Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SEC22B	9554	broad.mit.edu	37	1	145116104	145116104	+	3'UTR	SNP	T	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116104T>C	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						GCAGAGGCTTTCTCTGGGTGC	0.418													4	17	---	---	---	---	PASS
VANGL2	57216	broad.mit.edu	37	1	160395201	160395201	+	3'UTR	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160395201G>A	uc001fwb.1	+	9					VANGL2_uc001fwc.1_3'UTR	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2						apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGAAACTCTGGGGGGTCCTGA	0.532													24	19	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55523818	55523818	+	Intron	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55523818C>T	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc002ryt.2_5'UTR|CCDC88A_uc010fbw.2_Intron|CCDC88A_uc002ryu.2_Intron|CCDC88A_uc002rys.2_Intron|CCDC88A_uc002ryw.2_Intron|CCDC88A_uc010fby.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						AATCTTTTATCAGTCTAACAA	0.249													6	11	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604850	179604850	+	Silent	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604850C>T	uc010zfh.1	-	46	12821	c.12597G>A	c.(12595-12597)CAG>CAA	p.Q4199Q	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.Q4132Q|TTN_uc010zfj.1_Silent_p.Q4007Q|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGTACCTCCTGCACTTTCT	0.463													4	97	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52696199	52696199	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52696199C>A	uc003des.2	-	4	490	c.478G>T	c.(478-480)GAA>TAA	p.E160*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.E160*|PBRM1_uc003der.2_Nonsense_Mutation_p.E160*|PBRM1_uc003det.2_Nonsense_Mutation_p.E160*|PBRM1_uc003deu.2_Nonsense_Mutation_p.E160*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.E160*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.E160*|PBRM1_uc003dey.2_Nonsense_Mutation_p.E160*|PBRM1_uc003dez.1_Nonsense_Mutation_p.E160*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.E58*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	160			E -> A (found in a malignant melanoma cell line).		chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATCATCTTCGTCATCTGCT	0.453			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								144	94	---	---	---	---	PASS
NR1I2	8856	broad.mit.edu	37	3	119528965	119528965	+	Silent	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119528965G>A	uc003edj.2	+	3	2094	c.255G>A	c.(253-255)GAG>GAA	p.E85E	NR1I2_uc003edi.2_Silent_p.E85E|NR1I2_uc003edk.2_Silent_p.E124E|NR1I2_uc003edl.2_5'Flank	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	85	Nuclear receptor.|Bipartite nuclear localization signal.|NR C4-type.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	GCGCCTGCGAGATCACCCGGA	0.617													8	7	---	---	---	---	PASS
LMLN	89782	broad.mit.edu	37	3	197748373	197748373	+	Silent	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197748373C>A	uc011buo.1	+	13	1444	c.1422C>A	c.(1420-1422)TCC>TCA	p.S474S	LMLN_uc003fyt.2_Silent_p.S459S|LMLN_uc010iar.2_Silent_p.S511S|LMLN_uc010ias.2_Silent_p.S422S|LMLN_uc003fyu.2_Silent_p.S271S	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	474					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		ATGGTGGCTCCGTGGAAATTG	0.393													232	347	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39297338	39297338	+	Silent	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39297338C>T	uc003gty.1	-	22	2987	c.2853G>A	c.(2851-2853)GGG>GGA	p.G951G	RFC1_uc003gtx.1_Silent_p.G950G	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	951					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GGGTCATGTACCCCCTCATCA	0.458													55	81	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70351057	70351057	+	Silent	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70351057A>G	uc003hek.3	-	5	1226	c.1179T>C	c.(1177-1179)GTT>GTC	p.V393V	UGT2B4_uc011cap.1_Silent_p.V257V|UGT2B4_uc003hel.3_Intron	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	393					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						CAAACAATGGAACGCCCACCA	0.458													6	229	---	---	---	---	PASS
GALNT7	51809	broad.mit.edu	37	4	174216550	174216550	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174216550A>G	uc003isz.3	+	4	841	c.758A>G	c.(757-759)CAC>CGC	p.H253R	GALNT7_uc011ckb.1_Missense_Mutation_p.H30R	NM_017423	NP_059119	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	253	Catalytic subdomain A.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTAACAGAACACTTAAAAGAA	0.313													105	168	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94876456	94876456	+	Silent	SNP	T	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94876456T>G	uc003klb.2	-	8	751	c.481A>C	c.(481-483)AGA>CGA	p.R161R	TTC37_uc010jbf.1_Silent_p.R113R	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	161							binding			ovary(3)|pancreas(1)	4						GTCAATTTTCTCCATAGTTGA	0.378													175	331	---	---	---	---	PASS
PJA2	9867	broad.mit.edu	37	5	108719205	108719205	+	5'UTR	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108719205C>A	uc003kos.3	-	2						NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		acactatggacaagccgcaga	0.000													14	142	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	100957131	100957131	+	3'UTR	SNP	T	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100957131T>C	uc003pqk.2	-	42						NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTGCAGCCACTGTCAATTTCC	0.363													14	37	---	---	---	---	PASS
TRAF3IP2	10758	broad.mit.edu	37	6	111913024	111913024	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111913024T>A	uc011ebc.1	-	3	881	c.266A>T	c.(265-267)GAG>GTG	p.E89V	TRAF3IP2_uc003pvg.2_Missense_Mutation_p.E89V|TRAF3IP2_uc003pvf.2_Missense_Mutation_p.E89V|TRAF3IP2_uc010kdw.2_Missense_Mutation_p.E89V|TRAF3IP2_uc010kdx.2_Missense_Mutation_p.E89V	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2	98					intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		TTCACTGTCCTCCAGAACTTG	0.567													29	45	---	---	---	---	PASS
GPNMB	10457	broad.mit.edu	37	7	23309735	23309735	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23309735C>T	uc003swc.2	+	9	1567	c.1406C>T	c.(1405-1407)ACC>ATC	p.T469I	GPNMB_uc003swb.2_Missense_Mutation_p.T457I|GPNMB_uc011jyy.1_Missense_Mutation_p.T411I|GPNMB_uc011jyz.1_Missense_Mutation_p.T358I	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	469	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			GTGAACCTCACCCTGGGGGAT	0.512													87	60	---	---	---	---	PASS
SPDYE8P	389517	broad.mit.edu	37	7	72500251	72500251	+	5'UTR	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72500251C>A	uc011keo.1	-	1					FKBP6_uc003twz.2_Intron|PMS2L2_uc003txf.3_Intron|PMS2L2_uc003txg.3_Intron|PMS2L2_uc003txn.3_Intron|PMS2L2_uc003txh.3_Intron|PMS2L2_uc003txi.3_Intron|PMS2L2_uc010las.1_Intron	NR_003664				SubName: Full=Speedy homolog E3 (Xenopus laevis); SubName: Full=Similar to Williams Beuren syndrome chromosome region 19;												0						GAGTCTCTCGCTCATGGGAAA	0.269													4	6	---	---	---	---	PASS
YTHDF3	253943	broad.mit.edu	37	8	64099319	64099319	+	Silent	SNP	G	A	A	rs61745071		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64099319G>A	uc003xuy.2	+	5	1066	c.750G>A	c.(748-750)CCG>CCA	p.P250P	YTHDF3_uc010lys.2_Silent_p.P194P|YTHDF3_uc003xuz.2_Silent_p.P194P|YTHDF3_uc003xva.2_Silent_p.P194P|YTHDF3_uc011len.1_Silent_p.P194P	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	250											0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			AACCTCAACCGAAACTTAAAC	0.488													36	57	---	---	---	---	PASS
STMN2	11075	broad.mit.edu	37	8	80549106	80549106	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80549106G>A	uc003ybj.2	+	2	140	c.89G>A	c.(88-90)CGC>CAC	p.R30H	STMN2_uc010lzp.2_RNA|STMN2_uc011lfn.1_Missense_Mutation_p.R30H	NM_007029	NP_008960	Q93045	STMN2_HUMAN	superiorcervical ganglia, neural specific 10	30					intracellular signal transduction|negative regulation of microtubule depolymerization|negative regulation of microtubule polymerization|negative regulation of neuron projection development|neuron differentiation|positive regulation of microtubule depolymerization|positive regulation of neuron projection development	axon|growth cone|membrane|membrane fraction|perinuclear region of cytoplasm|soluble fraction	protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			CCGGAACCTCGCAACATCAAC	0.393													86	153	---	---	---	---	PASS
RIPK2	8767	broad.mit.edu	37	8	90796294	90796294	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90796294G>T	uc003yee.2	+	8	1270	c.956G>T	c.(955-957)AGT>ATT	p.S319I	RIPK2_uc003yef.2_Missense_Mutation_p.S182I	NM_003821	NP_003812	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	319					activation of MAPK activity|anti-apoptosis|apoptosis|inflammatory response|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|CARD domain binding|LIM domain binding|protein homodimerization activity|protein serine/threonine kinase activity|signal transducer activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.0474)			AGTGTTTCAAGTGCCATTCAC	0.279													89	190	---	---	---	---	PASS
GSDMC	56169	broad.mit.edu	37	8	130788505	130788505	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130788505A>G	uc003ysr.2	-	3	1129	c.247T>C	c.(247-249)TTC>CTC	p.F83L		NM_031415	NP_113603	Q9BYG8	GSDMC_HUMAN	melanoma-derived leucine zipper, extra-nuclear	83						mitochondrion				ovary(2)|skin(1)	3						ATGTCACTGAAGTGGAACGGT	0.458													7	294	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68414581	68414581	+	RNA	SNP	T	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414581T>A	uc004aex.2	+	1		c.1136T>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		tactgaatattttaatcccac	0.005													3	7	---	---	---	---	PASS
SEC61B	10952	broad.mit.edu	37	9	101984847	101984847	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101984847G>C	uc004azh.2	+	2	99	c.23G>C	c.(22-24)GGC>GCC	p.G8A	ALG2_uc004azg.2_5'Flank|ALG2_uc004azf.2_5'Flank	NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit	8	Cytoplasmic (Potential).				ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				ACCCCCAGTGGCACTAACGTG	0.672													12	11	---	---	---	---	PASS
ANKRD1	27063	broad.mit.edu	37	10	92681008	92681008	+	5'UTR	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92681008G>A	uc001khe.1	-	1						NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				AGGGAGGGGAGGACAAGCTAA	0.498													10	20	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46895081	46895081	+	Silent	SNP	G	A	A	rs17848229		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46895081G>A	uc001ndn.3	-	29	4439	c.4293C>T	c.(4291-4293)GAC>GAT	p.D1431D	uc001ndl.2_RNA	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1431	Extracellular (Potential).|LDL-receptor class B 16.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CTGCCAGCCCGTCAGTGGTCT	0.592													14	33	---	---	---	---	PASS
LRTOMT	220074	broad.mit.edu	37	11	71816983	71816983	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71816983G>A	uc010rqv.1	+	7	1177	c.85G>A	c.(85-87)GCC>ACC	p.A29T	LRTOMT_uc010rqw.1_Missense_Mutation_p.A29T|LRTOMT_uc001ors.3_Intron|C11orf59_uc001ort.2_5'Flank	NM_001145309	NP_001138781	Q96E66	LRC51_HUMAN	leucine rich transmembrane and	Error:Variant_position_missing_in_Q96E66_after_alignment						cytoplasm					0						CCACCCCAGGGCCCAGGTAGG	0.483													8	22	---	---	---	---	PASS
C12orf24	29902	broad.mit.edu	37	12	110922888	110922888	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110922888A>G	uc001tqu.3	+	3	639	c.190A>G	c.(190-192)ATC>GTC	p.I64V	C12orf24_uc010sxz.1_5'UTR|C12orf24_uc009zvo.2_Missense_Mutation_p.I64V|C12orf24_uc001tqt.2_RNA|C12orf24_uc001tqv.3_RNA|C12orf24_uc009zvp.2_5'Flank	NM_013300	NP_037432	Q8WUB2	CL024_HUMAN	hypothetical protein LOC29902	64											0						TACAGATAGAATCAAAGATGG	0.318													7	226	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23906156	23906156	+	Silent	SNP	T	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23906156T>C	uc001uon.2	-	10	12448	c.11859A>G	c.(11857-11859)AAA>AAG	p.K3953K	SACS_uc001uoo.2_Silent_p.K3806K|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3953					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATCCATGGTCTTTCCCTAAGT	0.388													6	188	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68048655	68048655	+	Intron	SNP	C	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68048655C>G	uc001xjl.1	+						PLEKHH1_uc010tsw.1_Intron|PLEKHH1_uc001xjn.1_Intron|PLEKHH1_uc010tsx.1_Intron|PLEKHH1_uc001xjo.1_5'UTR|PLEKHH1_uc001xjp.1_5'UTR	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H							cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGAGGCAATACAAAATAGGCT	0.433													19	28	---	---	---	---	PASS
PAPOLA	10914	broad.mit.edu	37	14	97009231	97009231	+	Splice_Site	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97009231G>A	uc001yfq.2	+	14	1499	c.1289_splice	c.e14+1	p.K430_splice	PAPOLA_uc001yfr.2_Splice_Site_p.K430_splice|PAPOLA_uc010twv.1_Splice_Site_p.K430_splice|PAPOLA_uc010avp.2_Splice_Site_p.K180_splice	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha						mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		ATCCCGACAAGTAAGCCCTTT	0.353													36	336	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106330892	106330892	+	RNA	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106330892C>T	uc010tyt.1	-	3523		c.53584G>A			uc001yrs.2_5'Flank|uc001yrt.2_5'Flank|uc001yrw.1_5'Flank|uc001yrx.1_5'Flank|uc001yrz.1_5'Flank|uc001yse.2_5'Flank|uc001ysf.2_Intron|uc001ysj.2_5'Flank|uc001ysk.1_5'Flank|uc001ysl.1_5'Flank|uc001ysm.1_5'Flank|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						AACCTGTGCCCGTGCAGGACA	0.607													4	80	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72030149	72030149	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72030149A>G	uc002atb.1	+	10	1788	c.1709A>G	c.(1708-1710)AAG>AGG	p.K570R	THSD4_uc010ukg.1_Missense_Mutation_p.K210R|THSD4_uc002ate.2_Missense_Mutation_p.K210R	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	570						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						AACGAGGAGAAGGAAGACTTG	0.577													6	227	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	76958055	76958055	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76958055C>T	uc002bby.2	-	20	2643	c.2584G>A	c.(2584-2586)GGA>AGA	p.G862R	SCAPER_uc010bkr.2_Missense_Mutation_p.G170R|SCAPER_uc002bbx.2_Missense_Mutation_p.G616R|SCAPER_uc002bbz.1_Missense_Mutation_p.G733R|SCAPER_uc002bca.1_Missense_Mutation_p.G727R	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	861						endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						CGCTCTTCTCCATCTTTCAAA	0.328													8	482	---	---	---	---	PASS
C16orf73	254528	broad.mit.edu	37	16	1884331	1884331	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1884331T>A	uc002cne.2	-	13	1373	c.1255A>T	c.(1255-1257)ATT>TTT	p.I419F	FAHD1_uc002cnd.2_Intron|FAHD1_uc010brz.2_Intron|C16orf73_uc010uvq.1_Missense_Mutation_p.I448F|C16orf73_uc010uvr.1_Missense_Mutation_p.I241F	NM_152764	NP_689977	Q8N635	CP073_HUMAN	hypothetical protein LOC254528 isoform 2	419					meiosis	cytoplasm					0						AGTACACTAATTTTCAATCCA	0.383													128	274	---	---	---	---	PASS
UMOD	7369	broad.mit.edu	37	16	20344558	20344558	+	3'UTR	SNP	A	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20344558A>G	uc002dgz.2	-	11					UMOD_uc002dha.2_3'UTR|UMOD_uc002dhb.2_3'UTR	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor						cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						CTGTGGCTGGAGCACTGGCCC	0.532													4	14	---	---	---	---	PASS
ZNF785	146540	broad.mit.edu	37	16	30593843	30593843	+	3'UTR	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30593843C>T	uc002dyw.1	-	3					uc002dyu.2_Intron|ZNF785_uc002dyv.1_3'UTR|ZNF785_uc010vez.1_3'UTR	NM_152458	NP_689671	A8K8V0	ZN785_HUMAN	zinc finger protein 785						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTGCCTCTTCCTCTCCAGGGA	0.498													8	14	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8159217	8159217	+	Silent	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8159217G>A	uc002gkr.2	+	6	810	c.669G>A	c.(667-669)GCG>GCA	p.A223A	PFAS_uc010vuv.1_5'UTR	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	223					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TTGACTTGGCGCAGTCCAATA	0.557													4	95	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29182285	29182285	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29182285G>T	uc002hfs.1	+	7	2921	c.2575G>T	c.(2575-2577)GTG>TTG	p.V859L	ATAD5_uc002hft.1_Missense_Mutation_p.V756L	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	859					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TGCGCTGGATGTGTACAATGC	0.393													51	95	---	---	---	---	PASS
PSMD3	5709	broad.mit.edu	37	17	38153787	38153787	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38153787G>C	uc002htn.1	+	12	1722	c.1558G>C	c.(1558-1560)GAG>CAG	p.E520Q	PSMD3_uc010wen.1_RNA|PSMD3_uc010weo.1_Missense_Mutation_p.E421Q	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3	520					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					GCAGGACTTGGAGTTTGCCAA	0.607													25	59	---	---	---	---	PASS
RNF43	54894	broad.mit.edu	37	17	56440700	56440700	+	Missense_Mutation	SNP	A	G	G	rs145164323		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56440700A>G	uc002iwf.2	-	4	2474	c.518T>C	c.(517-519)ATG>ACG	p.M173T	RNF43_uc010wnv.1_Missense_Mutation_p.M132T|RNF43_uc002iwh.3_Missense_Mutation_p.M173T|RNF43_uc002iwg.3_Missense_Mutation_p.M173T|RNF43_uc010dcw.2_Missense_Mutation_p.M46T	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	173	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CACAAACTCCATCAGCTTCTC	0.587													74	113	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61890626	61890626	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61890626A>T	uc002jbu.2	+	16	1971	c.1714A>T	c.(1714-1716)AAC>TAC	p.N572Y	DDX42_uc002jbv.2_Missense_Mutation_p.N572Y|DDX42_uc002jbw.1_Missense_Mutation_p.N308Y|DDX42_uc002jbx.2_Missense_Mutation_p.N308Y|DDX42_uc002jby.2_Missense_Mutation_p.N118Y|DDX42_uc010wps.1_5'Flank	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein	572	Helicase C-terminal.				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						GACTGTCATTAACTATGATGT	0.443													51	84	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47363917	47363917	+	Missense_Mutation	SNP	A	G	G	rs138128932	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47363917A>G	uc002leb.2	-	37	5396	c.5108T>C	c.(5107-5109)GTC>GCC	p.V1703A	MYO5B_uc002ldz.2_Missense_Mutation_p.V273A|MYO5B_uc002lea.2_Missense_Mutation_p.V818A	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	1703	Dilute.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CCAAGAGCAGACGTCCTTCCG	0.527													5	77	---	---	---	---	PASS
C19orf62	29086	broad.mit.edu	37	19	17387524	17387524	+	Intron	SNP	T	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17387524T>G	uc002nfu.2	+						C19orf62_uc010xpl.1_3'UTR|C19orf62_uc002nfv.2_Intron|C19orf62_uc010ean.2_Intron|C19orf62_uc002nfw.2_Intron	NM_014173	NP_054892	Q9NWV8	BABA1_HUMAN	mediator of Rap80 interactions and targeting 40						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|protein K63-linked deubiquitination|response to ionizing radiation	BRCA1-A complex|BRISC complex|cytoplasm	protein binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						GAGGCTGGGGTGCCTAGAGGT	0.602													8	50	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243947	56243947	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243947C>A	uc002qly.2	-	2	1278	c.1250G>T	c.(1249-1251)AGG>ATG	p.R417M		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	417	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TAACCCATTCCTCCGGAGATC	0.498													52	75	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625956	29625956	+	Missense_Mutation	SNP	G	A	A	rs147809085		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625956G>A	uc010ztl.1	+	2	142	c.110G>A	c.(109-111)AGA>AAA	p.R37K	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATTGGACCAAGAGAACAATGG	0.338													5	106	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33437795	33437795	+	Silent	SNP	C	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33437795C>T	uc002xay.2	-	14	1837	c.1794G>A	c.(1792-1794)CCG>CCA	p.P598P	GGT7_uc010gex.2_RNA|GGT7_uc002xaz.1_Silent_p.P615P	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	598	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						ACTGCAGGTCCGGGTGTAGGC	0.607													4	23	---	---	---	---	PASS
SLC2A4RG	56731	broad.mit.edu	37	20	62373331	62373331	+	Silent	SNP	T	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62373331T>A	uc002ygq.2	+	4	556	c.501T>A	c.(499-501)TCT>TCA	p.S167S	SLC2A4RG_uc002ygr.2_Silent_p.S62S|SLC2A4RG_uc011abj.1_Silent_p.S62S|SLC2A4RG_uc002ygs.2_Intron|SLC2A4RG_uc002ygt.2_5'UTR	NM_020062	NP_064446	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	167						cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					ACCAGTCCTCTCCGTCCACCC	0.672													6	5	---	---	---	---	PASS
GGT3P	2679	broad.mit.edu	37	22	18775275	18775275	+	Intron	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18775275G>A	uc011ago.1	-						GGT3P_uc011agp.1_RNA|GGT3P_uc002zob.1_Intron					Homo sapiens cDNA clone IMAGE:5761295, **** WARNING: chimeric clone ****.												0						TGGTGCTGTTGTAGATGGTGA	0.642													5	20	---	---	---	---	PASS
RPL3	6122	broad.mit.edu	37	22	39713525	39713525	+	Silent	SNP	G	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39713525G>A	uc003axi.2	-	3	374	c.306C>T	c.(304-306)TTC>TTT	p.F102F	RPL3_uc003axh.2_Silent_p.F102F|RPL3_uc003axj.2_5'UTR|RPL3_uc011aoj.1_Silent_p.F102F|RPL3_uc010gxx.2_Silent_p.F50F|RPL3_uc003axg.2_Silent_p.F50F|RPL3_uc003axk.1_5'UTR	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a	102					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)					AGACAGTCTTGAAGGTCCGGA	0.542													21	46	---	---	---	---	PASS
SLC25A14	9016	broad.mit.edu	37	X	129507022	129507022	+	3'UTR	SNP	C	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129507022C>A	uc004evn.1	+	11					SLC25A14_uc004evo.1_3'UTR|SLC25A14_uc004evp.1_3'UTR|SLC25A14_uc004evq.1_3'UTR|SLC25A14_uc004evr.1_3'UTR	NM_003951	NP_003942	O95258	UCP5_HUMAN	solute carrier family 25, member 14 isoform						aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding			ovary(1)	1						AAGTGTTTACCAAGCCGTTGG	0.433													6	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	11928846	11928846	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11928846delT								NPPB (9854 upstream) : KIAA2013 (51278 downstream)																							gctgggaatctttagtcgccc	0.060													4	2	---	---	---	---	
VPS13D	55187	broad.mit.edu	37	1	12438868	12438868	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12438868delA	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTCAAACAATAAAATGGGTAT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14238262	14238262	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14238262delA								PRDM2 (86690 upstream) : KAZ (686951 downstream)																							GTCCTTAAATAAAAAATGTTA	0.408													4	2	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15427661	15427662	+	Intron	DEL	TC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15427661_15427662delTC	uc001avm.3	+						KAZ_uc001avs.3_5'Flank	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						TCTCGGtctttctctctctctc	0.248													4	2	---	---	---	---	
CAPZB	832	broad.mit.edu	37	1	19680774	19680774	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19680774delC	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		GCTCACTTCTCCCAGAACCCT	0.483													4	2	---	---	---	---	
HP1BP3	50809	broad.mit.edu	37	1	21070972	21070972	+	3'UTR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21070972delA	uc001bdw.1	-	13					HP1BP3_uc001bdv.1_3'UTR|HP1BP3_uc010odh.1_3'UTR|HP1BP3_uc001bdy.1_Intron|HP1BP3_uc010odf.1_3'UTR|HP1BP3_uc010odg.1_3'UTR	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74						nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		AAATTGGAAGAAAAAAAAAAG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30509277	30509277	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30509277delG	uc001bry.3	-											Homo sapiens cDNA clone IMAGE:4830073.																		TGGGGAACCTGGGGACTCAGC	0.428													4	2	---	---	---	---	
MAST2	23139	broad.mit.edu	37	1	46391135	46391136	+	Intron	INS	-	G	G	rs111264457		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46391135_46391136insG	uc001cov.2	+						MAST2_uc001cow.2_Intron|MAST2_uc001cox.1_Intron|MAST2_uc001coy.1_Intron|MAST2_uc001coz.1_Intron|MAST2_uc009vya.2_Intron	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase						regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGCACTCAGATGGGGGTGTTGC	0.391													4	2	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	51261885	51261886	+	Intron	DEL	AC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51261885_51261886delAC	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		AAacacacaaacacacacacac	0.218													6	3	---	---	---	---	
OSBPL9	114883	broad.mit.edu	37	1	52211525	52211525	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52211525delA	uc001cst.2	+						OSBPL9_uc001css.2_Intron|OSBPL9_uc001csx.2_Intron|OSBPL9_uc009vza.2_Intron|OSBPL9_uc001csu.2_Intron|OSBPL9_uc001csv.2_Intron|OSBPL9_uc001csw.2_Intron|OSBPL9_uc001csy.2_Intron|OSBPL9_uc001csz.2_Intron|OSBPL9_uc001cta.2_Intron	NM_024586	NP_078862	Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9 isoform e						lipid transport		lipid binding			central_nervous_system(1)	1						GGTCATTAAGAAAAAAAAGGT	0.269													4	2	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	54149471	54149471	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54149471delG	uc001cvr.1	-							NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						agcacacagtgggtggtcact	0.075													4	2	---	---	---	---	
MRPL37	51253	broad.mit.edu	37	1	54688225	54688225	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54688225delC	uc001cxb.1	+							NM_016491	NP_057575	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37 precursor						translation	mitochondrial ribosome	structural constituent of ribosome				0						cctctctgcaccccttttctt	0.254													4	2	---	---	---	---	
SSBP3	23648	broad.mit.edu	37	1	54749242	54749242	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54749242delG	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron|uc001cxi.1_5'Flank	NM_145716	NP_663768	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0						tttgtaagctgGGACAGCTCT	0.239													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58610795	58610796	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58610795_58610796insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						TGTACTGCATGAAAGAACCAGC	0.490													4	2	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61629320	61629321	+	Intron	INS	-	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61629320_61629321insG	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						GTTAGTAGTCAGAAAAAAAGAC	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62111686	62111686	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62111686delG								NFIA (183227 upstream) : TM2D1 (35033 downstream)																							AAACTATTTTGGAAAGTTCGT	0.393													4	2	---	---	---	---	
TM2D1	83941	broad.mit.edu	37	1	62191418	62191418	+	5'Flank	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62191418delA	uc001czz.1	-							NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor						apoptosis					ovary(1)	1						TACGCCTTTTAAAAAAAAAAA	0.303													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73839668	73839668	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73839668delT								None (None upstream) : LRRIQ3 (652036 downstream)																							ttaactaggattttttttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74241193	74241193	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74241193delT								None (None upstream) : LRRIQ3 (250511 downstream)																							tatacatggattttttttcaa	0.070													4	2	---	---	---	---	
TNNI3K	51086	broad.mit.edu	37	1	74986299	74986299	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74986299delA	uc001dgf.1	+						TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TCACAACTTCAAAAAAAAAAT	0.368													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	75476642	75476642	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75476642delA								TYW3 (244284 upstream) : LHX8 (117477 downstream)																							TTTAAGTCCTAAAAATAGAGG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	87672824	87672825	+	IGR	DEL	AC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87672824_87672825delAC								LOC339524 (37940 upstream) : LMO4 (121326 downstream)																							atggtagtctaccccaaaacat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88327611	88327611	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88327611delG								LMO4 (513008 upstream) : PKN2 (822311 downstream)																							GAGGCATGTTGGGAAATTATG	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90069119	90069119	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90069119delC								LRRC8B (5701 upstream) : LRRC8C (29525 downstream)																							ACTAGAAGGGCCTGGAAGAAA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	96205635	96205636	+	IGR	INS	-	TTTG	TTTG	rs146504292	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96205635_96205636insTTTG								RWDD3 (492862 upstream) : PTBP2 (981539 downstream)																							atttatctttttttgtttgttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	104737170	104737170	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104737170delA								AMY1A (529998 upstream) : None (None downstream)																							gaggaaaaggaaaaaaaaaat	0.035													4	2	---	---	---	---	
STXBP3	6814	broad.mit.edu	37	1	109321581	109321582	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109321581_109321582insC	uc001dvy.2	+						STXBP3_uc001dvz.2_Intron	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3						negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		tatctgttatttagttgaaaaa	0.050													2	4	---	---	---	---	
C1orf194	127003	broad.mit.edu	37	1	109650348	109650348	+	Intron	DEL	A	-	-	rs71823454		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109650348delA	uc009wev.2	-						C1orf194_uc001dwp.3_Intron|C1orf194_uc009wew.2_Intron	NM_001122961	NP_001116433	Q5T5A4	CA194_HUMAN	hypothetical protein LOC127003											ovary(1)	1						tcatctcttcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	112603565	112603565	+	IGR	DEL	G	-	-	rs11102377	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112603565delG								KCND3 (71788 upstream) : CTTNBP2NL (335235 downstream)																							TGATCCCACAGGCATTCAGTA	0.498													4	2	---	---	---	---	
DENND2C	163259	broad.mit.edu	37	1	115154028	115154029	+	Intron	INS	-	A	A	rs141459590	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115154028_115154029insA	uc001efd.1	-						DENND2C_uc001eez.2_Intron|DENND2C_uc001efc.1_Intron	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C											skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAGTTTTAAGAGTCTAGTTCA	0.386													1	5	---	---	---	---	
CD2	914	broad.mit.edu	37	1	117302051	117302051	+	Intron	DEL	A	-	-	rs66603322		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117302051delA	uc001egu.3	+						CD2_uc010owz.1_Intron|CD2_uc010oxa.1_Intron	NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor						blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	AAAGAATGAGAAAAAAAAAAA	0.239													4	2	---	---	---	---	
ADAM30	11085	broad.mit.edu	37	1	120441314	120441314	+	5'Flank	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120441314delG	uc001eij.2	-							NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GAGAAAATAAGGGAGAGCTAG	0.542													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120592822	120592823	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120592822_120592823insA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAAGATTTAGAAAAAACACAC	0.337			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120627425	120627425	+	IGR	DEL	G	-	-	rs111900640		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120627425delG								NOTCH2 (15149 upstream) : FAM72B (211580 downstream)																							GACTGATTCAGGACACAGCAG	0.294													3	6	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145200777	145200777	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145200777delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AACTTTGCCGTTTTTTTTTTT	0.144													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145215207	145215208	+	Intron	DEL	CT	-	-	rs111871027		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145215207_145215208delCT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ACTTGCTGGCCTCACTTAGTAC	0.386													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145231553	145231554	+	Intron	INS	-	C	C	rs142041832		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145231553_145231554insC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGCTATGGAACCTTCAGGGAT	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	147004765	147004766	+	IGR	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147004765_147004766insC								CHD1L (237324 upstream) : BCL9 (8416 downstream)																							ACACTGGgtgtcccccatacca	0.238													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148001285	148001286	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001285_148001286insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CATCATTTTTGAAAAGAGTATT	0.277													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148904610	148904611	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148904610_148904611insT								NBPF16 (146299 upstream) : LOC645166 (23675 downstream)																							TCAAGCCCAGATTTTTTTTTTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149689123	149689124	+	IGR	INS	-	G	G	rs138164517		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149689123_149689124insG								HIST2H2BF (289894 upstream) : FCGR1A (65126 downstream)																							acagacgcaaaaaaaaatgcta	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151910667	151910667	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151910667delT								THEM4 (28554 upstream) : S100A10 (44720 downstream)																							ccatTAAAAATTTTTTTTTTG	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151953853	151953853	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151953853delA								THEM4 (71740 upstream) : S100A10 (1534 downstream)																							CCGTATGTGGAAAGAGGGAGG	0.353													4	2	---	---	---	---	
MEF2D	4209	broad.mit.edu	37	1	156435200	156435201	+	3'UTR	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156435200_156435201insC	uc001fpc.2	-	12					MEF2D_uc001fpb.2_3'UTR|MEF2D_uc001fpd.2_3'UTR|MEF2D_uc001fpe.1_3'UTR|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D						apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TAACTGCCAATCCCCCCAACTG	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159838142	159838143	+	IGR	DEL	CT	-	-	rs140007018		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159838142_159838143delCT								VSIG8 (5695 upstream) : CCDC19 (4013 downstream)																							agtgagcgccctgtctctcagg	0.000													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161413601	161413601	+	IGR	DEL	A	-	-	rs144019666	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161413601delA								C1orf192 (75937 upstream) : FCGR2A (61604 downstream)																							tctcCCCCCCACCCCTCGCTG	0.448													6	3	---	---	---	---	
FCGR3A	2214	broad.mit.edu	37	1	161513383	161513383	+	Intron	DEL	A	-	-	rs71906927		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161513383delA	uc001gat.3	-						FCGR3A_uc001gar.2_Intron|FCGR3A_uc001gas.2_Intron|FCGR3A_uc009wuh.2_Intron|FCGR3A_uc009wui.2_Intron	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor						immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ttccaaacttaaaaaaaaaat	0.144													4	2	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161903802	161903802	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161903802delA	uc001gbr.2	+							NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			GAGACACAATAAAAATGATAG	0.274													3	3	---	---	---	---	
RGS5	8490	broad.mit.edu	37	1	163136853	163136854	+	Intron	INS	-	A	A	rs150403610	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163136853_163136854insA	uc001gcn.2	-						RGS5_uc009wvb.2_Intron	NM_003617	NP_003608	O15539	RGS5_HUMAN	regulator of G-protein signalling 5						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity				0			LUSC - Lung squamous cell carcinoma(543;0.187)			TTTGAAGTAATAAAAAAAGGAG	0.366													3	3	---	---	---	---	
RXRG	6258	broad.mit.edu	37	1	165415683	165415683	+	5'Flank	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165415683delA	uc001gda.2	-						RXRG_uc001gdb.1_5'Flank	NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	GTTGGGCTGGAAAAAAGATAA	0.443													4	2	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175712567	175712567	+	5'UTR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175712567delT	uc009wwu.1	-	1					TNR_uc010pmz.1_5'UTR	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GGAAGGAGAATGAGGAGGCAA	0.507											OREG0013998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178954719	178954719	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178954719delT								RALGPS2 (65484 upstream) : FAM20B (40355 downstream)																							cagaattgccttttttttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	179897563	179897564	+	IGR	DEL	CA	-	-	rs145963577	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179897563_179897564delCA								TOR1AIP1 (8352 upstream) : CEP350 (26344 downstream)																							caacctatgtcaCACTGTAAGC	0.064													4	2	---	---	---	---	
NPL	80896	broad.mit.edu	37	1	182781848	182781848	+	Intron	DEL	T	-	-	rs74733296		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182781848delT	uc009wyb.2	+						NPL_uc010pnx.1_Intron|NPL_uc010pny.1_Intron|NPL_uc001gpo.1_Intron|NPL_uc009wyc.2_Intron|NPL_uc001gpp.3_Intron|NPL_uc001gpq.1_Intron	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase						carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						cgttgtggaattttttttttc	0.000													4	2	---	---	---	---	
DHX9	1660	broad.mit.edu	37	1	182822929	182822929	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182822929delT	uc001gpr.2	+						DHX9_uc001gps.2_Intron	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9						CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						GAAGTTGTCATTTTTTTTTTT	0.264													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	186602128	186602129	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186602128_186602129insT								PDC (171889 upstream) : PTGS2 (38816 downstream)																							gctgatttctatttttttcaca	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	192694182	192694182	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192694182delT								RGS13 (64795 upstream) : RGS2 (83987 downstream)																							TGCTTAAAGATTACCATAACC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198567466	198567466	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198567466delG								ATP6V1G3 (57391 upstream) : PTPRC (40671 downstream)																							aaCATCAGTAGGATTGAAGTA	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198902516	198902517	+	Intron	DEL	AT	-	-	rs72231038		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198902516_198902517delAT	uc001guz.2	-											Homo sapiens familial acute myelogenous leukemia related factor mRNA, complete cds.																		atatatatacatatatatatat	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201315208	201315208	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201315208delA								PKP1 (13093 upstream) : TNNT2 (12935 downstream)																							ATTTATTCTCAGGTAAGTCTG	0.428											OREG0014075	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215482212	215482212	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215482212delT								KCNK2 (71777 upstream) : KCTD3 (258523 downstream)																							TTCTACCACATTTTTTTTTAC	0.299													3	4	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215967474	215967475	+	Intron	DEL	AG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215967474_215967475delAG	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCATCTGCCCAGAGAGAGCACT	0.386										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221952520	221952520	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221952520delA								DUSP10 (37059 upstream) : HHIPL2 (743082 downstream)																							AAAAAATCACAAAAAATGTAC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223708539	223708539	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223708539delA								C1orf65 (139727 upstream) : CAPN8 (6433 downstream)																							TCAGGTAGCCAGGAGAAGCTG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226793740	226793740	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226793740delA								C1orf95 (437 upstream) : ITPKB (25652 downstream)																							CTGCAGAAAGAAAAAAAGCCA	0.522													4	2	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235940134	235940134	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235940134delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTAATTGTACTAATTACATTT	0.209									Chediak-Higashi_syndrome				4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239832435	239832435	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239832435delA	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	ACTCCTGGACACAAACCCTAC	0.502													4	2	---	---	---	---	
GREM2	64388	broad.mit.edu	37	1	240728083	240728083	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240728083delT	uc001hys.2	-							NM_022469	NP_071914	Q9H772	GREM2_HUMAN	gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			cccatttgccttcctgcacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	409412	409412	+	IGR	DEL	A	-	-	rs144128328		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:409412delA								FAM150B (121104 upstream) : TMEM18 (258563 downstream)																							aaacaacaacaaaaaaaaCCA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4273441	4273441	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4273441delT								ALLC (523183 upstream) : None (None downstream)																							TTCACTTTTGTTTTAAGGAAA	0.378													4	2	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9396547	9396547	+	Intron	DEL	A	-	-	rs5829204		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9396547delA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						ATGCTGTGCCAATGATGATGC	0.418													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10373323	10373324	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10373323_10373324delGT								C2orf48 (21467 upstream) : HPCAL1 (69716 downstream)																							AAGATtgtgagtgtgtgtgtgt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14439136	14439136	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14439136delG	uc002rby.2	-											Homo sapiens cDNA clone IMAGE:5263003.																		ACAGAAACCAGACCATTTTGG	0.433													4	2	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39075225	39075225	+	Intron	DEL	A	-	-	rs75260498		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39075225delA	uc002rrf.2	-						DHX57_uc002rrd.3_Intron|DHX57_uc002rre.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				actctgtctcaaaaaaaaaaa	0.154													6	4	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43776727	43776727	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43776727delA	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ATATAACAACAAAAAAAACTC	0.328													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50416797	50416797	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50416797delT	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGAGTCATCTCAAAACTGGT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	55721642	55721642	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55721642delA								CCDC88A (74585 upstream) : CCDC104 (25098 downstream)																							tggtcgaggtaaatgcctgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56249581	56249581	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56249581delT	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																		CATGAATTGATGAATTGCTTT	0.299													4	2	---	---	---	---	
FANCL	55120	broad.mit.edu	37	2	58422062	58422062	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58422062delA	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ATTATATCACAAAAAAAAAAG	0.313								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	3	---	---	---	---	
KIAA1841	84542	broad.mit.edu	37	2	61312051	61312052	+	Intron	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61312051_61312052delGA	uc002saw.3	+						KIAA1841_uc002sax.3_Intron|KIAA1841_uc002say.2_Intron|KIAA1841_uc002sav.3_Intron	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a												0			Epithelial(17;0.193)			atgatgtggggagagagagagg	0.000													4	2	---	---	---	---	
LOC100132215	100132215	broad.mit.edu	37	2	63274130	63274130	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63274130delA	uc002scc.3	-							NR_027069				Homo sapiens cDNA FLJ59022 complete cds.												0						TAGGCTACAGAAAAAAAAAAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	63299391	63299391	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63299391delT								OTX1 (15088 upstream) : C2orf86 (49146 downstream)																							CCCCTCTGCCTTTTCTTCTAG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	72127212	72127212	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72127212delC								DYSF (213320 upstream) : CYP26B1 (229155 downstream)																							ACTGTGCAGACCCACTTCTTA	0.423													4	2	---	---	---	---	
RAB11FIP5	26056	broad.mit.edu	37	2	73334942	73334942	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73334942delG	uc002siu.3	-							NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)						protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						TGCCAGCTCTGGGGCCGAGCA	0.632													4	2	---	---	---	---	
TET3	200424	broad.mit.edu	37	2	74301004	74301004	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74301004delA	uc002skb.3	+						TET3_uc010fez.1_3'UTR	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3								metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AAATGTTTTTATGGTTATATG	0.244													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80682929	80682929	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80682929delG	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TGTCAGATGAGGGGAGGAGGA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81430951	81430951	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81430951delT								CTNNA2 (555047 upstream) : None (None downstream)																							tctgagtctatttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	84694250	84694250	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84694250delT								SUCLG1 (7664 upstream) : DNAH6 (49329 downstream)																							cccctttaactttagccagtg	0.000													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87588219	87588221	+	Intron	DEL	GAT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87588219_87588221delGAT	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						aattaaatgagatgatgaaatta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91669031	91669035	+	IGR	DEL	AACTT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91669031_91669035delAACTT								None (None upstream) : LOC654342 (136157 downstream)																							AACCCCTAACAACTTAAAGCAAAAC	0.346													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91791556	91791557	+	IGR	DEL	TT	-	-	rs10569836		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91791556_91791557delTT								None (None upstream) : LOC654342 (13635 downstream)																							GATTAAAGTCTTTTAGAAATGT	0.347													7	4	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91828280	91828281	+	Intron	INS	-	T	T	rs146552335	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91828280_91828281insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						tctattctctatatGGGCCTCA	0.262													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91976432	91976432	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91976432delA								GGT8P (6279 upstream) : FKSG73 (152727 downstream)																							TAAGGCACATAATGAGCAATT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96607211	96607211	+	Intron	DEL	T	-	-	rs75646787	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96607211delT	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		ATAACACTTATTTCTACTTGG	0.328													4	2	---	---	---	---	
RFX8	731220	broad.mit.edu	37	2	102026854	102026855	+	Intron	DEL	CA	-	-	rs5832964		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102026854_102026855delCA	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136	Q6ZV50	RFX8_HUMAN	regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						tgcccacactcacacacacaca	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106350793	106350794	+	IGR	INS	-	A	A	rs72627447	byFrequency	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106350793_106350794insA								FHL2 (295563 upstream) : NCK2 (10560 downstream)																							gaacaactaggaaaaaaaaaaa	0.094													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108083196	108083196	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108083196delT								ST6GAL2 (579633 upstream) : LOC729121 (356324 downstream)																							TTGCATTGCATTTTTTTTTTG	0.408													3	3	---	---	---	---	
CCDC138	165055	broad.mit.edu	37	2	109464445	109464445	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109464445delA	uc002ten.1	+						CCDC138_uc002teo.1_Intron|CCDC138_uc002tep.1_Intron|CCDC138_uc010fjm.1_Intron	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138												0						TCCAAATCTTAAAAAAAAATA	0.363													4	2	---	---	---	---	
TFCP2L1	29842	broad.mit.edu	37	2	121989684	121989693	+	Intron	DEL	TTTTGTTTTG	-	-	rs3835787		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121989684_121989693delTTTTGTTTTG	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron|TFCP2L1_uc010flq.2_Intron	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)					CTGCCACTCTttttgttttgttttgttttg	0.281													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122656735	122656736	+	IGR	INS	-	T	T	rs72004104		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122656735_122656736insT								TSN (131309 upstream) : None (None downstream)																							CATTCTCAAAATTTGAGTTTGT	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122821290	122821291	+	IGR	DEL	CA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122821290_122821291delCA								TSN (295864 upstream) : None (None downstream)																							cacacacacgcacacacacaca	0.262													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127678986	127678986	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127678986delC								GYPC (224741 upstream) : BIN1 (126621 downstream)																							CATAACTGGGCCCCCACCCAT	0.512													4	2	---	---	---	---	
FAM123C	205147	broad.mit.edu	37	2	131522906	131522906	+	3'UTR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131522906delG	uc002trw.2	+	2					FAM123C_uc010fmv.2_3'UTR|FAM123C_uc010fms.1_3'UTR|FAM123C_uc010fmt.1_3'UTR|FAM123C_uc010fmu.1_3'UTR	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147											pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		tgaagaaataggtcaaaatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139099879	139099879	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139099879delC								HNMT (325946 upstream) : SPOPL (159471 downstream)																							ctatcaccttccaaagtatga	0.000													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142390289	142390289	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142390289delA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAAGGACTGAATGGAGCCAG	0.294										TSP Lung(27;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	149290467	149290467	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149290467delC								MBD5 (19425 upstream) : EPC2 (112093 downstream)																							GGTAAGGAGACAGGAGACAGT	0.418													4	2	---	---	---	---	
GALNT13	114805	broad.mit.edu	37	2	155207413	155207414	+	Intron	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155207413_155207414delGA	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron|GALNT13_uc010fod.2_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GTTCTACTTTGAGAAGAATATT	0.381													4	2	---	---	---	---	
CYTIP	9595	broad.mit.edu	37	2	158291770	158291770	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158291770delA	uc002tzj.1	-						CYTIP_uc010zcl.1_Intron	NM_004288	NP_004279	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein						regulation of cell adhesion	cell cortex|early endosome	protein binding			ovary(1)|kidney(1)|skin(1)	3						GATGATGATGAAATGACAGTG	0.299													4	2	---	---	---	---	
ACVR1	90	broad.mit.edu	37	2	158643209	158643209	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158643209delA	uc002tzm.3	-						ACVR1_uc002tzn.3_Intron|ACVR1_uc010fog.2_Intron	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A receptor, type I precursor						BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	ACATTAATAGAACAGCTGGGC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164397065	164397066	+	IGR	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164397065_164397066delGA								KCNH7 (701825 upstream) : FIGN (67052 downstream)																							attgacaattgagagagagaga	0.000													5	3	---	---	---	---	
FIGN	55137	broad.mit.edu	37	2	164485894	164485894	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164485894delG	uc002uck.1	-							NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin							nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						AATGCAAGGTGGGATCAGACG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	170252507	170252507	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170252507delC								LRP2 (33385 upstream) : BBS5 (83499 downstream)																							TAACAGATATCCCCCAGCACT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174769846	174769846	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174769846delT								CDCA7 (536128 upstream) : SP3 (3413 downstream)																							CCACTATCACTTTAGGTTCCA	0.328													4	2	---	---	---	---	
HOXD4	3233	broad.mit.edu	37	2	177015353	177015354	+	5'Flank	DEL	AG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177015353_177015354delAG	uc002uks.2	+							NM_014621	NP_055436	P09016	HXD4_HUMAN	homeobox D4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		aaagagagaaagagagagagag	0.391													6	3	---	---	---	---	
PLEKHA3	65977	broad.mit.edu	37	2	179365153	179365153	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179365153delT	uc002umn.2	+							NM_019091	NP_061964	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A							cytoplasm|membrane				ovary(1)|kidney(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTTTCTATCCTTTCTACCTCa	0.289													135	82	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	187725654	187725654	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187725654delA								ZSWIM2 (11757 upstream) : CALCRL (482197 downstream)																							cttgtgttgcaaaaggtaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	188803519	188803519	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188803519delA								TFPI (384300 upstream) : GULP1 (353085 downstream)																							AGAGCACCATAAAAAAGATGG	0.333													4	2	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	212295469	212295470	+	Intron	DEL	TA	-	-	rs144307905		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212295469_212295470delTA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		TAatatatggtatatatatatg	0.322										TSP Lung(8;0.080)			5	4	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	212400289	212400289	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212400289delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		acataatgagaaaaAAAAAGA	0.100										TSP Lung(8;0.080)			3	3	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216269382	216269382	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216269382delG	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCAGTTCTAGGAAAAAAGAT	0.413													56	25	---	---	---	---	
COL4A3	1285	broad.mit.edu	37	2	228149400	228149400	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228149400delA	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		ATTCCACATTAAAAAACTTTT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228670346	228670347	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228670346_228670347insT								SLC19A3 (87601 upstream) : CCL20 (8211 downstream)																							GTGGTTTATTCTTTTTTTTTAG	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228839657	228839658	+	IGR	INS	-	T	T	rs141757364	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228839657_228839658insT								WDR69 (50631 upstream) : SPHKAP (5012 downstream)																							TTATAGCTACATTTTTTCTTTG	0.248													3	4	---	---	---	---	
FBXO36	130888	broad.mit.edu	37	2	230855399	230855399	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230855399delT	uc002vqa.2	+						FBXO36_uc002vqb.2_Intron|FBXO36_uc010fxi.1_Intron|FBXO36_uc002vqc.2_Intron	NM_174899	NP_777559	Q8NEA4	FBX36_HUMAN	F-box protein 36											ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		ctaagtaaagtttagcataca	0.000													4	2	---	---	---	---	
SP110	3431	broad.mit.edu	37	2	231043177	231043178	+	Intron	INS	-	A	A	rs35552559		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231043177_231043178insA	uc002vqh.3	-						SP110_uc002vqg.3_Intron|SP110_uc002vqi.3_Intron|SP110_uc010fxk.2_Intron|SP110_uc010fxj.2_Intron	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		AACACTATATCAAAAAAAAAAA	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240384890	240384890	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240384890delG								HDAC4 (61544 upstream) : NDUFA10 (515268 downstream)																							GGCTCACCGTGGGGTGTAATT	0.597													4	2	---	---	---	---	
OXTR	5021	broad.mit.edu	37	3	8794521	8794521	+	3'UTR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8794521delC	uc003brc.2	-	4						NM_000916	NP_000907	P30559	OXYR_HUMAN	oxytocin receptor						female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)	CCACTCTCCACCCCACTGAAG	0.542													4	2	---	---	---	---	
TTLL3	26140	broad.mit.edu	37	3	9855251	9855252	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9855251_9855252insA	uc003btg.2	+						ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Intron|TTLL3_uc003btf.3_Intron|TTLL3_uc010hco.1_Intron|TTLL3_uc003bth.3_Intron|TTLL3_uc011atj.1_5'Flank	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3						axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					ataacttgaggctaggagttca	0.054													5	3	---	---	---	---	
KIAA1143	57456	broad.mit.edu	37	3	44795446	44795447	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44795446_44795447insA	uc011bac.1	-							NM_020696	NP_065747	Q96AT1	K1143_HUMAN	hypothetical protein LOC57456												0				BRCA - Breast invasive adenocarcinoma(193;0.00847)|KIRC - Kidney renal clear cell carcinoma(197;0.0465)|Kidney(197;0.0582)		ACCATCTATTTAAAAAAAAAAA	0.153													6	3	---	---	---	---	
DCP1A	55802	broad.mit.edu	37	3	53321906	53321906	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53321906delT	uc003dgs.3	-						DCP1A_uc003dgt.3_Intron	NM_018403	NP_060873	Q9NPI6	DCP1A_HUMAN	DCP1 decapping enzyme homolog A						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TCTGTTTTTGTTTTTTTtttg	0.204													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72104547	72104547	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72104547delA	uc003dpb.1	-											Homo sapiens cDNA FLJ39871 fis, clone SPLEN2015730.																		AGAGGGATGCAAATTCCTGAC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	88302155	88302157	+	IGR	DEL	AGC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88302155_88302157delAGC								C3orf38 (95042 upstream) : EPHA3 (854517 downstream)																							GGGAACAGAGAGCAGTTAAGGAT	0.443													4	2	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	96612372	96612372	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96612372delG	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						ttatttaggtgggaaattaat	0.000													4	2	---	---	---	---	
ZBTB20	26137	broad.mit.edu	37	3	114462528	114462528	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114462528delC	uc003ebk.2	-						ZBTB20_uc003ebl.2_Intron|ZBTB20_uc003ebm.2_Intron|ZBTB20_uc003ebn.2_Intron|ZBTB20_uc003ebp.2_Intron	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		gaatcagaaacttggtgaagg	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117714734	117714735	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117714734_117714735insA								None (None upstream) : IGSF11 (904746 downstream)																							CCAGCTGTCAGAAAAAAATCAG	0.322													4	2	---	---	---	---	
GSK3B	2932	broad.mit.edu	37	3	119670802	119670802	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119670802delA	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	agatggcattaaaaaaaaaaa	0.000													3	3	---	---	---	---	
ZXDC	79364	broad.mit.edu	37	3	126192685	126192685	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126192685delG	uc003eiv.2	-						ZXDC_uc010hsh.2_Intron|ZXDC_uc003eix.2_Intron	NM_025112	NP_079388	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C isoform 1						positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|LRR domain binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.155)		CCTTCCTCCTGGGCCCTCACC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	129709855	129709856	+	IGR	INS	-	TT	TT			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129709855_129709856insTT								TRH (13079 upstream) : ALG1L2 (90818 downstream)																							cagaaattcaatttttttttct	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141190081	141190081	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141190081delG								ZBTB38 (21456 upstream) : RASA2 (15845 downstream)																							CTGGCCACCTGGGCTTGTAGG	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	143778967	143778967	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143778967delT								C3orf58 (67758 upstream) : None (None downstream)																							TATTCTGTGCTTTTTTTTTGG	0.368													4	2	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153972076	153972076	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153972076delT	uc011bog.1	+						SGEF_uc011boh.1_Intron|SGEF_uc011boi.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ATTTCTAAACTTTTTTTTGGA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155701449	155701449	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155701449delT								GMPS (45931 upstream) : KCNAB1 (136888 downstream)																							tgccttgtaatttttttttga	0.000													4	3	---	---	---	---	
RSRC1	51319	broad.mit.edu	37	3	158072448	158072449	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158072448_158072449insA	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			CTTTTTCTAGGAAAAAAAAATG	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166785317	166785317	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166785317delA								None (None upstream) : ZBBX (172764 downstream)																							CTTTCTGGAGAAAAAAAACAG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167647592	167647592	+	IGR	DEL	A	-	-	rs5854257		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167647592delA								SERPINI1 (104236 upstream) : GOLIM4 (80062 downstream)																							CATACTTGAGAAAAAAAGCCT	0.428													5	3	---	---	---	---	
PEX5L	51555	broad.mit.edu	37	3	179599095	179599096	+	Intron	DEL	AA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179599095_179599096delAA	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TTCATGAGTTAACCATTCCTAT	0.436													4	2	---	---	---	---	
KNG1	3827	broad.mit.edu	37	3	186461472	186461473	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186461472_186461473insT	uc003fqr.2	+							NM_000893	NP_000884	P01042	KNG1_HUMAN	kininogen 1 isoform 2						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	ATCATATTAACTGCGTTTTACT	0.426													72	42	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187287735	187287735	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187287735delC								RTP4 (198368 upstream) : SST (98961 downstream)																							GGGATTTTAACCTGAAAAGGA	0.418													4	2	---	---	---	---	
SLBP	7884	broad.mit.edu	37	4	1700947	1700947	+	Intron	DEL	T	-	-	rs74555404		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1700947delT	uc003gdi.1	-						SLBP_uc010ibx.1_Intron|SLBP_uc003gdj.1_Intron|SLBP_uc003gdk.1_Intron|SLBP_uc011bvf.1_Intron|SLBP_uc003gdl.1_Intron	NM_006527	NP_006518	Q14493	SLBP_HUMAN	stem-loop (histone) binding protein						DNA replication involved in S phase|histone mRNA 3'-end processing|mRNA export from nucleus|regulation of S phase|termination of RNA polymerase II transcription	cytosol|histone pre-mRNA 3'end processing complex|nucleoplasm	histone pre-mRNA DCP binding|histone pre-mRNA stem-loop binding|protein binding				0		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			GCAATGCCAATTTTTTTTTCT	0.338													4	2	---	---	---	---	
WHSC1	7468	broad.mit.edu	37	4	1926476	1926476	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1926476delA	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gdy.1_Intron|WHSC1_uc010icd.1_Intron|WHSC1_uc003gea.1_Intron|WHSC1_uc010ice.1_Intron|WHSC1_uc003geh.1_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		tcatctctacaaaaaaaaaaa	0.000			T	IGH@	MM								4	5	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2158274	2158275	+	Intron	DEL	GA	-	-	rs140938006		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2158274_2158275delGA	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron|POLN_uc011bvi.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CTGCACACTGGAGTGCATGGGT	0.470								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	3	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3416752	3416764	+	Intron	DEL	CGTGTGAGAGGGA	-	-	rs145348636	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3416752_3416764delCGTGTGAGAGGGA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc010ict.1_Intron|RGS12_uc003ggz.2_Intron|RGS12_uc010icu.1_Intron|RGS12_uc011bvs.1_Intron|RGS12_uc003gha.2_Intron|RGS12_uc010icv.2_Intron|RGS12_uc003ghb.2_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gtgagaggggcgtgtgagagggacgtgtgagag	0.070													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	10882007	10882007	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10882007delC								CLNK (195621 upstream) : MIR572 (488444 downstream)																							taaaatctgacctatatttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17533507	17533507	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17533507delT								CLRN2 (4780 upstream) : LAP3 (45420 downstream)																							cactgagttctttcctCTCAG	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20620790	20620790	+	IGR	DEL	A	-	-	rs75247881		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20620790delA								SLIT2 (2 upstream) : PACRGL (77115 downstream)																							CTGCATTTGGAAAAAAAAAAA	0.303													4	4	---	---	---	---	
LGI2	55203	broad.mit.edu	37	4	25003443	25003443	+	3'UTR	DEL	A	-	-	rs35976646		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25003443delA	uc003grf.2	-	8						NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)				TAAAGTCAGGAAACAACAAAC	0.363													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26105661	26105661	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26105661delT								C4orf52 (174161 upstream) : RBPJ (215671 downstream)																							ctttctcttctttcagttgct	0.000													4	2	---	---	---	---	
C4orf34	201895	broad.mit.edu	37	4	39562649	39562650	+	Intron	INS	-	TT	TT			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39562649_39562650insTT	uc003guo.2	-						uc003gum.1_Intron|C4orf34_uc010ifm.2_Intron	NM_174921	NP_777581	Q96QK8	CD034_HUMAN	hypothetical protein LOC201895							integral to membrane	protein binding				0						ttccagagtgatttttttTTCT	0.015													4	2	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	41169922	41169922	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41169922delC	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						GAGGCCAGAGCCAACATGGTG	0.299													4	2	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41466094	41466094	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41466094delA	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						aagtctgcttaaaatcattcc	0.045													4	2	---	---	---	---	
GABRA2	2555	broad.mit.edu	37	4	46314251	46314252	+	Intron	INS	-	AT	AT	rs144472547	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46314251_46314252insAT	uc003gxc.3	-						GABRA2_uc010igc.2_Intron|GABRA2_uc011bzc.1_Intron|GABRA2_uc003gxe.2_Intron	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2						gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATAAAAATGTCGTGAAGAATAA	0.198													2	4	---	---	---	---	
GABRA4	2557	broad.mit.edu	37	4	46945333	46945333	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46945333delC	uc003gxg.2	-							NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTCTCTTTTCCTTTCAGTTT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49292354	49292354	+	IGR	DEL	G	-	-	rs111574778		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49292354delG								CWH43 (228261 upstream) : None (None downstream)																							aaggaaggaaggaaggaaaga	0.239													5	3	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54684336	54684336	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54684336delC	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CAAGAGTCAGCCCCAGAACCG	0.483			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	55070938	55070939	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55070938_55070939insT	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GTATAAACACCTTTTTTTTGCT	0.356			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
RUFY3	22902	broad.mit.edu	37	4	71588132	71588132	+	5'UTR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71588132delT	uc003hfq.2	+	1					RUFY3_uc003hfp.3_Intron|RUFY3_uc011cax.1_5'UTR|RUFY3_uc003hfr.2_5'UTR	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2						negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			GTATTTTTCCTTTTTTTTTTT	0.323													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	71944000	71944000	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71944000delT								DCK (47373 upstream) : SLC4A4 (109003 downstream)																							agatgacagatttttttttcc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80497667	80497668	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80497667_80497668delGT								GK2 (168295 upstream) : GDEP (250957 downstream)																							GAGAGACAGAGTGTGTGTGTGT	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80584434	80584434	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80584434delG								GK2 (255062 upstream) : GDEP (164191 downstream)																							ctaagtttgtggctggtgttt	0.000													4	2	---	---	---	---	
SCD5	79966	broad.mit.edu	37	4	83650629	83650629	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83650629delT	uc003hna.2	-						SCD5_uc003hnb.3_Intron|SCD5_uc003hnc.2_Intron	NM_001037582	NP_001032671	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				GATTTCACCCTCCCCCCGGCA	0.453													4	2	---	---	---	---	
FAM175A	84142	broad.mit.edu	37	4	84393690	84393691	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84393690_84393691insT	uc003hou.2	-						FAM175A_uc003hot.2_5'Flank|FAM175A_uc003hov.2_Intron	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						TTTGGGAATCGTTTTTTTTGAA	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	92769330	92769330	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92769330delA								FAM190A (245961 upstream) : GRID2 (456220 downstream)																							caggtaacataaaaagggttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	104756360	104756360	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104756360delT								TACR3 (115387 upstream) : CXXC4 (636985 downstream)																							TGGCATGATATTTTTTTTTAA	0.318													4	2	---	---	---	---	
HADH	3033	broad.mit.edu	37	4	108942696	108942696	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108942696delT	uc003hyq.2	+						HADH_uc010ilx.2_Intron|HADH_uc010ily.2_Intron|HADH_uc003hyr.2_Intron	NM_005327	NP_005318	Q16836	HCDH_HUMAN	L-3-hydroxyacyl-Coenzyme A dehydrogenase						fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)	TATATATGTATTTTTTTTCAG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117078503	117078503	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117078503delG								None (None upstream) : MIR1973 (142378 downstream)																							cttaaaaactggggtttttgt	0.000													4	2	---	---	---	---	
SPATA5	166378	broad.mit.edu	37	4	124109782	124109782	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124109782delT	uc003iez.3	+							NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						CCCCCGTAGCTTTTTTCTTTC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	135143770	135143770	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135143770delC								PABPC4L (20867 upstream) : None (None downstream)																							GTTTTGTTTTCCCTGAATGAT	0.303													4	2	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139949653	139949654	+	Intron	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139949653_139949654delGT	uc003ihl.2	+						CCRN4L_uc003ihk.1_Intron	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					TGCTGTGGCAGTGTGTGTGTGC	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	163967065	163967065	+	IGR	DEL	T	-	-	rs71962434		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163967065delT								FSTL5 (881879 upstream) : NAF1 (80795 downstream)																							TCACCATTTGTTTTTTTTTTA	0.358													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	169254489	169254489	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169254489delA								DDX60 (14531 upstream) : DDX60L (23398 downstream)																							CACTCTGGAGAAAAAAAAACC	0.294													5	3	---	---	---	---	
GPM6A	2823	broad.mit.edu	37	4	176594562	176594562	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176594562delA	uc003iuf.2	-						GPM6A_uc011ckj.1_Intron|GPM6A_uc003iug.2_Intron|GPM6A_uc003iuh.2_Intron	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		AGCCCTTTGGAAAAAAAAAAC	0.343													7	4	---	---	---	---	
FAM92A3	403315	broad.mit.edu	37	4	183959522	183959522	+	RNA	DEL	A	-	-	rs3039659		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183959522delA	uc003ivi.3	+	1		c.705delA				NR_003612				Homo sapiens family with sequence similarity 92, member A3, mRNA (cDNA clone IMAGE:4822144).												0						ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190630511	190630511	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190630511delG								None (None upstream) : FRG1 (231463 downstream)																							CTACAGAAATGGGGAGAAGCA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1795468	1795469	+	IGR	INS	-	G	G	rs77372099		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1795468_1795469insG								LOC728613 (161348 upstream) : MRPL36 (3031 downstream)																							GGAAATGCATAGACAGCTCCTA	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3347317	3347317	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3347317delC								C5orf38 (591805 upstream) : IRX1 (248851 downstream)																							TTATACTTTTCCTTTGGAATC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8390950	8390950	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8390950delC	uc003jeh.1	-											Homo sapiens cDNA clone IMAGE:5297486.																		AGGCAGAGGACCAGGGGAAAC	0.567													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11104799	11104800	+	Intron	DEL	CC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11104799_11104800delCC	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GTGTCTGAATCCCCCAGGAGCT	0.446													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13806942	13806942	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13806942delT	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ACTTGAGGGGTTTTTTTTCTC	0.368									Kartagener_syndrome				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23832501	23832502	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23832501_23832502insA								PRDM9 (303797 upstream) : CDH10 (654708 downstream)																							tgtggggcaccaagaaggcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30532878	30532878	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30532878delC								None (None upstream) : CDH6 (660918 downstream)																							ACAAAAGAATCCATTCTCATC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30850405	30850405	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30850405delT								None (None upstream) : CDH6 (343391 downstream)																							AGCTGGGTCATTTTTTTTTAA	0.333													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37337631	37337631	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37337631delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGTTTTCAGAAAAAAAAAGA	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40405921	40405921	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40405921delA								DAB2 (980586 upstream) : PTGER4 (274111 downstream)																							CAAGAAGCTGAAAGGGAATTC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	41623402	41623407	+	IGR	DEL	CATATT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41623402_41623407delCATATT								PLCXD3 (112672 upstream) : OXCT1 (106761 downstream)																							AGGATCCACACATATTCATAAAGGAC	0.403													4	2	---	---	---	---	
CCDC152	100129792	broad.mit.edu	37	5	42800055	42800056	+	3'UTR	INS	-	A	A	rs147679303	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42800055_42800056insA	uc003jmx.3	+	9					CCDC152_uc011cpr.1_3'UTR|SEPP1_uc011cps.1_RNA|SEPP1_uc011cpt.1_RNA|SEPP1_uc011cpu.1_RNA|SEPP1_uc011cpv.1_RNA|SEPP1_uc003jna.2_RNA	NM_001134848	NP_001128320	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152												0						CATTCTTGCTTAATAGTATTAA	0.337													4	2	---	---	---	---	
ARL15	54622	broad.mit.edu	37	5	53541426	53541426	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53541426delT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				tggggacttcttttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	64341449	64341449	+	IGR	DEL	T	-	-	rs67210336		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64341449delT								CWC27 (26859 upstream) : ADAMTS6 (103115 downstream)																							ttctactcacttttttttttg	0.000													2	4	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66075222	66075224	+	Intron	DEL	TTT	-	-	rs72080184		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66075222_66075224delTTT	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CACATAGCACttttttttttttt	0.384													4	3	---	---	---	---	
HOMER1	9456	broad.mit.edu	37	5	78721074	78721074	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78721074delA	uc003kfy.2	-						HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		CCGGAGTAGGAAAAAAAAAAA	0.378													6	4	---	---	---	---	
CMYA5	202333	broad.mit.edu	37	5	79000538	79000539	+	Intron	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79000538_79000539delGA	uc003kgc.2	+							NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5							perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		gagaaagagggagagagagaga	0.312													4	2	---	---	---	---	
ELL2	22936	broad.mit.edu	37	5	95270295	95270296	+	Intron	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95270295_95270296delGA	uc003klr.3	-							NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CTTTCCACTGGAGAGAGAGAGA	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	107084122	107084123	+	IGR	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107084122_107084123delTG								EFNA5 (77526 upstream) : FBXL17 (110617 downstream)																							GAAAACATGCTGTGACCATCAT	0.406													4	2	---	---	---	---	
PJA2	9867	broad.mit.edu	37	5	108727188	108727188	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108727188delT	uc003kos.3	-							NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		attagacaccttttttttttc	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114284084	114284085	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114284084_114284085insA								KCNN2 (451888 upstream) : TRIM36 (176382 downstream)																							CTTTGAAAAGGAAAAAAAAATG	0.337													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125214752	125214752	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125214752delT								None (None upstream) : GRAMD3 (481036 downstream)																							ATGTGAATTCTTTAGTCACTT	0.338													4	2	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131144015	131144016	+	Intron	DEL	CT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131144015_131144016delCT	uc003kvv.1	-							NM_015256		Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTTATCTCACCTACCCTTCAAA	0.317													4	2	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134123927	134123927	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134123927delT	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			agatTATCACTTTTTTTTTTT	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	137969213	137969213	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137969213delC								HSPA9 (58098 upstream) : CTNNA1 (119894 downstream)																							tcactccactccagcctcact	0.000													4	2	---	---	---	---	
MATR3	9782	broad.mit.edu	37	5	138645098	138645098	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138645098delT	uc003ldu.2	+						MATR3_uc010jfb.2_Intron|MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Intron|MATR3_uc003ldx.2_Intron|MATR3_uc010jfc.2_Intron|MATR3_uc003ldy.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Intron|MATR3_uc003lea.2_Intron|MATR3_uc003leb.2_5'Flank	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GGAAGGGTCATTTTCTTTTCA	0.313													4	2	---	---	---	---	
DIAPH1	1729	broad.mit.edu	37	5	140911747	140911747	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140911747delT	uc003llb.3	-						DIAPH1_uc003llc.3_Intron|DIAPH1_uc010jgc.1_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			aattttttggttttttttttt	0.000													4	2	---	---	---	---	
DIAPH1	1729	broad.mit.edu	37	5	140966329	140966329	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140966329delT	uc003llb.3	-						DIAPH1_uc003llc.3_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACACAGGGTTAGATGGTCC	0.433													0	8	---	---	---	---	
RNF14	9604	broad.mit.edu	37	5	141364714	141364715	+	Intron	DEL	AC	-	-	rs150158676		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141364714_141364715delAC	uc003lly.2	+						RNF14_uc003llz.2_Intron|RNF14_uc003lma.2_Intron|RNF14_uc003lmb.2_Intron|RNF14_uc003lmc.2_Intron|RNF14_uc011dbg.1_Intron|RNF14_uc011dbh.1_Intron|RNF14_uc003lmd.2_Intron	NM_183399	NP_899646	Q9UBS8	RNF14_HUMAN	ring finger protein 14 isoform 1						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|protein ubiquitination|regulation of androgen receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|small conjugating protein ligase activity|transcription coactivator activity|zinc ion binding				0		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		aagttttcaaacacagaaaatt	0.109													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141418381	141418382	+	IGR	INS	-	TT	TT	rs10662242		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141418381_141418382insTT								GNPDA1 (25761 upstream) : NDFIP1 (69942 downstream)																							TCTTCCTCTTCTTTTTTTTTTT	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141551204	141551205	+	IGR	INS	-	A	A	rs112253874		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141551204_141551205insA								NDFIP1 (17198 upstream) : SPRY4 (138787 downstream)																							AGGTCATTGTTAAAAAAAAAAA	0.376													4	2	---	---	---	---	
PRELID2	153768	broad.mit.edu	37	5	145191829	145191829	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145191829delA	uc003lnp.1	-						PRELID2_uc003lnq.1_Intron|PRELID2_uc003lno.1_Intron|PRELID2_uc003lnr.1_Intron	NM_182960	NP_892005	Q8N945	PRLD2_HUMAN	PRELI domain containing 2 isoform a												0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCAAACTTGAAAAAAAAAAA	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	145742601	145742602	+	IGR	INS	-	A	A	rs147342869	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145742601_145742602insA								POU4F3 (22518 upstream) : TCERG1 (84271 downstream)																							ACTTTTCTCTTaaacaaaacaa	0.356													4	2	---	---	---	---	
PDE6A	5145	broad.mit.edu	37	5	149240690	149240697	+	Intron	DEL	CACGGAAA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149240690_149240697delCACGGAAA	uc003lrg.3	-							NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A						cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGAGGAGAATCACGGAAACAGAACATTT	0.255													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152108344	152108344	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152108344delG	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		tgaatacagtgggtattatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153815910	153815910	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153815910delA	uc003lvi.2	-											Homo sapiens cDNA FLJ38109 fis, clone D3OST2001788.																		agtggaatgcaaaaaaaaagg	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159017506	159017506	+	IGR	DEL	T	-	-	rs74387802		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159017506delT								LOC285627 (124222 upstream) : ADRA1B (326234 downstream)																							TATGTGTGTGTTTTTTTAAAC	0.393													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161108691	161108691	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161108691delT								GABRB2 (133561 upstream) : GABRA6 (3967 downstream)																							TTTAACTCCCTTAATAGTGTG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164800896	164800896	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164800896delA								None (None upstream) : None (None downstream)																							AATCTCAAAGAAAAAAATGTT	0.244													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167394163	167394163	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167394163delT	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGGCTGTGTCTTTTTTTTTTC	0.478													4	3	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168495847	168495848	+	Intron	INS	-	A	A	rs145436062	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168495847_168495848insA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTAAAAGCCTCAAAAAAAAAAT	0.351													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168584960	168584960	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168584960delC	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			agagagaaaacagaattaaaa	0.000													4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170676104	170676104	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170676104delA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ctcccagcacaaaatttgcca	0.000			T	TRD@	ALL								4	2	---	---	---	---	
ZNF879	345462	broad.mit.edu	37	5	178449980	178449987	+	5'Flank	DEL	GGGAGTTG	-	-	rs72062180		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178449980_178449987delGGGAGTTG	uc003mjt.3	+							NM_001136116	NP_001129588	B4DU55	ZN879_HUMAN	zinc finger protein 879						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						TGATAGCGCTGGGAGTTGGGCTTTATTT	0.250													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178510272	178510273	+	IGR	DEL	AT	-	-	rs147516432		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178510272_178510273delAT								ZNF354C (2583 upstream) : ADAMTS2 (30578 downstream)																							tgggtagtagataatgtggtat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180118785	180118785	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180118785delC								FLT4 (42161 upstream) : OR2Y1 (47338 downstream)																							CCCTGATGATCCAGCCGTCAT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10740443	10740443	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10740443delG								TMEM14C (9085 upstream) : SYCP2L (7552 downstream)																							gggtcagagtggggcttcagt	0.000													4	2	---	---	---	---	
ACOT13	55856	broad.mit.edu	37	6	24701476	24701476	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24701476delG	uc003nek.2	+						ACOT13_uc010jpv.2_Intron	NM_018473	NP_060943	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13 isoform 1						protein homotetramerization	mitochondrion	acyl-CoA thioesterase activity				0						TCACATATTTGGGAAAAGAAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26615347	26615347	+	IGR	DEL	A	-	-	rs11350120		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26615347delA								ABT1 (15072 upstream) : ZNF322A (19265 downstream)																							GCCCAACGATAAAAAAATTGT	0.458													4	3	---	---	---	---	
DDR1	780	broad.mit.edu	37	6	30849512	30849513	+	5'Flank	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30849512_30849513delTG	uc003nrr.2	+						DDR1_uc010jse.2_5'Flank|DDR1_uc003nrq.2_5'Flank|DDR1_uc003nrs.2_5'Flank|DDR1_uc003nrt.2_5'Flank	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1						cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	CACCTTTTGCTGTGTGTGCCCT	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37555102	37555102	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37555102delT								C6orf129 (87402 upstream) : MDGA1 (45182 downstream)																							AAGGAGCTGCttttttttctt	0.264													9	6	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39308640	39308640	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39308640delG	uc003oot.2	-						KIF6_uc003oos.2_Intron|KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						GGCTTCTTGAGGGGAGGAATG	0.353													4	2	---	---	---	---	
FOXP4	116113	broad.mit.edu	37	6	41553444	41553444	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41553444delC	uc003oql.2	+						FOXP4_uc003oqm.2_Intron|FOXP4_uc003oqn.2_Intron	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN	forkhead box P4 isoform 1						embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					CTCCCCTCATCCCCATTCATT	0.527													4	2	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44140399	44140400	+	Intron	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44140399_44140400delTG	uc003owt.1	+							NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCCTCTCCACTGTGTGTGTGGG	0.421											OREG0017466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46541353	46541354	+	Intron	DEL	CC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46541353_46541354delCC	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						agcactggttccaggGCACAGG	0.248													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57371754	57371755	+	Intron	INS	-	T	T	rs111511096		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57371754_57371755insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATATTAAATACTTTGAGTTGCT	0.332													2	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57386124	57386124	+	Intron	DEL	A	-	-	rs11347363		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57386124delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTAGCTGGAGAAAAAAAACCC	0.363													4	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57400604	57400604	+	Intron	DEL	A	-	-	rs72046320		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57400604delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ccatctcaagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
LGSN	51557	broad.mit.edu	37	6	64004570	64004570	+	Intron	DEL	T	-	-	rs80071559		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64004570delT	uc003peh.2	-						LGSN_uc003pei.2_Intron|LGSN_uc003pej.1_Intron	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase						glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	CTGTTTGTTCTTTTTTTTTTC	0.308													4	4	---	---	---	---	
PHIP	55023	broad.mit.edu	37	6	79742689	79742689	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79742689delA	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		cagcaagcataaaaacaacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87351756	87351757	+	IGR	INS	-	C	C	rs147650087	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87351756_87351757insC								SNHG5 (963305 upstream) : HTR1E (295267 downstream)																							ACTAGTCCTCACCCCCGGACTA	0.243													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88981760	88981761	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88981760_88981761insT								CNR1 (105993 upstream) : RNGTT (338228 downstream)																							tccaataacagtttttgtgctg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	100235069	100235069	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100235069delT								PRDM13 (171615 upstream) : MCHR2 (132717 downstream)																							CCACAGAGTCTTTTATCTTCA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108287571	108287571	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108287571delT								SEC63 (8089 upstream) : OSTM1 (75044 downstream)																							aaaccttcccttttttccatt	0.000													4	2	---	---	---	---	
REV3L	5980	broad.mit.edu	37	6	111628362	111628362	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111628362delA	uc003puy.3	-						REV3L_uc003pux.3_Intron|REV3L_uc003puz.3_Intron|REV3L_uc003puw.3_Intron	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta						DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ACTATTCCataaaaaaaacaa	0.194								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
SLC35F1	222553	broad.mit.edu	37	6	118426678	118426678	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118426678delG	uc003pxx.3	+							NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		ctcacaccgtggtcattcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	119701144	119701144	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119701144delA								MAN1A1 (30218 upstream) : None (None downstream)																							gagcaagtgcaaaagctttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	122474710	122474710	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122474710delC								GJA1 (703838 upstream) : HSF2 (245986 downstream)																							CATACCAATTCCCCCATTCTA	0.388													4	2	---	---	---	---	
ARG1	383	broad.mit.edu	37	6	131904255	131904256	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131904255_131904256insT	uc003qcp.1	+	6	674_675	c.616_617insT	c.(616-618)CTAfs	p.L206fs	ARG1_uc003qco.1_Intron|ARG1_uc010kfm.1_Frame_Shift_Ins_p.L214fs|MED23_uc003qcq.2_Intron	NM_000045	NP_000036	P05089	ARGI1_HUMAN	arginase 1	206					arginine catabolic process|urea cycle	cytosol	arginase activity			ovary(1)	1	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	AGTGGACAGACTAGGAATTGGC	0.356													241	129	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136496064	136496064	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136496064delA	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	aaaaagaactaaaaactagag	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	149461178	149461178	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149461178delA								UST (63053 upstream) : TAB2 (78581 downstream)																							TTATGGATTTAAAAAAAAAAC	0.313													3	3	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168986689	168986689	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168986689delT	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		tgaagtccacttttttttgtc	0.000													3	3	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	169997555	169997555	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169997555delG	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		ccagaaaggtgggcagatgaa	0.000													4	2	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2250402	2250402	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2250402delC	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CTCTACCAGGCCCACAGCCAA	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3200684	3200685	+	Intron	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3200684_3200685delGT	uc003smw.1	-											Homo sapiens hypothetical protein LOC389457, mRNA (cDNA clone IMAGE:5267367).																		gtgtgtgtgcgtgtgtgtgtgC	0.302													4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	6819606	6819606	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6819606delT	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc011jxc.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						gcctggctaattttttttttt	0.000													4	2	---	---	---	---	
MIOS	54468	broad.mit.edu	37	7	7611892	7611893	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7611892_7611893insT	uc003srf.2	+						MIOS_uc010ktp.1_Intron	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog												0						GTTCTTTCTCCTTTTTTTTCAA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9343236	9343237	+	IGR	INS	-	C	C	rs139713672	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9343236_9343237insC								NXPH1 (550644 upstream) : PER4 (330663 downstream)																							CTGCAACACTTCGAGCATCATC	0.322													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	13812614	13812614	+	IGR	DEL	T	-	-	rs34883954		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13812614delT								None (None upstream) : ETV1 (118244 downstream)																							atagaagtaattttttttttt	0.085													8	4	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14875314	14875315	+	Intron	DEL	TC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14875314_14875315delTC	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	GGAGGTCAAGTCTCTCTCTCTC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15799229	15799229	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15799229delA								MEOX2 (72921 upstream) : ISPD (327923 downstream)																							atggatgaagaaaaaaaaaaa	0.015													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15961386	15961387	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15961386_15961387insT								MEOX2 (235078 upstream) : ISPD (165765 downstream)																							AAGCTTTTTGATTTTTTTTTGC	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24113689	24113689	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24113689delG								STK31 (169324 upstream) : NPY (210120 downstream)																							CTCCCTCTCAGGGTCATTTCT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24347047	24347048	+	IGR	INS	-	A	A	rs111830045		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24347047_24347048insA								NPY (15570 upstream) : MPP6 (266037 downstream)																							aactattggagaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25655286	25655286	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25655286delA	uc003sxp.1	-											Homo sapiens cDNA FLJ32817 fis, clone TESTI2002877.																		CATGTCTTGGAGGATGTTAGC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25919836	25919837	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25919836_25919837insA								NPVF (651731 upstream) : MIR148A (69702 downstream)																							TATTTTCCCTTAAAAAAAAAAC	0.337													3	3	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27570577	27570578	+	Intron	DEL	AC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27570577_27570578delAC	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	gcacacacatacacacacacac	0.267													1	5	---	---	---	---	
CPVL	54504	broad.mit.edu	37	7	29119648	29119648	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29119648delG	uc003szv.2	-						CPVL_uc003szw.2_Intron|CPVL_uc003szx.2_Intron	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like						proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						TGGCTGAGGTGGGAAGATGGC	0.468													4	2	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30805615	30805615	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30805615delC	uc010kwe.2	+							NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						AAACATCTGGCCCCCATGTAG	0.557													4	2	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30918479	30918479	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30918479delC	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron|AQP1_uc011kac.1_Intron|FAM188B_uc003tbu.2_Intron	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						ACATGTGCCTCCCCCTGAAGT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33682583	33682583	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33682583delT								BBS9 (36903 upstream) : BMPER (262529 downstream)																							tacttttgactttttttTTCA	0.005													4	2	---	---	---	---	
NPSR1	387129	broad.mit.edu	37	7	34699827	34699827	+	Intron	DEL	G	-	-	rs35018938		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34699827delG	uc003teg.1	+						AAA1_uc010kwo.1_Intron|AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron|AAA1_uc003teb.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Intron|NPSR1_uc010kwt.1_Intron|NPSR1_uc010kwu.1_Intron|NPSR1_uc010kwv.1_Intron|NPSR1_uc003tei.1_Intron|NPSR1_uc010kww.1_Intron|NPSR1_uc011kar.1_Intron	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma							cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	CACTGGACAAGGAGAAAAGCA	0.413													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37565338	37565339	+	IGR	DEL	CC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37565338_37565339delCC								ELMO1 (76808 upstream) : GPR141 (214657 downstream)																							CTTGACAGATCCAAAAGGAAGC	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37772666	37772666	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37772666delA	uc003tfl.2	+											Homo sapiens, clone IMAGE:3881224, mRNA.																		TGTGTCAGGTAAGGCAGAGAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41205779	41205779	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41205779delT								C7orf10 (305422 upstream) : INHBA (522824 downstream)																							TTTAATGAAGTTTTTTTTTCC	0.279													2	4	---	---	---	---	
GLI3	2737	broad.mit.edu	37	7	42195424	42195424	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42195424delT	uc011kbh.1	-							NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GCCTCCTGTATTTTTTTTTTA	0.408									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	43034737	43034737	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43034737delT								MRPL32 (57286 upstream) : HECW1 (117461 downstream)																							ctccttcttatttttttttag	0.000													4	2	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44269854	44269854	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44269854delG	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron|CAMK2B_uc003tkn.2_5'UTR	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						TGTCATAGCTGGGTAGGCCGG	0.577													4	2	---	---	---	---	
OGDH	4967	broad.mit.edu	37	7	44719910	44719910	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44719910delA	uc003tln.2	+						OGDH_uc011kbx.1_Intron|OGDH_uc011kby.1_Intron|OGDH_uc003tlp.2_Intron|OGDH_uc011kbz.1_Intron|OGDH_uc003tlo.1_Intron	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor						glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	agctctgactaatacaAGGGT	0.179													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47612942	47612942	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47612942delG	uc003tnw.2	-							NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						CTCCCACCCTGGGGACACCCT	0.597													4	2	---	---	---	---	
PKD1L1	168507	broad.mit.edu	37	7	47941182	47941182	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47941182delC	uc003tny.1	-							NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						AGAACGCGTTCCCCCAGCACG	0.592													4	2	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51230725	51230725	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51230725delT	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpt.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					cagtgttacattttatcaccg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55794705	55794706	+	IGR	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55794705_55794706delTG								FKBP9L (22445 upstream) : SEPT14 (66531 downstream)																							ctcactgtcttgtgaagttaaa	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64480457	64480457	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64480457delA								ZNF117 (13336 upstream) : INTS4L1 (121146 downstream)																							GGGTATCaagaaaaaaaaaaa	0.119													4	4	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70776262	70776262	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70776262delG	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAAGGTGTGTGGTGTTGGTCA	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75450242	75450245	+	IGR	DEL	CATC	-	-	rs62477645		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75450242_75450245delCATC								CCL24 (7209 upstream) : RHBDD2 (58072 downstream)																							tccatcaattcatccatccatcca	0.000													3	4	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76626477	76626478	+	Intron	INS	-	GT	GT	rs141618293	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626477_76626478insGT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						AAGTGTgtggggtgtgaggtgg	0.015													3	3	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90367431	90367432	+	Intron	DEL	TG	-	-	rs113349487		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90367431_90367432delTG	uc003uky.2	+						CDK14_uc003ukt.1_Intron|CDK14_uc003ukv.1_Intron|CDK14_uc003uku.1_Intron|CDK14_uc003ukx.1_Intron|CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						GTTAGGACTCTGTGTGAATATT	0.252													3	3	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90428183	90428183	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90428183delT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						CAGGGTCAGCTTTTCTATTTT	0.393													4	2	---	---	---	---	
CALCR	799	broad.mit.edu	37	7	93129930	93129930	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93129930delG	uc003umv.1	-						CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	AAATGGAGGTGGGGTAGAATG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100628957	100628957	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100628957delG								ACHE (134418 upstream) : MUC12 (19118 downstream)																							ggtttcaGCTGGAGGGCTGAG	0.303													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101883014	101883014	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101883014delT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TCCCTTAGGGTtttttttttc	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	102799822	102799823	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102799822_102799823delGT								NAPEPLD (9815 upstream) : DPY19L2P2 (15641 downstream)																							gtgaacttgagtgtgactggaa	0.000													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103113880	103113880	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103113880delT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGAGACAAAATAAGGAGGTCA	0.368													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103264881	103264882	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103264881_103264882insT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCCACTCTACtttttttttaa	0.252													4	2	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104525656	104525656	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104525656delC	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						GGGGTAGTAGCCCCCTTGCCC	0.308													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105374288	105374291	+	Intron	DEL	CCAT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105374288_105374291delCCAT	uc003vde.2	-							NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						atccgtccacccatccatccatcc	0.000													3	3	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	106844539	106844539	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106844539delT	uc003ved.2	-						COG5_uc003vec.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						ATTCCTGTTATTTGATGAACT	0.453													4	2	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108138216	108138217	+	Intron	INS	-	A	A	rs146969443	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108138216_108138217insA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						ATCTAAATGATAAAAAAACCTA	0.252													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	110041453	110041453	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110041453delT								EIF3IP1 (441183 upstream) : IMMP2L (261657 downstream)																							tgtgtgcctgtttttgtaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	112398476	112398477	+	IGR	DEL	TC	-	-	rs7778133	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112398476_112398477delTC								C7orf53 (267541 upstream) : TMEM168 (7312 downstream)																							GGTTTTCATTTCTCTCTCTCTC	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	118423140	118423140	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118423140delA								ANKRD7 (540358 upstream) : None (None downstream)																							CATTTTCCAGAAAAAAAAAAG	0.318													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	118513214	118513214	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118513214delT								ANKRD7 (630432 upstream) : None (None downstream)																							ATTCATTCCCTTTTTTCTATT	0.328													4	2	---	---	---	---	
KCND2	3751	broad.mit.edu	37	7	120065367	120065367	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120065367delA	uc003vjj.1	+							NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GAATGAATATAAAAAATATAA	0.398													4	2	---	---	---	---	
C7orf58	79974	broad.mit.edu	37	7	120725341	120725342	+	Intron	INS	-	TG	TG	rs142233697	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120725341_120725342insTG	uc003vjq.3	+						C7orf58_uc003vjr.1_Intron|C7orf58_uc003vjs.3_Intron|C7orf58_uc003vjt.3_Intron|C7orf58_uc010lkk.1_Intron	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GCTGCTGAAACAAACTGCTGGT	0.500													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121710597	121710597	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121710597delA								PTPRZ1 (8509 upstream) : AASS (3003 downstream)																							agagagagagaaaaAAAAAAG	0.154													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123281871	123281871	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123281871delA								ASB15 (3939 upstream) : LMOD2 (13990 downstream)																							CTGAAAATACAAAAAAAAAAA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124927412	124927412	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124927412delT								POT1 (357375 upstream) : None (None downstream)																							taatgacttcttagtcttctc	0.095													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127360096	127360097	+	Intron	DEL	GG	-	-	rs150418758	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127360096_127360097delGG	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TTGGTTCTTTGGAAAAGGTAGA	0.411													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127499176	127499177	+	Intron	INS	-	G	G			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127499176_127499177insG	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TGTGTTTGCATGGGGGGGTGGT	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	129778858	129778858	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129778858delT								KLHDC10 (5265 upstream) : TMEM209 (25697 downstream)																							TGATTTTTTGTTTTTTTTTTA	0.433													3	4	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133075425	133075425	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133075425delC	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				TCCCTTGTGTCCTCTCCTGCT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135032853	135032853	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135032853delC								STRA8 (89611 upstream) : CNOT4 (13700 downstream)																							ATGTCAGTCTCCCCTTTGAGT	0.363													4	2	---	---	---	---	
HIPK2	28996	broad.mit.edu	37	7	139334295	139334296	+	Intron	INS	-	TG	TG	rs147734211	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139334295_139334296insTG	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GCCTGAGGGTATGTGTGTGTGT	0.485													2	5	---	---	---	---	
AGK	55750	broad.mit.edu	37	7	141297187	141297187	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141297187delT	uc003vwi.2	+						AGK_uc011krg.1_Intron	NM_018238	NP_060708	Q53H12	AGK_HUMAN	acylglycerol kinase precursor						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)					TAGGCAAAACTTTTTTTTACA	0.154													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147712152	147712152	+	Intron	DEL	T	-	-	rs66480304		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147712152delT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACATAGCATGTTTTTTTGTTT	0.353										HNSCC(39;0.1)			0	6	---	---	---	---	
ACTR3C	653857	broad.mit.edu	37	7	149987783	149987783	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149987783delA	uc003wgu.1	-							NM_001040135	NP_001035225	Q9C0K3	ARP3C_HUMAN	actin-related protein 3-beta isoform 2						regulation of actin filament polymerization	cytoskeleton	actin binding|ATP binding				0						TTCCAGAAGCAAAAAAAGATT	0.313													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151988400	151988401	+	Intron	INS	-	TGA	TGA			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151988400_151988401insTGA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ttcataggatttgatgatgaag	0.000			N		medulloblastoma								9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	154961781	154961781	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154961781delA								HTR5A (84322 upstream) : INSIG1 (127705 downstream)																							acaagacaacaaaaaATGCAA	0.194													3	4	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155493869	155493870	+	Intron	INS	-	A	A	rs143521704	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155493869_155493870insA	uc010lqk.1	+						RBM33_uc003wme.2_3'UTR|RBM33_uc011kvv.1_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ttaagataattaaaaaaaattt	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155893677	155893677	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155893677delT								SHH (288710 upstream) : C7orf4 (439508 downstream)																							GAGGTCAGAGTTTGCCTTGGA	0.517													4	2	---	---	---	---	
VIPR2	7434	broad.mit.edu	37	7	158913304	158913304	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158913304delA	uc003woh.2	-						VIPR2_uc010lqx.2_Intron|VIPR2_uc010lqy.2_Intron	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2						cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		GCCCGCTGGGAACATGTTCCG	0.483													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3827717	3827717	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3827717delT	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AACAAGGGACTTTCTTTTACA	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	12698418	12698418	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12698418delG								LOC340357 (29508 upstream) : C8orf79 (104733 downstream)																							GCTGCCTGTTGGACATTGCAT	0.433											OREG0018572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	13518597	13518597	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13518597delA								C8orf48 (92801 upstream) : SGCZ (428777 downstream)																							ACAAAACAATAAAAAAACGAA	0.358													4	2	---	---	---	---	
PSD3	23362	broad.mit.edu	37	8	18557377	18557377	+	Intron	DEL	A	-	-	rs112027780		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18557377delA	uc003wza.2	-						PSD3_uc003wyy.2_Intron|PSD3_uc003wyz.2_Intron	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		ATCCCCACCCAAAAAAAAAAA	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23338465	23338465	+	IGR	DEL	C	-	-	rs149736201	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23338465delC								ENTPD4 (23221 upstream) : SLC25A37 (47898 downstream)																							GCGTAAGCTGCCCCCGGGGAC	0.517													4	2	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25090608	25090608	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25090608delC	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xef.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		gccaccttgacccccctgaat	0.000													4	2	---	---	---	---	
PBK	55872	broad.mit.edu	37	8	27687833	27687833	+	Intron	DEL	A	-	-	rs111493994		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27687833delA	uc003xgi.2	-						PBK_uc011lap.1_Intron	NM_018492	NP_060962	Q96KB5	TOPK_HUMAN	PDZ binding kinase						mitosis		ATP binding|protein binding|protein serine/threonine kinase activity				0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		agcataacggaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29826884	29826884	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29826884delT								LOC286135 (15763 upstream) : TMEM66 (93748 downstream)																							Atttttcacattttttttttt	0.159													4	2	---	---	---	---	
UNC5D	137970	broad.mit.edu	37	8	35425010	35425010	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35425010delA	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		cccatcgcttaaaaaaaaaaT	0.199													4	2	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38099572	38099572	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38099572delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.139													3	3	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48845352	48845352	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48845352delA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				taattttttcaaaaaaaaaat	0.254								NHEJ					3	3	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53062819	53062820	+	Intron	DEL	TG	-	-	rs111351277		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53062819_53062820delTG	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTTATGAAAAtgtgtgtgtgtg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53433754	53433755	+	IGR	INS	-	A	A	rs137880416	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53433754_53433755insA								ST18 (111315 upstream) : FAM150A (12843 downstream)																							TGTCTAAGTTTATTGAAATTAT	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	62802981	62802981	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62802981delA								ASPH (175782 upstream) : NKAIN3 (358520 downstream)																							tctccttattaaaaaaaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77799908	77799909	+	IGR	INS	-	CA	CA	rs141001088	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77799908_77799909insCA								ZFHX4 (20388 upstream) : PEX2 (92587 downstream)																							acatgcacatgcacacacacac	0.272													5	4	---	---	---	---	
CNBD1	168975	broad.mit.edu	37	8	88098582	88098582	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88098582delC	uc003ydy.2	+							NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1											ovary(3)	3						tgctgagtaaccccagccctc	0.000													4	2	---	---	---	---	
OSGIN2	734	broad.mit.edu	37	8	90936586	90936586	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90936586delT	uc003yeg.2	+						OSGIN2_uc003yeh.2_Intron	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family						germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			CTAAAAATAGTTTTTTTTTTA	0.199													5	3	---	---	---	---	
SLC26A7	115111	broad.mit.edu	37	8	92269184	92269185	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92269184_92269185insC	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			ggtatctgttgcccAGCTTGCT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	99356296	99356296	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99356296delT								NIPAL2 (49675 upstream) : KCNS2 (82954 downstream)																							GAAAGGATGGTTACTAAAATT	0.313													4	2	---	---	---	---	
ANGPT1	284	broad.mit.edu	37	8	108508878	108508878	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108508878delT	uc003ymn.2	-						ANGPT1_uc003ymo.2_Intron	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			ATCTTTTTAATTTTTTTTCTC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	111668780	111668780	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111668780delT								KCNV1 (680704 upstream) : None (None downstream)																							caaaatgatcttatgcaatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117818510	117818510	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117818510delC								UTP23 (31591 upstream) : RAD21 (39664 downstream)																							CTCCTCAGATCCCACCACAAT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122766214	122766214	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122766214delC								HAS2AS (109281 upstream) : None (None downstream)																							TGCACAGGGTCCTCCACGAGG	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123557644	123557644	+	IGR	DEL	A	-	-	rs79180599		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123557644delA								HAS2AS (900711 upstream) : ZHX2 (236257 downstream)																							AGATAACAACAAAAAAAAAGC	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127310320	127310320	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127310320delT								TRIB1 (859678 upstream) : FAM84B (254367 downstream)																							tcaccacatgttttacagtga	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128710238	128710239	+	Intron	DEL	CA	-	-	rs34141920		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128710238_128710239delCA	uc003ysg.2	-											Homo sapiens, clone IMAGE:5554747, mRNA.																		AAAATACAAGcacacacacaca	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135373566	135373567	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135373566_135373567insT								ST3GAL1 (789383 upstream) : ZFAT (116466 downstream)																							AATTGCTGTGATTTTTTTTTCA	0.376													4	3	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139286164	139286164	+	Intron	DEL	T	-	-	rs112920711		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139286164delT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ctacgccacctacaagctgag	0.000										HNSCC(54;0.14)			4	2	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	331269	331270	+	Intron	DEL	AC	-	-	rs62533405		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:331269_331270delAC	uc003zgf.2	+						DOCK8_uc011lls.1_Intron|DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgg.2_Intron|DOCK8_uc003zgh.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CTCAAGTGTTACGTGCTTATGT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1102968	1102968	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1102968delA								DMRT2 (45415 upstream) : SMARCA2 (912374 downstream)																							ATAAATCACTAAAAGGTGGAT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1770693	1770693	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1770693delT								DMRT2 (713140 upstream) : SMARCA2 (244649 downstream)																							CATGTTCTGCTTACCCCGGCT	0.124													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8730941	8730942	+	Intron	INS	-	C	C	rs144682589	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8730941_8730942insC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCCATTCAAGACACCGGAATGA	0.406										TSP Lung(15;0.13)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	28939465	28939465	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28939465delG								MIR873 (50512 upstream) : None (None downstream)																							TCATATACTTGACTACCCCTA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36787651	36787652	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36787651_36787652delGT								MELK (109973 upstream) : PAX5 (50879 downstream)																							TTGGTGGAGGGTGTGTGTGTGT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	47202618	47202619	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:47202618_47202619insA								KGFLP1 (454233 upstream) : None (None downstream)																							CAAACTTCTCCAAAAAAAAAGT	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460715	66460716	+	5'Flank	INS	-	T	T	rs58550614		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460715_66460716insT	uc004aeb.2	-						uc004aec.2_Intron					Homo sapiens cDNA clone IMAGE:3941306, partial cds.																		tgtatttgttgtttttggtgtc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66461548	66461549	+	Intron	INS	-	C	C	rs149299153		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66461548_66461549insC	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																		agcttaaggagttttgggtcac	0.000													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66477869	66477869	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66477869delA								FAM74A4 (983483 upstream) : LOC442421 (18601 downstream)																							aataaaccataaaaaaatctg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68400387	68400387	+	IGR	DEL	C	-	-	rs111626719		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68400387delC								FAM27B (606198 upstream) : MIR1299 (601852 downstream)																							GATCTGGGGTCCTCTGATGAG	0.532													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68416273	68416273	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68416273delG								FAM27B (622084 upstream) : MIR1299 (585966 downstream)																							CTAGGtttttggttgttcttt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430746	68430746	+	IGR	DEL	T	-	-	rs113456947		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430746delT								FAM27B (636557 upstream) : MIR1299 (571493 downstream)																							TTTTACTAGCTTCTTATATCC	0.313													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	72415926	72415926	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72415926delG								PTAR1 (41050 upstream) : C9orf135 (19805 downstream)																							TTGTGGACTTGGAAATGTAGA	0.328													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82252752	82252753	+	Intron	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82252752_82252753delTG	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						CAGAATTGCCTGTGTGTGTGTG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	82544320	82544320	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82544320delA								TLE4 (202663 upstream) : None (None downstream)																							ACAAGAGCTGAAAAAAAATGT	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90470694	90470694	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90470694delG								CTSL3 (68895 upstream) : C9orf79 (27047 downstream)																							TGTCTTTCCAGGGTGCCTCTA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94150349	94150350	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94150349_94150350delGT								AUH (26143 upstream) : NFIL3 (20979 downstream)																							gtggtgtggggtgtgtgtgtgt	0.312													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94668290	94668290	+	Intron	DEL	A	-	-	rs76471041		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94668290delA	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GAATTCTTTGAAAAAAAAAAA	0.343													3	3	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101237629	101237629	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101237629delA	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CAGAAACTTTaaaaaaaaaaa	0.348													4	2	---	---	---	---	
LPPR1	54886	broad.mit.edu	37	9	103887730	103887730	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103887730delT	uc004bbb.2	+						LPPR1_uc011lvi.1_Intron	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3							integral to membrane	catalytic activity				0						CCTGGAAACCTTTTTTATGAC	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106045143	106045143	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106045143delT	uc004bbt.2	-											Homo sapiens cDNA clone IMAGE:5266449.																		TAGTCAATCATTTTTCTGATG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	108413853	108413853	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108413853delG								FKTN (10455 upstream) : TAL2 (10885 downstream)																							CACTTGGCCTGGCAGAAATCC	0.373													4	2	---	---	---	---	
PALM2	114299	broad.mit.edu	37	9	112528718	112528718	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112528718delA	uc004beg.2	+						PALM2_uc004bef.2_Intron	NM_001037293	NP_001032370	Q8IXS6	PALM2_HUMAN	paralemmin 2 isoform b						regulation of cell shape	plasma membrane				ovary(2)	2						ATAGGCTATTAATTCTCAAAG	0.473													4	2	---	---	---	---	
TXN	7295	broad.mit.edu	37	9	113006614	113006617	+	Intron	DEL	TATG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113006614_113006617delTATG	uc004bep.1	-						TXN_uc004beq.1_Intron	NM_003329	NP_003320	P10599	THIO_HUMAN	thioredoxin						cell proliferation|cell-cell signaling|cellular component movement|electron transport chain|glycerol ether metabolic process|nucleobase, nucleoside and nucleotide interconversion|positive regulation of DNA binding|regulation of protein import into nucleus, translocation|response to radiation|signal transduction|transcription, DNA-dependent|transport	cytosol|extracellular region|nucleoplasm	electron carrier activity|protein binding|protein disulfide oxidoreductase activity				0				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		tatatatacatatgtataaatatg	0.216													4	2	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	116034972	116034973	+	Intron	DEL	TT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116034972_116034973delTT	uc010muu.1	-						CDC26_uc004bgw.2_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						TTCTAAAGTCtttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120623777	120623777	+	IGR	DEL	C	-	-	rs60852509	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120623777delC								TLR4 (144013 upstream) : None (None downstream)																							aaataaaaaacaaacaaacaa	0.289													4	2	---	---	---	---	
NUP188	23511	broad.mit.edu	37	9	131718396	131718396	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131718396delT	uc004bws.1	+						NUP188_uc004bwq.1_Intron	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						aTTTAACCACTTTTTTTTTGT	0.124													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132289774	132289774	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132289774delG								C9orf106 (204892 upstream) : C9orf50 (84732 downstream)																							aggtgcttctggcagcagagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133226294	133226294	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133226294delA								NCS1 (226711 upstream) : ASS1 (93800 downstream)																							agtctcaaggaaaaaaaaagg	0.000													4	2	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134955504	134955504	+	5'Flank	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134955504delG	uc004cbe.1	-						MED27_uc004cbf.1_5'Flank|MED27_uc011mco.1_5'Flank|MED27_uc004cbg.3_5'Flank	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		CTTGCACTCTGGGGAATCATA	0.303													4	2	---	---	---	---	
SETX	23064	broad.mit.edu	37	9	135170844	135170844	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135170844delT	uc004cbk.2	-						SETX_uc004cbj.2_Intron|SETX_uc010mzt.2_Intron	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin						cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCCCTGATTCTTTTTTTTTAT	0.398													4	2	---	---	---	---	
NELF	26012	broad.mit.edu	37	9	140349402	140349402	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140349402delA	uc004cna.2	-						C9orf167_uc011mew.1_Intron|NELF_uc011mex.1_5'Flank|NELF_uc010nci.2_Intron|NELF_uc011mey.1_Intron|NELF_uc011mez.1_Intron|NELF_uc004cmz.2_Intron|NELF_uc004cnc.2_Intron|NELF_uc004cnb.2_Intron	NM_001130969	NP_001124441	Q6X4W1	NELF_HUMAN	nasal embryonic LHRH factor isoform a							nucleus|plasma membrane					0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000222)|Epithelial(140;0.000888)		CAAAACGGGCAAAAAAGCTTC	0.617													4	2	---	---	---	---	
LARP4B	23185	broad.mit.edu	37	10	903080	903080	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:903080delA	uc001ifs.1	-							NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B								nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						cacaaaggccaaaaacacaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5430995	5430995	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5430995delT								UCN3 (14826 upstream) : TUBAL3 (4067 downstream)																							ACGCATATCCTTTTTAAAAGT	0.443													4	2	---	---	---	---	
PRKCQ	5588	broad.mit.edu	37	10	6541457	6541458	+	Intron	DEL	GA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6541457_6541458delGA	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						CACAGCAGGTGAGAGAGAATAA	0.366													4	2	---	---	---	---	
ITIH5	80760	broad.mit.edu	37	10	7667728	7667728	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7667728delA	uc001ijq.2	-						ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						attctgtctcaaaaaaaaaaa	0.015													4	3	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106249	8106252	+	Intron	DEL	TTTC	-	-	rs66514322		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106249_8106252delTTTC	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						ttttttcctttttctttctttctt	0.328			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						12	8	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14676718	14676718	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14676718delT	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						tttttgcagcttttagcctga	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	15783432	15783433	+	IGR	INS	-	T	T	rs140537662	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15783432_15783433insT								ITGA8 (21662 upstream) : FAM188A (36742 downstream)																							CTCTTGCTTGCTTTTTGTCTTC	0.406													5	3	---	---	---	---	
RSU1	6251	broad.mit.edu	37	10	16758846	16758849	+	Intron	DEL	CAAA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16758846_16758849delCAAA	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		GACAAGAGGTCAAACAAATACAGA	0.333													4	3	---	---	---	---	
ST8SIA6	338596	broad.mit.edu	37	10	17387570	17387573	+	Intron	DEL	AGAG	-	-	rs10615959		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17387570_17387573delAGAG	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						agcctggagaagagagagagagca	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19021095	19021096	+	IGR	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19021095_19021096delTG								ARL5B (54155 upstream) : None (None downstream)																							GGAGTATGTTTGTGTGTGTGTG	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19598679	19598679	+	IGR	DEL	C	-	-	rs112997528		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19598679delC								ARL5B (631739 upstream) : PLXDC2 (506693 downstream)																							TGTTAAGTAACCTGTGACAGA	0.423													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23110630	23110630	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23110630delC								PIP4K2A (107127 upstream) : ARMC3 (106324 downstream)																							TTCATAAATTCCTTGCAGCTT	0.388													4	2	---	---	---	---	
GJD4	219770	broad.mit.edu	37	10	35894971	35894971	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35894971delG	uc001iyy.1	+							NM_153368	NP_699199	Q96KN9	CXD4_HUMAN	connexin40.1						cell communication	connexon complex|integral to membrane				large_intestine(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CTGGAAGCTTGGttttttttt	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38568628	38568628	+	IGR	DEL	G	-	-	rs146639754		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38568628delG								LOC100129055 (65356 upstream) : HSD17B7P2 (76680 downstream)																							AAACAACCCTGGGAACTGTAA	0.333													3	3	---	---	---	---	
ZNF37B	100129482	broad.mit.edu	37	10	43028706	43028706	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43028706delA	uc001jab.3	-						ZNF37B_uc001jac.3_Intron|ZNF37B_uc001jaa.3_Intron					Homo sapiens cDNA: FLJ23327 fis, clone HEP12630, highly similar to HSZNF37 Homo sapiens ZNF37A mRNA for zinc finger protein.												0						aaacagtcagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	48443293	48443296	+	IGR	DEL	TGTG	-	-	rs9421806		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48443293_48443296delTGTG								GDF10 (4127 upstream) : FRMPD2L1 (400747 downstream)																							tgtgtgtgtatgtgtgtgtgtgtg	0.338													4	2	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	50008482	50008482	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50008482delA	uc001jha.3	+						WDFY4_uc001jhb.1_5'Flank	NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						AATGGACAGGAAGCTGTGAGG	0.532													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55649297	55649297	+	Intron	DEL	A	-	-	rs113275569		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55649297delA	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				cacagtgactaaaaaaaaaaa	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61793596	61793597	+	Intron	INS	-	G	G	rs138500074	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61793596_61793597insG	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ttctcaaacttggttgcacatt	0.188													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	64606025	64606025	+	IGR	DEL	A	-	-	rs34559399		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64606025delA								EGR2 (27098 upstream) : NRBF2 (286982 downstream)																							aagtcagctcaaaaatggctc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	70968942	70968943	+	IGR	INS	-	TTTT	TTTT	rs147863098	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70968942_70968943insTTTT								SUPV3L1 (93 upstream) : HKDC1 (11116 downstream)																							ttgtgtgtgtgtttgtttgtTT	0.267													4	3	---	---	---	---	
LRRC20	55222	broad.mit.edu	37	10	72083889	72083890	+	Intron	DEL	CA	-	-	rs3833735		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72083889_72083890delCA	uc001jqx.1	-						LRRC20_uc001jqy.1_Intron|LRRC20_uc001jqz.1_Intron	NM_207119	NP_997002	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20 isoform 1												0						GCCAGGAAGGCACAGAGGAAGC	0.649													3	4	---	---	---	---	
CAMK2G	818	broad.mit.edu	37	10	75630063	75630063	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75630063delA	uc001jvv.1	-						CAMK2G_uc001jvm.1_Intron|CAMK2G_uc001jvo.1_Intron|CAMK2G_uc001jvq.1_Intron|CAMK2G_uc001jvr.1_Intron|CAMK2G_uc001jvp.1_Intron|CAMK2G_uc001jvs.1_Intron|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Intron|CAMK2G_uc010qkv.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					CACGGTTCTGAAGCAAACGGA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	83078747	83078747	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83078747delA								SH2D4B (672431 upstream) : NRG3 (556323 downstream)																							CCATATGAGGAAAGTGGTACA	0.353													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	88017542	88017542	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88017542delC	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	tgggagaaggcagactaagtg	0.095										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	89357087	89357088	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89357087_89357088insT								MINPP1 (43919 upstream) : PAPSS2 (62388 downstream)																							ttagaaattaatttttttttta	0.079													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92244669	92244670	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92244669_92244670insC	uc001kgy.2	+											Homo sapiens, clone IMAGE:4520798, mRNA.																		ctggctattcaccccctccccc	0.000													4	2	---	---	---	---	
TCTN3	26123	broad.mit.edu	37	10	97424226	97424226	+	Intron	DEL	A	-	-	rs71954790		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97424226delA	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron	NM_015631	NP_056446	Q6NUS6	TECT3_HUMAN	tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		AGACACAAGGAAATGAATATC	0.383													4	2	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100964218	100964218	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100964218delA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		cctacttcacaaaatgcacag	0.000													4	2	---	---	---	---	
DNMBP	23268	broad.mit.edu	37	10	101635517	101635518	+	3'UTR	INS	-	G	G	rs142349325	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101635517_101635518insG	uc001kqj.2	-	17					DNMBP_uc010qpl.1_3'UTR|DNMBP_uc001kqg.2_3'UTR|DNMBP_uc001kqh.2_3'UTR	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GTGCACTTGGAGGAACAGGGGC	0.460													4	2	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106723821	106723821	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106723821delC	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		cagaacctctccctggtctct	0.000													4	2	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106723825	106723825	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106723825delG	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		acctctccctggtctctttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110884927	110884927	+	IGR	DEL	T	-	-	rs11194411		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110884927delT								None (None upstream) : XPNPEP1 (739597 downstream)																							CGTTTTGGtgttttttttttt	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112194815	112194815	+	IGR	DEL	C	-	-	rs113078134		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112194815delC								SMNDC1 (130108 upstream) : DUSP5 (62810 downstream)																							TTTCCCCCAACCCCAAATCGT	0.249													3	5	---	---	---	---	
INPP5F	22876	broad.mit.edu	37	10	121565651	121565651	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121565651delT	uc001leo.2	+							NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F								phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		tgcaccccagttttttttttt	0.055													4	4	---	---	---	---	
FGFR2	2263	broad.mit.edu	37	10	123311193	123311193	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123311193delA	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfn.3_Intron|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Intron|FGFR2_uc010qtp.1_Intron|FGFR2_uc010qtq.1_Intron	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	CAACAGGAAGAAAAAAAAAAA	0.353		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				3	3	---	---	---	---	
FAM24A	118670	broad.mit.edu	37	10	124671560	124671560	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124671560delG	uc001lgv.2	+							NM_001029888	NP_001025059	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A							extracellular region				ovary(2)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		TCAGCACCTTGGCCAAGCCTC	0.532											OREG0004279	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=FAM24A|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132588812	132588813	+	IGR	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132588812_132588813insC								GLRX3 (606028 upstream) : TCERG1L (301843 downstream)																							caccacactcacccccacacac	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133261307	133261307	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133261307delA								TCERG1L (151323 upstream) : PPP2R2D (486653 downstream)																							ACGACTGAGCAAAAAAAAAAG	0.373													4	2	---	---	---	---	
AP2A2	161	broad.mit.edu	37	11	954354	954355	+	Intron	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:954354_954355delGT	uc001lss.2	+						AP2A2_uc001lst.1_Intron|AP2A2_uc009yco.1_Intron	NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCGTTTTAAAgtgtgtgtgtat	0.277													4	2	---	---	---	---	
OVCH2	341277	broad.mit.edu	37	11	7721486	7721487	+	Intron	INS	-	T	T	rs142922611	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7721486_7721487insT	uc010rbf.1	-							NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		AGTTTGCTGGATTTTTTTGAGA	0.119													0	6	---	---	---	---	
SCUBE2	57758	broad.mit.edu	37	11	9048721	9048721	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9048721delC	uc001mhh.1	-						SCUBE2_uc001mhi.1_Intron|SCUBE2_uc001mhj.1_Intron	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor							extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		ACCTCTGGGGCCCAGCAAGAC	0.498													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16023806	16023806	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16023806delA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						ATCTGAGCTTAAAAAGGCTTA	0.398													4	2	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	21481024	21481024	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21481024delA	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AGTAAAGGATAAAAAAAAGAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34063610	34063611	+	IGR	INS	-	AACA	AACA	rs140170417	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34063610_34063611insAACA								LMO2 (149774 upstream) : CAPRIN1 (9619 downstream)																							aaaacaaaaacaacaaacaaac	0.000													8	5	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35415978	35415978	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35415978delA	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	GCCGCTTTTCAAAAATATGGA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	41580648	41580649	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41580648_41580649insT								LRRC4C (99325 upstream) : None (None downstream)																							ATATTTTTTGGTCCCACTGATG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44491464	44491464	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44491464delT								ALX4 (159748 upstream) : CD82 (95677 downstream)																							GGTGACTCCCTTCCCTGCACA	0.547													4	2	---	---	---	---	
PTPRJ	5795	broad.mit.edu	37	11	48015278	48015278	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48015278delC	uc001ngp.3	+						PTPRJ_uc001ngo.3_Intron	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						TCTCTAGGCTCCGGCACTGAT	0.522													4	2	---	---	---	---	
SLC22A12	116085	broad.mit.edu	37	11	64363561	64363562	+	Intron	INS	-	ATGG	ATGG	rs146602952		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64363561_64363562insATGG	uc001oam.1	+						SLC22A12_uc009ypr.1_Intron|SLC22A12_uc001oal.1_Intron|SLC22A12_uc009yps.1_Intron|SLC22A12_uc001oan.1_Intron|SLC22A12_uc009ypt.2_Intron	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a						cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1						ttgatggttgaatggatggatg	0.000													4	2	---	---	---	---	
CLPB	81570	broad.mit.edu	37	11	72005981	72005982	+	Intron	INS	-	GAGAGGA	GAGAGGA	rs66645103		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72005981_72005982insGAGAGGA	uc001osj.2	-						CLPB_uc010rqx.1_Intron|CLPB_uc010rqy.1_Intron|CLPB_uc001osk.2_Intron|CLPB_uc009ytg.2_Intron|CLPB_uc010rqz.1_Intron|CLPB_uc001osi.2_Intron	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B						cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						TGTGAGGGAGGGAGAGGAGAGG	0.550													3	3	---	---	---	---	
FCHSD2	9873	broad.mit.edu	37	11	72674588	72674588	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72674588delA	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			aacaagactgaaaaaaatgtg	0.015													4	2	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077165	73077168	+	Intron	DEL	TGTG	-	-	rs112101560		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077165_73077168delTGTG	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						CTAGGATAGTtgtgtgtgtgtgtg	0.387													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	73682578	73682578	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73682578delG								DNAJB13 (1247 upstream) : UCP2 (3138 downstream)																							gattcaggaagGGGTAACAGC	0.289													4	2	---	---	---	---	
GAB2	9846	broad.mit.edu	37	11	77962789	77962791	+	Intron	DEL	CTT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77962789_77962791delCTT	uc001ozh.2	-						GAB2_uc001ozg.2_Intron	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			cctggacttgcttcttcttctgt	0.000													2	4	---	---	---	---	
PICALM	8301	broad.mit.edu	37	11	85684949	85684949	+	Intron	DEL	A	-	-	rs35407411		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85684949delA	uc001pbm.2	-						PICALM_uc001pbl.2_Intron|PICALM_uc001pbn.2_Intron|PICALM_uc010rtl.1_Intron|PICALM_uc001pbk.2_Intron|PICALM_uc010rtk.1_Intron	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly						clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TCTAGATGTCAAAACAGTACG	0.388			T	MLLT10|MLL	TALL|AML|								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91676924	91676924	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91676924delC								None (None upstream) : FAT3 (408338 downstream)																							tctccctctgccccatatcca	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	94009925	94009925	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94009925delT								PANX1 (94790 upstream) : FOLR4 (28878 downstream)																							TTCTATTTTCTTTTTTTTCTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	103626330	103626331	+	IGR	DEL	TT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103626330_103626331delTT								DYNC2H1 (275739 upstream) : PDGFD (151584 downstream)																							gactctgtacttttttaaatga	0.000													4	2	---	---	---	---	
DRD2	1813	broad.mit.edu	37	11	113288173	113288173	+	Intron	DEL	T	-	-	rs35685394		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113288173delT	uc001pnz.2	-						DRD2_uc010rwv.1_Intron|DRD2_uc001poa.3_Intron|DRD2_uc001pob.3_Intron|DRD2_uc009yyr.1_Intron	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	cttcatcacattttttttttt	0.184													4	2	---	---	---	---	
FXYD6	53826	broad.mit.edu	37	11	117710117	117710118	+	Intron	DEL	AC	-	-	rs562089	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117710117_117710118delAC	uc001pro.1	-						FXYD6_uc001prn.1_Intron|FXYD6_uc001prp.1_Intron|FXYD6_uc001prq.1_Intron|FXYD6_uc001prr.1_Intron|FXYD6_uc009yzq.1_3'UTR	NM_022003	NP_071286	Q9H0Q3	FXYD6_HUMAN	FXYD domain-containing ion transport regulator 6							integral to membrane|plasma membrane	ion channel activity			central_nervous_system(1)|skin(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		GTTTAAAAAAACAAGTGGCCCT	0.376													4	2	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118247607	118247607	+	Intron	DEL	A	-	-	rs1784239		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118247607delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		catctctaccaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121661665	121661665	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121661665delT								SORL1 (157194 upstream) : LOC399959 (298146 downstream)																							AATTTCATAGTTTTTTCCCCA	0.403													4	2	---	---	---	---	
CDON	50937	broad.mit.edu	37	11	125933784	125933784	+	5'Flank	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125933784delT	uc009zbw.2	-						CDON_uc001qdc.3_5'Flank|CDON_uc009zbx.2_5'Flank	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		CAGTTAGCTCTTTTTTTTCCC	0.174													4	2	---	---	---	---	
RPUSD4	84881	broad.mit.edu	37	11	126075146	126075146	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126075146delG	uc001qde.2	-						RPUSD4_uc010sbl.1_Intron|RPUSD4_uc009zbz.2_Intron|RPUSD4_uc009zby.2_Intron	NM_032795	NP_116184	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4						pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			breast(1)	1	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		atcgttttgaggaaccactct	0.179													4	2	---	---	---	---	
ETS1	2113	broad.mit.edu	37	11	128383891	128383891	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128383891delA	uc010sbs.1	-						ETS1_uc001qej.2_Intron|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Intron	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		AATTGCACACAAAAAAAGTAA	0.353													4	2	---	---	---	---	
WNT5B	81029	broad.mit.edu	37	12	1728818	1728818	+	Intron	DEL	A	-	-	rs78695823		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1728818delA	uc009zdq.2	+						WNT5B_uc001qjj.2_Intron	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,						angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			ATAACTGACCAAAAAAAAAAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13386750	13386751	+	IGR	INS	-	T	T	rs138945292	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13386750_13386751insT								EMP1 (17043 upstream) : C12orf36 (137272 downstream)																							atgcttcatgaggcagggttgt	0.084													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14891835	14891836	+	IGR	INS	-	GG	GG	rs112104120		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14891835_14891836insGG								GUCY2C (42316 upstream) : HIST4H4 (29098 downstream)																							GTCACTCACTAGAGAGCCATCA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16342348	16342349	+	IGR	INS	-	T	T	rs138503409	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16342348_16342349insT								DERA (152034 upstream) : MGST1 (157727 downstream)																							GAAAACTGTCATTTTTTTTGTC	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26311442	26311442	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26311442delT	uc001rhc.2	+											Homo sapiens cDNA clone IMAGE:5300499.																		TCATGGCACCTCAGGCTCTGA	0.507													4	2	---	---	---	---	
ARID2	196528	broad.mit.edu	37	12	46161995	46161995	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46161995delT	uc001ros.1	+						ARID2_uc001ror.2_Intron	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		gatatcaagattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47447752	47447753	+	IGR	INS	-	TC	TC			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47447752_47447753insTC								SLC38A4 (227972 upstream) : AMIGO2 (21738 downstream)																							tttctaggctttctctctcttg	0.000													4	2	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50294669	50294669	+	Intron	DEL	A	-	-	rs72326331		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50294669delA	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						TGGTGACTTGAAAAAAAAATG	0.438													2	4	---	---	---	---	
HOXC9	3225	broad.mit.edu	37	12	54392740	54392740	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54392740delT	uc001sep.2	+						HOXC9_uc001seq.2_5'Flank	NM_006897	NP_008828	P31274	HXC9_HUMAN	homeobox C9						multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)|skin(1)	3						CCTCCGTTGCTTTTTTCCCGT	0.383													4	2	---	---	---	---	
ATP5B	506	broad.mit.edu	37	12	57033569	57033569	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57033569delG	uc001slr.2	-							NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit						angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						aaaaaaaaaagaaagaaaaaT	0.199													5	3	---	---	---	---	
SRGAP1	57522	broad.mit.edu	37	12	64265418	64265418	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64265418delT	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TTCTTTTTTCTTTTTTTTTTG	0.328													4	4	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	70934342	70934345	+	Intron	DEL	CACA	-	-	rs144421221		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70934342_70934345delCACA	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGATATGAACCACACACACACACA	0.382													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76696529	76696530	+	IGR	INS	-	T	T	rs144585401	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76696529_76696530insT								NAP1L1 (217791 upstream) : BBS10 (41736 downstream)																							gtttttgtttgtttttttttaa	0.000													4	3	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77202587	77202587	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77202587delT	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						ATTTTTATTCTTTTTTTTTTG	0.239													6	3	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81822006	81822006	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81822006delA	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010sui.1_Intron|PPFIA2_uc010suj.1_Intron|PPFIA2_uc009zsi.1_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						TACCACAAATAAAAAAAAACC	0.289													3	3	---	---	---	---	
MGAT4C	25834	broad.mit.edu	37	12	87077387	87077387	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87077387delC	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						CCATGactcaccactatgcta	0.144													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88514519	88514519	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88514519delA	uc001tar.2	-						CEP290_uc001tat.2_Intron|CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						CACAGATAATAAAAAAAAGTA	0.373													4	2	---	---	---	---	
PLEKHG7	440107	broad.mit.edu	37	12	93131554	93131554	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93131554delA	uc001tcj.2	+							NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						gaagggaAAGAGAGGGAACGG	0.204													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97640718	97640718	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97640718delG								NEDD1 (293257 upstream) : RMST (218081 downstream)																							TGCAGCTTATGGGttttttaa	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97785644	97785644	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97785644delT								NEDD1 (438183 upstream) : RMST (73155 downstream)																							ATTCAGATCCTTTTTTTAAAA	0.328													4	2	---	---	---	---	
UHRF1BP1L	23074	broad.mit.edu	37	12	100464069	100464069	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100464069delT	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron|UHRF1BP1L_uc001tgp.2_Intron	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						aattaattaattttttttttt	0.124													7	6	---	---	---	---	
P2RX4	5025	broad.mit.edu	37	12	121660208	121660209	+	Intron	INS	-	TG	TG	rs147011040		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121660208_121660209insTG	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Intron|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					cttgtttttttttttgttttgt	0.163													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	129564124	129564124	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129564124delT	uc009zyl.1	-						TMEM132D_uc001uia.2_Intron	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTAGAAGAGATGGGCTTCATC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20770651	20770652	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20770651_20770652insA								GJB2 (3537 upstream) : GJB6 (25450 downstream)																							TTCAAAGAGTTAAAAAAAAATT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34281167	34281168	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34281167_34281168insT								STARD13 (30235 upstream) : RFC3 (111038 downstream)																							tacctcactgatttttttgttt	0.000													4	2	---	---	---	---	
RFC3	5983	broad.mit.edu	37	13	34511366	34511366	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34511366delT	uc001uva.2	+							NM_181558	NP_853536	P40938	RFC3_HUMAN	replication factor C 3 isoform 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding				0		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		taccattctgttacaattgcc	0.000													4	2	---	---	---	---	
TRPC4	7223	broad.mit.edu	37	13	38292526	38292527	+	Intron	DEL	TC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38292526_38292527delTC	uc001uws.2	-						TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		aatttctccttctagaaagaag	0.000													4	2	---	---	---	---	
FOXO1	2308	broad.mit.edu	37	13	41165115	41165115	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41165115delA	uc001uxl.3	-						FOXO1_uc010acc.1_Intron	NM_002015	NP_002006	Q12778	FOXO1_HUMAN	forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		TAAAGTATTGAAAAAGAAAAA	0.448													4	2	---	---	---	---	
SUGT1L1	283507	broad.mit.edu	37	13	41445621	41445622	+	Intron	INS	-	TTTC	TTTC	rs112898053		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41445621_41445622insTTTC	uc001uxp.1	-							NR_003365				Homo sapiens cDNA FLJ35913 fis, clone TESTI2010239.												0						ATGCTTTTTGGTTTTTTTTTAT	0.347													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47530437	47530437	+	IGR	DEL	T	-	-	rs67195819		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47530437delT								HTR2A (59387 upstream) : SUCLA2 (986355 downstream)																							Tttcttaaaattttttttttt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	53374573	53374573	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53374573delT								LECT1 (60626 upstream) : MIR759 (9612 downstream)																							TTTATTCAGCTTTTTTCCTCA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86981197	86981198	+	IGR	INS	-	T	T	rs141027502	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86981197_86981198insT								SLITRK6 (607714 upstream) : None (None downstream)																							GACACCGGCTATTTTTTTTTAA	0.297													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94177708	94177708	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94177708delG	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GATTTTATCTGGGAAAACTGT	0.363													4	2	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96455001	96455002	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96455001_96455002insC	uc001vmt.2	-						UGGT2_uc001vms.2_Intron	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						GCCTGTCAGCTCCCCACCCCAC	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112211678	112211678	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112211678delT								C13orf16 (215085 upstream) : SOX1 (510235 downstream)																							aattcttgaattttttttttt	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112341373	112341373	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112341373delG								C13orf16 (344780 upstream) : SOX1 (380540 downstream)																							gaggcagaatgggggtttttt	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	113289889	113289889	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113289889delC								TUBGCP3 (47408 upstream) : C13orf35 (11469 downstream)																							GACCCCAAGACCCCCACCCCA	0.542													4	2	---	---	---	---	
GAS6	2621	broad.mit.edu	37	13	114564785	114564785	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114564785delA	uc001vud.2	-							NM_000820	NP_000811	Q14393	GAS6_HUMAN	growth arrest-specific 6 isoform 1 precursor						cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				AACCAGAGGGAAAGCGGGTTG	0.572													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114838169	114838169	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114838169delC	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CCACGCACCACCAAGGACAGA	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19396845	19396845	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19396845delA								OR11H12 (18273 upstream) : POTEG (156520 downstream)																							aggaactgacaaaaaaaaaaa	0.030													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19434604	19434604	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19434604delA								OR11H12 (56032 upstream) : POTEG (118761 downstream)																							ATCTACAAAGAAAAAAAAAAT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20946756	20946756	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20946756delA								PNP (1510 upstream) : RNASE10 (26940 downstream)																							CATCAGGATGAGGCAAAGCAG	0.443													4	2	---	---	---	---	
SUPT16H	11198	broad.mit.edu	37	14	21833520	21833521	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21833520_21833521insC	uc001wao.2	-							NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation						DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		CTAATTGATTATATCGAGCCTT	0.351													4	2	---	---	---	---	
NUBPL	80224	broad.mit.edu	37	14	32240777	32240777	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32240777delT	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		atgacttgagtcacacagacc	0.159													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	34230750	34230750	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34230750delA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		ATTTGAACTCAAGGGGGTTTC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34518967	34518967	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34518967delC								EGLN3 (98680 upstream) : C14orf147 (383178 downstream)																							TCAGGATTTTCCCTGCAGAGT	0.512													4	2	---	---	---	---	
PAX9	5083	broad.mit.edu	37	14	37145745	37145745	+	3'UTR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37145745delC	uc001wty.3	+	5					PAX9_uc010amq.2_RNA	NM_006194	NP_006185	P55771	PAX9_HUMAN	paired box 9						multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		TCCCACCCCTCCTGCCCTCCA	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	41066753	41066753	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41066753delT								None (None upstream) : None (None downstream)																							ATTTTTCTAATTTTTTTTTTG	0.289													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	47044218	47044218	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47044218delG								None (None upstream) : RPL10L (76004 downstream)																							atggaaaatcggttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	48231135	48231136	+	IGR	INS	-	AC	AC	rs144639489	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48231135_48231136insAC								MDGA2 (87147 upstream) : None (None downstream)																							cacacacacatacacacacaca	0.223													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	53637131	53637131	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53637131delT								DDHD1 (17085 upstream) : BMP4 (779326 downstream)																							AGAAACATCCTTTTTTTCTCT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	53657069	53657070	+	IGR	DEL	TT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53657069_53657070delTT								DDHD1 (37023 upstream) : BMP4 (759387 downstream)																							CTACTCTGACTTTAGAAGTGAA	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57150085	57150085	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57150085delT								C14orf101 (33855 upstream) : OTX2 (117342 downstream)																							caatataaactttTTTTTTTA	0.179													4	2	---	---	---	---	
SNAPC1	6617	broad.mit.edu	37	14	62243179	62243179	+	Intron	DEL	T	-	-	rs33967758		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62243179delT	uc001xft.2	+							NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		ATGTATTTTCTTTTTTTTTTG	0.244													5	4	---	---	---	---	
PPP2R5E	5529	broad.mit.edu	37	14	63977348	63977348	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63977348delC	uc001xgd.1	-						PPP2R5E_uc010tsf.1_5'Flank|PPP2R5E_uc010tsg.1_5'Flank|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron|PPP2R5E_uc001xgg.3_Intron	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		aaatgcaaagccctacggcct	0.000													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64643215	64643216	+	Intron	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64643215_64643216delGT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGCACAGTGGTGAGAAGTGGA	0.317													4	2	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65252070	65252070	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65252070delA	uc001xht.2	-						SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron|SPTB_uc001xhu.2_Intron|SPTB_uc010aqi.2_5'Flank	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TTCAGATTTGAAAAAAAAAAA	0.299													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79485511	79485511	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79485511delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		tcagtgaccctttgatcttga	0.040													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	80257987	80257987	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80257987delC	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCttggctttccccccaactt	0.085													4	2	---	---	---	---	
RIN3	79890	broad.mit.edu	37	14	93108162	93108162	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93108162delG	uc001yap.2	+						RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Intron	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GAGGGGTAAAGAGGGGAGAGG	0.542													4	2	---	---	---	---	
PAPOLA	10914	broad.mit.edu	37	14	96967880	96967884	+	5'Flank	DEL	CTTTG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96967880_96967884delCTTTG	uc001yfq.2	+						PAPOLA_uc001yfo.2_5'Flank|PAPOLA_uc001yfp.2_5'Flank|PAPOLA_uc001yfr.2_5'Flank|PAPOLA_uc010twv.1_5'Flank|PAPOLA_uc010avp.2_5'Flank	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha						mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		CCAAGACAACCTTTGCTAAAATGCC	0.468													4	2	---	---	---	---	
SETD3	84193	broad.mit.edu	37	14	99903134	99903134	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99903134delT	uc001ygc.2	-						SETD3_uc001ygd.2_Intron|SETD3_uc001ygf.2_Intron	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a						peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				AGGAGCTGTATTTTTTTATCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	100095649	100095649	+	IGR	DEL	A	-	-	rs115893405	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100095649delA								CCDC85C (24922 upstream) : HHIPL1 (15831 downstream)																							GAACATACATAAAAAAAACAT	0.428											OREG0022916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MIR1185-1	100302157	broad.mit.edu	37	14	101508323	101508324	+	5'Flank	INS	-	A	A	rs71912987		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101508323_101508324insA	hsa-mir-1185-1|MI0003844	+						MIR1185-2_hsa-mir-1185-2|MI0003821_5'Flank																	0						cacaataggttaaaaaaaaaag	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101534561	101534561	+	5'Flank	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101534561delG	uc001yjz.1	+											Homo sapiens cDNA FLJ11465 fis, clone HEMBA1001636.																		tgaattcccaggcaggtgctg	0.154													4	2	---	---	---	---	
INF2	64423	broad.mit.edu	37	14	105273136	105273138	+	Intron	DEL	CAC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105273136_105273138delCAC	uc010tyi.1	+							NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		cctccaccttcaccaccaccacc	0.236													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20121441	20121441	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20121441delA								None (None upstream) : GOLGA6L6 (615653 downstream)																							CACTATTTTGAAAATGAAAAG	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20476655	20476663	+	IGR	DEL	GCCTGTTGA	-	-	rs144012551		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20476655_20476663delGCCTGTTGA								None (None upstream) : GOLGA6L6 (260431 downstream)																							AACTGACTCTGCCTGTTGAGCCTAAGGCC	0.301													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20488228	20488229	+	Splice_Site	INS	-	TGAA	TGAA			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20488228_20488229insTGAA	uc001ytf.1	+	1		c.231_splice	c.e1+1							full-length cDNA clone CS0DI026YN18 of Placenta Cot 25-normalized of Homo sapiens (human).																		ggCAGAATAGGtgaatgaatga	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20607500	20607500	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20607500delA	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		ttatttcatcaaaatctttgt	0.000													4	2	---	---	---	---	
CHRFAM7A	89832	broad.mit.edu	37	15	30668185	30668186	+	Intron	INS	-	AT	AT	rs146286293	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30668185_30668186insAT	uc001zdt.1	-						CHRFAM7A_uc001zdu.1_Intron|CHRFAM7A_uc010azn.2_Intron|CHRFAM7A_uc001zdv.2_5'Flank	NM_139320	NP_647536	Q494W8	CRFM7_HUMAN	CHRNA7-FAM7A fusion isoform 1							integral to membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity			skin(1)	1		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		tgtgttgagtcgtgggtggtat	0.000													6	3	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	31883569	31883569	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31883569delT	uc001zfq.2	-						OTUD7A_uc001zfr.2_Intron|OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		tgctcagacattactcgaggt	0.229													4	2	---	---	---	---	
SCG5	6447	broad.mit.edu	37	15	32977086	32977086	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32977086delA	uc001zha.2	+						SCG5_uc001zgz.2_Intron	NM_001144757	NP_001138229	P05408	7B2_HUMAN	secretogranin V isoform 1						intracellular protein transport|neuropeptide signaling pathway|peptide hormone processing|regulation of hormone secretion	extracellular region|stored secretory granule	enzyme inhibitor activity|GTP binding|unfolded protein binding				0		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		AAGAGACAGCAACCTAACATT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39142468	39142469	+	IGR	DEL	AG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39142468_39142469delAG								C15orf53 (150229 upstream) : C15orf54 (400416 downstream)																							gccatgtgtcagagagagagaa	0.163													4	2	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43689740	43689740	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43689740delT	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		TTTTTTGGTGTTTTTTTTTGT	0.289													6	3	---	---	---	---	
CASC4	113201	broad.mit.edu	37	15	44671682	44671682	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44671682delA	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		tccccccaccaaaaaaaaaaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60595968	60595969	+	IGR	INS	-	CTTCCATC	CTTCCATC	rs144521061	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60595968_60595969insCTTCCATC								FOXB1 (267560 upstream) : ANXA2 (43382 downstream)																							cactagtcatgcttccatcttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70214056	70214056	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70214056delC								C15orf50 (78751 upstream) : TLE3 (126487 downstream)																							gacctgctctccttcatagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85136353	85136354	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85136353_85136354insA								UBE2Q2P1 (22327 upstream) : ZSCAN2 (7895 downstream)																							GTtgtatagctaaaaaaaaatt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98005877	98005877	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98005877delA								SPATA8 (677033 upstream) : LOC91948 (279969 downstream)																							ACATATGTGGAAAAAGACACA	0.373													4	2	---	---	---	---	
LRRK1	79705	broad.mit.edu	37	15	101567289	101567289	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101567289delG	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			gacacagtgtggggcacccag	0.134													4	2	---	---	---	---	
ABCA3	21	broad.mit.edu	37	16	2382818	2382818	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2382818delT	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron|ABCA3_uc002cpz.1_5'Flank	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				CTATGTGCCCttttttttttt	0.234													5	4	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3802457	3802457	+	Intron	DEL	T	-	-	rs141045150		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3802457delT	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTTTTTCCTGTTTTTTTTTTT	0.299			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				4	2	---	---	---	---	
UBN1	29855	broad.mit.edu	37	16	4919755	4919755	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4919755delT	uc002cyb.2	+						UBN1_uc010uxw.1_Intron|UBN1_uc002cyc.2_Intron	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1						chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						AAGAGAAATATTTTTTTGCTT	0.463													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6661778	6661778	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6661778delT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		catcttccccttctctctctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12031883	12031883	+	IGR	DEL	G	-	-	rs116770375		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12031883delG								GSPT1 (21364 upstream) : TNFRSF17 (27081 downstream)																							acctctttttgtttttgagac	0.000													4	3	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12370567	12370567	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12370567delG	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						CCCTTGGTGTGGGAGGTCTTC	0.418													4	3	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	24088094	24088094	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24088094delG	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CTGATGGCCAGGGTCACTGGA	0.507													4	2	---	---	---	---	
KIAA0556	23247	broad.mit.edu	37	16	27768019	27768019	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27768019delT	uc002dow.2	+							NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						ttggtcaggattttttttttg	0.055													6	4	---	---	---	---	
XPO6	23214	broad.mit.edu	37	16	28120623	28120623	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28120623delT	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						ttttcttttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29268098	29268098	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29268098delG	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TCACAAGTGTGGATGTCATGC	0.537													4	2	---	---	---	---	
TGFB1I1	7041	broad.mit.edu	37	16	31486658	31486658	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31486658delA	uc002ecd.1	+						TGFB1I1_uc002ece.1_Intron|TGFB1I1_uc010caq.1_Intron	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced						androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding				0						gtgttggtgtaaagatgggta	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32529785	32529786	+	IGR	INS	-	C	C	rs143028824		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32529785_32529786insC								HERC2P4 (365911 upstream) : TP53TG3B (155055 downstream)																							aaggtttatctcatgagatgga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33483961	33483961	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33483961delA								SLC6A10P (587498 upstream) : MIR1826 (481547 downstream)																							tttccaaagcaaaaaaaAAAA	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34389863	34389863	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34389863delA								MIR1826 (424271 upstream) : UBE2MP1 (13939 downstream)																							attttctagtaaaaaaaaagg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49178903	49178904	+	IGR	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49178903_49178904delTG								N4BP1 (534783 upstream) : CBLN1 (133307 downstream)																							TAGCATTTTCTGTGTGTTTTGT	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51037072	51037073	+	IGR	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51037072_51037073delGT								CYLD (201226 upstream) : SALL1 (132813 downstream)																							GTGGGTCTCCGTGTGTGTGGTG	0.520													4	2	---	---	---	---	
CES7	221223	broad.mit.edu	37	16	55914640	55914640	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55914640delG	uc002eir.2	-						CES7_uc002eiq.2_Intron			Q6NT32	EST5A_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000383269; Flags: Fragment;							extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)		TAGGTATAGAGGCAAGGGTAA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	56892214	56892214	+	5'Flank	DEL	T	-	-	rs35474169		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56892214delT	uc002ekc.2	+						MIR138-2_hsa-mir-138-2|MI0000455_5'Flank					DM004413																		ATTGTACAGGTTTTTTTTTTA	0.547													5	5	---	---	---	---	
GPR114	221188	broad.mit.edu	37	16	57596650	57596650	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57596650delG	uc002elx.3	+						GPR114_uc010vhr.1_Intron|GPR114_uc002ely.2_Intron	NM_153837	NP_722579	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						gattctggctgggctctccag	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	65166322	65166322	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65166322delA								CDH11 (10403 upstream) : LOC283867 (152080 downstream)																							gaaggatgtcaaggataattc	0.000													4	2	---	---	---	---	
BCAR1	9564	broad.mit.edu	37	16	75283636	75283636	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75283636delC	uc002fdv.2	-						BCAR1_uc010vna.1_5'Flank|BCAR1_uc010vnb.1_Intron|BCAR1_uc002fdw.2_Intron|BCAR1_uc010vnc.1_Intron|BCAR1_uc010vnd.1_Intron|BCAR1_uc002fdx.2_Intron	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1						actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		ACAGCAGATGCCAGGAGAGGG	0.587													4	2	---	---	---	---	
CFDP1	10428	broad.mit.edu	37	16	75368426	75368426	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75368426delT	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron	NM_006324	NP_006315	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1						GTGGAGGAGGTTTCTATAAAG	0.493													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82746185	82746185	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82746185delT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CCTTTGTCCCTTTCTCACATG	0.428													4	2	---	---	---	---	
HSBP1	3281	broad.mit.edu	37	16	83838832	83838832	+	5'Flank	DEL	A	-	-	rs11325964		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83838832delA	uc002fgy.1	+							NM_001537	NP_001528	O75506	HSBP1_HUMAN	heat shock factor binding protein 1						negative regulation of transcription from RNA polymerase II promoter	nucleus	transcription corepressor activity				0		all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)		GAAGAGCTTTAAAAAAAAAAT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7033272	7033272	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7033272delA								ASGR2 (14980 upstream) : ASGR1 (43480 downstream)																							ACCAACCCAGAAAAAAAAAAG	0.363													2	4	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10206176	10206176	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10206176delT	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GCTTTGAGGGTAGACTGGGGT	0.398													4	2	---	---	---	---	
SHISA6	388336	broad.mit.edu	37	17	11374084	11374085	+	Intron	DEL	TG	-	-	rs140386799		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11374084_11374085delTG	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269	Q6ZSJ9	SHSA6_HUMAN	shisa homolog 6							integral to membrane				breast(1)	1						CCCTGACAAATGTGTGCAGCAT	0.327													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16398495	16398495	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16398495delT								C17orf76 (3015 upstream) : ZNF287 (55136 downstream)																							TTGCTCTTGATTTTTTTACCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25301890	25301890	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25301890delT								None (None upstream) : WSB1 (319216 downstream)																							AATGAATGTATTTGTTTGGGT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35236082	35236083	+	IGR	INS	-	CC	CC	rs72824414	byFrequency	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35236082_35236083insCC								MRM1 (270676 upstream) : LHX1 (58416 downstream)																							cctccctccctctctctctctc	0.411													4	2	---	---	---	---	
CDK12	51755	broad.mit.edu	37	17	37682372	37682372	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37682372delT	uc010cvv.2	+	13	4149	c.3563delT	c.(3562-3564)ATCfs	p.I1188fs	CDK12_uc010wef.1_Frame_Shift_Del_p.I1187fs|CDK12_uc002hrw.3_Frame_Shift_Del_p.I1188fs	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	1188					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						GCCCCAGTGATCCTGCCTTCA	0.527										TCGA Ovarian(9;0.13)			51	25	---	---	---	---	
LOC90586	90586	broad.mit.edu	37	17	41016597	41016598	+	5'Flank	DEL	AC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41016597_41016598delAC	uc002ibw.1	+							NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						acacagacagacacacacacac	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43261202	43261203	+	IGR	DEL	AG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43261202_43261203delAG								HEXIM2 (13796 upstream) : FMNL1 (38089 downstream)																							aaaaaaaaaaagaaGGTCCTGC	0.292													6	3	---	---	---	---	
SKAP1	8631	broad.mit.edu	37	17	46408187	46408187	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46408187delA	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						CAGGGGGCGGAAAAAAAAAAA	0.428													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48018547	48018547	+	IGR	DEL	A	-	-	rs35986605		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48018547delA								TAC4 (93168 upstream) : DLX4 (28015 downstream)																							CTGACTCCCCAATCCAGCCTT	0.577													2	4	---	---	---	---	
ITGA3	3675	broad.mit.edu	37	17	48158833	48158834	+	Intron	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48158833_48158834insT	uc010dbl.2	+						ITGA3_uc010dbm.2_Intron	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor						blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						TACAGGGCATCTTTTAAGAGGA	0.347													20	12	---	---	---	---	
HLF	3131	broad.mit.edu	37	17	53393052	53393052	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53393052delA	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_Intron|HLF_uc010wni.1_Intron	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GAGTGATTTTAAACCCATGAA	0.373			T	TCF3	ALL								4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59480314	59480332	+	Intron	DEL	AGAGAGAGAGAGAGAGAGA	-	-	rs112242392	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480314_59480332delAGAGAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						agagagagagagagagagagagagagagaaagtggagag	0.256													5	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63769223	63769223	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63769223delG	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			tatgcagccagGGATGAAAAC	0.214													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64164992	64164992	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64164992delC	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			aaggctctcacccatgcttct	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	69877142	69877142	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69877142delC								None (None upstream) : SOX9 (240019 downstream)																							ATGTTAACTGCCAGCAGAGAA	0.403													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	71068025	71068026	+	Intron	INS	-	CG	CG			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71068025_71068026insCG	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						TTACACACACAGGCCATCTCCC	0.144													4	2	---	---	---	---	
C17orf54	283982	broad.mit.edu	37	17	71771781	71771781	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71771781delG	uc010wqv.1	-						C17orf54_uc010dfo.2_Intron					Homo sapiens cDNA FLJ40319 fis, clone TESTI2030754.												0						CTAACAGGGTGGGACGTCATT	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72037501	72037501	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72037501delA								C17orf54 (212825 upstream) : RPL38 (162294 downstream)																							GGAAAGCGAGAAATGGAAGAC	0.517													4	2	---	---	---	---	
TK1	7083	broad.mit.edu	37	17	76182767	76182771	+	Intron	DEL	AGGGG	-	-	rs150794517	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76182767_76182771delAGGGG	uc002juw.2	-						TK1_uc002jux.2_Intron|AFMID_uc002juy.3_5'Flank|AFMID_uc010dhj.2_5'Flank|AFMID_uc002jvb.3_5'Flank|AFMID_uc002jva.3_5'Flank|AFMID_uc002juz.3_5'Flank	NM_003258	NP_003249	P04183	KITH_HUMAN	thymidine kinase 1						DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)			agggaagggaaggggaggggagggg	0.400													6	4	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80156546	80156546	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80156546delT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			caggatacaattaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	23235251	23235252	+	IGR	INS	-	T	T	rs35142164		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23235251_23235252insT								ZNF521 (303037 upstream) : SS18 (360967 downstream)																							accgtcaccagttttgactaag	0.000													4	2	---	---	---	---	
CHST9	83539	broad.mit.edu	37	18	24528356	24528356	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24528356delA	uc002kwd.2	-						C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Intron|CHST9_uc002kwe.2_Intron	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					acttaaagttaaaaaaaaaaT	0.209													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	26280672	26280672	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26280672delT								CDH2 (523227 upstream) : None (None downstream)																							atttagagaatagccagtaat	0.000													4	2	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	34199292	34199292	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34199292delA	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron|FHOD3_uc002kzu.1_Intron|FHOD3_uc010dmz.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCCACACATGAAATGCAACCA	0.468													4	2	---	---	---	---	
ZBTB7C	201501	broad.mit.edu	37	18	45553821	45553821	+	3'UTR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45553821delG	uc002lda.2	-	2					ZBTB7C_uc002ldb.2_3'UTR|ZBTB7C_uc010dnu.2_3'UTR|ZBTB7C_uc010dnv.2_3'UTR|ZBTB7C_uc010dnw.2_3'UTR	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						GTTGGCTGGTGGACATGGGCA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49049835	49049835	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49049835delC	uc010xdq.1	+											Homo sapiens cDNA FLJ37617 fis, clone BRCOC2012229.																		CTAGGTTTTACCCCTGACCTT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53795809	53795810	+	Intron	DEL	TC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53795809_53795810delTC	uc002lgf.1	-						uc010dpj.1_Intron					Homo sapiens cDNA FLJ32774 fis, clone TESTI2002002.																		CCAAGTTCTTTCTAGTGTGGAT	0.366													4	2	---	---	---	---	
C18orf20	221241	broad.mit.edu	37	18	61762324	61762324	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61762324delC	uc010dqk.2	-						C18orf20_uc002ljw.3_Intron					RecName: Full=Uncharacterized protein C18orf20; Flags: Precursor;												0						GCTGGCTTTACTAAAAGGGCA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	70744510	70744511	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70744510_70744511insT								NETO1 (209700 upstream) : FBXO15 (996077 downstream)																							atgtccacttctttttttttaa	0.000													4	2	---	---	---	---	
ZNF516	9658	broad.mit.edu	37	18	74119594	74119595	+	Intron	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74119594_74119595insC	uc010dqx.1	-						ZNF516_uc002lme.2_Intron	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CACTGCCATTTCCCCCTTAACT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75708405	75708405	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75708405delA								GALR1 (726311 upstream) : None (None downstream)																							ACTCTTATATAAAAAAAAAAC	0.264													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76461736	76461736	+	IGR	DEL	T	-	-	rs74588878		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76461736delT								None (None upstream) : SALL3 (278539 downstream)																							ttttcttttcttttttttttt	0.284													4	2	---	---	---	---	
DNM2	1785	broad.mit.edu	37	19	10853357	10853358	+	Intron	DEL	GT	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10853357_10853358delGT	uc002mps.1	+						DNM2_uc010dxk.2_Intron|DNM2_uc002mpt.1_Intron|DNM2_uc002mpv.1_Intron|DNM2_uc002mpu.1_Intron|DNM2_uc010dxl.1_Intron	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2						G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			GTGCTGTGTGGTGACCGGGATG	0.495													4	2	---	---	---	---	
ZNF791	163049	broad.mit.edu	37	19	12734232	12734233	+	Intron	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12734232_12734233insA	uc002mua.2	+						ZNF791_uc010xml.1_Intron|ZNF791_uc010dyu.1_Intron|ZNF791_uc010xmm.1_Intron	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						caaaaaggaagaaaaaaaaaTT	0.144													4	2	---	---	---	---	
TPM4	7171	broad.mit.edu	37	19	16189073	16189073	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16189073delG	uc002ndj.2	+						TPM4_uc002ndi.2_Intron|TPM4_uc002ndk.1_5'Flank	NM_003290	NP_003281	P67936	TPM4_HUMAN	tropomyosin 4 isoform 2						cellular component movement|muscle filament sliding|response to oxidative stress	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding|calcium ion binding|structural constituent of muscle		TPM4/ALK(12)	soft_tissue(10)|haematopoietic_and_lymphoid_tissue(2)|breast(1)	13						CCAGAGACATGGGTGTGCACA	0.502			T	ALK	ALCL								4	2	---	---	---	---	
USHBP1	83878	broad.mit.edu	37	19	17369974	17369974	+	Intron	DEL	A	-	-	rs80351288		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17369974delA	uc002nfs.1	-						USHBP1_uc002nfr.1_5'Flank|USHBP1_uc002nft.1_Intron|USHBP1_uc010xpk.1_Intron|USHBP1_uc010eam.1_Intron	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1								PDZ domain binding			ovary(1)	1						attctgtctcaaaaaaaaaaa	0.249													4	3	---	---	---	---	
PBX4	80714	broad.mit.edu	37	19	19691328	19691328	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19691328delC	uc002nmy.2	-						PBX4_uc010xqz.1_Intron|PBX4_uc010xra.1_Intron	NM_025245	NP_079521	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2						CTTTCCTGTTCCAGTTTTCAG	0.507													4	2	---	---	---	---	
ZNF714	148206	broad.mit.edu	37	19	21281144	21281144	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21281144delT	uc002npo.3	+						ZNF714_uc002npl.2_Intron|ZNF714_uc010ecp.1_Intron|ZNF714_uc002npn.2_Intron	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TACATAAGTCTTAATATACCC	0.308													333	149	---	---	---	---	
TDRD12	91646	broad.mit.edu	37	19	33299620	33299620	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33299620delT	uc002ntq.2	+									Q587J7	TDR12_HUMAN	RecName: Full=Tudor domain-containing protein 12; AltName: Full=ES cell-associated transcript 8 protein;								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	Esophageal squamous(110;0.137)					CATTATTGAATTTTTAAAAAA	0.159													4	2	---	---	---	---	
ZNF233	353355	broad.mit.edu	37	19	44776905	44776905	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44776905delA	uc002oyz.1	+						ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Intron	NM_181756	NP_861421	A6NK53	ZN233_HUMAN	zinc finger protein 233						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)				aaaaaaagagaaaaaaaaaCA	0.159													4	4	---	---	---	---	
ZFP112	7771	broad.mit.edu	37	19	44845036	44845037	+	Intron	DEL	AC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44845036_44845037delAC	uc010ejj.2	-						ZFP112_uc002ozc.3_Intron|ZFP112_uc010xwy.1_Intron|ZFP112_uc010xwz.1_Intron	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CTCCTCATTTACACACACACAC	0.361													4	2	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45852955	45852955	+	Intron	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45852955delG	uc002pbf.1	+						KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ACGTGAGGGTGGGGGGGGGCC	0.652													4	2	---	---	---	---	
CDC42EP5	148170	broad.mit.edu	37	19	54981121	54981121	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54981121delT	uc002qfz.1	-							NM_145057	NP_659494	Q6NZY7	BORG3_HUMAN	CDC42 effector protein 5						positive regulation of actin filament polymerization|positive regulation of pseudopodium assembly|regulation of cell shape	cytoplasm|cytoskeleton|endomembrane system|membrane	GTP-Rho binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		CGCATCCCCCTTCCATTGCCC	0.368													4	2	---	---	---	---	
ZNF583	147949	broad.mit.edu	37	19	56916308	56916309	+	Intron	DEL	TG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56916308_56916309delTG	uc010ygl.1	+						ZNF583_uc002qnc.2_Intron|ZNF583_uc010ygm.1_Intron	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		GTGTGTGACCTGTGTGTGTGGG	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10197011	10197011	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10197011delA	uc002wnn.1	-						SNAP25_uc002wnq.1_5'Flank|SNAP25_uc002wnr.1_5'Flank|SNAP25_uc002wns.1_5'Flank|SNAP25_uc010gca.1_5'Flank|SNAP25_uc010gcb.1_5'Flank|SNAP25_uc010gcc.1_5'Flank					Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																		AAGAACCTCTAAGAACCTCTC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12682687	12682687	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12682687delC								BTBD3 (775445 upstream) : SPTLC3 (306940 downstream)																							tgagactagacctggatgaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21677708	21677708	+	IGR	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21677708delC								NKX2-2 (183044 upstream) : PAX1 (8589 downstream)																							GAATGTCAAGCCCCAGCCAAT	0.463													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26148145	26148146	+	IGR	INS	-	AA	AA			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26148145_26148146insAA								C20orf191 (53468 upstream) : MIR663 (40676 downstream)																							ttatacagatgaaaaaaagtca	0.109													3	4	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29652102	29652103	+	Intron	INS	-	T	T	rs71264009		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29652102_29652103insT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ctaccatgttctttttgtgcct	0.000													8	6	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35425723	35425723	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35425723delT	uc002xgd.1	-						C20orf117_uc002xge.1_Intron	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				GGTGGTTGGGTTTTTTTTTTA	0.522													5	3	---	---	---	---	
BPI	671	broad.mit.edu	37	20	36946524	36946524	+	Intron	DEL	A	-	-	rs71932802		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36946524delA	uc002xib.2	+							NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein						defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				caacagcaacaaaaaaaaaaa	0.035													4	2	---	---	---	---	
PPP1R16B	26051	broad.mit.edu	37	20	37535955	37535962	+	Intron	DEL	TGGATGGA	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37535955_37535962delTGGATGGA	uc002xje.2	+						PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				ggtgggtgggtggatggatggatggatg	0.130													3	3	---	---	---	---	
ADA	100	broad.mit.edu	37	20	43270414	43270415	+	Intron	DEL	TT	-	-	rs77936929		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43270414_43270415delTT	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	gttgttgttgtttttttttttt	0.218									Adenosine_Deaminase_Deficiency				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53751632	53751632	+	IGR	DEL	G	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53751632delG								DOK5 (483923 upstream) : CBLN4 (820865 downstream)																							CCTGTAGACAGGGGCAGATAT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56686807	56686808	+	IGR	DEL	TC	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56686807_56686808delTC								PMEPA1 (400266 upstream) : C20orf85 (39175 downstream)																							TGGGATTCCTTCTCCCAAGGTT	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59018435	59018435	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59018435delT	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		ctctgtggagtttttttttcc	0.015													4	2	---	---	---	---	
ZBTB46	140685	broad.mit.edu	37	20	62411789	62411789	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62411789delA	uc002ygv.1	-						ZBTB46_uc002ygu.2_Intron	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					cgccacatacaaaaaaaccaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9854127	9854128	+	IGR	INS	-	C	C			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9854127_9854128insC								None (None upstream) : None (None downstream)																							ttcaacctcctcacactgaatt	0.025													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10704654	10704655	+	IGR	INS	-	A	A	rs111933778		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10704654_10704655insA								None (None upstream) : TPTE (202088 downstream)																							tattttcacttaaaaactaaac	0.000													20	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10764159	10764159	+	IGR	DEL	A	-	-	rs111339368		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10764159delA								None (None upstream) : TPTE (142584 downstream)																							caatcaaaagataggttcaac	0.000													9	5	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10968699	10968699	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10968699delA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGAATCCCTTAAAAAATTGCC	0.418													4	2	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10979005	10979005	+	Intron	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10979005delA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		actgaaaaagaaatacaacaa	0.109													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11076555	11076557	+	Intron	DEL	TAA	-	-	rs151275384		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11076555_11076557delTAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tctaatttgttaataataatata	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11151911	11151912	+	IGR	INS	-	A	A	rs77036193		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11151911_11151912insA								BAGE (52974 upstream) : None (None downstream)																							AGGAGAAAGAGAAAAAAAATGA	0.371													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23964802	23964802	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23964802delT								None (None upstream) : None (None downstream)																							caccccacccttacccccgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30005427	30005427	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30005427delA								NCRNA00161 (92751 upstream) : N6AMT1 (239086 downstream)																							CACCCACTGGATGAGATTATG	0.488													4	2	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33362735	33362735	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33362735delT	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						gacctcattcttttttttttt	0.000													4	3	---	---	---	---	
TMEM50B	757	broad.mit.edu	37	21	34839088	34839088	+	Intron	DEL	A	-	-	rs67303406		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34839088delA	uc002yrt.1	-						TMEM50B_uc002yrs.1_Intron|TMEM50B_uc010gmb.1_Intron	NM_006134	NP_006125	P56557	TM50B_HUMAN	transmembrane protein 50B							endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						AAATATGAGGaaaaaaaaaaa	0.040													4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	36703080	36703080	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36703080delT	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						TCAGCCCACATTTTTTACTCT	0.423			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	37322281	37322282	+	Intron	INS	-	A	A	rs144301832	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37322281_37322282insA	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						ATGTTTCTTAGAAAAATGTTTA	0.421			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16116652	16116652	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16116652delA								None (None upstream) : POTEH (139680 downstream)																							AAATTTATAGAAGAAGGACAC	0.274													4	2	---	---	---	---	
C22orf28	51493	broad.mit.edu	37	22	32808538	32808538	+	5'Flank	DEL	A	-	-	rs5844995		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32808538delA	uc003amm.2	-						C22orf28_uc011ama.1_5'Flank	NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						GGAAAAAGATAACGCCAGCAG	0.413											OREG0003512	type=REGULATORY REGION|Gene=AF161466|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35081515	35081516	+	IGR	INS	-	T	T			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35081515_35081516insT								LARGE (762931 upstream) : ISX (380613 downstream)																							ATCATTTATTGTTTTTCTACAT	0.292													4	2	---	---	---	---	
TMEM184B	25829	broad.mit.edu	37	22	38664790	38664790	+	Intron	DEL	C	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38664790delC	uc003avf.1	-						TMEM184B_uc003avg.1_Intron|TMEM184B_uc003avh.1_Intron|TMEM184B_uc010gxl.1_Intron	NM_012264	NP_036396	Q9Y519	T184B_HUMAN	transmembrane protein 184B							integral to membrane					0	Melanoma(58;0.045)					tccctaagagcccccaggacA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39680675	39680675	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39680675delT								PDGFB (39718 upstream) : RPL3 (28213 downstream)																							TTTTCTCTGCTTAGGGAAATA	0.239													4	2	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40677500	40677500	+	Intron	DEL	T	-	-	rs71838517		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40677500delT	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						TAAACCTGTATTTTTTTTTTT	0.308													4	3	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42160948	42160948	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42160948delT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_Intron|MEI1_uc003bbb.1_Intron|MEI1_uc003bbc.1_Intron|MEI1_uc010gym.1_Intron|MEI1_uc003bbd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						tcagtcttgattttttttttc	0.100													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	12844472	12844472	+	IGR	DEL	A	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12844472delA								PRPS2 (2130 upstream) : TLR7 (40730 downstream)																							AGCTTCCTTGAAAAAAAAAAG	0.239													11	5	---	---	---	---	
ACE2	59272	broad.mit.edu	37	X	15583216	15583217	+	Intron	DEL	AG	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15583216_15583217delAG	uc004cxa.1	-						ACE2_uc004cxb.2_Intron	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor						angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	AGAGTCCACCAGAGAGAGAGAG	0.475											OREG0019681	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MID1IP1	58526	broad.mit.edu	37	X	38664818	38664818	+	3'UTR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38664818delT	uc004dei.3	+	3					MID1IP1_uc010ngz.2_3'UTR|MID1IP1_uc004dej.3_3'UTR	NM_001098790	NP_001092260	Q9NPA3	M1IP1_HUMAN	MID1 interacting G12-like protein						lipid biosynthetic process|negative regulation of microtubule depolymerization|positive regulation of fatty acid biosynthetic process|positive regulation of ligase activity|protein polymerization	cytosol|microtubule|nucleus					0						TCCTCAAAGCTTTTTTTTTTT	0.642													4	2	---	---	---	---	
OPHN1	4983	broad.mit.edu	37	X	67273791	67273791	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67273791delT	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						ACTCTGGCTATTTTTTTTTTT	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	75555026	75555026	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75555026delT								CXorf26 (156993 upstream) : MAGEE1 (93091 downstream)																							ttgctttCCCTTTTTTTTTTC	0.169													2	4	---	---	---	---	
MAGT1	84061	broad.mit.edu	37	X	77111274	77111274	+	Intron	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77111274delT	uc004fof.2	-						MAGT1_uc004fog.3_Intron	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						GAAAACACTAttttttttttt	0.134													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13445900	13445900	+	IGR	DEL	C	-	-	rs149511831		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13445900delC								None (None upstream) : None (None downstream)																							AAAGTCCCAACAAACTTCTCA	0.244													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13552156	13552157	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13552156_13552157insA								None (None upstream) : None (None downstream)																							CCCTCTTGAACGTCACTGGAGA	0.431													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	22722112	22722113	+	IGR	INS	-	A	A			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:22722112_22722113insA								TTTY10 (40998 upstream) : EIF1AY (15498 downstream)																							cacaaaaagagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59010884	59010884	+	IGR	DEL	T	-	-			TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59010884delT								None (None upstream) : None (None downstream)																							ggaataactgttgatgcagta	0.000													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59013019	59013019	+	IGR	DEL	A	-	-	rs148494923		TCGA-CZ-5454-01A-01D-1501-10	TCGA-CZ-5454-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59013019delA								None (None upstream) : None (None downstream)																							gtctcaaaagaaaaaaaaaaT	0.189													7	4	---	---	---	---	
