NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			tccatgtctccaaaaaaaaaaa	0.149													4	2	---	---	---	---	
GRHL1	29841	broad.mit.edu	37	2	10101687	10101687	+	Intron	DEL	T	-	-	rs138724700		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10101687delT	uc002raa.2	+						GRHL1_uc002rab.2_Intron|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GAATAAAAGATTTTTTTTTTA	0.363													6	4	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86701787	86701787	+	Intron	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86701787delA	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						actccatcccaaaaaaaaaaa	0.060													4	2	---	---	---	---	
STARD7	56910	broad.mit.edu	37	2	96852842	96852843	+	Intron	INS	-	A	A	rs78788674		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96852842_96852843insA	uc002svm.3	-						STARD7_uc002svl.2_Intron	NM_020151	NP_064536	Q9NQZ5	STAR7_HUMAN	START domain containing 7 precursor							mitochondrion					0						CTCTGTCTCAGAAAAAAAAAAA	0.406													6	3	---	---	---	---	
GULP1	51454	broad.mit.edu	37	2	189434250	189434251	+	Intron	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189434250_189434251insT	uc010fru.2	+						GULP1_uc002uqd.2_Intron|GULP1_uc010zfw.1_Intron|GULP1_uc002uqf.2_Intron|GULP1_uc002uqg.2_Intron|GULP1_uc002uqh.1_5'Flank	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing						apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			CCCCTGCACAGTTTTTTTTTTT	0.391													4	2	---	---	---	---	
ARMC9	80210	broad.mit.edu	37	2	232120982	232120982	+	Intron	DEL	T	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232120982delT	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GTGCTCACCCTTTTGGAGTCA	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGTGATCTTCTGC	0.577													6	7	---	---	---	---	
WDR52	55779	broad.mit.edu	37	3	113127853	113127854	+	Intron	INS	-	A	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113127853_113127854insA	uc003eae.1	-							NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2											central_nervous_system(1)	1						ACCAAAACAGCaaaaaaaaaaa	0.282													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161146872	161146873	+	IGR	DEL	AT	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161146872_161146873delAT								C3orf57 (57001 upstream) : OTOL1 (67723 downstream)																							TGGTGAAAAGATATATATATAT	0.342													6	3	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6998263	6998263	+	Intron	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6998263delA	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron|TBC1D14_uc010idh.2_Intron|TBC1D14_uc011bwh.1_5'Flank	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						GTCTTCCAGTAAAAAAAAAAA	0.224													8	4	---	---	---	---	
PI4K2B	55300	broad.mit.edu	37	4	25261982	25261983	+	Intron	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25261982_25261983insT	uc003grk.2	+						PI4K2B_uc011bxs.1_Intron	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				ATTTATGTTTGTTTTTTTTTTT	0.163													6	3	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25581118	25581121	+	Intron	DEL	TAAG	-	-	rs3834707		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25581118_25581121delTAAG	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TGTGGCTACCTAAGTGTTTTTTTA	0.373													6	3	---	---	---	---	
SMAP1	60682	broad.mit.edu	37	6	71508370	71508370	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71508370delA	uc003pfr.2	+	6	754	c.506delA	c.(505-507)GAAfs	p.E169fs	SMAP1_uc011dxy.1_RNA|SMAP1_uc003pfs.2_Frame_Shift_Del_p.E142fs|SMAP1_uc010kao.2_Frame_Shift_Del_p.E142fs|SMAP1_uc010kap.2_Frame_Shift_Del_p.E159fs	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating	169					regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						aaagaaaaggaaaaaaaaaag	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22813177	22813178	+	IGR	INS	-	C	C	rs145036723	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22813177_22813178insC								IL6 (41558 upstream) : TOMM7 (39076 downstream)																							TCCTAGATAAGCCCCTACACTC	0.337													3	3	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30872488	30872488	+	Intron	DEL	T	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30872488delT	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						tctttccttatttatctttag	0.005													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74105540	74105541	+	Intron	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74105540_74105541insT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						ttctttctttcttttttttttt	0.089													4	3	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100369720	100369721	+	Intron	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100369720_100369721insT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron|ZAN_uc011kke.1_5'Flank	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			cctctaaattcttttttttttt	0.257													6	3	---	---	---	---	
LUZP6	767558	broad.mit.edu	37	7	135614509	135614510	+	3'UTR	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135614509_135614510insT	uc003vte.3	-	4					LUZP6_uc010lmv.2_RNA	NM_145808	NP_665807	Q538Z0	LUZP6_HUMAN	myotrophin												0						CTCCAAAACAATTTTTTTTTTC	0.401													4	2	---	---	---	---	
BRAF	673	broad.mit.edu	37	7	140434620	140434621	+	Intron	INS	-	AAAG	AAAG	rs145368076	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140434620_140434621insAAAG	uc003vwc.3	-							NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	aaaagaaaaaaaaagaaagaaa	0.262		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				3	4	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139701401	139701402	+	Intron	INS	-	G	G	rs149093007	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139701401_139701402insG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGCTCTCCCGGGGGGGGGGC	0.545										HNSCC(7;0.00092)			4	2	---	---	---	---	
RASEF	158158	broad.mit.edu	37	9	85619330	85619331	+	Intron	INS	-	TTTATTCTATTA	TTTATTCTATTA			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85619330_85619331insTTTATTCTATTA	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						TATTCTATTATTTTAATCCACC	0.302													4	2	---	---	---	---	
SPTAN1	6709	broad.mit.edu	37	9	131337249	131337256	+	Intron	DEL	GTGTATGT	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131337249_131337256delGTGTATGT	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TGCTCTCTAGGTGTATGTGCTATTCTGT	0.471													3	4	---	---	---	---	
POLR3A	11128	broad.mit.edu	37	10	79770063	79770063	+	Intron	DEL	A	-	-	rs3832673		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770063delA	uc001jzn.2	-							NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			aaaaaaaaagaaaaaaaaaaa	0.179													4	2	---	---	---	---	
CAT	847	broad.mit.edu	37	11	34490058	34490058	+	Intron	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34490058delA	uc001mvm.2	+						CAT_uc001mvn.2_Intron	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase						hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	AAGAGAACTTAAAAAAAAAAA	0.393													4	2	---	---	---	---	
IFFO1	25900	broad.mit.edu	37	12	6658356	6658357	+	Intron	INS	-	A	A	rs143026912		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6658356_6658357insA	uc001qpd.1	-						IFFO1_uc001qoy.2_Intron|IFFO1_uc001qpa.1_5'Flank|IFFO1_uc001qpb.1_Intron|IFFO1_uc001qpe.1_Intron|IFFO1_uc010sfe.1_Intron|IFFO1_uc001qpf.1_Intron|IFFO1_uc001qoz.1_5'Flank|IFFO1_uc001qpc.1_Intron|IFFO1_uc001qpg.2_5'Flank	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2							intermediate filament					0						ATGACTCAACTAAAAAAAAAAA	0.426													4	2	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494515	49494516	+	Intron	INS	-	T	T	rs112884400		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494515_49494516insT	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						CAGCCCACttcttttttttttt	0.233													3	3	---	---	---	---	
ACCN2	41	broad.mit.edu	37	12	50453038	50453039	+	Intron	INS	-	C	C	rs144549190	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50453038_50453039insC	uc001rvw.2	+						ACCN2_uc001rvv.2_Intron|ACCN2_uc009zln.2_Intron|ACCN2_uc009zlo.2_Intron	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal						calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	CCACCCCCAAACCTGCCACTCA	0.614													2	5	---	---	---	---	
SPIC	121599	broad.mit.edu	37	12	101873596	101873597	+	Intron	INS	-	T	T	rs35835395		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101873596_101873597insT	uc001tid.2	+						SPIC_uc009zua.2_Intron|SPIC_uc010svp.1_Intron	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ttttttctttcttttttttttt	0.178													4	2	---	---	---	---	
CTDSPL2	51496	broad.mit.edu	37	15	44811330	44811330	+	Intron	DEL	T	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44811330delT	uc001ztr.2	+						CTDSPL2_uc001zts.2_Intron|CTDSPL2_uc001ztt.2_Intron|CTDSPL2_uc010bdv.2_Intron	NM_016396	NP_057480	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,								phosphoprotein phosphatase activity				0		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TTTTAGAAAGttttttttttt	0.259													4	3	---	---	---	---	
C16orf71	146562	broad.mit.edu	37	16	4788056	4788056	+	Intron	DEL	T	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4788056delT	uc002cxn.2	+							NM_139170	NP_631909	Q8IYS4	CP071_HUMAN	hypothetical protein LOC146562											central_nervous_system(1)	1						AACATGGTCCTTTTTTTTTTC	0.498													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32490382	32490382	+	IGR	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32490382delA								HERC2P4 (326508 upstream) : TP53TG3B (194459 downstream)																							ACAAGAGACCAGGGGGATAAG	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33395820	33395821	+	IGR	INS	-	CAG	CAG	rs144984499	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33395820_33395821insCAG								SLC6A10P (499357 upstream) : MIR1826 (569687 downstream)																							aataataataataataatTTTT	0.183													4	2	---	---	---	---	
NOB1	28987	broad.mit.edu	37	16	69785968	69785968	+	Intron	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69785968delA	uc002exs.2	-							NM_014062	NP_054781	Q9ULX3	NOB1_HUMAN	nin one binding protein							nucleus	metal ion binding|protein binding				0						actctatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C16orf46	123775	broad.mit.edu	37	16	81087883	81087883	+	Intron	DEL	C	-	-	rs62054595		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81087883delC	uc010chf.2	-							NM_001100873	NP_001094343	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 1												0						acaacaacaacaacaaaaaaa	0.264													9	5	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36374964	36374964	+	Intron	DEL	A	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36374964delA	uc010wdn.1	-						uc002hpx.2_Intron			Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		gtctcaaagtaaaaaaaaaaa	0.144													6	3	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593627	+	Intron	DEL	TT	-	-	rs144318990		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626_60593627delTT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTTT	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	109963	109963	+	Intron	DEL	G	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109963delG	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		atctgcctatgggggcatagt	0.000													4	2	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3094392	3094393	+	Intron	DEL	AC	-	-	rs71159041		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3094392_3094393delAC	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						AAAAAAAAAAACCACACAATGG	0.233													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59888802	59888803	+	Intron	INS	-	T	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59888802_59888803insT	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TACGTAGTTTCttttttttttt	0.262													6	3	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77737811	77737815	+	Intron	DEL	TTTTG	-	-	rs71338078		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77737811_77737815delTTTTG	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TCAGGGCAAtttttgttttgttttt	0.137													1	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													4	3	---	---	---	---	
C22orf28	51493	broad.mit.edu	37	22	32790101	32790102	+	Intron	INS	-	T	T	rs11396073		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32790101_32790102insT	uc003amm.2	-							NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						ACCCAGACttcttttttttttt	0.144													4	3	---	---	---	---	
IQSEC2	23096	broad.mit.edu	37	X	53352787	53352787	+	5'Flank	DEL	G	-	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53352787delG	uc004dsd.2	-							NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						GGCTGCTGGAGAAAAGGCTGT	0.507													4	2	---	---	---	---	
