Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
GNB1	2782	broad.mit.edu	37	1	1722611	1722612	+	Intron	INS	-	T	T	rs112081596		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1722611_1722612insT	uc001aif.2	-						GNB1_uc009vky.2_Intron	NM_002074	NP_002065			guanine nucleotide-binding protein, beta-1						cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)														---	---	---	---
ARHGEF16	27237	broad.mit.edu	37	1	3381862	3381863	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3381862_3381863insA	uc001akg.3	+						ARHGEF16_uc001aki.2_5'Flank|ARHGEF16_uc001akj.2_5'Flank	NM_014448	NP_055263			Rho guanine exchange factor 16						activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	4129947	4129947	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4129947delT								LOC100133612 (296070 upstream) : LOC284661 (342164 downstream)																																			---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4822044	4822044	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4822044delT	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	5351952	5351953	+	IGR	INS	-	G	G	rs139699167	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5351952_5351953insG								AJAP1 (508102 upstream) : NPHP4 (570917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5727584	5727585	+	Intron	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5727584_5727585delCA	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	6981346	6981346	+	Intron	DEL	A	-	-	rs79615812		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6981346delA	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
TARDBP	23435	broad.mit.edu	37	1	11080808	11080808	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11080808delA	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401			TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)														---	---	---	---
MASP2	10747	broad.mit.edu	37	1	11106454	11106455	+	Intron	INS	-	G	G	rs142927705	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11106454_11106455insG	uc001aru.2	-						MASP2_uc001arv.2_Intron|MASP2_uc001arw.2_3'UTR|MASP2_uc001arx.1_Intron	NM_006610	NP_006601			mannan-binding lectin serine protease 2 isoform						complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)														---	---	---	---
PRAMEF11	440560	broad.mit.edu	37	1	12889138	12889139	+	Intron	DEL	TT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12889138_12889139delTT	uc001auk.2	-							NM_001146344	NP_001139816			PRAME family member 11												0																		---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15591045	15591046	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15591045_15591046delTG	uc001awb.2	+						FHAD1_uc001awa.1_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17120993	17120994	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17120993_17120994insT	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17180697	17180697	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17180697delA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17204712	17204712	+	Intron	DEL	C	-	-	rs149290793		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17204712delC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
UBR4	23352	broad.mit.edu	37	1	19520264	19520265	+	Intron	DEL	CA	-	-	rs4912053		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19520264_19520265delCA	uc001bbi.2	-							NM_020765	NP_065816			retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20754629	20754629	+	Intron	DEL	A	-	-	rs71585764		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20754629delA	uc001bdf.1	-											Homo sapiens cDNA clone IMAGE:5269505.																														---	---	---	---
PINK1	65018	broad.mit.edu	37	1	20971980	20971981	+	Intron	INS	-	AA	AA	rs11379920		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20971980_20971981insAA	uc001bdm.2	+						PINK1_uc001bdn.2_5'Flank	NM_032409	NP_115785			PTEN induced putative kinase 1 precursor						cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	25380940	25380941	+	IGR	INS	-	TCCTTCCT	TCCTTCCT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25380940_25380941insTCCTTCCT								RUNX3 (89328 upstream) : SYF2 (167826 downstream)																																			---	---	---	---
MTMR9L	339483	broad.mit.edu	37	1	32700936	32700936	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32700936delT	uc001but.2	-						MTMR9L_uc010ohb.1_Intron|MTMR9L_uc001buv.3_Intron					Homo sapiens cDNA FLJ30998 fis, clone HLUNG1000105, weakly similar to MYOTUBULARIN.												0																		---	---	---	---
ZBTB8A	653121	broad.mit.edu	37	1	32963164	32963165	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32963164_32963165insT	uc001bvk.2	+							NM_001145720				zinc finger and BTB domain containing 8B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	34787061	34787061	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34787061delA								C1orf94 (102332 upstream) : MIR552 (348139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37208672	37208673	+	IGR	INS	-	TG	TG	rs138885369	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37208672_37208673insTG								CSF3R (260163 upstream) : GRIK3 (52455 downstream)																																			---	---	---	---
PPIEL	728448	broad.mit.edu	37	1	40011937	40011937	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40011937delC	uc001cdk.2	-							NR_003929				Homo sapiens cDNA FLJ35287 fis, clone PROST2008243.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	40055989	40055991	+	IGR	DEL	TGA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40055989_40055991delTGA								PABPC4 (13468 upstream) : HEYL (33113 downstream)																																			---	---	---	---
NFYC	4802	broad.mit.edu	37	1	41213913	41213913	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41213913delC	uc001cge.2	+						NFYC_uc010ojm.1_Intron|NFYC_uc001cfx.3_Intron|NFYC_uc009vwd.2_Intron|NFYC_uc001cfz.2_Intron|NFYC_uc010ojn.1_Intron|NFYC_uc001cfy.3_Intron|NFYC_uc001cgc.2_Intron|NFYC_uc001cgb.2_Intron|NFYC_uc001cgd.3_Intron	NM_001142588	NP_001136060			nuclear transcription factor Y, gamma isoform 1						protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)|kidney(1)	3	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	42842238	42842240	+	IGR	DEL	AGG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42842238_42842240delAGG								FOXJ3 (40690 upstream) : RIMKLA (4228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	43756945	43756946	+	IGR	INS	-	TT	TT	rs71577691		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43756945_43756946insTT								C1orf210 (5695 upstream) : TIE1 (9718 downstream)																																			---	---	---	---
ST3GAL3	6487	broad.mit.edu	37	1	44389155	44389155	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44389155delG	uc001ckc.2	+						ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270			sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	46909044	46909044	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46909044delT								FAAH (29524 upstream) : DMBX1 (63624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	46942936	46942936	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46942936delC								FAAH (63416 upstream) : DMBX1 (29732 downstream)																																	OREG0013461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EPS15	2060	broad.mit.edu	37	1	51970791	51970792	+	Intron	INS	-	A	A	rs112478129		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51970791_51970792insA	uc001csq.1	-						EPS15_uc009vyz.1_Intron|EPS15_uc001csr.1_Intron	NM_001981	NP_001972			epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2								T	MLL	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	1	53094195	53094196	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53094195_53094196insA								GPX7 (19473 upstream) : FAM159A (4870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	54632234	54632234	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54632234delT								CDCP2 (12791 upstream) : CYB5RL (5795 downstream)																																			---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54851162	54851163	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54851162_54851163delAC	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
C1orf177	163747	broad.mit.edu	37	1	55285782	55285793	+	Intron	DEL	TCTCTCTTTCTT	-	-	rs141652617	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55285782_55285793delTCTCTCTTTCTT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003			hypothetical protein LOC163747 isoform 2												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56104434	56104434	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56104434delT	uc001cyi.1	+											SubName: Full=cDNA FLJ45337 fis, clone BRHIP3007960;																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	56166426	56166426	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56166426delT	uc001cyi.1	+											SubName: Full=cDNA FLJ45337 fis, clone BRHIP3007960;																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	56317016	56317016	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56317016delA								USP24 (636254 upstream) : PPAP2B (643417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	63669074	63669075	+	Intron	INS	-	T	T	rs12405016		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63669074_63669075insT	uc001daw.1	-											Homo sapiens cDNA clone IMAGE:4838722.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	64811367	64811370	+	IGR	DEL	CACA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64811367_64811370delCACA								UBE2U (101340 upstream) : CACHD1 (125106 downstream)																																			---	---	---	---
IL23R	149233	broad.mit.edu	37	1	67672567	67672568	+	Intron	INS	-	T	T	rs79547341		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67672567_67672568insT	uc001ddo.2	+						IL23R_uc009waz.2_Intron|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Intron|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_Intron|IL23R_uc001ddq.2_Intron|IL23R_uc010opn.1_Intron|IL23R_uc001ddr.2_Intron|IL23R_uc010opo.1_Intron|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Intron|IL23R_uc010opr.1_Intron|IL23R_uc010ops.1_Intron|IL23R_uc010opt.1_Intron|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Intron|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Intron|IL23R_uc010opz.1_Intron|IL23R_uc010oqa.1_Intron|IL23R_uc010oqb.1_Intron|IL23R_uc010oqc.1_Intron|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Intron|IL23R_uc010oqg.1_Intron|IL23R_uc010oqh.1_Intron|IL23R_uc001dds.2_5'Flank|IL23R_uc001ddt.2_5'Flank	NM_144701	NP_653302			interleukin 23 receptor precursor						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0																		---	---	---	---
RPE65	6121	broad.mit.edu	37	1	68917241	68917241	+	5'Flank	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68917241delT	uc001dei.1	-							NM_000329	NP_000320			retinal pigment epithelium-specific protein						visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	69796354	69796355	+	IGR	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69796354_69796355delGA								DEPDC1 (833555 upstream) : LRRC7 (236513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73570074	73570074	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73570074delA								NEGR1 (821669 upstream) : LRRIQ3 (921630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	76184689	76184689	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76184689delA	uc001dgv.2	-											Homo sapiens mRNA; cDNA DKFZp686J0423 (from clone DKFZp686J0423).																														---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76609077	76609078	+	Intron	INS	-	GTGTGT	GTGTGT	rs146822606	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76609077_76609078insGTGTGT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	77550363	77550364	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77550363_77550364delCT								ST6GALNAC5 (18971 upstream) : PIGK (4305 downstream)																																			---	---	---	---
PIGK	10026	broad.mit.edu	37	1	77632188	77632189	+	Intron	INS	-	A	A	rs142671419	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77632188_77632189insA	uc001dhk.2	-						PIGK_uc010orj.1_Intron|PIGK_uc009wbx.2_Intron|PIGK_uc001dhl.1_Intron	NM_005482	NP_005473			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|protein thiol-disulfide exchange|proteolysis	GPI-anchor transamidase complex	cysteine-type endopeptidase activity|GPI-anchor transamidase activity|protein binding			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	78241841	78241844	+	IGR	DEL	ACAA	-	-	rs71658578		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78241841_78241844delACAA								USP33 (16304 upstream) : FAM73A (3465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79317354	79317354	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79317354delG								IFI44 (187593 upstream) : ELTD1 (38097 downstream)																																			---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82033540	82033540	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82033540delT	uc001dis.2	+											SubName: Full=cDNA FLJ41428 fis, clone BRHIP2005236, highly similar to Latrophilin-2;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
ODF2L	57489	broad.mit.edu	37	1	86823286	86823287	+	Intron	INS	-	A	A	rs142517000		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86823286_86823287insA	uc001dll.1	-						ODF2L_uc001dlm.1_Intron|ODF2L_uc001dln.2_Intron|ODF2L_uc001dlo.2_Intron|ODF2L_uc001dlp.2_Intron|ODF2L_uc010osg.1_Intron	NM_020729	NP_065780			outer dense fiber of sperm tails 2-like isoform							centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)														---	---	---	---
LOC339524	339524	broad.mit.edu	37	1	87625722	87625722	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87625722delC	uc001dme.1	+						LOC339524_uc001dmf.2_Intron	NM_001134492	NP_001127964			heparan sulfate 2-O-sulfotransferase 1 isoform												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	87985550	87985551	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87985550_87985551delTG								LMO4 (170947 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	95245417	95245418	+	Intron	DEL	CC	-	-	rs142669964		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95245417_95245418delCC	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																														---	---	---	---
DBT	1629	broad.mit.edu	37	1	100703876	100703877	+	Intron	INS	-	CCCTC	CCCTC	rs141440499	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100703876_100703877insCCCTC	uc001dta.2	-						DBT_uc010oug.1_Intron	NM_001918	NP_001909			dihydrolipoamide branched chain transacylase						branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	101090620	101090620	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101090620delG								GPR88 (83038 upstream) : VCAM1 (94677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	107323756	107323756	+	IGR	DEL	A	-	-	rs111270429		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107323756delA								None (None upstream) : PRMT6 (275511 downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107961569	107961569	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107961569delA	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvi.2_Intron|NTNG1_uc001dve.2_Intron|NTNG1_uc009wek.2_Intron|NTNG1_uc001dvg.2_Intron|NTNG1_uc009wem.2_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108247977	108247978	+	Intron	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108247977_108247978delAA	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104			vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108374657	108374662	+	Intron	DEL	ATGAGC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108374657_108374662delATGAGC	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104			vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	115919245	115919245	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115919245delT								NGF (38388 upstream) : VANGL1 (265329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142555474	142555474	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142555474delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142615214	142615215	+	IGR	INS	-	T	T	rs149144068		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142615214_142615215insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142642170	142642170	+	Intron	DEL	A	-	-	rs113636242		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142642170delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142917402	142917403	+	Intron	INS	-	AC	AC	rs148450439		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142917402_142917403insAC	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143119751	143119753	+	Intron	DEL	CTA	-	-	rs150545507		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143119751_143119753delCTA	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143140855	143140856	+	Intron	INS	-	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143140855_143140856insG	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143144761	143144762	+	Intron	DEL	AT	-	-	rs151281403		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143144761_143144762delAT	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143474835	143474835	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143474835delT								None (None upstream) : LOC100286793 (172804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143535041	143535041	+	IGR	DEL	C	-	-	rs111718134		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143535041delC								None (None upstream) : LOC100286793 (112598 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144528099	144528100	+	Intron	DEL	AA	-	-	rs66868112		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144528099_144528100delAA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144533512	144533514	+	Intron	DEL	AAG	-	-	rs66523280		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144533512_144533514delAAG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145058407	145058408	+	Intron	INS	-	A	A	rs146890997		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058407_145058408insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145370407	145370408	+	Intron	INS	-	GA	GA			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145370407_145370408insGA	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	148924626	148924628	+	IGR	DEL	AAC	-	-	rs60245226		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148924626_148924628delAAC								NBPF16 (166315 upstream) : LOC645166 (3658 downstream)																																			---	---	---	---
LOC645166	645166	broad.mit.edu	37	1	148952142	148952142	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148952142delT	uc009wkw.1	+							NR_027354				Homo sapiens cDNA, FLJ18771.												0																		---	---	---	---
ANXA9	8416	broad.mit.edu	37	1	150957654	150957655	+	Intron	INS	-	CTCG	CTCG	rs71729267		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150957654_150957655insCTCG	uc001ewa.2	+							NM_003568	NP_003559			annexin A9						cell-cell adhesion	cell surface|cytosol	acetylcholine receptor activity|calcium ion binding|calcium-dependent phospholipid binding|phosphatidylserine binding|protein homodimerization activity				0	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
DCST2	127579	broad.mit.edu	37	1	154993916	154993916	+	Intron	DEL	T	-	-	rs112439021		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154993916delT	uc001fgm.2	-						DCST2_uc009wpb.2_Intron	NM_144622	NP_653223			DC-STAMP domain containing 2							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156522975	156522975	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156522975delA	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	157088822	157088822	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157088822delC								ETV3L (19222 upstream) : ETV3 (5637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157641018	157641021	+	IGR	DEL	TATC	-	-	rs144837964	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157641018_157641021delTATC								FCRL4 (73148 upstream) : FCRL3 (5257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158073303	158073303	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158073303delT								KIRREL (7461 upstream) : CD1D (76434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158176070	158176071	+	5'Flank	INS	-	TT	TT	rs141018069	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158176070_158176071insTT	uc001frs.1	-											Homo sapiens cDNA FLJ40602 fis, clone THYMU2011585.																														---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162274570	162274571	+	Intron	INS	-	TGTG	TGTG	rs142219781	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162274570_162274571insTGTG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
UHMK1	127933	broad.mit.edu	37	1	162468973	162468973	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162468973delT	uc001gcc.1	+						UHMK1_uc001gcb.1_Intron|UHMK1_uc009wuu.1_Intron	NM_175866	NP_787062			kinase interacting stathmin						cell cycle arrest|neuron projection development|peptidyl-serine phosphorylation|positive regulation of translational initiation|protein autophosphorylation|regulation of protein export from nucleus	axon|dendrite cytoplasm|neuronal RNA granule|nucleus	protein binding|protein serine/threonine kinase activity|ribonucleoprotein binding|RNA binding				0	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	163053059	163053060	+	IGR	DEL	CA	-	-	rs35657995		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163053059_163053060delCA								RGS4 (6468 upstream) : RGS5 (59038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163215138	163215138	+	IGR	DEL	T	-	-	rs35037655		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163215138delT								RGS5 (42266 upstream) : NUF2 (76585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	165150610	165150610	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165150610delG								PBX1 (296310 upstream) : LMX1A (20495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	165924560	165924561	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165924560_165924561insT								UCK2 (47223 upstream) : FAM78B (104855 downstream)																																			---	---	---	---
FAM78B	149297	broad.mit.edu	37	1	166116875	166116875	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166116875delT	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961			hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
GPA33	10223	broad.mit.edu	37	1	167056128	167056129	+	Intron	DEL	GT	-	-	rs10553767		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167056128_167056129delGT	uc001gea.1	-							NM_005814	NP_005805			transmembrane glycoprotein A33 precursor							integral to plasma membrane	receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	167127682	167127683	+	IGR	INS	-	AC	AC	rs144831593	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167127682_167127683insAC								DUSP27 (29280 upstream) : POU2F1 (62460 downstream)																																			---	---	---	---
DCAF6	55827	broad.mit.edu	37	1	167964920	167964920	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167964920delA	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron|MIR1255B-2_hsa-mir-1255b-2|MI0006436_5'Flank	NM_001017977	NP_001017977			IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
TNFSF4	7292	broad.mit.edu	37	1	173165573	173165574	+	Intron	DEL	TC	-	-	rs72190735		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173165573_173165574delTC	uc001giw.2	-						TNFSF4_uc001giv.2_Intron	NM_003326	NP_003317			tumor necrosis factor (ligand) superfamily,						acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1																		---	---	---	---
RFWD2	64326	broad.mit.edu	37	1	176157970	176157971	+	Intron	INS	-	ACAC	ACAC	rs142079354	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176157970_176157971insACAC	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron	NM_022457	NP_071902			ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
NPL	80896	broad.mit.edu	37	1	182757062	182757063	+	5'Flank	INS	-	CA	CA	rs34260906		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182757062_182757063insCA	uc009wyb.2	+						NPL_uc010pnx.1_5'Flank|NPL_uc010pny.1_5'Flank|NPL_uc001gpo.1_5'Flank|NPL_uc009wyc.2_5'Flank|NPL_uc001gpp.3_5'Flank	NM_030769	NP_110396			N-acetylneuraminate pyruvate lyase						carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
RGL1	23179	broad.mit.edu	37	1	183857872	183857872	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183857872delT	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964			ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186710055	186710055	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186710055delT								PTGS2 (60496 upstream) : PLA2G4A (87977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188416136	188416139	+	IGR	DEL	TTCC	-	-	rs112749943		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188416136_188416139delTTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	190618806	190618817	+	IGR	DEL	TTCCTTCCTTCT	-	-	rs150632663		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190618806_190618817delTTCCTTCCTTCT								FAM5C (172047 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191484729	191484729	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191484729delG								None (None upstream) : RGS18 (642863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192498067	192498067	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192498067delT								RGS21 (161655 upstream) : RGS1 (46790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194738060	194738060	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194738060delA								None (None upstream) : None (None downstream)																																			---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196330335	196330336	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196330335_196330336delAC	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron	NM_198503	NP_940905			potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197341842	197341843	+	Intron	INS	-	A	A	rs144652368		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197341842_197341843insA	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Intron|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Intron	NM_201253	NP_957705			crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	199369420	199369421	+	IGR	DEL	TA	-	-	rs67421527		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199369420_199369421delTA								MIR181A1 (541138 upstream) : NR5A2 (627349 downstream)																																			---	---	---	---
LMOD1	25802	broad.mit.edu	37	1	201907260	201907260	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201907260delT	uc001gxb.2	-						LMOD1_uc010ppu.1_Intron	NM_012134	NP_036266			leiomodin 1 (smooth muscle)						muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
PM20D1	148811	broad.mit.edu	37	1	205820183	205820183	+	5'Flank	DEL	A	-	-	rs71817302		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205820183delA	uc001hdj.2	-						PM20D1_uc009xbr.2_5'Flank	NM_152491	NP_689704			peptidase M20 domain containing 1 precursor							extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	208850763	208850764	+	IGR	INS	-	A	A	rs149813277	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208850763_208850764insA								PLXNA2 (433098 upstream) : LOC642587 (751404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209598121	209598121	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209598121delT								None (None upstream) : LOC642587 (4047 downstream)																																			---	---	---	---
NSL1	25936	broad.mit.edu	37	1	212935649	212935649	+	Intron	DEL	A	-	-	rs35753417		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212935649delA	uc001hjn.2	-						NSL1_uc001hjm.2_Intron|NSL1_uc010pti.1_Intron	NM_015471	NP_056286			NSL1, MIND kinetochore complex component isoform						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	221326099	221326100	+	IGR	INS	-	CAA	CAA			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221326099_221326100insCAA								HLX (267701 upstream) : LOC400804 (177170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221499654	221499655	+	IGR	INS	-	T	T	rs142089187	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221499654_221499655insT								HLX (441256 upstream) : LOC400804 (3615 downstream)																																			---	---	---	---
LOC400804	400804	broad.mit.edu	37	1	221509373	221509373	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221509373delA	uc001hmw.1	-	1	266	c.57delT	c.(55-57)CCTfs	p.P19fs		NR_024236				RecName: Full=Putative uncharacterized protein C1orf140;												0																		---	---	---	---
C1orf95	375057	broad.mit.edu	37	1	226771914	226771914	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226771914delA	uc010pvn.1	+							NM_001003665	NP_001003665			hypothetical protein LOC375057							integral to membrane				ovary(1)	1	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)														---	---	---	---
CABC1	56997	broad.mit.edu	37	1	227148176	227148178	+	Intron	DEL	GCA	-	-	rs114853987	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227148176_227148178delGCA	uc001hqm.1	+						CABC1_uc010pvp.1_Intron|CABC1_uc001hqn.1_Intron|CABC1_uc009xeq.1_Intron|CABC1_uc010pvq.1_Intron	NM_020247	NP_064632			chaperone, ABC1 activity of bc1 complex like						cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)																---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227177883	227177884	+	3'UTR	INS	-	ACA	ACA	rs143046609	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227177883_227177884insACA	uc001hqr.2	-	36					CDC42BPA_uc001hqq.2_3'UTR|CDC42BPA_uc001hqs.2_3'UTR|CDC42BPA_uc009xes.2_3'UTR|CDC42BPA_uc010pvs.1_3'UTR|CDC42BPA_uc001hqp.2_3'UTR	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	228097557	228097567	+	IGR	DEL	GAAGGAGGGGA	-	-	rs139651349	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228097557_228097567delGAAGGAGGGGA								PRSS38 (63388 upstream) : WNT9A (11598 downstream)																																			---	---	---	---
ACTA1	58	broad.mit.edu	37	1	229570268	229570268	+	5'Flank	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229570268delC	uc001htm.2	-							NM_001100	NP_001091			actin, alpha 1, skeletal muscle						muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	229826109	229826109	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229826109delT								URB2 (30163 upstream) : GALNT2 (367427 downstream)																																			---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230267823	230267825	+	Intron	DEL	TCT	-	-	rs67523014		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230267823_230267825delTCT	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
COG2	22796	broad.mit.edu	37	1	230787953	230787954	+	Intron	INS	-	AGG	AGG	rs144169424	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230787953_230787954insAGG	uc001htw.2	+						COG2_uc001htx.2_Intron|COG2_uc010pwc.1_Intron	NM_007357	NP_031383			component of oligomeric golgi complex 2 isoform						Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	232468965	232468965	+	IGR	DEL	C	-	-	rs113707890		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232468965delC								DISC1 (291949 upstream) : SIPA1L2 (64749 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233431748	233431748	+	5'Flank	DEL	C	-	-	rs1294350		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233431748delC	uc001hvl.2	-							NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234356848	234356851	+	Intron	DEL	AGAG	-	-	rs72337252		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234356848_234356851delAGAG	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
GNG4	2786	broad.mit.edu	37	1	235749680	235749681	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235749680_235749681delGT	uc001hxe.3	-						GNG4_uc009xfz.2_Intron|GNG4_uc001hxh.3_Intron	NM_001098722	NP_001092192			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)															---	---	---	---
LYST	1130	broad.mit.edu	37	1	235873719	235873719	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235873719delG	uc001hxj.2	-						LYST_uc001hxi.2_Intron	NM_000081	NP_000072			lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)											Chediak-Higashi_syndrome				---	---	---	---
NID1	4811	broad.mit.edu	37	1	236180872	236180873	+	Intron	INS	-	A	A	rs141192565	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236180872_236180873insA	uc001hxo.2	-						NID1_uc009xgd.2_Intron	NM_002508	NP_002499			nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	239263763	239263764	+	IGR	INS	-	ATACAT	ATACAT	rs148416782	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239263763_239263764insATACAT								LOC339535 (614446 upstream) : CHRM3 (286101 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240301838	240301838	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240301838delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	240806973	240806974	+	IGR	DEL	TT	-	-	rs111688685		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240806973_240806974delTT								GREM2 (31511 upstream) : RGS7 (124581 downstream)																																			---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242643785	242643785	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242643785delA	uc001hzn.1	-						PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
ADSS	159	broad.mit.edu	37	1	244593624	244593625	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244593624_244593625insA	uc001iaj.2	-						ADSS_uc009xgr.1_Intron	NM_001126	NP_001117			adenylosuccinate synthase						AMP biosynthetic process|immune system process|purine base metabolic process	cytosol|plasma membrane	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(2)|kidney(1)	3	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)		L-Aspartic Acid(DB00128)													---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245667601	245667602	+	Intron	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245667601_245667602delTC	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246159827	246159827	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246159827delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	648377	648377	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:648377delA								FAM150B (360069 upstream) : TMEM18 (19598 downstream)																																			---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1969003	1969004	+	Intron	DEL	GC	-	-	rs149817539		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1969003_1969004delGC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2299418	2299419	+	Intron	DEL	AT	-	-	rs112459105	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2299418_2299419delAT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4559794	4559795	+	IGR	DEL	CT	-	-	rs149661145		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4559794_4559795delCT								ALLC (809536 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6324684	6324687	+	IGR	DEL	AGGA	-	-	rs76871621		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6324684_6324687delAGGA								LOC400940 (196320 upstream) : CMPK2 (655816 downstream)																																			---	---	---	---
NOL10	79954	broad.mit.edu	37	2	10817966	10817967	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10817966_10817967delTG	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170			nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)														---	---	---	---
KCNF1	3754	broad.mit.edu	37	2	11050151	11050152	+	5'Flank	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11050151_11050152delTG	uc002rax.2	+							NM_002236	NP_002227			potassium voltage-gated channel, subfamily F,							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)														---	---	---	---
LPIN1	23175	broad.mit.edu	37	2	11909718	11909718	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11909718delT	uc010yjn.1	+						LPIN1_uc010yjm.1_Intron|LPIN1_uc002rbt.2_Intron|LPIN1_uc002rbs.2_Intron	NM_145693	NP_663731			lipin 1						fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	13364187	13364188	+	IGR	INS	-	AC	AC	rs146209183	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13364187_13364188insAC								TRIB2 (481331 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14860414	14860415	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14860414_14860415delAC								FAM84A (69481 upstream) : NBAS (446617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16400793	16400793	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16400793delG								MYCN (313665 upstream) : FAM49A (333108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16850459	16850460	+	IGR	INS	-	TG	TG	rs149455153	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16850459_16850460insTG								FAM49A (3363 upstream) : RAD51AP2 (841526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19904146	19904147	+	IGR	INS	-	CACA	CACA	rs12619202		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19904146_19904147insCACA								OSR1 (345774 upstream) : TTC32 (192371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21601239	21601239	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21601239delC								APOB (334294 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22014567	22014570	+	IGR	DEL	CTTC	-	-	rs71974438		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22014567_22014570delCTTC								APOB (747622 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22174521	22174522	+	IGR	INS	-	AGAA	AGAA	rs142952741	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22174521_22174522insAGAA								APOB (907576 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23073977	23073977	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23073977delT								None (None upstream) : KLHL29 (681478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23400907	23400907	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23400907delT								None (None upstream) : KLHL29 (354548 downstream)																																			---	---	---	---
KLHL29	114818	broad.mit.edu	37	2	23759788	23759789	+	Intron	INS	-	CACTCT	CACTCT	rs143009876	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23759788_23759789insCACTCT	uc002ref.2	+											SubName: Full=KLHL29 protein; Flags: Fragment;											ovary(1)|lung(1)	2																		---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	23972114	23972114	+	3'UTR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23972114delA	uc002rek.3	-	28					ATAD2B_uc010yki.1_RNA|ATAD2B_uc002rei.3_3'UTR|ATAD2B_uc002rej.3_3'UTR	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
DNAJC27	51277	broad.mit.edu	37	2	25186057	25186057	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25186057delA	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628			DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	26230443	26230454	+	IGR	DEL	GTGTGTGTGTGG	-	-	rs113895149		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26230443_26230454delGTGTGTGTGTGG								KIF3C (25000 upstream) : RAB10 (26275 downstream)																																			---	---	---	---
RAB10	10890	broad.mit.edu	37	2	26278261	26278261	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26278261delT	uc002rgv.2	+							NM_016131	NP_057215			ras-related GTP-binding protein RAB10						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	27376376	27376377	+	IGR	INS	-	TCTTT	TCTTT	rs139640315	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27376376_27376377insTCTTT								TCF23 (643 upstream) : SLC5A6 (46082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	28682807	28682808	+	IGR	DEL	AC	-	-	rs140013090		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28682807_28682808delAC								FOSL2 (45293 upstream) : PLB1 (36174 downstream)																																			---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33247332	33247333	+	Intron	INS	-	TT	TT	rs5830249		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33247332_33247333insTT	uc002ros.2	+							NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	35876172	35876172	+	IGR	DEL	C	-	-	rs12472863		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35876172delC								None (None upstream) : CRIM1 (707225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37393715	37393717	+	IGR	DEL	TTC	-	-	rs10197917		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37393715_37393717delTTC								EIF2AK2 (9525 upstream) : SULT6B1 (1247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37675748	37675748	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37675748delG								QPCT (75284 upstream) : CDC42EP3 (194995 downstream)																																			---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40688006	40688007	+	Intron	INS	-	CTGA	CTGA	rs142776305	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40688006_40688007insCTGA	uc002rsd.3	-						SLC8A1_uc002rsc.1_Intron	NM_001112802	NP_001106273			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	44230975	44230976	+	IGR	INS	-	A	A	rs141861480	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44230975_44230976insA								LRPPRC (7831 upstream) : PPM1B (165024 downstream)																																			---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46273018	46273018	+	Intron	DEL	A	-	-	rs71394869		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46273018delA	uc002rut.2	+							NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	57688103	57688104	+	IGR	DEL	TT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57688103_57688104delTT								None (None upstream) : VRK2 (446682 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57775131	57775162	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG	-	-	rs58710429		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57775131_57775162delAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG								None (None upstream) : VRK2 (359624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60667962	60667963	+	IGR	DEL	AC	-	-	rs72354426		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60667962_60667963delAC								None (None upstream) : BCL11A (10340 downstream)																																			---	---	---	---
VPS54	51542	broad.mit.edu	37	2	64239826	64239826	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64239826delA	uc002scq.2	-						VPS54_uc002scp.2_Intron	NM_016516	NP_057600			vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	67826646	67826647	+	IGR	INS	-	T	T	rs138518531		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67826646_67826647insT								ETAA1 (189113 upstream) : C1D (442686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68345698	68345698	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68345698delA								C1D (55539 upstream) : WDR92 (4370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68565518	68565518	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68565518delT								CNRIP1 (18335 upstream) : PLEK (26804 downstream)																																			---	---	---	---
APLF	200558	broad.mit.edu	37	2	68799971	68799975	+	Intron	DEL	AACAA	-	-	rs71395980		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68799971_68799975delAACAA	uc002sep.2	+						APLF_uc002seq.1_Intron|APLF_uc002ser.1_Intron	NM_173545	NP_775816			aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2																		---	---	---	---
APLF	200558	broad.mit.edu	37	2	68853208	68853209	+	Intron	INS	-	G	G	rs140676039	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68853208_68853209insG	uc002seq.1	+						PROKR1_uc002ses.2_Intron					Homo sapiens cDNA FLJ16593 fis, clone TESTI4004722, highly  similar to Mus musculus G protein-coupled receptor 73 (Gpr73).						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2																		---	---	---	---
ASPRV1	151516	broad.mit.edu	37	2	70259818	70259818	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70259818delC	uc002sga.2	-						uc002sgb.1_Intron					Homo sapiens cDNA FLJ32260 fis, clone PROST1000334.						protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1																		---	---	---	---
ASPRV1	151516	broad.mit.edu	37	2	70308626	70308626	+	Intron	DEL	A	-	-	rs72060609		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70308626delA	uc002sga.2	-						uc002sgb.1_Intron|uc002sgd.2_Intron|uc002sge.1_Intron					Homo sapiens cDNA FLJ32260 fis, clone PROST1000334.						protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	74355348	74355349	+	IGR	INS	-	T	T	rs139293795	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74355348_74355349insT								TET3 (20048 upstream) : BOLA3 (7179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	74412826	74412827	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74412826_74412827insT								MOBKL1B (6831 upstream) : MTHFD2 (12863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76809837	76809837	+	IGR	DEL	T	-	-	rs71374372		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76809837delT								C2orf3 (871726 upstream) : LRRTM4 (165021 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80785569	80785570	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80785569_80785570delGT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88148378	88148379	+	IGR	INS	-	GT	GT	rs146297428	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88148378_88148379insGT								RMND5A (109612 upstream) : KRCC1 (178345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91801335	91801336	+	IGR	INS	-	CAATG	CAATG	rs56326147		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801335_91801336insCAATG								None (None upstream) : LOC654342 (3856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92085541	92085541	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92085541delG								GGT8P (115388 upstream) : FKSG73 (43618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92178561	92178563	+	IGR	DEL	ATG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92178561_92178563delATG								FKSG73 (48067 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92280547	92280548	+	IGR	INS	-	C	C	rs138884494		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92280547_92280548insC								FKSG73 (150053 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96593321	96593321	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593321delT	uc002sva.1	-						uc010yug.1_Intron|uc002svc.1_5'Flank					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98417222	98417223	+	Intron	INS	-	A	A	rs75414453		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98417222_98417223insA	uc002syh.3	-							NM_015348	NP_056163			RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	104905184	104905185	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104905184_104905185insA								None (None upstream) : LOC150568 (145620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108100773	108100774	+	IGR	DEL	TT	-	-	rs72100445		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108100773_108100774delTT								ST6GAL2 (597210 upstream) : LOC729121 (338746 downstream)																																			---	---	---	---
RGPD4	285190	broad.mit.edu	37	2	108479623	108479623	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108479623delT	uc010ywk.1	+						RGPD4_uc002tdu.2_Intron|RGPD4_uc010ywl.1_Intron	NM_182588	NP_872394			RANBP2-like and GRIP domain containing 4						intracellular transport		binding			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	112790410	112790411	+	IGR	INS	-	A	A	rs75562374		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112790410_112790411insA								MERTK (3465 upstream) : TMEM87B (22389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	113634142	113634142	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113634142delT								IL1B (39786 upstream) : IL1F7 (36406 downstream)																																			---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115634318	115634318	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115634318delT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	116966415	116966415	+	IGR	DEL	T	-	-	rs112138182		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116966415delT								DPP10 (364479 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	118165419	118165420	+	IGR	INS	-	CTTT	CTTT	rs138636071	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118165419_118165420insCTTT								None (None upstream) : DDX18 (406835 downstream)																																			---	---	---	---
STEAP3	55240	broad.mit.edu	37	2	120015853	120015853	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120015853delT	uc002tlp.2	+						STEAP3_uc002tlq.2_Intron|STEAP3_uc002tlr.2_Intron|STEAP3_uc010fle.2_Intron	NM_018234	NP_060704			dudulin 2 isoform b						apoptosis|cell cycle|cellular iron ion homeostasis|protein secretion|transferrin transport|transmembrane transport	endosome membrane|integral to membrane|multivesicular body	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			central_nervous_system(2)|skin(1)	3																		---	---	---	---
CLASP1	23332	broad.mit.edu	37	2	122398260	122398261	+	Intron	DEL	AA	-	-	rs35129398		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122398260_122398261delAA	uc002tnc.2	-						CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097			CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)																	---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125021956	125021957	+	Intron	INS	-	ACAG	ACAG	rs149935408	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125021956_125021957insACAG	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133016676	133016677	+	5'Flank	INS	-	TGTC	TGTC	rs67307110		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133016676_133016677insTGTC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133096619	133096624	+	IGR	DEL	ACACAC	-	-	rs34413131		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133096619_133096624delACACAC								NCRNA00164 (81077 upstream) : GPR39 (77523 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134029036	134029036	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134029036delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134827483	134827483	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134827483delA								NCKAP5 (501452 upstream) : MGAT5 (184347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	138695227	138695227	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138695227delG								THSD7B (259940 upstream) : HNMT (26363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140693496	140693496	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140693496delT								None (None upstream) : LRP1B (295500 downstream)																																			---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144946076	144946079	+	Intron	DEL	GGAT	-	-	rs149749765		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144946076_144946079delGGAT	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Intron	NM_001006636	NP_001006637			glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	146945683	146945684	+	IGR	INS	-	AT	AT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146945683_146945684insAT								None (None upstream) : PABPC1P2 (398941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148328923	148328924	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148328923_148328924insA								PABPC1P2 (980366 upstream) : ACVR2A (273162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151354605	151354606	+	IGR	DEL	TT	-	-	rs36186374		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151354605_151354606delTT								RND3 (10425 upstream) : RBM43 (750123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154098171	154098172	+	IGR	INS	-	TG	TG	rs138673350	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154098171_154098172insTG								ARL6IP6 (480404 upstream) : RPRM (235680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	157604036	157604036	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157604036delA								GPD2 (133789 upstream) : GALNT5 (510304 downstream)																																			---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160360780	160360780	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160360780delG	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uas.1_Intron|BAZ2B_uc002uau.1_Intron|BAZ2B_uc002uat.3_Intron|BAZ2B_uc010fop.1_Intron	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	161694538	161694541	+	IGR	DEL	ACAC	-	-	rs144456311		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161694538_161694541delACAC								RBMS1 (344220 upstream) : TANK (298925 downstream)																																			---	---	---	---
ABCB11	8647	broad.mit.edu	37	2	169873489	169873490	+	Intron	INS	-	AC	AC	rs71397686		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169873489_169873490insAC	uc002ueo.1	-							NM_003742	NP_003733			ATP-binding cassette, sub-family B (MDR/TAP),						bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	173019441	173019441	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173019441delT								DLX2 (51963 upstream) : ITGA6 (272641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174322483	174322483	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174322483delA								CDCA7 (88765 upstream) : SP3 (450776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	175207263	175207264	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175207263_175207264insT								SP9 (4995 upstream) : CIR1 (5616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	179941825	179941825	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179941825delA								CCDC141 (27039 upstream) : SESTD1 (24596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	183658548	183658553	+	IGR	DEL	CACACA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183658548_183658553delCACACA								DNAJC10 (15293 upstream) : FRZB (40184 downstream)																																			---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185582977	185582977	+	Intron	DEL	C	-	-	rs79104982		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185582977delC	uc002uph.2	+							NM_194250	NP_919226			zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	195186178	195186178	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195186178delT								None (None upstream) : None (None downstream)																																			---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197113300	197113301	+	Intron	INS	-	GAGA	GAGA	rs139727641		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197113300_197113301insGAGA	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811			HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198667191	198667192	+	5'Flank	DEL	GT	-	-	rs112639829		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198667191_198667192delGT	uc010fsp.2	+						PLCL1_uc002uuv.3_5'Flank	NM_001114661	NP_001108133			RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	202861804	202861804	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202861804delC								CDK15 (103541 upstream) : FZD7 (37506 downstream)																																			---	---	---	---
SUMO1	7341	broad.mit.edu	37	2	203081458	203081459	+	Intron	DEL	TT	-	-	rs139805661		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203081458_203081459delTT	uc002uyz.1	-						SUMO1_uc002uza.1_Intron	NM_001005781	NP_001005781			SMT3 suppressor of mif two 3 homolog 1 isoform a						DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	203188113	203188118	+	IGR	DEL	TGTGTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203188113_203188118delTGTGTG								NOP58 (19731 upstream) : BMPR2 (52932 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205641523	205641523	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205641523delC	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206014978	206014979	+	Intron	DEL	CA	-	-	rs10204064		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206014978_206014979delCA	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206370702	206370702	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206370702delA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206404873	206404875	+	Intron	DEL	TTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206404873_206404875delTTG	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	209064075	209064078	+	IGR	DEL	CCTT	-	-	rs12328626		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209064075_209064078delCCTT								C2orf80 (9302 upstream) : IDH1 (36876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217723588	217723589	+	IGR	DEL	CA	-	-	rs141238817		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217723588_217723589delCA								IGFBP5 (163316 upstream) : TNP1 (595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217877972	217877972	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217877972delG								TNP1 (153190 upstream) : DIRC3 (270776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	218879432	218879432	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218879432delG								TNS1 (11714 upstream) : RUFY4 (20279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221037760	221037760	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221037760delT								SLC4A3 (531059 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222551975	222551975	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222551975delC								EPHA4 (113053 upstream) : PAX3 (512632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	226647262	226647289	+	IGR	DEL	CCTCCCTCCCTTCCTCCCTCCCTCCCTT	-	-	rs72963840		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226647262_226647289delCCTCCCTCCCTTCCTCCCTCCCTCCCTT								KIAA1486 (51791 upstream) : IRS1 (948745 downstream)																																			---	---	---	---
SPHKAP	80309	broad.mit.edu	37	2	228936027	228936027	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228936027delA	uc002vpq.2	-						SPHKAP_uc002vpp.2_Intron|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116			sphingosine kinase type 1-interacting protein							cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)														---	---	---	---
UGT1A8	54576	broad.mit.edu	37	2	234565570	234565570	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234565570delT	uc002vup.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron	NM_019076	NP_061949			UDP glycosyltransferase 1 family, polypeptide A8						drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)														---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236461062	236461062	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236461062delA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																OREG0015311	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236521670	236521671	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236521670_236521671insT	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236691695	236691696	+	Intron	DEL	TC	-	-	rs72190767		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236691695_236691696delTC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236923361	236923362	+	Intron	INS	-	T	T	rs143680821	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236923361_236923362insT	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ANKMY1	51281	broad.mit.edu	37	2	241448177	241448180	+	Intron	DEL	ATGA	-	-	rs112514842		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241448177_241448180delATGA	uc002vyz.1	-						ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Intron|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron	NM_016552	NP_057636			ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)														---	---	---	---
ATG4B	23192	broad.mit.edu	37	2	242582213	242582213	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242582213delG	uc002wbv.2	+						ATG4B_uc002wbu.2_Intron|ATG4B_uc002wbw.2_Intron|ATG4B_uc010zox.1_Intron|ATG4B_uc010zoy.1_Intron|ATG4B_uc010fzp.2_Intron	NM_013325	NP_037457			APG4 autophagy 4 homolog B isoform a						autophagic vacuole assembly|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)														---	---	---	---
C2orf85	285093	broad.mit.edu	37	2	242811060	242811060	+	5'Flank	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242811060delT	uc010fzu.1	+							NM_173821	NP_776182			hypothetical protein LOC285093							integral to membrane				ovary(1)	1																		---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	3095988	3095988	+	Intron	DEL	T	-	-	rs34047966		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3095988delT	uc003bpc.2	+						CNTN4_uc003bpe.2_Intron|CNTN4_uc003bpf.2_Intron|CNTN4_uc003bpg.2_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	3735094	3735094	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3735094delA								CRBN (513704 upstream) : SUMF1 (87942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	5329993	5329994	+	IGR	INS	-	TT	TT	rs150556920	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5329993_5329994insTT								EDEM1 (68344 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6698542	6698542	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6698542delA	uc003bqj.1	+											Homo sapiens clone P1 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
C3orf32	51066	broad.mit.edu	37	3	8781308	8781308	+	Intron	DEL	A	-	-	rs35987481		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8781308delA	uc003bqz.2	-						CAV3_uc003bra.2_Intron|CAV3_uc003brb.2_Intron	NM_015931	NP_057015			hypothetical protein LOC51066											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	12892892	12892892	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12892892delG								RPL32 (9811 upstream) : IQSEC1 (45827 downstream)																																			---	---	---	---
IQSEC1	9922	broad.mit.edu	37	3	12944159	12944159	+	Intron	DEL	A	-	-	rs63063761		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12944159delA	uc003bxt.2	-						IQSEC1_uc003bxu.3_Intron|IQSEC1_uc011auw.1_Intron	NM_014869	NP_055684			IQ motif and Sec7 domain 1 isoform b						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	15978337	15978337	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15978337delA	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	23654107	23654107	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23654107delA								UBE2E2 (21811 upstream) : UBE2E1 (193332 downstream)																																			---	---	---	---
THRB	7068	broad.mit.edu	37	3	24225026	24225026	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24225026delT	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron|THRB_uc003cdc.2_Intron|THRB_uc003cdd.2_Intron|THRB_uc003cde.1_Intron	NM_001128176	NP_001121648			thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	29128422	29128426	+	IGR	DEL	CTTGT	-	-	rs145420808		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29128422_29128426delCTTGT								ZCWPW2 (561792 upstream) : RBMS3 (194517 downstream)																																			---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29568381	29568382	+	Intron	INS	-	T	T	rs141993471	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29568381_29568382insT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30842299	30842300	+	Intron	DEL	AC	-	-	rs71867248		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30842299_30842300delAC	uc003cep.2	-							NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
ITGA9	3680	broad.mit.edu	37	3	37570753	37570753	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37570753delA	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198			integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	39635394	39635395	+	IGR	INS	-	AAGTGTGT	AAGTGTGT	rs143182813	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39635394_39635395insAAGTGTGT								MOBP (67539 upstream) : MYRIP (215908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41134123	41134124	+	IGR	INS	-	GT	GT	rs141819087	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41134123_41134124insGT								ZNF621 (553080 upstream) : CTNNB1 (102277 downstream)																																			---	---	---	---
NME6	10201	broad.mit.edu	37	3	48344234	48344235	+	5'Flank	INS	-	CT	CT	rs148837263	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48344234_48344235insCT	uc003csp.3	-						NME6_uc003cso.2_5'Flank|NME6_uc011bbh.1_5'Flank|NME6_uc010hju.2_5'Flank|NME6_uc011bbi.1_5'Flank	NM_005793	NP_005784			nucleoside diphosphate kinase type 6						anti-apoptosis|apoptosis|CTP biosynthetic process|GTP biosynthetic process|negative regulation of cell growth|negative regulation of mitosis|UTP biosynthetic process	mitochondrion	ATP binding|metal ion binding|nucleoside diphosphate kinase activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)														---	---	---	---
SPINK8	646424	broad.mit.edu	37	3	48349028	48349031	+	Intron	DEL	CCCA	-	-	rs35694909		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48349028_48349031delCCCA	uc003csq.1	-							NM_001080525	NP_001073994			serine peptidase inhibitor, Kazal type 8							extracellular region	serine-type endopeptidase inhibitor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)														---	---	---	---
TKT	7086	broad.mit.edu	37	3	53262580	53262580	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53262580delC	uc003dgo.2	-						TKT_uc003dgp.2_Intron|TKT_uc011beo.1_Intron|TKT_uc003dgq.2_Intron|TKT_uc011beq.1_Intron|TKT_uc011ber.1_Intron|TKT_uc011bep.1_Intron	NM_001135055	NP_001128527			transketolase isoform 1						energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|transketolase activity			ovary(2)	2		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)	Thiamine(DB00152)													---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54380076	54380076	+	Intron	DEL	A	-	-	rs35728887		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54380076delA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56319038	56319043	+	Intron	DEL	CTCACA	-	-	rs72397637		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56319038_56319043delCTCACA	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
FLNB	2317	broad.mit.edu	37	3	58000464	58000465	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58000464_58000465insT	uc003djj.2	+						FLNB_uc010hne.2_Intron|FLNB_uc003djk.2_Intron|FLNB_uc010hnf.2_Intron	NM_001457	NP_001448			filamin B isoform 2						actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)														---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60590833	60590834	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60590833_60590834delAC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65934002	65934002	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65934002delC	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
FAM19A1	407738	broad.mit.edu	37	3	68312596	68312597	+	Intron	INS	-	AC	AC	rs3033685		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68312596_68312597insAC	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774			family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	69016445	69016445	+	IGR	DEL	A	-	-	rs36074781		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69016445delA								FAM19A4 (34734 upstream) : C3orf64 (7924 downstream)																																			---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71362686	71362686	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71362686delT	uc003dop.2	-						FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003doq.1_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	3	72253983	72253996	+	IGR	DEL	ACATACACACACAC	-	-	rs67637211		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72253983_72253996delACATACACACACAC								PROK2 (419626 upstream) : RYBP (169755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72406772	72406772	+	IGR	DEL	T	-	-	rs35605638		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72406772delT								PROK2 (572415 upstream) : RYBP (16979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75300832	75300833	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75300832_75300833delTG								CNTN3 (730489 upstream) : FAM86D (169872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75902829	75902829	+	IGR	DEL	T	-	-	rs77340713		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75902829delT								ZNF717 (68159 upstream) : None (None downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78767933	78767936	+	Intron	DEL	GAAG	-	-	rs10558820		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78767933_78767936delGAAG	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron	NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	84650195	84650196	+	IGR	DEL	TG	-	-	rs148847846		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84650195_84650196delTG								None (None upstream) : CADM2 (357937 downstream)																																			---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85565409	85565409	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85565409delT	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	86619810	86619810	+	IGR	DEL	A	-	-	rs71910713		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86619810delA								CADM2 (501862 upstream) : VGLL3 (367315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	86742958	86742959	+	IGR	INS	-	CTT	CTT	rs145503756	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86742958_86742959insCTT								CADM2 (625010 upstream) : VGLL3 (244166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88752126	88752141	+	IGR	DEL	TTCCTTCCTTCCTTCC	-	-	rs66786643	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88752126_88752141delTTCCTTCCTTCCTTCC								C3orf38 (545013 upstream) : EPHA3 (404533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88927192	88927193	+	IGR	INS	-	CT	CT	rs10645632		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88927192_88927193insCT								C3orf38 (720079 upstream) : EPHA3 (229481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	94443382	94443382	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94443382delA								NSUN3 (597752 upstream) : LOC255025 (213725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95397836	95397839	+	Intron	DEL	CAAG	-	-	rs71792680		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95397836_95397839delCAAG	uc003dro.1	-											Homo sapiens cDNA FLJ34909 fis, clone NT2RI2009301, moderately similar to BIFUNCTIONAL METHYLENETETRAHYDROFOLATE DEHYDROGENASE/CYCLOHYDROLASE, MITOCHONDRIAL PRECURSOR.																														---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100330087	100330088	+	Intron	INS	-	TTTCCTTC	TTTCCTTC	rs71981038		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330087_100330088insTTTCCTTC	uc003duc.2	+							NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100562387	100562388	+	Intron	DEL	GA	-	-	rs57891258		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100562387_100562388delGA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc011bhd.1_Intron|ABI3BP_uc003dum.2_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	106154560	106154563	+	IGR	DEL	GGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106154560_106154563delGGAA								CBLB (566294 upstream) : LOC100302640 (401097 downstream)																																			---	---	---	---
IFT57	55081	broad.mit.edu	37	3	107880820	107880821	+	3'UTR	INS	-	T	T	rs146708114	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107880820_107880821insT	uc003dwx.3	-	11						NM_018010	NP_060480			estrogen-related receptor beta like 1						activation of caspase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cilium|microtubule basal body	DNA binding|protein binding			ovary(1)|skin(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	109648950	109648953	+	IGR	DEL	TCCC	-	-	rs113948167		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109648950_109648953delTCCC								FLJ25363 (434936 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110203289	110203292	+	IGR	DEL	GAAG	-	-	rs61316697	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110203289_110203292delGAAG								FLJ25363 (989275 upstream) : PVRL3 (587573 downstream)																																			---	---	---	---
PHLDB2	90102	broad.mit.edu	37	3	111685348	111685349	+	Intron	DEL	AT	-	-	rs67645066		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111685348_111685349delAT	uc010hqa.2	+						PHLDB2_uc003dyc.2_Intron|PHLDB2_uc003dyd.2_Intron|PHLDB2_uc003dyg.2_Intron|PHLDB2_uc003dyh.2_Intron|PHLDB2_uc003dyi.2_Intron|PHLDB2_uc003dyj.2_Intron	NM_001134438	NP_001127910			pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6																		---	---	---	---
BOC	91653	broad.mit.edu	37	3	113005743	113005744	+	3'UTR	INS	-	T	T	rs146459508	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113005743_113005744insT	uc003dzx.2	+	20					BOC_uc003dzy.2_3'UTR|BOC_uc003dzz.2_3'UTR|BOC_uc003eab.2_3'UTR|BOC_uc003eac.2_Intron	NM_033254	NP_150279			brother of CDO precursor						cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	113819294	113819295	+	IGR	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113819294_113819295insC								QTRTD1 (12028 upstream) : DRD3 (28262 downstream)																																			---	---	---	---
DRD3	1814	broad.mit.edu	37	3	113913674	113913674	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113913674delT	uc010hqn.1	-							NM_000796	NP_000787			dopamine receptor D3 isoform a						activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---
C3orf1	51300	broad.mit.edu	37	3	119225366	119225367	+	Intron	DEL	AA	-	-	rs72079903		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119225366_119225367delAA	uc003ecn.2	+						C3orf1_uc003eco.2_Intron|C3orf1_uc003ecp.2_Intron	NM_016589	NP_057673			hypothetical protein LOC51300							integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)														---	---	---	---
FSTL1	11167	broad.mit.edu	37	3	120131665	120131672	+	Intron	DEL	GTGCGCGC	-	-	rs72554515		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120131665_120131672delGTGCGCGC	uc003eds.2	-						FSTL1_uc011bjh.1_Intron|FSTL1_uc010hrb.2_Intron	NM_007085	NP_009016			follistatin-like 1 precursor						BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	122246328	122246328	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122246328delG								KPNA1 (12542 upstream) : PARP9 (434 downstream)																																			---	---	---	---
PDIA5	10954	broad.mit.edu	37	3	122821475	122821475	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122821475delT	uc003egc.1	+						PDIA5_uc003egd.1_Intron	NM_006810	NP_006801			protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	123196038	123196038	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123196038delG								ADCY5 (28646 upstream) : PTPLB (17325 downstream)																																			---	---	---	---
KLF15	28999	broad.mit.edu	37	3	126065631	126065631	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126065631delG	uc011bkk.1	-							NM_014079	NP_054798			Kruppel-like factor 15							nucleus	DNA binding|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(114;0.147)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	127272606	127272606	+	IGR	DEL	A	-	-	rs112258965		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127272606delA								PLXNA1 (516378 upstream) : TPRA1 (19302 downstream)																																			---	---	---	---
MCM2	4171	broad.mit.edu	37	3	127329645	127329645	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127329645delG	uc003ejp.2	+						MCM2_uc011bkm.1_Intron|MCM2_uc010hsl.2_Intron|MCM2_uc011bkn.1_Frame_Shift_Del_p.L368fs	NM_004526	NP_004517			minichromosome maintenance complex component 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4																		---	---	---	---
MGLL	11343	broad.mit.edu	37	3	127424620	127424620	+	Intron	DEL	A	-	-	rs147430205		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127424620delA	uc003ejx.2	-						MGLL_uc003ejw.2_Intron|MGLL_uc011bko.1_Intron|MGLL_uc003ejv.2_Intron	NM_001003794	NP_001003794			monoglyceride lipase isoform 2						arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|carboxylesterase activity|lysophospholipase activity|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	128191957	128191962	+	IGR	DEL	TGTGTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128191957_128191962delTGTGTG								DNAJB8 (5866 upstream) : GATA2 (6303 downstream)																																			---	---	---	---
ALG1L2	644974	broad.mit.edu	37	3	129814807	129814807	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129814807delG	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624			asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0																		---	---	---	---
COL29A1	256076	broad.mit.edu	37	3	130157250	130157253	+	Intron	DEL	TGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130157250_130157253delTGAA	uc010htj.1	+						COL29A1_uc010hti.1_Intron|COL29A1_uc010htk.1_5'Flank	NM_153264	NP_694996			collagen, type XXIX, alpha 1						axon guidance|cell adhesion	collagen					0																		---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131465144	131465144	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131465144delG	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133622112	133622113	+	IGR	DEL	AC	-	-	rs72309776		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133622112_133622113delAC								RAB6B (7421 upstream) : C3orf36 (24877 downstream)																																			---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134863577	134863577	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134863577delG	uc003eqt.2	+						EPHB1_uc003equ.2_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136310399	136310399	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136310399delA	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron|STAG1_uc003erd.2_Intron|STAG1_uc003ere.2_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	138800444	138800444	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138800444delA								PRR23C (36710 upstream) : BPESC1 (22583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	138998052	138998052	+	IGR	DEL	A	-	-	rs113211186		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138998052delA								PISRT1 (45688 upstream) : MRPS22 (64746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139171130	139171130	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139171130delC								COPB2 (62608 upstream) : RBP2 (597 downstream)																																			---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140221611	140221611	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140221611delG	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140278007	140278008	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140278007_140278008insA	uc003etn.2	+							NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143051123	143051123	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143051123delT	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143397949	143397950	+	Intron	INS	-	A	A	rs140034677	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143397949_143397950insA	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
CPB1	1360	broad.mit.edu	37	3	148562685	148562685	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562685delA	uc003ewl.2	+							NM_001871	NP_001862			pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	149083231	149083232	+	IGR	DEL	TT	-	-	rs10587180		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149083231_149083232delTT								TM4SF18 (31812 upstream) : TM4SF1 (3573 downstream)																																			---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	153741166	153741167	+	IGR	INS	-	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153741166_153741167insG								C3orf79 (520683 upstream) : SGEF (97982 downstream)																																			---	---	---	---
IFT80	57560	broad.mit.edu	37	3	159996291	159996291	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159996291delT	uc011boy.1	-						IFT80_uc003fda.2_Intron|IFT80_uc003fdb.1_Intron|IFT80_uc003fdd.1_Intron|IFT80_uc003fde.1_Intron	NM_020800	NP_065851			WD repeat domain 56							cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161408148	161408148	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161408148delA								OTOL1 (186420 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163806394	163806394	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163806394delA								None (None upstream) : MIR1263 (82865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164042796	164042797	+	IGR	INS	-	C	C	rs147379992	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164042796_164042797insC								MIR1263 (153452 upstream) : MIR720 (16332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166602505	166602505	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166602505delA								None (None upstream) : ZBBX (355576 downstream)																																			---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	167066050	167066057	+	Intron	DEL	GGAAGGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167066050_167066057delGGAAGGAA	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963			zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	168249231	168249232	+	IGR	INS	-	TC	TC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168249231_168249232insTC								GOLIM4 (435814 upstream) : MIR551B (20410 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	168915327	168915327	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168915327delT	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
SAMD7	344658	broad.mit.edu	37	3	169640689	169640689	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169640689delA	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416			sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171177015	171177016	+	Intron	DEL	AC	-	-	rs71951228		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171177015_171177016delAC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171889409	171889409	+	Intron	DEL	G	-	-	rs149694056		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171889409delG	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173204248	173204248	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173204248delT	uc003fio.1	+							NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	176509111	176509134	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAGGAAA	-	-	rs58783869		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176509111_176509134delGAAGGAAGGAAGGAAGGAAGGAAA								NAALADL2 (985685 upstream) : TBL1XR1 (229409 downstream)																																			---	---	---	---
KCNMB2	10242	broad.mit.edu	37	3	178433553	178433553	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178433553delT	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Intron|KCNMB2_uc003fjf.2_Intron	NM_181361	NP_852006			calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)															---	---	---	---
ATP11B	23200	broad.mit.edu	37	3	182599328	182599328	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182599328delA	uc003flb.2	+						ATP11B_uc003flc.2_Intron|ATP11B_uc011bqm.1_Intron|ATP11B_uc010hxf.1_Intron	NM_014616	NP_055431			ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	184520564	184520564	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184520564delT								MAGEF1 (90728 upstream) : VPS8 (9367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	185275820	185275821	+	IGR	INS	-	AC	AC	rs112371951		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185275820_185275821insAC								LIPH (5451 upstream) : SENP2 (24686 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	189007194	189007194	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189007194delT	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192247428	192247428	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192247428delA	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193878879	193878880	+	IGR	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193878879_193878880delTC								HES1 (22483 upstream) : LOC100131551 (138544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194672854	194672857	+	IGR	DEL	AAAG	-	-	rs72197243		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194672854_194672857delAAAG								FAM43A (263090 upstream) : C3orf21 (116158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194776279	194776281	+	IGR	DEL	CGC	-	-	rs74881321		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194776279_194776281delCGC								FAM43A (366515 upstream) : C3orf21 (12734 downstream)																																			---	---	---	---
C3orf21	152002	broad.mit.edu	37	3	194817241	194817242	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194817241_194817242delAC	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744			hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195381322	195381323	+	5'Flank	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195381322_195381323delCT	uc011bta.1	-											Homo sapiens, clone IMAGE:5171739, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195891850	195891851	+	IGR	DEL	GT	-	-	rs111934138		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195891850_195891851delGT								TFRC (82818 upstream) : ZDHHC19 (32473 downstream)																																			---	---	---	---
LRRC33	375387	broad.mit.edu	37	3	196371831	196371831	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196371831delA	uc003fwv.2	+							NM_198565	NP_940967			leucine rich repeat containing 33 precursor							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197162743	197162743	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197162743delA								DLG1 (136600 upstream) : BDH1 (73912 downstream)																																			---	---	---	---
IQCG	84223	broad.mit.edu	37	3	197652459	197652459	+	Intron	DEL	T	-	-	rs145598304		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197652459delT	uc003fyo.2	-						IQCG_uc003fyn.2_Intron|IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907			IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)														---	---	---	---
LOC348840	348840	broad.mit.edu	37	3	197791815	197791815	+	Intron	DEL	T	-	-	rs60182436		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197791815delT	uc003fyx.3	-						LOC348840_uc010iat.2_Intron	NR_003291				Homo sapiens hypothetical protein LOC348840, mRNA (cDNA clone IMAGE:5167648), partial cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	197845126	197845126	+	IGR	DEL	C	-	-	rs143129956	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197845126delC								LOC348840 (37584 upstream) : FAM157A (34111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29172	29172	+	IGR	DEL	A	-	-	rs145707628		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29172delA								None (None upstream) : ZNF595 (24055 downstream)																																			---	---	---	---
ZNF595	152687	broad.mit.edu	37	4	54942	54943	+	Intron	INS	-	T	T	rs139883952		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54942_54943insT	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330			zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)														---	---	---	---
ZNF718	255403	broad.mit.edu	37	4	108189	108189	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108189delA	uc003fzt.3	+						ZNF595_uc003fzu.1_Intron	NM_001039127	NP_001034216			zinc finger protein 718						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3612651	3612652	+	IGR	INS	-	CATCCATC	CATCCATC	rs74184326		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3612651_3612652insCATCCATC								LRPAP1 (78427 upstream) : ADRA2C (155423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3913533	3913548	+	IGR	DEL	TGCACACGTGCACACG	-	-	rs116680024		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3913533_3913548delTGCACACGTGCACACG								ADRA2C (143282 upstream) : LOC348926 (30122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	4765822	4765822	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4765822delT	uc003gie.1	+											Homo sapiens cDNA FLJ31519 fis, clone NT2RI2000116.																														---	---	---	---
STK32B	55351	broad.mit.edu	37	4	5465205	5465206	+	Intron	INS	-	CA	CA	rs146433054	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5465205_5465206insCA	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871			serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	7041317	7041318	+	IGR	DEL	TT	-	-	rs143984773		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7041317_7041318delTT								TBC1D14 (6473 upstream) : CCDC96 (1258 downstream)																																			---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7319390	7319402	+	Intron	DEL	AGGGCTGAGGCTT	-	-	rs72320249		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7319390_7319402delAGGGCTGAGGCTT	uc003gkb.3	+							NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8219843	8219844	+	Intron	DEL	AT	-	-	rs1281137	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8219843_8219844delAT	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859			SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8843515	8843517	+	IGR	DEL	ATG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8843515_8843517delATG								CPZ (222029 upstream) : HMX1 (25256 downstream)																																			---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	10025086	10025086	+	5'Flank	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10025086delC	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	11502079	11502079	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11502079delT								HS3ST1 (71542 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12860089	12860090	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12860089_12860090insT								None (None upstream) : HSP90AB2P (474947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14449323	14449324	+	IGR	INS	-	T	T	rs71177756		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14449323_14449324insT								BOD1L (819995 upstream) : CPEB2 (556198 downstream)																																			---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20433625	20433626	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20433625_20433626delTG	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778			slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21513788	21513811	+	Intron	DEL	GGAGGGAGGAAGGAAGGAACGAAC	-	-	rs68124536		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21513788_21513811delGGAGGGAGGAAGGAAGGAACGAAC	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
CCDC149	91050	broad.mit.edu	37	4	24919902	24919903	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24919902_24919903insA	uc011bxr.1	-						CCDC149_uc003gre.2_Intron	NM_173463	NP_775734			coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	25042989	25042989	+	IGR	DEL	T	-	-	rs35642561		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25042989delT								LGI2 (10575 upstream) : SEPSECS (78639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27556794	27556795	+	IGR	INS	-	T	T	rs71645531		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27556794_27556795insT								STIM2 (530986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27868993	27868993	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27868993delA								STIM2 (843185 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28121920	28121920	+	IGR	DEL	A	-	-	rs71647421		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28121920delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28396587	28396587	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28396587delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32353099	32353100	+	IGR	INS	-	TTCTGT	TTCTGT	rs149661876	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32353099_32353100insTTCTGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32588096	32588097	+	IGR	INS	-	A	A	rs139827147	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32588096_32588097insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33191615	33191615	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33191615delT								None (None upstream) : None (None downstream)																																			---	---	---	---
KIAA1239	57495	broad.mit.edu	37	4	37429470	37429472	+	Intron	DEL	TTT	-	-	rs5857567		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37429470_37429472delTTT	uc011bxz.1	+							NM_001144990	NP_001138462			hypothetical protein LOC57495												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	38387900	38387901	+	IGR	INS	-	AAGGAAGG	AAGGAAGG	rs6812640	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38387900_38387901insAAGGAAGG								TBC1D1 (247107 upstream) : FLJ13197 (226421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	41722790	41722790	+	IGR	DEL	A	-	-	rs34600942		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41722790delA								LIMCH1 (20731 upstream) : PHOX2B (23310 downstream)																																			---	---	---	---
SLC30A9	10463	broad.mit.edu	37	4	42027123	42027123	+	Intron	DEL	A	-	-	rs67295747		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42027123delA	uc003gwl.2	+						SLC30A9_uc011byx.1_Intron	NM_006345	NP_006336			solute carrier family 30 (zinc transporter),						nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
KCTD8	386617	broad.mit.edu	37	4	44374816	44374817	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44374816_44374817insT	uc003gwu.2	-							NM_198353	NP_938167			potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3															HNSCC(17;0.042)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59268493	59268493	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59268493delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60360445	60360446	+	IGR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60360445_60360446delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	63810250	63810250	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63810250delA								LPHN3 (872083 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	64163869	64163869	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:64163869delA								None (None upstream) : TECRL (980316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67030356	67030356	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67030356delC								EPHA5 (494703 upstream) : MIR1269 (112186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72004897	72004902	+	IGR	DEL	TGTGTG	-	-	rs71906422		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72004897_72004902delTGTGTG								DCK (108270 upstream) : SLC4A4 (48101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72706262	72706262	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72706262delA								GC (36504 upstream) : NPFFR2 (191259 downstream)																																			---	---	---	---
TMEM150C	441027	broad.mit.edu	37	4	83448695	83448695	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83448695delG	uc003hmy.1	-						TMEM150C_uc011ccj.1_Intron	NM_001080506	NP_001073975			transmembrane protein 150C							integral to membrane				ovary(1)	1																		---	---	---	---
SCD5	79966	broad.mit.edu	37	4	83717092	83717092	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83717092delT	uc003hna.2	-						SCD5_uc003hnb.3_Intron|SCD5_uc003hnc.2_Intron	NM_001037582	NP_001032671			stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	86066143	86066144	+	IGR	DEL	TA	-	-	rs11736585		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86066143_86066144delTA								C4orf12 (137975 upstream) : ARHGAP24 (330140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86374121	86374121	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86374121delA								C4orf12 (445953 upstream) : ARHGAP24 (22163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	93148037	93148037	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93148037delT								FAM190A (624668 upstream) : GRID2 (77513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	94835034	94835034	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94835034delC								ATOH1 (83892 upstream) : SMARCAD1 (293725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	95056652	95056652	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95056652delA								ATOH1 (305510 upstream) : SMARCAD1 (72107 downstream)																																			---	---	---	---
SMARCAD1	56916	broad.mit.edu	37	4	95149310	95149310	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95149310delT	uc003htc.3	+						SMARCAD1_uc003htb.3_Intron|SMARCAD1_uc003htd.3_Intron|SMARCAD1_uc010ila.2_Intron	NM_020159	NP_064544			SWI/SNF-related, matrix-associated						chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)														---	---	---	---
PDLIM5	10611	broad.mit.edu	37	4	95543767	95543767	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95543767delT	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448			PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)														---	---	---	---
RAP1GDS1	5910	broad.mit.edu	37	4	99294006	99294007	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99294006_99294007insT	uc003htx.3	+						RAP1GDS1_uc003htu.2_Intron|RAP1GDS1_uc003htw.3_Intron|RAP1GDS1_uc003htv.3_Intron|RAP1GDS1_uc003htz.3_Intron|RAP1GDS1_uc003hty.3_Intron|RAP1GDS1_uc003hua.3_Intron	NM_001100427	NP_001093897			RAP1, GTP-GDP dissociation stimulator 1 isoform								binding|GTPase activator activity			ovary(1)|lung(1)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)				T	NUP98	T-ALL								---	---	---	---
METAP1	23173	broad.mit.edu	37	4	99951716	99951716	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99951716delC	uc003huf.3	+						METAP1_uc003hug.2_Intron	NM_015143	NP_055958			methionyl aminopeptidase 1						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis|regulation of translation	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	100253389	100253409	+	IGR	DEL	CTCTCTATTCTTCTCCTCACC	-	-	rs36207960		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100253389_100253409delCTCTCTATTCTTCTCCTCACC								ADH1A (10817 upstream) : ADH1C (4242 downstream)																																			---	---	---	---
ADH1C	126	broad.mit.edu	37	4	100261040	100261041	+	Intron	INS	-	A	A	rs138827617	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100261040_100261041insA	uc003huu.2	-							NM_000669	NP_000660			class I alcohol dehydrogenase, gamma subunit						ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	4	105062042	105062042	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105062042delT								TACR3 (421069 upstream) : CXXC4 (331303 downstream)																																			---	---	---	---
PPA2	27068	broad.mit.edu	37	4	106364849	106364849	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106364849delG	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron	NM_176869	NP_789845			inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)														---	---	---	---
COL25A1	84570	broad.mit.edu	37	4	109986689	109986690	+	Intron	DEL	CG	-	-	rs33978585		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109986689_109986690delCG	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014			collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	112785820	112785822	+	IGR	DEL	TTG	-	-	rs34904986		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112785820_112785822delTTG								None (None upstream) : C4orf32 (280731 downstream)																																			---	---	---	---
C4orf21	55345	broad.mit.edu	37	4	113537992	113537992	+	Intron	DEL	A	-	-	rs34222388		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113537992delA	uc003iau.2	-						C4orf21_uc003iaw.2_Intron	NM_018392	NP_060862			prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	118075114	118075115	+	IGR	INS	-	GAAG	GAAG	rs141057827	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118075114_118075115insGAAG								TRAM1L1 (68378 upstream) : NDST3 (879658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	119794025	119794030	+	IGR	DEL	ATGTCC	-	-	rs148474285		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119794025_119794030delATGTCC								SEC24D (34198 upstream) : SYNPO2 (15966 downstream)																																			---	---	---	---
SYNPO2	171024	broad.mit.edu	37	4	119815802	119815803	+	Intron	INS	-	AT	AT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119815802_119815803insAT	uc003icm.3	+						SYNPO2_uc010ina.2_Intron|SYNPO2_uc010inb.2_Intron|SYNPO2_uc011cgh.1_Intron	NM_001128933	NP_001122405			synaptopodin 2 isoform b							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2																		---	---	---	---
LOC285419	285419	broad.mit.edu	37	4	124728402	124728402	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124728402delG	uc011cgn.1	+						LOC285419_uc003ifd.2_Intron	NR_027105				Homo sapiens mRNA; cDNA DKFZp686P12109 (from clone DKFZp686P12109).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	132520919	132520920	+	IGR	INS	-	GAGAGAGACA	GAGAGAGACA	rs140548851	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132520919_132520920insGAGAGAGACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133302837	133302837	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133302837delC								None (None upstream) : PCDH10 (767633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133325053	133325053	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133325053delT								None (None upstream) : PCDH10 (745417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133437793	133437794	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133437793_133437794delCA								None (None upstream) : PCDH10 (632676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135702657	135702658	+	IGR	DEL	AC	-	-	rs34211065		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135702657_135702658delAC								PABPC4L (579754 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137139719	137139719	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137139719delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139028634	139028635	+	Intron	INS	-	T	T	rs148301491	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139028634_139028635insT	uc003ihi.1	+						uc003ihh.2_Intron					Homo sapiens hypothetical protein LOC641364, mRNA (cDNA clone IMAGE:5273158).																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	139877355	139877356	+	IGR	INS	-	TGTGTA	TGTGTA	rs147067281	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139877355_139877356insTGTGTA								SLC7A11 (713852 upstream) : CCRN4L (59587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141422591	141422591	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141422591delT								CLGN (73776 upstream) : ELMOD2 (22761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	144194720	144194721	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144194720_144194721insA								USP38 (51580 upstream) : GAB1 (63262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	145488414	145488414	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145488414delA								GYPA (426510 upstream) : HHIP (78759 downstream)																																			---	---	---	---
C4orf51	646603	broad.mit.edu	37	4	146605946	146605946	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146605946delG	uc003ikk.2	+							NM_001080531	NP_001074000			chromosome 4 open reading frame 51												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	150364104	150364109	+	Intron	DEL	ACAGAG	-	-	rs9307858		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150364104_150364109delACAGAG	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	150843830	150843830	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150843830delT								None (None upstream) : DCLK2 (156250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	155814558	155814559	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155814558_155814559insA								RBM46 (64594 upstream) : NPY2R (315222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	158556617	158556618	+	IGR	INS	-	CA	CA	rs143944145	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158556617_158556618insCA								LOC340017 (59322 upstream) : FAM198B (489115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161373034	161373035	+	IGR	INS	-	T	T	rs147425812	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161373034_161373035insT								None (None upstream) : FSTL5 (932016 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161734913	161734913	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161734913delA								None (None upstream) : FSTL5 (570138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161803417	161803418	+	IGR	INS	-	CA	CA	rs147125538	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161803417_161803418insCA								None (None upstream) : FSTL5 (501633 downstream)																																			---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	165230407	165230410	+	Intron	DEL	TGTG	-	-	rs10577361		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165230407_165230410delTGTG	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	174770339	174770339	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174770339delT								MORF4 (232545 upstream) : FBXO8 (387473 downstream)																																			---	---	---	---
HPGD	3248	broad.mit.edu	37	4	175428273	175428273	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175428273delT	uc003itu.2	-						HPGD_uc003itv.2_Intron|HPGD_uc011ckf.1_Intron|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Intron|HPGD_uc011ckg.1_Intron|HPGD_uc011ckh.1_Intron|HPGD_uc003itw.2_Intron|HPGD_uc003itx.2_3'UTR	NM_000860	NP_000851			hydroxyprostaglandin dehydrogenase 15-(NAD)						female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	176439538	176439539	+	IGR	DEL	TG	-	-	rs151218016		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176439538_176439539delTG								ADAM29 (540208 upstream) : GPM6A (114550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180259723	180259723	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180259723delC								None (None upstream) : None (None downstream)																																			---	---	---	---
ENPP6	133121	broad.mit.edu	37	4	185024821	185024821	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185024821delT	uc003iwc.2	-							NM_153343	NP_699174			ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)														---	---	---	---
ENPP6	133121	broad.mit.edu	37	4	185082820	185082821	+	Intron	INS	-	GT	GT	rs146965925	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185082820_185082821insGT	uc003iwc.2	-							NM_153343	NP_699174			ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)														---	---	---	---
SORBS2	8470	broad.mit.edu	37	4	186748223	186748224	+	Intron	INS	-	CAT	CAT	rs144017246	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186748223_186748224insCAT	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547			sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190552968	190552968	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190552968delA								None (None upstream) : FRG1 (309006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190596438	190596439	+	IGR	INS	-	TCCTTGG	TCCTTGG	rs140220951		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190596438_190596439insTCCTTGG								None (None upstream) : FRG1 (265535 downstream)																																			---	---	---	---
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589			solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)													---	---	---	---
SLC12A7	10723	broad.mit.edu	37	5	1098546	1098546	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1098546delG	uc003jbu.2	-							NM_006598	NP_006589			solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)													---	---	---	---
CLPTM1L	81037	broad.mit.edu	37	5	1333412	1333412	+	Intron	DEL	A	-	-	rs68084960		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1333412delA	uc003jch.2	-						CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409			CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	4215472	4215473	+	IGR	INS	-	CTC	CTC	rs138881871	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4215472_4215473insCTC								IRX1 (613956 upstream) : LOC340094 (818999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4271837	4271838	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4271837_4271838insT								IRX1 (670321 upstream) : LOC340094 (762634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5366411	5366411	+	IGR	DEL	C	-	-	rs35015773		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5366411delC								ADAMTS16 (46000 upstream) : KIAA0947 (56396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5985755	5985756	+	IGR	INS	-	T	T	rs11381600		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5985755_5985756insT								KIAA0947 (495418 upstream) : FLJ33360 (324798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6991670	6991671	+	IGR	INS	-	TC	TC	rs139526158	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6991670_6991671insTC								PAPD7 (234509 upstream) : ADCY2 (404672 downstream)																																			---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7741914	7741917	+	Intron	DEL	CATA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7741914_7741917delCATA	uc003jdz.1	+						ADCY2_uc011cmo.1_Intron	NM_020546	NP_065433			adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
LOC285692	285692	broad.mit.edu	37	5	9738891	9738891	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9738891delG	uc003jen.2	-							NR_027112				Homo sapiens clone TEE10 Cri-du-chat region mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	10559959	10559962	+	IGR	DEL	TCTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10559959_10559962delTCTC								ROPN1L (94822 upstream) : DAP (119381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	14099549	14099552	+	IGR	DEL	AGGA	-	-	rs140767590		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14099549_14099552delAGGA								DNAH5 (154960 upstream) : TRIO (44277 downstream)																																			---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14692789	14692789	+	Intron	DEL	T	-	-	rs150134895		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692789delT	uc003jfk.2	+							NM_138348	NP_612357			hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15526167	15526167	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15526167delG	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
MARCH11	441061	broad.mit.edu	37	5	16167066	16167093	+	Intron	DEL	TACAACGATGTTCATTTACTTATGAACA	-	-	rs36218722		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16167066_16167093delTACAACGATGTTCATTTACTTATGAACA	uc003jfo.2	-							NM_001102562	NP_001096032			membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	20240393	20240394	+	IGR	INS	-	TAGC	TAGC	rs144588315	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20240393_20240394insTAGC								CDH18 (252086 upstream) : None (None downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21533700	21533700	+	Intron	DEL	G	-	-	rs67891163		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21533700delG	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	25077572	25077572	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25077572delT								CDH10 (432661 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25885491	25885492	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25885491_25885492delCT								None (None upstream) : CDH9 (995217 downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31708984	31708989	+	Intron	DEL	TTTTGT	-	-	rs33947537		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31708984_31708989delTTTTGT	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
MTMR12	54545	broad.mit.edu	37	5	32233574	32233579	+	Intron	DEL	ACACAA	-	-	rs35760638		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32233574_32233579delACACAA	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536			myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1																		---	---	---	---
C5orf33	133686	broad.mit.edu	37	5	36242910	36242910	+	5'Flank	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36242910delA	uc003jkf.3	-						C5orf33_uc003jkg.3_5'Flank|C5orf33_uc011cov.1_5'Flank	NM_001085411	NP_001078880			hypothetical protein LOC133686 isoform 1								NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	36307970	36307979	+	IGR	DEL	CGCACACACA	-	-	rs71873336	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36307970_36307979delCGCACACACA								RANBP3L (5959 upstream) : SLC1A3 (298478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41685981	41685981	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41685981delT								PLCXD3 (175251 upstream) : OXCT1 (44187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45011859	45011859	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45011859delC								MRPS30 (196245 upstream) : HCN1 (247494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49674491	49674491	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49674491delA								None (None upstream) : EMB (17542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51859581	51859581	+	IGR	DEL	A	-	-	rs77266961		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51859581delA								None (None upstream) : ITGA1 (224193 downstream)																																			---	---	---	---
MAP3K1	4214	broad.mit.edu	37	5	56152297	56152297	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56152297delT	uc003jqw.3	+							NM_005921	NP_005912			mitogen-activated protein kinase kinase kinase						cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	57019165	57019165	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57019165delC								ACTBL2 (240529 upstream) : PLK2 (730647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	57467501	57467501	+	IGR	DEL	A	-	-	rs57276635		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57467501delA								ACTBL2 (688865 upstream) : PLK2 (282311 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58511379	58511380	+	Intron	DEL	GT	-	-	rs35142413		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58511379_58511380delGT	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	59124971	59124972	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59124971_59124972delAC	uc003jsa.2	-						PDE4D_uc003jsb.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	61495551	61495551	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61495551delC								FLJ37543 (493189 upstream) : KIF2A (106438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	64338834	64338834	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64338834delT								CWC27 (24244 upstream) : ADAMTS6 (105730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	66635457	66635458	+	IGR	INS	-	CTTT	CTTT	rs150933394	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66635457_66635458insCTTT								CD180 (142840 upstream) : PIK3R1 (876146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67819060	67819060	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67819060delC								PIK3R1 (221413 upstream) : SLC30A5 (570758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	68287215	68287218	+	Intron	DEL	TCTC	-	-	rs146489819		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68287215_68287218delTCTC	uc003jvf.1	-											Homo sapiens cDNA FLJ46633 fis, clone TRACH2025705.																														---	---	---	---
SLC30A5	64924	broad.mit.edu	37	5	68396440	68396443	+	Intron	DEL	AAAA	-	-	rs33982147		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68396440_68396443delAAAA	uc003jvh.2	+						SLC30A5_uc003jvg.2_Intron|SLC30A5_uc011crc.1_Intron|SLC30A5_uc003jvi.2_5'Flank	NM_022902	NP_075053			solute carrier family 30 (zinc transporter),						cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)														---	---	---	---
CENPH	64946	broad.mit.edu	37	5	68489995	68489995	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68489995delT	uc003jvp.2	+						CENPH_uc010ixc.2_Intron	NM_022909	NP_075060			centromere protein H						cell division|CenH3-containing nucleosome assembly at centromere|chromosome segregation|kinetochore organization|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm	kinetochore binding|protein binding			large_intestine(1)	1		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)														---	---	---	---
MAP1B	4131	broad.mit.edu	37	5	71501381	71501382	+	3'UTR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71501381_71501382delAG	uc003kbw.3	+	7						NM_005909	NP_005900			microtubule-associated protein 1B							microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)														---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73034308	73034309	+	Intron	DEL	GT	-	-	rs147983527		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73034308_73034309delGT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron	NM_001080479	NP_001073948			Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
ANKRD31	256006	broad.mit.edu	37	5	74455173	74455173	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74455173delA	uc003kdo.1	-											Homo sapiens cDNA FLJ40191 fis, clone TESTI2019280, weakly similar to Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	81204144	81204144	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81204144delC								SSBP2 (157072 upstream) : ATG10 (63700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88668435	88668437	+	IGR	DEL	TCC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88668435_88668437delTCC								MEF2C (468566 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88706446	88706447	+	IGR	DEL	TG	-	-	rs34784366		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88706446_88706447delTG								MEF2C (506577 upstream) : CETN3 (983084 downstream)																																			---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90002685	90002687	+	Intron	DEL	TTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90002685_90002687delTTG	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90061246	90061247	+	Intron	INS	-	CA	CA	rs72458842		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90061246_90061247insCA	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	94950713	94950714	+	IGR	DEL	AA	-	-	rs139840644		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94950713_94950714delAA								ARSK (9908 upstream) : GPR150 (5266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99463535	99463535	+	IGR	DEL	T	-	-	rs75110011		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99463535delT								None (None upstream) : LOC100133050 (251674 downstream)																																			---	---	---	---
SLCO6A1	133482	broad.mit.edu	37	5	101796295	101796296	+	Intron	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101796295_101796296delAA	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)														---	---	---	---
PAM	5066	broad.mit.edu	37	5	102328051	102328052	+	Intron	INS	-	T	T	rs141240422	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102328051_102328052insT	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knx.1_Intron	NM_000919	NP_000910			peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	102579884	102579885	+	IGR	DEL	AT	-	-	rs58131674		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102579884_102579885delAT								PPIP5K2 (40977 upstream) : C5orf30 (14557 downstream)																																			---	---	---	---
REEP5	7905	broad.mit.edu	37	5	112249618	112249619	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112249618_112249619delTG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660			receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)														---	---	---	---
TMED7-TICAM2	100302736	broad.mit.edu	37	5	114918584	114918585	+	Intron	INS	-	AT	AT	rs11949955		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114918584_114918585insAT	uc003krd.2	-						TMED7-TICAM2_uc003kre.2_Intron|TICAM2_uc003krc.2_Intron	NM_021649	NP_067681			toll-like receptor adaptor molecule 2						I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	Golgi apparatus|intrinsic to membrane|plasma membrane	protein binding|transmembrane receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	116053079	116053082	+	IGR	DEL	CCTG	-	-	rs70978621		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116053079_116053082delCCTG								SEMA6A (142528 upstream) : None (None downstream)																																			---	---	---	---
DTWD2	285605	broad.mit.edu	37	5	118273911	118273911	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118273911delA	uc003ksa.2	-							NM_173666	NP_775937			DTW domain containing 2												0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	125376277	125376277	+	IGR	DEL	A	-	-	rs34796251		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125376277delA								None (None upstream) : GRAMD3 (319511 downstream)																																			---	---	---	---
CTXN3	613212	broad.mit.edu	37	5	126983693	126983693	+	5'Flank	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126983693delG	uc003kul.3	+							NM_001048252	NP_001041717			cortexin 3							integral to membrane					0		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0128)|COAD - Colon adenocarcinoma(49;0.0234)|OV - Ovarian serous cystadenocarcinoma(64;0.038)														---	---	---	---
VDAC1	7416	broad.mit.edu	37	5	133316325	133316326	+	Intron	INS	-	A	A	rs55708320		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133316325_133316326insA	uc003kyp.1	-						VDAC1_uc003kyq.1_Intron|VDAC1_uc003kyr.1_Intron	NM_003374	NP_003365			voltage-dependent anion channel 1						apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	134893244	134893245	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134893244_134893245insA								NEUROG1 (21605 upstream) : CXCL14 (13128 downstream)																																			---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137346646	137346647	+	Intron	INS	-	A	A	rs35839686		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137346646_137346647insA	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687			hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
BRD8	10902	broad.mit.edu	37	5	137399917	137399919	+	Intron	DEL	GAG	-	-	rs140185075		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137399917_137399919delGAG	uc003lcc.1	-							NM_001164326				bromodomain containing 8 isoform 4						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	140006789	140006789	+	IGR	DEL	T	-	-	rs113327813		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140006789delT								SLC35A4 (58106 upstream) : CD14 (4528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141101193	141101193	+	IGR	DEL	C	-	-	rs5871785		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141101193delC								ARAP3 (39393 upstream) : PCDH1 (131490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141219083	141219084	+	IGR	INS	-	GGAGAG	GGAGAG	rs149137448	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141219083_141219084insGGAGAG								ARAP3 (157283 upstream) : PCDH1 (13599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	142902548	142902549	+	IGR	DEL	TG	-	-	rs113241223		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142902548_142902549delTG								NR3C1 (87471 upstream) : HMHB1 (289177 downstream)																																			---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146259743	146259746	+	5'Flank	DEL	TGTG	-	-	rs34164130		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146259743_146259746delTGTG	uc003loe.2	-						PPP2R2B_uc010jgm.2_5'Flank|PPP2R2B_uc003log.3_5'Flank|PPP2R2B_uc003lof.3_5'Flank|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146359122	146359125	+	Intron	DEL	ACAC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146359122_146359125delACAC	uc011dbv.1	-						PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron	NM_181675	NP_858061			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
DPYSL3	1809	broad.mit.edu	37	5	146774246	146774246	+	Intron	DEL	A	-	-	rs34195078		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146774246delA	uc003lon.1	-						DPYSL3_uc003loo.2_Intron	NM_001387	NP_001378			dihydropyrimidinase-like 3						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SH3TC2	79628	broad.mit.edu	37	5	148247997	148247998	+	Intron	INS	-	TG	TG	rs140953468	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148247997_148247998insTG	uc003lpp.1	-							NM_024577				SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PPARGC1B	133522	broad.mit.edu	37	5	149175353	149175353	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149175353delG	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Intron|PPARGC1B_uc003lrd.2_Intron	NM_133263	NP_573570			peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
IRGM	345611	broad.mit.edu	37	5	150227371	150227372	+	5'UTR	INS	-	TTTGTTTGTTTG	TTTGTTTGTTTG	rs140589514	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150227371_150227372insTTTGTTTGTTTG	uc010jhk.2	+	2					IRGM_uc011dcl.1_5'Flank	NM_001145805	NP_001139277			immunity-related GTPase family, M						autophagy|inflammatory response|innate immune response	autophagic vacuole membrane|cell projection|Golgi membrane|phagocytic cup|phagocytic vesicle membrane	GTP binding|hydrolase activity, acting on acid anhydrides				0																		---	---	---	---
SLC36A1	206358	broad.mit.edu	37	5	150846882	150846882	+	Intron	DEL	C	-	-	rs61191955	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150846882delC	uc003luc.2	+						GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Intron|SLC36A1_uc010jhw.1_Intron	NM_078483	NP_510968			solute carrier family 36 member 1						cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	153558757	153558758	+	IGR	INS	-	AT	AT	rs142505443	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153558757_153558758insAT								MFAP3 (121743 upstream) : GALNT10 (11537 downstream)																																			---	---	---	---
SOX30	11063	broad.mit.edu	37	5	157053272	157053272	+	3'UTR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157053272delT	uc003lxb.1	-	5					SOX30_uc003lxc.1_3'UTR|SOX30_uc011dds.1_3'UTR	NM_178424	NP_848511			SRY (sex determining region Y)-box 30 isoform a						regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158249272	158249275	+	Intron	DEL	GGAC	-	-	rs58788704		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158249272_158249275delGGAC	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870			early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	5	161266901	161266902	+	IGR	INS	-	TCTTTCTT	TCTTTCTT	rs10626981		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161266901_161266902insTCTTTCTT								GABRA6 (137303 upstream) : GABRA1 (7295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165292895	165292895	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165292895delC								None (None upstream) : None (None downstream)																																			---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168164851	168164851	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168164851delA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168425898	168425899	+	Intron	INS	-	TG	TG	rs148013927	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168425898_168425899insTG	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168714382	168714382	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168714382delT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
FOXI1	2299	broad.mit.edu	37	5	169536545	169536546	+	3'UTR	INS	-	T	T	rs149339219	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169536545_169536546insT	uc003mai.3	+	2					FOXI1_uc003maj.3_3'UTR	NM_012188	NP_036320			forkhead box I1 isoform a						epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)											Pendred_syndrome				---	---	---	---
LCP2	3937	broad.mit.edu	37	5	169717995	169718006	+	Intron	DEL	AGAAAGAAAGAG	-	-	rs72288812	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169717995_169718006delAGAAAGAAAGAG	uc003man.1	-						LCP2_uc011det.1_Intron	NM_005565	NP_005556			lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)														---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	169789470	169789470	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169789470delG	uc003map.2	+							NM_001034838	NP_001030010			Kv channel interacting protein 1 isoform 3						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171717366	171717366	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171717366delT								UBTD2 (6571 upstream) : SH3PXD2B (43139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171997981	171998000	+	IGR	DEL	GGAAGGAAGGAGGGAAGGAA	-	-	rs72075870		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171997981_171998000delGGAAGGAAGGAGGGAAGGAA								SH3PXD2B (116454 upstream) : NEURL1B (70276 downstream)																																			---	---	---	---
RPL26L1	51121	broad.mit.edu	37	5	172388497	172388497	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172388497delC	uc003mcc.2	+						LOC100268168_uc011dfb.1_5'Flank|LOC100268168_uc011dfc.1_5'Flank	NM_016093	NP_057177			ribosomal protein L26-like 1						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	structural constituent of ribosome				0	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	173064226	173064227	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173064226_173064227delCA								BOD1 (20560 upstream) : CPEB4 (251104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174498166	174498166	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174498166delT								MSX2 (340265 upstream) : DRD1 (369510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174812028	174812047	+	IGR	DEL	AAGGAAAGAAGGAAGGAAGA	-	-	rs111559272		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174812028_174812047delAAGGAAAGAAGGAAGGAAGA								MSX2 (654127 upstream) : DRD1 (55629 downstream)																																			---	---	---	---
CPLX2	10814	broad.mit.edu	37	5	175268403	175268404	+	Intron	INS	-	GA	GA	rs138217615	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175268403_175268404insGA	uc003mde.1	+							NM_006650	NP_006641			complexin 2						mast cell degranulation|positive regulation of synaptic plasticity|vesicle docking involved in exocytosis	cytosol				ovary(1)	1	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176472937	176472937	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176472937delA	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	260632	260632	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:260632delC								None (None upstream) : DUSP22 (31469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1215528	1215529	+	IGR	INS	-	AGAC	AGAC	rs113803232		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1215528_1215529insAGAC								LOC285768 (113961 upstream) : FOXQ1 (97146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	3222213	3222214	+	5'Flank	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3222213_3222214insC	uc011dhu.1	+											Synthetic construct Homo sapiens gateway clone IMAGE:100018300 3' read TUBB2A mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	3705622	3705622	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3705622delG								SLC22A23 (248829 upstream) : C6orf145 (17214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4483500	4483501	+	IGR	INS	-	AC	AC	rs67769992		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4483500_4483501insAC								PECI (347669 upstream) : CDYL (222892 downstream)																																			---	---	---	---
F13A1	2162	broad.mit.edu	37	6	6151082	6151083	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6151082_6151083delGA	uc003mwv.2	-						F13A1_uc011dib.1_Intron	NM_000129	NP_000120			coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---
LOC285780	285780	broad.mit.edu	37	6	6481701	6481701	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6481701delT	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0																		---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11194094	11194094	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11194094delT	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron	NM_006403	NP_006394			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	12373759	12373759	+	IGR	DEL	C	-	-	rs111713484		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12373759delC								EDN1 (76333 upstream) : PHACTR1 (343129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12377146	12377146	+	IGR	DEL	C	-	-	rs149539240		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12377146delC								EDN1 (79720 upstream) : PHACTR1 (339742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12495337	12495337	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12495337delA								EDN1 (197911 upstream) : PHACTR1 (221551 downstream)																																			---	---	---	---
RANBP9	10048	broad.mit.edu	37	6	13637615	13637615	+	Intron	DEL	A	-	-	rs3216841		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13637615delA	uc003nbb.2	-						RANBP9_uc003nba.2_Intron	NM_005493	NP_005484			RAN binding protein 9						axon guidance|microtubule nucleation|protein complex assembly	cytosol|microtubule associated complex|nucleus	Ran GTPase binding			lung(1)|skin(1)	2	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	16037058	16037058	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16037058delT								DTNBP1 (373787 upstream) : MYLIP (92259 downstream)																																			---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16475095	16475096	+	Intron	INS	-	CT	CT	rs144147561	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16475095_16475096insCT	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	17003473	17003473	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17003473delG								ATXN1 (241752 upstream) : RBM24 (278336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18569637	18569638	+	Intron	INS	-	AC	AC	rs144759715	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18569637_18569638insAC	uc003nct.1	+						MIR548A1_hsa-mir-548a-1|MI0003593_5'Flank					Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	19470718	19470719	+	IGR	DEL	AT	-	-	rs142450618		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19470718_19470719delAT								MIR548A1 (898607 upstream) : ID4 (366898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19633715	19633718	+	IGR	DEL	ACAC	-	-	rs149956944		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19633715_19633718delACAC								None (None upstream) : ID4 (203899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19997486	19997489	+	IGR	DEL	AAGA	-	-	rs68035898	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19997486_19997489delAAGA								ID4 (156572 upstream) : MBOAT1 (103446 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21717453	21717453	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21717453delA	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21738077	21738080	+	Intron	DEL	AAAC	-	-	rs72175369		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21738077_21738080delAAAC	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	23647195	23647196	+	IGR	INS	-	A	A	rs138404374	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23647195_23647196insA								None (None upstream) : NRSN1 (479218 downstream)																																			---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24286821	24286821	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24286821delA	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440			doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---
CMAH	8418	broad.mit.edu	37	6	25169278	25169278	+	5'Flank	DEL	A	-	-	rs139100039		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25169278delA	uc011djv.1	-											Homo sapiens CMP-N-acetylneuraminic acid hydroxylase mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	26687108	26687109	+	IGR	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26687108_26687109delAA								ZNF322A (27145 upstream) : GUSBL1 (152157 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	29671667	29671674	+	IGR	DEL	ACCCATCC	-	-	rs74647612		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29671667_29671674delACCCATCC								ZFP57 (22780 upstream) : HLA-F (19443 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29959057	29959058	+	Intron	INS	-	G	G	rs138083356	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29959057_29959058insG	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30814602	30814603	+	IGR	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30814602_30814603delAA								IER3 (102275 upstream) : DDR1 (36091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32434669	32434670	+	IGR	INS	-	GTGAA	GTGAA	rs147834246	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32434669_32434670insGTGAA								HLA-DRA (21848 upstream) : HLA-DRB1 (50493 downstream)																																			---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	34898927	34898928	+	Intron	INS	-	T	T	rs71538282		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34898927_34898928insT	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	34906374	34906374	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34906374delT	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
FKBP5	2289	broad.mit.edu	37	6	35554624	35554625	+	Intron	INS	-	T	T	rs112376611		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35554624_35554625insT	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_3'UTR	NM_001145776	NP_001139248			FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37153602	37153603	+	IGR	INS	-	T	T	rs79440664		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37153602_37153603insT								PIM1 (10400 upstream) : TMEM217 (26352 downstream)																																			---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38581749	38581749	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38581749delC	uc003ooa.3	-						BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	40963274	40963275	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40963274_40963275insT								LRFN2 (408148 upstream) : UNC5CL (31497 downstream)																																			---	---	---	---
PGC	5225	broad.mit.edu	37	6	41712716	41712719	+	Intron	DEL	TCTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41712716_41712719delTCTG	uc003ora.1	-							NM_002630	NP_002621			progastricsin (pepsinogen C) precursor						digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)															---	---	---	---
CCND3	896	broad.mit.edu	37	6	41932238	41932239	+	Intron	DEL	GT	-	-	rs72237414		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41932238_41932239delGT	uc003orp.2	-						CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron	NM_001136017	NP_001129489			cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)					T	IGH@	MM								---	---	---	---
SUPT3H	8464	broad.mit.edu	37	6	45018016	45018017	+	Intron	DEL	GT	-	-	rs113546440		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45018016_45018017delGT	uc003oxo.2	-						SUPT3H_uc003oxn.1_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|SUPT3H_uc011dvw.1_Intron	NM_181356	NP_852001			suppressor of Ty 3 homolog isoform 2						histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3																		---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45935622	45935622	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45935622delA	uc003oxv.3	-						CLIC5_uc003oxu.3_Intron|CLIC5_uc003oxx.2_Intron	NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	50291408	50291410	+	IGR	DEL	GAG	-	-	rs68169092		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50291408_50291410delGAG								DEFB112 (275044 upstream) : TFAP2D (389847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52278832	52278833	+	IGR	INS	-	TGTA	TGTA	rs140357087	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52278832_52278833insTGTA								PAQR8 (6258 upstream) : EFHC1 (6161 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57316285	57316286	+	Intron	INS	-	G	G	rs147180550	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57316285_57316286insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57369651	57369651	+	Intron	DEL	T	-	-	rs67817875		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57369651delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57389262	57389262	+	Intron	DEL	G	-	-	rs5876591		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57389262delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57431423	57431423	+	Intron	DEL	A	-	-	rs5876611		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57431423delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57446951	57446951	+	Intron	DEL	G	-	-	rs66761994		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57446951delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57450766	57450770	+	Intron	DEL	TTTCC	-	-	rs67055368		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57450766_57450770delTTTCC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57479786	57479786	+	Intron	DEL	T	-	-	rs111752496		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57479786delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57509895	57509895	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57509895delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57534677	57534678	+	IGR	INS	-	ACTT	ACTT	rs138374545		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57534677_57534678insACTT								PRIM2 (21302 upstream) : GUSBL2 (711481 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64758808	64758808	+	Intron	DEL	T	-	-	rs72875100		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64758808delT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	64907164	64907165	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64907164_64907165delTG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66104125	66104126	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66104125_66104126delGT	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	68595740	68595740	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68595740delG	uc003pes.1	-						uc003pet.1_Intron					Homo sapiens mRNA, endogenous retrovirus.																														---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	73052330	73052333	+	Intron	DEL	GTGT	-	-	rs113847815		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73052330_73052333delGTGT	uc003pga.2	+						RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Intron|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron	NM_014989	NP_055804			regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73651024	73651027	+	Intron	DEL	CTTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73651024_73651027delCTTC	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816			potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	78263432	78263434	+	IGR	DEL	GGA	-	-	rs67264703		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78263432_78263434delGGA								HTR1B (90312 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81520318	81520319	+	IGR	DEL	GT	-	-	rs144100864		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81520318_81520319delGT								BCKDHB (464331 upstream) : FAM46A (935129 downstream)																																			---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82908969	82908970	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82908969_82908970delTG	uc003pjl.1	-						IBTK_uc011dyu.1_Intron|IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340			inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	84488043	84488044	+	IGR	INS	-	GG	GG	rs146197779		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84488043_84488044insGG								SNAP91 (68916 upstream) : RIPPLY2 (74941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	88505619	88505619	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88505619delG	uc003pmm.2	+											Homo sapiens mRNA sequence.																														---	---	---	---
PM20D2	135293	broad.mit.edu	37	6	89870707	89870707	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89870707delA	uc003pmz.2	+							NM_001010853	NP_001010853			aminoacylase 1-like 2								hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	93728158	93728158	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93728158delA								None (None upstream) : EPHA7 (221584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	102732180	102732180	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102732180delA								GRIK2 (214223 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	107314974	107314975	+	IGR	INS	-	T	T	rs150217515		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107314974_107314975insT								MIR587 (82879 upstream) : C6orf203 (34432 downstream)																																			---	---	---	---
SEC63	11231	broad.mit.edu	37	6	108261385	108261385	+	Intron	DEL	A	-	-	rs148577941		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108261385delA	uc003psc.3	-							NM_007214	NP_009145			SEC63-like protein						protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	110839403	110839404	+	IGR	INS	-	G	G	rs142451256	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110839403_110839404insG								SLC22A16 (41559 upstream) : CDK19 (91777 downstream)																																			---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112492418	112492418	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112492418delT	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676			laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	116216959	116216959	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116216959delC								None (None upstream) : FRK (45734 downstream)																																			---	---	---	---
FRK	2444	broad.mit.edu	37	6	116331377	116331378	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116331377_116331378insA	uc003pwi.1	-							NM_002031	NP_002022			fyn-related kinase						negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)														---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118503682	118503683	+	Intron	INS	-	GAAG	GAAG	rs149846783	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118503682_118503683insGAAG	uc003pxx.3	+							NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	118642734	118642735	+	IGR	INS	-	AT	AT	rs139594066	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118642734_118642735insAT								SLC35F1 (3897 upstream) : C6orf204 (143504 downstream)																																			---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124930818	124930818	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124930818delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	125952653	125952654	+	IGR	INS	-	TCTC	TCTC	rs140013409	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125952653_125952654insTCTC								HDDC2 (329371 upstream) : HEY2 (116126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	132076264	132076264	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132076264delA								ENPP3 (7715 upstream) : ENPP1 (52892 downstream)																																			---	---	---	---
ECT2L	345930	broad.mit.edu	37	6	139170711	139170711	+	Intron	DEL	T	-	-	rs72395106		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139170711delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174			epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	139383236	139383251	+	IGR	DEL	AAGGGAGAAAGGAAGC	-	-	rs12665587		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139383236_139383251delAAGGGAGAAAGGAAGC								C6orf115 (18797 upstream) : HECA (72998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142076967	142076968	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142076967_142076968delGT	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147958051	147958052	+	IGR	INS	-	T	T	rs150785686		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147958051_147958052insT								SAMD5 (66894 upstream) : SASH1 (705677 downstream)																																			---	---	---	---
LATS1	9113	broad.mit.edu	37	6	149998678	149998679	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149998678_149998679insA	uc003qmu.1	-						LATS1_uc010kif.1_Intron|LATS1_uc003qmv.1_Intron	NM_004690	NP_004681			LATS homolog 1						cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)														---	---	---	---
PPP1R14C	81706	broad.mit.edu	37	6	150546568	150546568	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150546568delC	uc003qnt.2	+							NM_030949	NP_112211			protein phosphatase 1, regulatory (inhibitor)						regulation of phosphorylation	cytoplasm|membrane					0		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)														---	---	---	---
RGS17	26575	broad.mit.edu	37	6	153348319	153348319	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153348319delG	uc003qpm.2	-							NM_012419	NP_036551			regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)										Lung_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	6	155689193	155689194	+	IGR	INS	-	GT	GT	rs143594082	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155689193_155689194insGT								TFB1M (53567 upstream) : NOX3 (27309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	159868243	159868247	+	IGR	DEL	CATGA	-	-	rs76942754	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159868243_159868247delCATGA								FNDC1 (175104 upstream) : SOD2 (231904 downstream)																																			---	---	---	---
AGPAT4	56895	broad.mit.edu	37	6	161695127	161695128	+	5'Flank	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161695127_161695128insA	uc003qtr.1	-						AGPAT4_uc003qts.1_5'Flank|AGPAT4_uc011egb.1_5'Flank|AGPAT4_uc011egc.1_5'Flank|AGPAT4_uc011egd.1_5'Flank|AGPAT4_uc011ege.1_5'Flank	NM_020133	NP_064518			1-acylglycerol-3-phosphate O-acyltransferase 4						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162001156	162001156	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162001156delC	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PACRG	135138	broad.mit.edu	37	6	163304744	163304745	+	Intron	INS	-	TA	TA	rs80098620		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163304744_163304745insTA	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623			parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166105078	166105083	+	IGR	DEL	CGCACA	-	-	rs9295313		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166105078_166105083delCGCACA								PDE10A (29494 upstream) : C6orf176 (232453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169199674	169199675	+	IGR	DEL	TC	-	-	rs12200720		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169199674_169199675delTC								SMOC2 (131003 upstream) : THBS2 (416201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169501953	169501953	+	IGR	DEL	T	-	-	rs79147527	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169501953delT								SMOC2 (433282 upstream) : THBS2 (113923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	374595	374598	+	IGR	DEL	AAAG	-	-	rs139749806	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:374595_374598delAAAG								FAM20C (73884 upstream) : PDGFA (162301 downstream)																																			---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	944922	944923	+	Intron	INS	-	A	A	rs147850075	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944922_944923insA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
FTSJ2	29960	broad.mit.edu	37	7	2276662	2276663	+	Intron	INS	-	TG	TG	rs149639770	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2276662_2276663insTG	uc003slm.2	-						FTSJ2_uc003slk.2_Intron|FTSJ2_uc003sll.2_Intron|FTSJ2_uc003sln.2_Intron|FTSJ2_uc003slo.2_Intron	NM_013393	NP_037525			FtsJ homolog 2						cell proliferation	mitochondrion|nucleolus	nucleic acid binding|rRNA (uridine-2'-O-)-methyltransferase activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)														---	---	---	---
SNX8	29886	broad.mit.edu	37	7	2329567	2329567	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2329567delC	uc003slw.2	-							NM_013321	NP_037453			sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2524798	2524799	+	IGR	DEL	CG	-	-	rs28406706		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2524798_2524799delCG								CHST12 (50584 upstream) : LFNG (34680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5002113	5002113	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5002113delA								MMD2 (3269 upstream) : RNF216L (11503 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10141931	10141932	+	IGR	INS	-	TGTG	TGTG	rs139054185	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10141931_10141932insTGTG								PER4 (466484 upstream) : NDUFA4 (830883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10264431	10264432	+	IGR	DEL	CG	-	-	rs142996372		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10264431_10264432delCG								PER4 (588984 upstream) : NDUFA4 (708383 downstream)																																			---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11634600	11634600	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11634600delA	uc003ssf.3	-							NM_015204	NP_056019			thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)											HNSCC(18;0.044)			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18628297	18628297	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18628297delA	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc011jya.1_Intron|HDAC9_uc003sua.1_Intron|HDAC9_uc011jyb.1_Intron|HDAC9_uc003sud.1_Intron|HDAC9_uc011jyc.1_Intron|HDAC9_uc003suf.1_Intron|HDAC9_uc010kud.1_Intron|HDAC9_uc011jye.1_Intron|HDAC9_uc011jyf.1_Intron|HDAC9_uc010kue.1_5'Flank	NM_058176	NP_478056			histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
FAM126A	84668	broad.mit.edu	37	7	23056119	23056120	+	5'Flank	DEL	CA	-	-	rs71552217		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23056119_23056120delCA	uc003svm.3	-						FAM126A_uc003svn.3_5'Flank|FAM126A_uc011jyr.1_5'Flank	NM_032581	NP_115970			family with sequence similarity 126, member A							cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
STK31	56164	broad.mit.edu	37	7	23895241	23895241	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23895241delC	uc003swv.1	+											SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25041063	25041063	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25041063delC								OSBPL3 (21303 upstream) : CYCS (117214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26313817	26313818	+	IGR	INS	-	T	T	rs6942724	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26313817_26313818insT								CBX3 (60843 upstream) : SNX10 (17697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	27307900	27307901	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27307900_27307901insT								EVX1 (21708 upstream) : HIBADH (257162 downstream)																																			---	---	---	---
HIBADH	11112	broad.mit.edu	37	7	27580752	27580752	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27580752delT	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_3'UTR	NM_152740	NP_689953			3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)													---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	32057697	32057698	+	Intron	INS	-	A	A	rs145673129	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32057697_32057698insA	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
AVL9	23080	broad.mit.edu	37	7	32799915	32799915	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32799915delC	uc011kai.1	+						uc003tcz.1_RNA	NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	33878264	33878265	+	IGR	DEL	CT	-	-	rs138753205		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33878264_33878265delCT								BBS9 (232584 upstream) : BMPER (66847 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37179991	37179991	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37179991delA	uc003tfk.1	-						ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SFRP4	6424	broad.mit.edu	37	7	37951253	37951254	+	Intron	DEL	GT	-	-	rs36039590		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37951253_37951254delGT	uc003tfo.3	-							NM_003014	NP_003005			secreted frizzled-related  protein 4 precursor						brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	38113064	38113065	+	IGR	INS	-	TTC	TTC	rs151128424	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38113064_38113065insTTC								EPDR1 (121525 upstream) : STARD3NL (104868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41228104	41228104	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41228104delT								C7orf10 (327747 upstream) : INHBA (500499 downstream)																																			---	---	---	---
ADCY1	107	broad.mit.edu	37	7	45665324	45665324	+	Intron	DEL	T	-	-	rs72025434		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45665324delT	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939			adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	46902825	46902830	+	IGR	DEL	CACACA	-	-	rs10546884		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46902825_46902830delCACACA								IGFBP3 (941954 upstream) : TNS3 (411923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48111246	48111264	+	IGR	DEL	TGCACAGTGTATATTACAG	-	-	rs144012980	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48111246_48111264delTGCACAGTGTATATTACAG								C7orf57 (10353 upstream) : UPP1 (17091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	50281877	50281880	+	IGR	DEL	GAAA	-	-	rs10258412		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50281877_50281880delGAAA								C7orf72 (82519 upstream) : IKZF1 (62498 downstream)																																			---	---	---	---
COBL	23242	broad.mit.edu	37	7	51157212	51157212	+	Intron	DEL	A	-	-	rs10715066		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51157212delA	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpt.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013			cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	53170843	53170844	+	IGR	INS	-	GA	GA			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53170843_53170844insGA								POM121L12 (66226 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54440914	54440915	+	IGR	INS	-	AA	AA	rs35562980		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54440914_54440915insAA								HPVC1 (170800 upstream) : VSTM2A (169104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56393150	56393151	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56393150_56393151delAC								PSPH (209060 upstream) : DKFZp434L192 (170765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57927501	57927502	+	IGR	INS	-	TCTC	TCTC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57927501_57927502insTCTC								ZNF716 (394236 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61077228	61077228	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61077228delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61790126	61790127	+	IGR	INS	-	CAG	CAG	rs142560201		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61790126_61790127insCAG								None (None upstream) : LOC643955 (961545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61792303	61792305	+	IGR	DEL	ATC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61792303_61792305delATC								None (None upstream) : LOC643955 (959367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64755913	64755913	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64755913delA								INTS4L1 (61314 upstream) : ZNF92 (82855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64960749	64960750	+	IGR	DEL	TA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64960749_64960750delTA								ZNF92 (94752 upstream) : INTS4L2 (152027 downstream)																																			---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66559991	66559991	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66559991delT	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	67668450	67668450	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67668450delG								STAG3L4 (881938 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68192271	68192272	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68192271_68192272insA								None (None upstream) : AUTS2 (871633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68194107	68194108	+	IGR	INS	-	A	A	rs146583790	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68194107_68194108insA								None (None upstream) : AUTS2 (869797 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69179232	69179233	+	Intron	DEL	TA	-	-	rs28845177		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69179232_69179233delTA	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69742945	69742946	+	Intron	DEL	TG	-	-	rs111308651		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69742945_69742946delTG	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69854332	69854333	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69854332_69854333insA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70021181	70021182	+	Intron	INS	-	CA	CA	rs35740261		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70021181_70021182insCA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70771272	70771272	+	Intron	DEL	T	-	-	rs74759036		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70771272delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73194199	73194199	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73194199delT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73221533	73221533	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73221533delT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73263039	73263040	+	Intron	INS	-	TTCC	TTCC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73263039_73263040insTTCC	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
ELN	2006	broad.mit.edu	37	7	73456758	73456758	+	Intron	DEL	A	-	-	rs72489767		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456758delA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224			elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	7	74288732	74288732	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74288732delG								GTF2IRD2 (20891 upstream) : STAG3L2 (10114 downstream)																																			---	---	---	---
CCL26	10344	broad.mit.edu	37	7	75419475	75419476	+	5'Flank	INS	-	CCTT	CCTT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419475_75419476insCCTT	uc003udt.1	-							NM_006072	NP_006063			chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	75826481	75826481	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75826481delA								MDH2 (130553 upstream) : SRRM3 (4735 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78662380	78662380	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78662380delT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88761484	88761491	+	Intron	DEL	ACACACAC	-	-	rs71764837		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88761484_88761491delACACACAC	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	90076038	90076039	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs149264284	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90076038_90076039insCTTCCTTC								CLDN12 (30772 upstream) : CDK14 (19699 downstream)																																			---	---	---	---
CCDC132	55610	broad.mit.edu	37	7	92970518	92970518	+	Intron	DEL	C	-	-	rs34517750		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92970518delC	uc003umo.2	+						CCDC132_uc003umq.2_Intron|CCDC132_uc003ump.2_Intron|CCDC132_uc003umr.2_Intron|CCDC132_uc011khz.1_Intron	NM_017667	NP_060137			coiled-coil domain containing 132 isoform a												0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
SLC25A13	10165	broad.mit.edu	37	7	95911904	95911904	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95911904delT	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066			solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	98053197	98053198	+	IGR	INS	-	A	A	rs140319820		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98053197_98053198insA								BAIAP2L1 (22770 upstream) : NPTX2 (193399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98090442	98090445	+	IGR	DEL	TTCA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98090442_98090445delTTCA								BAIAP2L1 (60015 upstream) : NPTX2 (156152 downstream)																																			---	---	---	---
SMURF1	57154	broad.mit.edu	37	7	98686823	98686824	+	Intron	INS	-	A	A	rs35381081		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98686823_98686824insA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162			Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	100213913	100213914	+	IGR	INS	-	A	A	rs77437407		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100213913_100213914insA								MOSPD3 (915 upstream) : TFR2 (4125 downstream)																																			---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104105590	104105591	+	Intron	INS	-	C	C	rs149947464	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104105590_104105591insC	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	105084952	105084953	+	IGR	INS	-	CCTC	CCTC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105084952_105084953insCCTC								SRPK2 (45154 upstream) : PUS7 (12009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	107467897	107467898	+	IGR	INS	-	T	T	rs139966510	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107467897_107467898insT								SLC26A3 (24219 upstream) : DLD (63688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	108302507	108302508	+	IGR	INS	-	T	T	rs34692644		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108302507_108302508insT								DNAJB9 (87215 upstream) : C7orf66 (221532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109001803	109001804	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109001803_109001804delGT								C7orf66 (477166 upstream) : EIF3IP1 (597480 downstream)																																			---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	113958517	113958517	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113958517delT	uc003vgv.1	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgt.1_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
CAV1	857	broad.mit.edu	37	7	116172501	116172501	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116172501delC	uc003vif.1	+						CAV1_uc010lkd.1_Intron|CAV1_uc010lke.1_Intron|CAV1_uc003vig.1_Intron|CAV1_uc003vih.2_Intron|CAV1_uc010lkf.1_Intron	NM_001753	NP_001744			caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	119486457	119486457	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119486457delA								None (None upstream) : KCND2 (427265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119556638	119556639	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119556638_119556639insT								None (None upstream) : KCND2 (357083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125590163	125590164	+	IGR	INS	-	AT	AT	rs141910691	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125590163_125590164insAT								None (None upstream) : GRM8 (488488 downstream)																																			---	---	---	---
METTL2B	55798	broad.mit.edu	37	7	128137529	128137532	+	Intron	DEL	TTGT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128137529_128137532delTTGT	uc003vnf.2	+						METTL2B_uc003vng.2_Intron|METTL2B_uc011kop.1_Intron	NM_018396	NP_060866			methyltransferase like 2B								methyltransferase activity			skin(1)	1																		---	---	---	---
FAM71F1	84691	broad.mit.edu	37	7	128360014	128360014	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128360014delA	uc003vno.1	+						FAM71F1_uc010llo.1_Intron|FAM71F1_uc011koq.1_Intron|FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_Intron|FAM71F1_uc003vnp.1_Intron	NM_032599	NP_115988			testes development-related NYD-SP18											skin(1)	1																		---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130980643	130980643	+	Intron	DEL	A	-	-	rs141002718		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130980643delA	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131528660	131528660	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131528660delC								PODXL (287284 upstream) : PLXNA4 (279432 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133383327	133383328	+	Intron	INS	-	A	A	rs11464448		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133383327_133383328insA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133882332	133882332	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133882332delA	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
AGBL3	340351	broad.mit.edu	37	7	134722088	134722088	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134722088delT	uc011kpw.1	+							NM_178563	NP_848658			carboxypeptidase 3, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	135209989	135209989	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135209989delA								CNOT4 (15138 upstream) : NUP205 (32673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	135473730	135473735	+	IGR	DEL	TGTGTA	-	-	rs66491975		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135473730_135473735delTGTGTA								FAM180A (40136 upstream) : LUZP6 (137770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	136040548	136040548	+	IGR	DEL	A	-	-	rs10715932		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136040548delA								LUZP6 (378344 upstream) : CHRM2 (512851 downstream)																																			---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139417323	139417323	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139417323delT	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139878082	139878089	+	5'Flank	DEL	TCCCTCCC	-	-	rs142303955		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139878082_139878089delTCCCTCCC	uc003vvm.2	-						LOC100134229_uc011kqy.1_RNA	NM_030647	NP_085150			jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
TMEM139	135932	broad.mit.edu	37	7	142979579	142979579	+	5'Flank	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142979579delT	uc010lov.2	+						TMEM139_uc003wck.3_5'Flank|TMEM139_uc003wcl.2_5'Flank|TMEM139_uc003wcm.2_5'Flank|TMEM139_uc003wcn.2_5'Flank	NM_153345	NP_699176			transmembrane protein 139 precursor							integral to membrane					0	Melanoma(164;0.059)																	---	---	---	---
ATG9B	285973	broad.mit.edu	37	7	150719079	150719079	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150719079delT	uc011kvc.1	-						ATG9B_uc003wig.3_Intron	NM_173681	NP_775952			ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	151155884	151155885	+	IGR	INS	-	G	G	rs72573494		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151155884_151155885insG								CRYGN (17985 upstream) : RHEB (7213 downstream)																																			---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151268159	151268160	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151268159_151268160insT	uc003wkk.2	-						PRKAG2_uc003wki.2_Intron|PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Intron|PRKAG2_uc003wkl.2_Intron|PRKAG2_uc010lqe.1_Intron	NM_016203	NP_057287			AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152104993	152104994	+	Intron	DEL	TC	-	-	rs146856728		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152104993_152104994delTC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152112577	152112577	+	Intron	DEL	G	-	-	rs66626051		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152112577delG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	155853638	155853639	+	IGR	DEL	TG	-	-	rs66757138		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155853638_155853639delTG								SHH (248671 upstream) : C7orf4 (479546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156086184	156086191	+	IGR	DEL	TCTCTCTT	-	-	rs35040628		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156086184_156086191delTCTCTCTT								SHH (481217 upstream) : C7orf4 (246994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156277265	156277266	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156277265_156277266insT								SHH (672298 upstream) : C7orf4 (55919 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157589024	157589024	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157589024delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	158510036	158510037	+	IGR	INS	-	CTT	CTT	rs139183173	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158510036_158510037insCTT								NCAPG2 (12516 upstream) : ESYT2 (13652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	158510542	158510544	+	IGR	DEL	CTT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158510542_158510544delCTT								NCAPG2 (13022 upstream) : ESYT2 (13145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1114116	1114117	+	IGR	INS	-	CC	CC	rs60583749		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1114116_1114117insCC								ERICH1 (432890 upstream) : DLGAP2 (335452 downstream)																																			---	---	---	---
DLGAP2	9228	broad.mit.edu	37	8	1453579	1453579	+	Intron	DEL	A	-	-	rs60057106		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1453579delA	uc003wpl.2	+							NM_004745	NP_004736			discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4181012	4181013	+	Intron	INS	-	T	T	rs145446704	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4181012_4181013insT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	4865498	4865499	+	IGR	INS	-	T	T	rs113307532		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4865498_4865499insT								CSMD1 (13170 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5236388	5236389	+	IGR	INS	-	AAGAAG	AAGAAG	rs147975025	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5236388_5236389insAAGAAG								CSMD1 (384060 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5511997	5511997	+	IGR	DEL	T	-	-	rs35887131		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5511997delT								CSMD1 (659669 upstream) : MCPH1 (752124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6702201	6702201	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6702201delA								XKR5 (9164 upstream) : DEFB1 (25896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6830169	6830170	+	IGR	INS	-	AAA	AAA	rs141980794		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6830169_6830170insAAA								DEFA4 (34383 upstream) : DEFA1B (5001 downstream)																																			---	---	---	---
SGK223	157285	broad.mit.edu	37	8	8198356	8198356	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8198356delA	uc003wsh.3	-							NM_001080826	NP_001074295			pragmin								ATP binding|non-membrane spanning protein tyrosine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	8837843	8837844	+	IGR	DEL	GT	-	-	rs1897211		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8837843_8837844delGT								MFHAS1 (86712 upstream) : ERI1 (22470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8964401	8964402	+	IGR	INS	-	T	T	rs35150312		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8964401_8964402insT								ERI1 (73552 upstream) : PPP1R3B (29372 downstream)																																			---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10263265	10263282	+	Intron	DEL	ATGTGCTCACACACACCT	-	-	rs113053260		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10263265_10263282delATGTGCTCACACACACCT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	11342478	11342479	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs138244699	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11342478_11342479insGAAGGAAG								FAM167A (18202 upstream) : BLK (9042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11521633	11521633	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11521633delA								BLK (99526 upstream) : GATA4 (12835 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12404579	12404583	+	Intron	DEL	GGTCG	-	-	rs9773643	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12404579_12404583delGGTCG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14939275	14939275	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14939275delA	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16992274	16992274	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16992274delT								EFHA2 (12126 upstream) : ZDHHC2 (21562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24869510	24869510	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24869510delA								NEFL (55379 upstream) : DOCK5 (172777 downstream)																																			---	---	---	---
DOCK5	80005	broad.mit.edu	37	8	25258930	25258930	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25258930delG	uc003xeg.2	+						PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216			dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)														---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	25444127	25444127	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25444127delT	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26287276	26287279	+	IGR	DEL	ACAC	-	-	rs71551881		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26287276_26287279delACAC								BNIP3L (16632 upstream) : PNMA2 (74917 downstream)																																			---	---	---	---
ZNF395	55893	broad.mit.edu	37	8	28249374	28249375	+	Intron	INS	-	A	A	rs79029803		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28249374_28249375insA	uc003xgt.2	-							NM_018660	NP_061130			zinc finger protein 395						transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28493233	28493234	+	IGR	DEL	CA	-	-	rs113242979		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28493233_28493234delCA								FZD3 (71274 upstream) : EXTL3 (65919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29438115	29438115	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29438115delT								DUSP4 (229930 upstream) : C8orf75 (140663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29642062	29642062	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29642062delG	uc003xho.2	+						uc003xhp.2_Intron					Homo sapiens, clone IMAGE:4861097, mRNA.																														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31497266	31497267	+	5'Flank	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31497266_31497267insT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32335783	32335784	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32335783_32335784insT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
GPR124	25960	broad.mit.edu	37	8	37680709	37680709	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37680709delT	uc003xkj.2	+						GPR124_uc003xki.2_Intron|GPR124_uc010lvy.2_Intron	NM_032777	NP_116166			G protein-coupled receptor 124 precursor						central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)															---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38656124	38656125	+	Intron	INS	-	GT	GT	rs142520406	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38656124_38656125insGT	uc010lwp.2	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron	NM_006283	NP_006274			transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
ZMAT4	79698	broad.mit.edu	37	8	40598512	40598513	+	Intron	DEL	CA	-	-	rs140375297		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40598512_40598513delCA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921			zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	47545976	47545976	+	IGR	DEL	A	-	-	rs78926432		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47545976delA								None (None upstream) : BEYLA (206532 downstream)																																			---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48586205	48586205	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48586205delT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_5'UTR|KIAA0146_uc010lxv.1_Intron	NM_001080394	NP_001073863			hypothetical protein LOC23514												0		Lung NSC(58;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	49541651	49541651	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49541651delT								UBE2V2 (567199 upstream) : EFCAB1 (81700 downstream)																																			---	---	---	---
ATP6V1H	51606	broad.mit.edu	37	8	54736558	54736558	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54736558delA	uc003xrl.2	-						ATP6V1H_uc003xrk.2_Intron|ATP6V1H_uc003xrm.2_Intron|ATP6V1H_uc003xrn.2_Intron|ATP6V1H_uc011ldv.1_Intron|ATP6V1H_uc010lyd.2_Intron	NM_213620	NP_998785			ATPase, H+ transporting, lysosomal 50/57kDa, V1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)															---	---	---	---
RGS20	8601	broad.mit.edu	37	8	54838961	54838962	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54838961_54838962insA	uc003xrp.2	+						RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrs.2_Intron|RGS20_uc003xrt.2_Intron	NM_170587	NP_733466			regulator of G-protein signaling 20 isoform a						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	57853482	57853482	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57853482delC								PENK (494200 upstream) : IMPAD1 (17009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	59395436	59395445	+	IGR	DEL	ACACACACAC	-	-	rs71973906		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59395436_59395445delACACACACAC								UBXN2B (31377 upstream) : CYP7A1 (7293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60045425	60045425	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60045425delA								TOX (13658 upstream) : None (None downstream)																																			---	---	---	---
ASPH	444	broad.mit.edu	37	8	62437929	62437930	+	Intron	DEL	AT	-	-	rs71992492		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62437929_62437930delAT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309			aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	66927174	66927174	+	IGR	DEL	G	-	-	rs141216948		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66927174delG								PDE7A (173419 upstream) : DNAJC5B (6617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	72067951	72067956	+	IGR	DEL	GTGTGT	-	-	rs71555571		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72067951_72067956delGTGTGT								XKR9 (419775 upstream) : EYA1 (41714 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	74298406	74298406	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74298406delA								RDH10 (60892 upstream) : STAU2 (34200 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74376836	74376837	+	Intron	INS	-	ACAT	ACAT	rs67799072		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74376836_74376837insACAT	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75334729	75334744	+	IGR	DEL	TCCTTCCTTCCTTCCT	-	-	rs67444628		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75334729_75334744delTCCTTCCTTCCTTCCT								GDAP1 (55396 upstream) : MIR2052 (283184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78939614	78939621	+	IGR	DEL	ACACACAC	-	-	rs111908783		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78939614_78939621delACACACAC								None (None upstream) : PKIA (488715 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81395353	81395354	+	IGR	INS	-	AC	AC	rs140609905	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81395353_81395354insAC								TPD52 (311517 upstream) : ZBTB10 (2500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	82554965	82554965	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82554965delA								FABP12 (111415 upstream) : IMPA1 (14186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90260850	90260850	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90260850delC								MMP16 (921133 upstream) : RIPK2 (509125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90556887	90556888	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90556887_90556888insT								None (None upstream) : RIPK2 (213087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90584555	90584555	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90584555delG								None (None upstream) : RIPK2 (185420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94349555	94349562	+	IGR	DEL	TACATACA	-	-	rs36224923		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94349555_94349562delTACATACA								C8orf83 (319654 upstream) : FAM92A1 (363211 downstream)																																			---	---	---	---
GEM	2669	broad.mit.edu	37	8	95272976	95272976	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95272976delA	uc003ygj.2	-						GEM_uc003ygi.2_Intron	NM_005261	NP_005252			GTP-binding mitogen-induced T-cell protein						cell surface receptor linked signaling pathway|immune response|small GTPase mediated signal transduction	internal side of plasma membrane	calmodulin binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding			lung(1)	1	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)															---	---	---	---
KIAA1429	25962	broad.mit.edu	37	8	95558283	95558283	+	Intron	DEL	A	-	-	rs79927793		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95558283delA	uc003ygo.1	-						KIAA1429_uc003ygp.2_Intron	NM_015496	NP_056311			hypothetical protein LOC25962 isoform 1						mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	96897161	96897161	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96897161delG								C8orf37 (615724 upstream) : GDF6 (257399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	102258758	102258759	+	IGR	INS	-	AGT	AGT	rs143258056	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102258758_102258759insAGT								ZNF706 (40798 upstream) : NACAP1 (115263 downstream)																																			---	---	---	---
BAALC	79870	broad.mit.edu	37	8	104183653	104183657	+	Intron	DEL	AAAAT	-	-	rs35336505		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104183653_104183657delAAAAT	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|uc010mcb.1_Intron	NM_024812	NP_079088			brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	105747569	105747572	+	IGR	DEL	GTGT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105747569_105747572delGTGT								LRP12 (146349 upstream) : ZFPM2 (583575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109895975	109895975	+	IGR	DEL	C	-	-	rs9297418	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109895975delC								TMEM74 (96205 upstream) : TRHR (203764 downstream)																																			---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110460728	110460728	+	Intron	DEL	G	-	-	rs1673406		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460728delG	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112474673	112474674	+	IGR	INS	-	GTT	GTT	rs148688179	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112474673_112474674insGTT								None (None upstream) : CSMD3 (760487 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113896905	113896905	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113896905delT	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114790736	114790736	+	IGR	DEL	A	-	-	rs139247041		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114790736delA								CSMD3 (341494 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116920496	116920497	+	IGR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116920496_116920497delAG								TRPS1 (239268 upstream) : EIF3H (736559 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119108904	119108919	+	Intron	DEL	AGGAAGGAAGGGAGGG	-	-	rs72254367		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119108904_119108919delAGGAAGGAAGGGAGGG	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	125901453	125901453	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125901453delG								MTSS1 (160723 upstream) : LOC157381 (50431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128762469	128762470	+	IGR	INS	-	TTCC	TTCC	rs144464525	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128762469_128762470insTTCC								MYC (8791 upstream) : PVT1 (44309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130212088	130212089	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130212088_130212089insA								None (None upstream) : GSDMC (548354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	131768775	131768776	+	IGR	INS	-	TCCT	TCCT	rs142776061	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131768775_131768776insTCCT								ASAP1 (354559 upstream) : ADCY8 (23772 downstream)																																			---	---	---	---
TG	7038	broad.mit.edu	37	8	133922842	133922843	+	Intron	INS	-	A	A	rs71299037		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133922842_133922843insA	uc003ytw.2	+						TG_uc010mdw.2_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	134155318	134155318	+	IGR	DEL	C	-	-	rs35485420		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134155318delC								TG (8177 upstream) : WISP1 (47994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134727338	134727379	+	IGR	DEL	TCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC	-	-	rs71293266	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727338_134727379delTCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC								ST3GAL1 (143155 upstream) : ZFAT (762654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135078098	135078099	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135078098_135078099delCA								ST3GAL1 (493915 upstream) : ZFAT (411934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135078118	135078119	+	IGR	INS	-	AT	AT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135078118_135078119insAT								ST3GAL1 (493935 upstream) : ZFAT (411914 downstream)																																			---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136497439	136497440	+	Intron	INS	-	TGTC	TGTC	rs111885106		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136497439_136497440insTGTC	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	137998346	137998346	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137998346delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139935792	139935792	+	IGR	DEL	C	-	-	rs10717557		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139935792delC								COL22A1 (9556 upstream) : KCNK9 (677290 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140990263	140990264	+	Intron	INS	-	A	A	rs34475283		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140990263_140990264insA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141167184	141167185	+	Intron	INS	-	TTTCCATTCAGAAGCCTCCC	TTTCCATTCAGAAGCCTCCC	rs66515425		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141167184_141167185insTTTCCATTCAGAAGCCTCCC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	142953158	142953158	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142953158delG								MIR1302-7 (85484 upstream) : NCRNA00051 (326559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143511030	143511031	+	IGR	INS	-	ATCC	ATCC	rs111494761		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143511030_143511031insATCC								TSNARE1 (26487 upstream) : BAI1 (34346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144003918	144003918	+	IGR	DEL	C	-	-	rs10717492		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144003918delC								CYP11B2 (4659 upstream) : LOC100133669 (59530 downstream)																																			---	---	---	---
PPP1R16A	84988	broad.mit.edu	37	8	145715064	145715064	+	5'Flank	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145715064delG	uc003zdd.2	+							NM_032902	NP_116291			protein phosphatase 1, regulatory (inhibitor)							plasma membrane	protein binding				0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	146292071	146292071	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146292071delC								C8orf33 (10656 upstream) : None (None downstream)																																			---	---	---	---
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
FLJ35024	401491	broad.mit.edu	37	9	2555513	2555513	+	Intron	DEL	A	-	-	rs142953761		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2555513delA	uc003zhh.1	-						FLJ35024_uc003zhi.2_Intron|FLJ35024_uc003zhj.3_Intron					Homo sapiens cDNA FLJ35024 fis, clone OCBBF2015233.												0																		---	---	---	---
FLJ35024	401491	broad.mit.edu	37	9	2609742	2609743	+	Intron	INS	-	A	A	rs147766620	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2609742_2609743insA	uc003zhh.1	-						FLJ35024_uc003zhi.2_Intron|FLJ35024_uc003zhj.3_Intron					Homo sapiens cDNA FLJ35024 fis, clone OCBBF2015233.												0																		---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8712448	8712448	+	Intron	DEL	T	-	-	rs111724244		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8712448delT	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	10478148	10478148	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10478148delA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16681645	16681645	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16681645delC	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron|BNC2_uc003zmo.1_Intron|BNC2_uc003zms.1_Intron|BNC2_uc010mik.1_Intron|BNC2_uc010mil.1_Intron|BNC2_uc003zmt.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16853296	16853297	+	Intron	INS	-	AGTC	AGTC	rs145494214	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16853296_16853297insAGTC	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	21104609	21104609	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21104609delT								IFNB1 (26666 upstream) : IFNW1 (36022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24150904	24150904	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24150904delT								ELAVL2 (324841 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26311856	26311857	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26311856_26311857delTG								TUSC1 (633000 upstream) : C9orf82 (528827 downstream)																																			---	---	---	---
MOBKL2B	79817	broad.mit.edu	37	9	27393371	27393372	+	Intron	DEL	GT	-	-	rs72290074		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27393371_27393372delGT	uc003zqn.2	-							NM_024761	NP_079037			MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29969385	29969385	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29969385delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32850065	32850066	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32850065_32850066insT								TMEM215 (60868 upstream) : APTX (122543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	34935742	34935743	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34935742_34935743delGT								C9orf144 (97159 upstream) : KIAA1045 (21778 downstream)																																			---	---	---	---
OR2S2	56656	broad.mit.edu	37	9	35960827	35960828	+	5'Flank	INS	-	TA	TA	rs7865587		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35960827_35960828insTA	uc011lpi.1	-							NM_019897	NP_063950			olfactory receptor, family 2, subfamily S,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
RECK	8434	broad.mit.edu	37	9	36060651	36060651	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36060651delT	uc003zyv.2	+						RECK_uc010mld.2_Intron|RECK_uc003zyu.3_Intron|RECK_uc003zyw.2_Intron|RECK_uc010mle.1_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934			RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	37089796	37089797	+	IGR	INS	-	TGCG	TGCG	rs138613327	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37089796_37089797insTGCG								PAX5 (55320 upstream) : ZCCHC7 (30672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	47210467	47210489	+	IGR	DEL	GGATGTCCCGTTGTTTCAGTACC	-	-	rs67424206	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:47210467_47210489delGGATGTCCCGTTGTTTCAGTACC								KGFLP1 (462082 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66535948	66535948	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66535948delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	68456940	68456940	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68456940delC								FAM27B (662751 upstream) : MIR1299 (545299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68991335	68991336	+	IGR	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68991335_68991336delAA								None (None upstream) : MIR1299 (10903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69989891	69989892	+	IGR	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69989891_69989892insC								LOC100133920 (324942 upstream) : FOXD4L5 (185817 downstream)																																			---	---	---	---
SMC5	23137	broad.mit.edu	37	9	72932891	72932891	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72932891delC	uc004ahr.2	+						uc004ahs.1_5'Flank	NM_015110	NP_055925			SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73762340	73762341	+	Intron	INS	-	AC	AC	rs148160114	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73762340_73762341insAC	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73851961	73851961	+	Intron	DEL	A	-	-	rs72457993		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73851961delA	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TMEM2	23670	broad.mit.edu	37	9	74326511	74326513	+	Intron	DEL	AAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74326511_74326513delAAA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522			transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)														---	---	---	---
TMEM2	23670	broad.mit.edu	37	9	74341939	74341939	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74341939delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522			transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)														---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75154015	75154016	+	Intron	INS	-	G	G	rs141047169	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75154015_75154016insG	uc004aiz.1	+							NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	76048385	76048385	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76048385delT								ANXA1 (263078 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	76885799	76885803	+	IGR	DEL	AGAAG	-	-	rs68052108		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76885799_76885803delAGAAG								None (None upstream) : RORB (226449 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78796126	78796126	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78796126delT	uc004ajz.2	+						PCSK5_uc004aka.2_Intron|PCSK5_uc004akb.2_5'Flank	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	79183353	79183360	+	IGR	DEL	AAGGAAGA	-	-	rs71354664		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79183353_79183360delAAGGAAGA								GCNT1 (61023 upstream) : PRUNE2 (42933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82000635	82000638	+	IGR	DEL	GTGT	-	-	rs139698987		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82000635_82000638delGTGT								None (None upstream) : TLE4 (186240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83331685	83331685	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83331685delC								TLE4 (990028 upstream) : TLE1 (866915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83477813	83477813	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83477813delC								None (None upstream) : TLE1 (720787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83632824	83632825	+	IGR	INS	-	TC	TC	rs143101324		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83632824_83632825insTC								None (None upstream) : TLE1 (565775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87004342	87004343	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87004342_87004343insA								SLC28A3 (20929 upstream) : NTRK2 (279123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87828012	87828013	+	IGR	DEL	CA	-	-	rs71499843		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87828012_87828013delCA								NTRK2 (189507 upstream) : AGTPBP1 (333442 downstream)																																			---	---	---	---
LOC440173	440173	broad.mit.edu	37	9	89628125	89628125	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89628125delA	uc010mqg.2	-							NR_027471				Homo sapiens cDNA FLJ60829 complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	90483572	90483572	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90483572delC								CTSL3 (81773 upstream) : C9orf79 (14169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90674482	90674482	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90674482delA	uc004apv.1	-											full-length cDNA clone CS0DI004YC05 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	90861166	90861180	+	IGR	DEL	GTGGGGGCTATATTT	-	-	rs140957264		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90861166_90861180delGTGGGGGCTATATTT								CDK20 (271499 upstream) : SPIN1 (141660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91488244	91488245	+	IGR	INS	-	AAG	AAG	rs139911254	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91488244_91488245insAAG								LOC286238 (221169 upstream) : C9orf47 (117533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	97445321	97445321	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97445321delA								FBP1 (42790 upstream) : C9orf3 (43673 downstream)																																			---	---	---	---
C9orf3	84909	broad.mit.edu	37	9	97584291	97584292	+	Intron	INS	-	CACG	CACG	rs72746564	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97584291_97584292insCACG	uc004ava.2	+						C9orf3_uc004aux.1_Intron|C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron	NM_032823	NP_116212			aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	99924731	99924732	+	IGR	INS	-	G	G	rs145342037	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99924731_99924732insG								LOC340508 (80504 upstream) : ZNF322B (32901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	100141118	100141124	+	IGR	DEL	TGCCCAT	-	-	rs5899306		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100141118_100141124delTGCCCAT								KIAA1529 (1549 upstream) : LOC286359 (11997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102173386	102173386	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102173386delG								SEC61B (180486 upstream) : NR4A3 (410751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102214636	102214636	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102214636delT								SEC61B (221736 upstream) : NR4A3 (369501 downstream)																																			---	---	---	---
LPPR1	54886	broad.mit.edu	37	9	104067487	104067488	+	Intron	DEL	GT	-	-	rs71907854		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104067487_104067488delGT	uc004bbb.2	+						LPPR1_uc011lvi.1_Intron|LPPR1_uc004bbc.2_Intron|LPPR1_uc010mtc.2_Intron	NM_207299	NP_997182			plasticity related gene 3							integral to membrane	catalytic activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	107311313	107311314	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107311313_107311314delCT								OR13C3 (12219 upstream) : OR13C8 (20135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108918880	108918880	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108918880delT	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	109407265	109407265	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109407265delA	uc004bcy.1	+											Homo sapiens cDNA FLJ36044 fis, clone TESTI2017584.																														---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109650866	109650866	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109650866delG	uc004bcz.2	+							NM_021224	NP_067047			zinc finger protein 462						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	110142697	110142698	+	IGR	INS	-	CAAA	CAAA	rs144122630	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110142697_110142698insCAAA								RAD23B (48228 upstream) : KLF4 (104437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110145013	110145014	+	IGR	INS	-	A	A	rs75238380		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110145013_110145014insA								RAD23B (50544 upstream) : KLF4 (102121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110821746	110821747	+	IGR	DEL	AA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110821746_110821747delAA								KLF4 (569699 upstream) : ACTL7B (795124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111010223	111010223	+	IGR	DEL	C	-	-	rs142442614	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111010223delC								KLF4 (758176 upstream) : ACTL7B (606648 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112268750	112268751	+	IGR	INS	-	CCTT	CCTT	rs142108809	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112268750_112268751insCCTT								PTPN3 (8157 upstream) : PALM2 (134321 downstream)																																			---	---	---	---
PALM2-AKAP2	445815	broad.mit.edu	37	9	112832988	112832989	+	Intron	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112832988_112832989delAG	uc004bei.2	+						PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron|AKAP2_uc011lwi.1_Intron|AKAP2_uc004bem.2_Intron	NM_001136562	NP_001130034			A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114816867	114816867	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114816867delA	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121428241	121428242	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121428241_121428242delCT								TLR4 (948477 upstream) : DBC1 (500666 downstream)																																			---	---	---	---
DBC1	1620	broad.mit.edu	37	9	122076761	122076761	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122076761delA	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433			deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	123148882	123148882	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123148882delT								MIR147 (141554 upstream) : CDK5RAP2 (2266 downstream)																																			---	---	---	---
TTLL11	158135	broad.mit.edu	37	9	124678266	124678269	+	Intron	DEL	ACAT	-	-	rs3048085		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124678266_124678269delACAT	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914			tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0																		---	---	---	---
PDCL	5082	broad.mit.edu	37	9	125581889	125581890	+	3'UTR	INS	-	A	A	rs76431423		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125581889_125581890insA	uc004bmz.1	-	4					uc004bmy.2_5'Flank	NM_005388	NP_005379			phosducin-like						signal transduction|visual perception						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126797998	126797999	+	IGR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126797998_126797999delAG								LHX2 (2556 upstream) : NEK6 (221887 downstream)																																			---	---	---	---
NR6A1	2649	broad.mit.edu	37	9	127432496	127432496	+	Intron	DEL	A	-	-	rs72486967		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127432496delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591			nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
LMX1B	4010	broad.mit.edu	37	9	129408597	129408616	+	Intron	DEL	ATCCATCCATCTACCTACCC	-	-	rs112445569		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129408597_129408616delATCCATCCATCTACCTACCC	uc004bqj.2	+						LMX1B_uc004bqi.2_Intron|LMX1B_uc011maa.1_Intron	NM_002316	NP_002307			LIM homeobox transcription factor 1, beta						dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														Nail-Patella_Syndrome				---	---	---	---
COQ4	51117	broad.mit.edu	37	9	131094014	131094015	+	Intron	INS	-	T	T	rs149247787	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131094014_131094015insT	uc004bur.3	+						COQ4_uc004bus.2_Intron|COQ4_uc010mxy.2_Intron	NM_016035	NP_057119			coenzyme Q4 homolog precursor						ubiquinone biosynthetic process	mitochondrial inner membrane					0																		---	---	---	---
TOR1A	1861	broad.mit.edu	37	9	132588454	132588463	+	5'Flank	DEL	AAAAAAAAAA	-	-	rs72078950		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132588454_132588463delAAAAAAAAAA	uc004byl.2	-						TOR1A_uc004bym.2_5'Flank|TOR1A_uc004byn.2_5'Flank	NM_000113	NP_000104			torsin A precursor						chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)																---	---	---	---
GPR107	57720	broad.mit.edu	37	9	132822682	132822684	+	Intron	DEL	TTT	-	-	rs35725615		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132822682_132822684delTTT	uc004bze.2	+						GPR107_uc004bzb.2_Intron|GPR107_uc004bzc.3_Intron|GPR107_uc011mbx.1_Intron|GPR107_uc004bzd.2_Intron	NM_001136557	NP_001130029			G protein-coupled receptor 107 isoform 1							integral to membrane				upper_aerodigestive_tract(1)	1		Ovarian(14;0.000531)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	133768036	133768036	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133768036delC								ABL1 (4976 upstream) : QRFP (780 downstream)																																			---	---	---	---
ABO	28	broad.mit.edu	37	9	136152872	136152873	+	5'Flank	INS	-	AGGAAGGG	AGGAAGGG	rs146876043	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136152872_136152873insAGGAAGGG	uc004cda.1	-						ABO_uc010naf.1_5'Flank|ABO_uc011mcz.1_5'Flank|ABO_uc010nag.1_5'Flank	NM_020469	NP_065202			ABO blood group (alpha						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	fucosylgalactoside 3-alpha-galactosyltransferase activity|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137918500	137918500	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137918500delC								FCN1 (108691 upstream) : OLFM1 (48589 downstream)																																			---	---	---	---
NOTCH1	4851	broad.mit.edu	37	9	139400836	139400836	+	Intron	DEL	A	-	-	rs72024525		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139400836delA	uc004chz.2	-						NOTCH1_uc004cia.1_Intron	NM_017617	NP_060087			notch1 preproprotein						aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)				T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1335232	1335233	+	Intron	INS	-	AGAG	AGAG	rs140314588	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1335232_1335233insAGAG	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	4401806	4401807	+	IGR	INS	-	A	A	rs5782752		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4401806_4401807insA								KLF6 (574333 upstream) : LOC100216001 (219637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5615338	5615345	+	IGR	DEL	AGGGAGGG	-	-	rs60890416	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5615338_5615345delAGGGAGGG								CALML3 (47113 upstream) : ASB13 (65475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6282874	6282874	+	IGR	DEL	T	-	-	rs111948612		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6282874delT								PFKFB3 (5369 upstream) : PRKCQ (186231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	7724153	7724156	+	IGR	DEL	AGAA	-	-	rs113820641		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7724153_7724156delAGAA								ITIH5 (15219 upstream) : ITIH2 (21080 downstream)																																			---	---	---	---
FAM171A1	221061	broad.mit.edu	37	10	15275520	15275521	+	Intron	INS	-	GT	GT	rs35596386		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15275520_15275521insGT	uc001iob.2	-							NM_001010924	NP_001010924			hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17076864	17076864	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17076864delT	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17098607	17098608	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17098607_17098608insA	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18913576	18913577	+	Intron	INS	-	AA	AA	rs66737855		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18913576_18913577insAA	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	22576850	22576850	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22576850delA								DNAJC1 (284200 upstream) : COMMD3 (28449 downstream)																																			---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30362576	30362577	+	Intron	INS	-	TCCT	TCCT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362576_30362577insTCCT	uc001iuz.2	-											RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30507422	30507425	+	IGR	DEL	GAGA	-	-	rs142368638		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30507422_30507425delGAGA								KIAA1462 (103002 upstream) : MTPAP (91306 downstream)																																			---	---	---	---
ZNF438	220929	broad.mit.edu	37	10	31225601	31225602	+	Intron	INS	-	A	A	rs79348450		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31225601_31225602insA	uc010qdz.1	-						ZNF438_uc001ivn.2_Intron|ZNF438_uc010qdy.1_Intron|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Intron|ZNF438_uc001ivp.3_Intron|ZNF438_uc010qea.1_Intron|ZNF438_uc010qeb.1_Intron|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432			zinc finger protein 438 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	31435693	31435694	+	IGR	DEL	CG	-	-	rs146437327		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31435693_31435694delCG								ZNF438 (114827 upstream) : LOC220930 (169764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	31847444	31847446	+	IGR	DEL	AAG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31847444_31847446delAAG								ZEB1 (29317 upstream) : ARHGAP12 (247779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	33427949	33427949	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33427949delA								ITGB1 (180656 upstream) : NRP1 (38471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36782243	36782244	+	IGR	DEL	GT	-	-	rs113777260		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36782243_36782244delGT								FZD8 (851881 upstream) : ANKRD30A (632541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39077884	39077898	+	IGR	DEL	TATTCCATTCCTTTT	-	-	rs113660502		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39077884_39077898delTATTCCATTCCTTTT								LOC399744 (336804 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42357918	42357918	+	IGR	DEL	T	-	-	rs79279953		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42357918delT								None (None upstream) : LOC441666 (469397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42711438	42711438	+	IGR	DEL	C	-	-	rs74878605		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42711438delC								None (None upstream) : LOC441666 (115877 downstream)																																			---	---	---	---
ZNF33B	7582	broad.mit.edu	37	10	43115666	43115666	+	Intron	DEL	A	-	-	rs35650961		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43115666delA	uc001jaf.1	-						ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Intron|ZNF33B_uc001jad.2_5'Flank	NM_006955	NP_008886			zinc finger protein 33B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	45145608	45145611	+	IGR	DEL	TCCT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45145608_45145611delTCCT								CXCL12 (265066 upstream) : TMEM72 (261153 downstream)																																			---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47042506	47042507	+	Intron	INS	-	AAG	AAG	rs141839225		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47042506_47042507insAAG	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	50766987	50766994	+	IGR	DEL	TGTGTGTG	-	-	rs146530060		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50766987_50766994delTGTGTGTG								PGBD3 (19403 upstream) : CHAT (50147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	50917992	50917997	+	IGR	DEL	TGTGTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50917992_50917997delTGTGTG								C10orf53 (1036 upstream) : OGDHL (24691 downstream)																																			---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53675308	53675309	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53675308_53675309delTG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	55166667	55166667	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55166667delA								MBL2 (635207 upstream) : PCDH15 (395868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55166789	55166790	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55166789_55166790delCT								MBL2 (635329 upstream) : PCDH15 (395745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	60717427	60717427	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60717427delG								BICC1 (128582 upstream) : PHYHIPL (218921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	60767014	60767015	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60767014_60767015delAC								BICC1 (178169 upstream) : PHYHIPL (169333 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	62385511	62385512	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62385511_62385512delAC	uc001jkz.3	-							NM_001149	NP_001140			ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69705574	69705578	+	Intron	DEL	AACAT	-	-	rs35496892		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69705574_69705578delAACAT	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
C10orf27	219793	broad.mit.edu	37	10	72534597	72534598	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72534597_72534598delTG	uc001jrj.1	-						C10orf27_uc010qjm.1_Intron|C10orf27_uc009xqh.1_Intron|C10orf27_uc010qjn.1_Intron|C10orf27_uc009xqi.1_Intron	NM_152710	NP_689923			stromal protein associated with thymii and lymph						cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1																		---	---	---	---
MIR606	693191	broad.mit.edu	37	10	77312184	77312184	+	5'Flank	DEL	C	-	-	rs1367290		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77312184delC	hsa-mir-606|MI0003619	+																							0																		---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	78188801	78188802	+	Intron	INS	-	ACACACAA	ACACACAA			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78188801_78188802insACACACAA	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	78358510	78358511	+	IGR	INS	-	T	T	rs149875750	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78358510_78358511insT								C10orf11 (41386 upstream) : KCNMA1 (270848 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79151703	79151704	+	Intron	INS	-	A	A	rs148676090	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79151703_79151704insA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)											OREG0020290	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	10	80164925	80164925	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80164925delT	uc010qlp.1	+											SubName: Full=cDNA FLJ57363;																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	80529022	80529023	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80529022_80529023delTG								RPS24 (712452 upstream) : LOC283050 (174061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	81266368	81266368	+	3'UTR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81266368delC	uc010qls.1	-	3										SubName: Full=cDNA FLJ60964, weakly similar to Homo sapiens dentin sialophosphoprotein (DSPP), mRNA;																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	86590668	86590669	+	IGR	INS	-	TGTG	TGTG	rs71473651		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86590668_86590669insTGTG								FAM190B (312392 upstream) : GRID1 (768643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87204701	87204701	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87204701delC								FAM190B (926425 upstream) : GRID1 (154611 downstream)																																			---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88237815	88237815	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88237815delA	uc001kdo.2	-						WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
AGAP11	119385	broad.mit.edu	37	10	88738203	88738204	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88738203_88738204insA	uc001kee.2	+							NM_133447	NP_597704			ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0																		---	---	---	---
GLUD1	2746	broad.mit.edu	37	10	88813952	88813952	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88813952delC	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262			glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)													---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90044930	90044930	+	3'UTR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90044930delT	uc001kfe.2	-	7					RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_3'UTR	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	91430744	91430744	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91430744delA								PANK1 (25529 upstream) : FLJ37201 (20313 downstream)																																			---	---	---	---
CPEB3	22849	broad.mit.edu	37	10	93812535	93812535	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93812535delG	uc001khw.1	-						CPEB3_uc001khu.1_Intron|CPEB3_uc001khv.1_Intron|CPEB3_uc010qnn.1_Intron	NM_014912	NP_055727			cytoplasmic polyadenylation element binding								nucleotide binding|RNA binding				0		Colorectal(252;0.0869)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	96853364	96853365	+	IGR	INS	-	A	A	rs78184463		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96853364_96853365insA								CYP2C8 (24110 upstream) : C10orf129 (100592 downstream)																																			---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97082154	97082154	+	Intron	DEL	A	-	-	rs5787130		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97082154delA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
RRP12	23223	broad.mit.edu	37	10	99133160	99133160	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99133160delC	uc001knf.2	-						RRP12_uc009xvl.2_Intron|RRP12_uc009xvm.2_Intron|RRP12_uc010qou.1_Intron|RRP12_uc009xvn.2_Intron	NM_015179	NP_055994			ribosomal RNA processing 12 homolog isoform 1							integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	99823423	99823430	+	IGR	DEL	TCTTTCTT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99823423_99823430delTCTTTCTT								CRTAC1 (32838 upstream) : C10orf28 (70951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	101253500	101253501	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101253500_101253501delAC								GOT1 (62970 upstream) : NKX2-3 (39189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	102960117	102960117	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102960117delG								TLX1 (62572 upstream) : LBX1 (26617 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108676334	108676335	+	Intron	DEL	AC	-	-	rs60868793		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108676334_108676335delAC	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	109572488	109572488	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109572488delA								SORCS1 (648196 upstream) : None (None downstream)																																			---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116302348	116302349	+	Intron	INS	-	GAAGGAGGAA	GAAGGAGGAA	rs145911227	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116302348_116302349insGAAGGAGGAA	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304			actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116476170	116476171	+	Intron	DEL	AC	-	-	rs149106447		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116476170_116476171delAC	uc001lbz.1	-											Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120280163	120280164	+	IGR	INS	-	A	A	rs141802066	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120280163_120280164insA								C10orf84 (178324 upstream) : PRLHR (72752 downstream)																																			---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121089893	121089894	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121089893_121089894delGA	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121102777	121102778	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121102777_121102778delGA	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122514365	122514365	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122514365delT								PPAPDC1A (164998 upstream) : WDR11 (96330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122723556	122723557	+	IGR	INS	-	G	G	rs143267597	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122723556_122723557insG								WDR11 (54521 upstream) : FGFR2 (514288 downstream)																																			---	---	---	---
BTBD16	118663	broad.mit.edu	37	10	124029399	124029399	+	5'Flank	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124029399delA	uc001lgc.1	+						BTBD16_uc001lgd.1_5'Flank	NM_144587	NP_653188			BTB (POZ) domain containing 16											skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	125107159	125107159	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125107159delA								BUB3 (182273 upstream) : GPR26 (318712 downstream)																																			---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126299085	126299090	+	Intron	DEL	GGGTGC	-	-	rs146189638		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126299085_126299090delGGGTGC	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron|LHPP_uc009yaj.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	132534480	132534506	+	IGR	DEL	GACCAAAGGATGATGGGCTTTAGGAGC	-	-	rs6144157		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132534480_132534506delGACCAAAGGATGATGGGCTTTAGGAGC								GLRX3 (551696 upstream) : TCERG1L (356150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132733964	132733965	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132733964_132733965delAC								GLRX3 (751180 upstream) : TCERG1L (156691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133176882	133176883	+	IGR	INS	-	ATAC	ATAC	rs71719257		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133176882_133176883insATAC								TCERG1L (66898 upstream) : PPP2R2D (571077 downstream)																																			---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135105878	135105885	+	Intron	DEL	CCCCGTGT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135105878_135105885delCCCCGTGT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
C11orf35	256329	broad.mit.edu	37	11	559962	559965	+	Intron	DEL	CACC	-	-	rs28650290	byFrequency	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:559962_559965delCACC	uc001lpx.2	-						uc001lpy.2_RNA|uc001lpz.2_RNA|RASSF7_uc001lqa.2_5'Flank|RASSF7_uc001lqb.2_5'Flank|RASSF7_uc001lqc.2_5'Flank|RASSF7_uc001lqd.2_5'Flank	NM_173573	NP_775844			hypothetical protein LOC256329											pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
PNPLA2	57104	broad.mit.edu	37	11	821261	821261	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:821261delT	uc001lrt.2	+						PNPLA2_uc009ycl.2_5'Flank	NM_020376	NP_065109			patatin-like phospholipase domain containing 2						negative regulation of sequestering of triglyceride|positive regulation of triglyceride catabolic process	integral to membrane|lipid particle|plasma membrane	triglyceride lipase activity				0		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
DENND5A	23258	broad.mit.edu	37	11	9273725	9273726	+	Intron	INS	-	T	T	rs138098666	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9273725_9273726insT	uc001mhl.2	-						DENND5A_uc010rbw.1_Intron|DENND5A_uc010rbx.1_Intron	NM_015213	NP_056028			RAB6 interacting protein 1											liver(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	9674606	9674606	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9674606delT								WEE1 (63295 upstream) : SWAP70 (11022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	10887595	10887599	+	Intron	DEL	CTTTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10887595_10887599delCTTTC	uc001mjl.1	+						uc001mjm.1_Intron					Homo sapiens, clone IMAGE:3930408, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	10955247	10955249	+	IGR	DEL	TGT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10955247_10955249delTGT								ZBED5 (75627 upstream) : GALNTL4 (337172 downstream)																																	OREG0020758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
USP47	55031	broad.mit.edu	37	11	11948773	11948774	+	Intron	INS	-	T	T	rs150721117	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11948773_11948774insT	uc001mjq.1	+						USP47_uc001mjr.2_Intron|USP47_uc001mjs.2_Intron	NM_017944	NP_060414			ubiquitin specific protease 47						base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)														---	---	---	---
TEAD1	7003	broad.mit.edu	37	11	12927334	12927344	+	Intron	DEL	CCTGACTCTTA	-	-	rs66829379		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12927334_12927344delCCTGACTCTTA	uc001mkj.3	+						TEAD1_uc001mkk.3_Intron|TEAD1_uc009ygl.2_Intron	NM_021961	NP_068780			TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13686845	13686845	+	IGR	DEL	A	-	-	rs143628939		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13686845delA								PTH (169278 upstream) : FAR1 (3361 downstream)																																			---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16380639	16380640	+	Intron	INS	-	T	T	rs145047190	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16380639_16380640insT	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron|SOX6_uc001mmh.1_Intron|SOX6_uc009ygs.2_Intron|SOX6_uc001mmi.3_Intron|SOX6_uc001mmj.2_Intron	NM_001145819	NP_001139291			SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16807540	16807540	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16807540delA	uc010rcu.1	-							NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																OREG0020803	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	22674530	22674539	+	IGR	DEL	TCTTTCTTTG	-	-	rs145997155	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22674530_22674539delTCTTTCTTTG								FANCF (27143 upstream) : GAS2 (13621 downstream)																																			---	---	---	---
SLC5A12	159963	broad.mit.edu	37	11	26747702	26747709	+	5'Flank	DEL	TTCTTCCT	-	-	rs4259786		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26747702_26747709delTTCTTCCT	uc001mrb.2	-											Homo sapiens mRNA; cDNA DKFZp564G223 (from clone DKFZp564G223).						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	27831512	27831513	+	IGR	DEL	TG	-	-	rs138484786		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27831512_27831513delTG								BDNF (87907 upstream) : KIF18A (210650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	27873498	27873499	+	IGR	INS	-	CCTC	CCTC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27873498_27873499insCCTC								BDNF (129893 upstream) : KIF18A (168664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30028838	30028839	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30028838_30028839delAC								None (None upstream) : KCNA4 (2927 downstream)																																			---	---	---	---
RCN1	5954	broad.mit.edu	37	11	32124056	32124057	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32124056_32124057delAC	uc010reb.1	+						RCN1_uc010rea.1_Intron|RCN1_uc001mtk.2_Intron	NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
LMO2	4005	broad.mit.edu	37	11	33894225	33894225	+	5'Flank	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33894225delA	uc001mve.2	-						LMO2_uc010rel.1_5'Flank|LMO2_uc010rem.1_Intron	NM_001142316	NP_001135788			LIM domain only 2 isoform 2						multicellular organismal development	nucleus	protein binding|zinc ion binding			lung(1)	1								T	TRD@	T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	11	33975687	33975688	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33975687_33975688insA								LMO2 (61851 upstream) : CAPRIN1 (97542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	34564049	34564050	+	IGR	INS	-	T	T	rs149310556	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34564049_34564050insT								ELF5 (28719 upstream) : EHF (78618 downstream)																																			---	---	---	---
TRIM44	54765	broad.mit.edu	37	11	35773700	35773701	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35773700_35773701insT	uc001mwi.2	+							NM_017583	NP_060053			DIPB protein							intracellular	protein binding|zinc ion binding			skin(1)	1	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	36966819	36966826	+	IGR	DEL	TGTGTGTG	-	-	rs2422449		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36966819_36966826delTGTGTGTG								C11orf74 (270429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37532399	37532400	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37532399_37532400delTG								C11orf74 (836009 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	38313372	38313373	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38313372_38313373delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	44821798	44821799	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44821798_44821799delCA								CD82 (180485 upstream) : TSPAN18 (60080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45009268	45009269	+	IGR	INS	-	TGGTCT	TGGTCT	rs148350780	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45009268_45009269insTGGTCT								LOC221122 (9692 upstream) : PRDM11 (106295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45568602	45568602	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45568602delG								SYT13 (260718 upstream) : CHST1 (101825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	47966530	47966531	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47966530_47966531delAC								NUP160 (96473 upstream) : PTPRJ (35579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54923435	54923435	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54923435delG								None (None upstream) : TRIM48 (106223 downstream)																																			---	---	---	---
P2RX3	5024	broad.mit.edu	37	11	57106992	57106993	+	Intron	INS	-	AC	AC	rs138637521	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57106992_57106993insAC	uc001nju.2	+							NM_002559	NP_002550			purinergic receptor P2X3						positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	57410493	57410493	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57410493delT	uc001nkt.1	+											Homo sapiens cDNA FLJ34998 fis, clone OCBBF2011706.																														---	---	---	---
OR9Q1	219956	broad.mit.edu	37	11	57863623	57863623	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57863623delT	uc001nmj.2	+							NM_001005212	NP_001005212			olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	58775245	58775248	+	Intron	DEL	GAGA	-	-	rs113690511		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58775245_58775248delGAGA	uc001nng.1	-											Homo sapiens cDNA FLJ34127 fis, clone FCBBF3010124.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	59066312	59066312	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066312delG								MPEG1 (85818 upstream) : OR5AN1 (65620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	63539389	63539394	+	IGR	DEL	AGGAGA	-	-	rs523291		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63539389_63539394delAGGAGA								C11orf95 (3276 upstream) : C11orf84 (41529 downstream)																																			---	---	---	---
SLC22A11	55867	broad.mit.edu	37	11	64320619	64320620	+	5'Flank	INS	-	A	A	rs142063841		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64320619_64320620insA	uc001oai.2	+						SLC22A11_uc001oah.1_5'Flank|SLC22A11_uc001oaj.2_5'Flank|SLC22A11_uc009ypq.2_5'Flank	NM_018484	NP_060954			solute carrier family 22 member 11						urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)													---	---	---	---
MAP4K2	5871	broad.mit.edu	37	11	64568154	64568154	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64568154delC	uc001obh.2	-						MAP4K2_uc001obi.2_Intron	NM_004579	NP_004570			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	65574383	65574383	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65574383delC								OVOL1 (9700 upstream) : SNX32 (27027 downstream)																																			---	---	---	---
RBM14	10432	broad.mit.edu	37	11	66393249	66393253	+	Intron	DEL	TCTTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66393249_66393253delTCTTC	uc001oit.2	+						RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Intron|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	NM_006328	NP_006319			RNA binding motif protein 14						DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
LRP5	4041	broad.mit.edu	37	11	68110835	68110836	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68110835_68110836delTG	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326			low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7																		---	---	---	---
KCNE3	10008	broad.mit.edu	37	11	74181301	74181301	+	5'Flank	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74181301delA	uc001ovc.2	-							NM_005472	NP_005463			potassium voltage-gated channel, Isk-related							integral to membrane	voltage-gated potassium channel activity			ovary(1)	1	Breast(11;2.86e-06)																	---	---	---	---
C11orf30	56946	broad.mit.edu	37	11	76244521	76244521	+	Intron	DEL	T	-	-	rs67555631		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76244521delT	uc001oxl.2	+						C11orf30_uc001oxm.2_Intron|C11orf30_uc010rsb.1_Intron|C11orf30_uc010rsc.1_Intron|C11orf30_uc001oxn.2_Intron|C11orf30_uc010rsd.1_Intron|C11orf30_uc001oxo.1_Intron|C11orf30_uc010rse.1_Intron	NM_020193	NP_064578			EMSY protein						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6																		---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77592957	77592958	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77592957_77592958insT	uc001oys.2	-						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron|INTS4_uc001oyt.2_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83281606	83281606	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83281606delA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
ME3	10873	broad.mit.edu	37	11	86278284	86278285	+	Intron	INS	-	A	A	rs149764846	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86278284_86278285insA	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811			mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	91393880	91393880	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91393880delA								MIR1261 (791510 upstream) : FAT3 (691382 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94995301	94995304	+	IGR	DEL	ACAC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94995301_94995304delACAC								SESN3 (29596 upstream) : FAM76B (506802 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99200814	99200815	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99200814_99200815insA	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
KIAA1377	57562	broad.mit.edu	37	11	101840268	101840268	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101840268delA	uc001pgm.2	+						KIAA1377_uc001pgn.2_Intron|KIAA1377_uc010run.1_Intron	NM_020802	NP_065853			hypothetical protein LOC57562								protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)														---	---	---	---
YAP1	10413	broad.mit.edu	37	11	101989481	101989482	+	Intron	INS	-	A	A	rs79575434		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101989481_101989482insA	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron	NM_001130145	NP_001123617			Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	102360195	102360195	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102360195delA								TMEM123 (36420 upstream) : MMP7 (31045 downstream)																																			---	---	---	---
CASP5	838	broad.mit.edu	37	11	104885024	104885024	+	Intron	DEL	T	-	-	rs35041238		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104885024delT	uc010rva.1	-						CASP5_uc010ruz.1_Intron|CASP5_uc010rvb.1_Intron|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338			caspase 5 isoform a precursor						apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)														---	---	---	---
ALG9	79796	broad.mit.edu	37	11	111741104	111741105	+	Intron	INS	-	C	C	rs60312459		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111741104_111741105insC	uc001pmb.2	-						ALG9_uc001ply.2_Intron|ALG9_uc001plz.2_Intron|ALG9_uc010rwm.1_Intron|ALG9_uc010rwn.1_Intron|ALG9_uc010rwo.1_Intron|ALG9_uc009yyh.1_Intron	NM_001077690	NP_001071158			asparagine-linked glycosylation 9 protein						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	113925938	113925938	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113925938delA								HTR3A (64906 upstream) : ZBTB16 (4493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116554499	116554500	+	IGR	INS	-	G	G	rs147246538	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116554499_116554500insG								None (None upstream) : BUD13 (64388 downstream)																																			---	---	---	---
PAFAH1B2	5049	broad.mit.edu	37	11	117024835	117024836	+	Intron	INS	-	A	A	rs142267495	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117024835_117024836insA	uc001pqe.1	+						PAFAH1B2_uc009yzk.1_Intron|PAFAH1B2_uc009yzl.1_Intron|PAFAH1B2_uc009yzm.2_Intron|PAFAH1B2_uc009yzn.2_Intron|PAFAH1B2_uc009yzj.1_Intron	NM_002572	NP_002563			platelet-activating factor acetylhydrolase,						lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)				T	IGH@	MLCLS								---	---	---	---
PCSK7	9159	broad.mit.edu	37	11	117093369	117093369	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117093369delT	uc001pqr.2	-							NM_004716	NP_004707			proprotein convertase subtilisin/kexin type 7						peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)				T	IGH@	MLCLS								---	---	---	---
Unknown	0	broad.mit.edu	37	11	118555656	118555656	+	IGR	DEL	T	-	-	rs36083539		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118555656delT								TREH (5275 upstream) : DDX6 (62817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	120070717	120070718	+	IGR	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120070717_120070718insC								TRIM29 (61854 upstream) : OAF (11029 downstream)																																			---	---	---	---
TMEM136	219902	broad.mit.edu	37	11	120199790	120199791	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199790_120199791delTG	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586			transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120836881	120836881	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120836881delA	uc001pxn.2	+						GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	124303294	124303295	+	IGR	DEL	TG	-	-	rs11219657		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124303294_124303295delTG								OR8B4 (8527 upstream) : OR8B8 (6752 downstream)																																			---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125281359	125281360	+	Intron	DEL	TC	-	-	rs34023012		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125281359_125281360delTC	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron|PKNOX2_uc001qbv.2_5'UTR	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126793342	126793342	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126793342delT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127572580	127572581	+	IGR	DEL	TG	-	-	rs149286998		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127572580_127572581delTG								KIRREL3 (699225 upstream) : ETS1 (756075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128079493	128079494	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128079493_128079494insT								None (None upstream) : ETS1 (249162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129329036	129329036	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129329036delA								BARX2 (6863 upstream) : TMEM45B (356705 downstream)																																			---	---	---	---
TMEM45B	120224	broad.mit.edu	37	11	129687781	129687781	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129687781delC	uc001qfe.1	+							NM_138788	NP_620143			transmembrane protein 45B							integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133008561	133008561	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133008561delC	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	133414330	133414331	+	IGR	DEL	TT	-	-	rs72201914		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133414330_133414331delTT								OPCML (11927 upstream) : SPATA19 (296186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	133589686	133589686	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133589686delT								OPCML (187283 upstream) : SPATA19 (120831 downstream)																																			---	---	---	---
IGSF9B	22997	broad.mit.edu	37	11	133788723	133788724	+	Intron	INS	-	G	G	rs150958113		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133788723_133788724insG	uc001qgx.3	-							NM_014987	NP_055802			immunoglobulin superfamily, member 9B							integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)														---	---	---	---
IGSF9B	22997	broad.mit.edu	37	11	133817980	133817981	+	Intron	INS	-	TC	TC	rs142317840	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133817980_133817981insTC	uc001qgx.3	-						IGSF9B_uc001qgz.2_5'Flank	NM_014987	NP_055802			immunoglobulin superfamily, member 9B							integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)														---	---	---	---
IGSF9B	22997	broad.mit.edu	37	11	133822680	133822681	+	Intron	DEL	AT	-	-	rs34560081		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133822680_133822681delAT	uc001qgx.3	-							NM_014987	NP_055802			immunoglobulin superfamily, member 9B							integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)														---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1164137	1164137	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1164137delA	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2352503	2352503	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2352503delG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2763494	2763494	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2763494delA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	4245566	4245567	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4245566_4245567delGT								PARP11 (262958 upstream) : CCND2 (137335 downstream)																																			---	---	---	---
VWF	7450	broad.mit.edu	37	12	6221741	6221741	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6221741delA	uc001qnn.1	-						VWF_uc010set.1_Intron|VWF_uc001qno.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
SLC2A14	144195	broad.mit.edu	37	12	7967853	7967853	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7967853delA	uc001qtk.2	-						SLC2A14_uc001qtl.2_Intron|SLC2A14_uc001qtm.2_Intron|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Intron|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Intron	NM_153449	NP_703150			glucose transporter 14						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	10392021	10392033	+	IGR	DEL	ATCCTTCCTTCCT	-	-	rs11053697		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392021_10392033delATCCTTCCTTCCT								GABARAPL1 (16299 upstream) : KLRD1 (65017 downstream)																																			---	---	---	---
PRR4	11272	broad.mit.edu	37	12	11000107	11000107	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11000107delT	uc001qyz.3	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRR4_uc001qza.3_Intron	NM_007244	NP_009175			proline rich 4 (lacrimal) isoform 2						visual perception	extracellular space					0																		---	---	---	---
GUCY2C	2984	broad.mit.edu	37	12	14837559	14837560	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14837559_14837560insT	uc001rcd.2	-						GUCY2C_uc009zhz.2_Intron	NM_004963	NP_004954			guanylate cyclase 2C precursor						intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	15987727	15987727	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15987727delT								EPS8 (45217 upstream) : STRAP (47561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	18309309	18309309	+	IGR	DEL	A	-	-	rs145617651		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18309309delA								RERGL (66195 upstream) : PIK3C2G (105165 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	26066364	26066364	+	IGR	DEL	T	-	-	rs112770705		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26066364delT								IFLTD1 (264876 upstream) : RASSF8 (45605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	27242456	27242456	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27242456delT								C12orf71 (7001 upstream) : STK38L (154622 downstream)																																			---	---	---	---
CCDC91	55297	broad.mit.edu	37	12	28696626	28696627	+	Intron	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28696626_28696627delTC	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rir.2_Intron|CCDC91_uc009zjl.2_Intron	NM_018318	NP_060788			GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)																	---	---	---	---
C12orf72	254013	broad.mit.edu	37	12	31799544	31799545	+	5'Flank	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31799544_31799545insT	uc009zjr.2	+							NM_001135864	NP_001129336			hypothetical protein LOC254013							cytoplasm	protein methyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	33057328	33057331	+	IGR	DEL	CCTT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33057328_33057331delCCTT								PKP2 (7548 upstream) : SYT10 (471017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37996257	37996258	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37996257_37996258insA								None (None upstream) : ALG10B (714299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38197160	38197161	+	IGR	INS	-	C	C	rs144703101		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38197160_38197161insC								None (None upstream) : ALG10B (513396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	42302750	42302750	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42302750delC								PDZRN4 (334366 upstream) : GXYLT1 (172900 downstream)																																			---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42840625	42840625	+	3'UTR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42840625delT	uc001rng.1	+	13					PPHLN1_uc010sks.1_3'UTR|PPHLN1_uc010skt.1_3'UTR|PPHLN1_uc001rni.1_3'UTR|PPHLN1_uc001rnh.1_RNA|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572			periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	43402332	43402333	+	IGR	INS	-	TGTC	TGTC	rs71847763		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43402332_43402333insTGTC								PRICKLE1 (418760 upstream) : ADAMTS20 (345680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43633969	43633969	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43633969delC								PRICKLE1 (650397 upstream) : ADAMTS20 (114044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43655484	43655485	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43655484_43655485delTG								PRICKLE1 (671912 upstream) : ADAMTS20 (92528 downstream)																																			---	---	---	---
TWF1	5756	broad.mit.edu	37	12	44192424	44192425	+	Intron	INS	-	A	A	rs35482343		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44192424_44192425insA	uc001rob.2	-						TWF1_uc001rnz.2_Intron|TWF1_uc001roa.2_Intron|TWF1_uc001roc.2_Intron	NM_002822	NP_002813			twinfilin 1							actin cytoskeleton|cytoplasm	actin binding|protein tyrosine kinase activity			stomach(1)	1	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	48026704	48026704	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48026704delA								FAM113B (396263 upstream) : RPAP3 (29012 downstream)																																			---	---	---	---
HDAC7	51564	broad.mit.edu	37	12	48176607	48176608	+	3'UTR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48176607_48176608delAC	uc010slo.1	-	26					HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_3'UTR|HDAC7_uc001rqj.3_3'UTR|HDAC7_uc001rqk.3_3'UTR	NM_015401	NP_056216			histone deacetylase 7 isoform a						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)														---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51786838	51786841	+	Intron	DEL	CTCT	-	-	rs139179142		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51786838_51786841delCTCT	uc001ryo.2	+						GALNT6_uc001ryl.1_5'Flank|GALNT6_uc010snh.1_5'Flank|SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryp.1_Intron	NM_001039960	NP_001035049			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	61521535	61521536	+	IGR	INS	-	GT	GT	rs147824367	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61521535_61521536insGT								None (None upstream) : FAM19A2 (580507 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62249938	62249938	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62249938delA	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
DPY19L2	283417	broad.mit.edu	37	12	63991432	63991433	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63991432_63991433insA	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173			dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)														---	---	---	---
DPY19L2	283417	broad.mit.edu	37	12	64020321	64020321	+	Intron	DEL	C	-	-	rs7310030	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64020321delC	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173			dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)														---	---	---	---
GNS	2799	broad.mit.edu	37	12	65133418	65133419	+	Intron	INS	-	A	A	rs56380290		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65133418_65133419insA	uc001ssg.3	-						GNS_uc001ssf.2_Intron|GNS_uc010ssq.1_Intron|GNS_uc010ssr.1_Intron	NM_002076	NP_002067			glucosamine (N-acetyl)-6-sulfatase precursor							lysosome	metal ion binding|N-acetylglucosamine-6-sulfatase activity|protein binding			central_nervous_system(1)	1	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	75961613	75961613	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75961613delT								KRR1 (56195 upstream) : PHLDA1 (457615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	76046262	76046262	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76046262delT								KRR1 (140844 upstream) : PHLDA1 (372966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77355914	77355915	+	IGR	DEL	AC	-	-	rs34521734		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77355914_77355915delAC								CSRP2 (83115 upstream) : E2F7 (59112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	83679346	83679347	+	IGR	INS	-	A	A	rs147955651	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83679346_83679347insA								TMTC2 (151283 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	84288110	84288111	+	IGR	INS	-	A	A	rs137885277	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84288110_84288111insA								TMTC2 (760047 upstream) : SLC6A15 (965158 downstream)																																			---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86486636	86486636	+	Intron	DEL	T	-	-	rs139660970	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86486636delT	uc001tai.3	-						MGAT4C_uc001tal.3_Intron|MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron|MGAT4C_uc010sum.1_Intron|MGAT4C_uc001tah.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	89539187	89539190	+	IGR	DEL	GGAA	-	-	rs72303197		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89539187_89539190delGGAA								KITLG (564949 upstream) : DUSP6 (202649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92113595	92113626	+	IGR	DEL	GAAGGAAGGAAAGAAAGAAGGAAGGAAGGAAA	-	-	rs12830115		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92113595_92113626delGAAGGAAGGAAAGAAAGAAGGAAGGAAGGAAA								DCN (536789 upstream) : BTG1 (265240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	93920790	93920791	+	IGR	INS	-	GT	GT	rs145609668	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93920790_93920791insGT								MRPL42 (24359 upstream) : SOCS2 (42807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	95359607	95359607	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95359607delA								MIR492 (131318 upstream) : NDUFA12 (5505 downstream)																																			---	---	---	---
DRAM1	55332	broad.mit.edu	37	12	102314075	102314075	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102314075delC	uc001tix.2	+						DRAM1_uc010svv.1_Intron	NM_018370	NP_060840			DNA-damage regulated autophagy modulator 1						apoptosis|autophagy	integral to membrane|lysosomal membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	105352389	105352389	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105352389delA								SLC41A2 (29917 upstream) : C12orf45 (27709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	107524329	107524330	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107524329_107524330insA								CRY1 (36731 upstream) : BTBD11 (187867 downstream)																																			---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107781725	107781726	+	Intron	INS	-	CTC	CTC	rs149452400	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107781725_107781726insCTC	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108505210	108505211	+	IGR	DEL	TG	-	-	rs151132712		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108505210_108505211delTG								ASCL4 (334790 upstream) : WSCD2 (18300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	108875805	108875805	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108875805delT								CMKLR1 (142711 upstream) : FICD (33246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	109823219	109823220	+	IGR	INS	-	CCT	CCT	rs139929359	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109823219_109823220insCCT								FOXN4 (76194 upstream) : MYO1H (3304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	110072974	110072975	+	IGR	INS	-	CAC	CAC	rs147461690	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072974_110072975insCAC								MVK (37904 upstream) : C12orf34 (79215 downstream)																																			---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111506948	111506948	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111506948delG	uc001tsa.1	+							NM_015267	NP_056082			cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
MAPKAPK5	8550	broad.mit.edu	37	12	112311746	112311747	+	Intron	INS	-	AA	AA	rs148457098	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112311746_112311747insAA	uc001tta.2	+						MAPKAPK5_uc001tsz.2_Intron|MAPKAPK5_uc001ttb.2_Intron	NM_139078	NP_620777			MAP kinase-activated protein kinase 5 isoform 2						signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	112966672	112966677	+	IGR	DEL	TTTTTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112966672_112966677delTTTTTG								PTPN11 (18956 upstream) : RPH3A (46224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	114864002	114864002	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114864002delT								TBX5 (17755 upstream) : TBX3 (244057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115710625	115710625	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115710625delT								TBX3 (588656 upstream) : MED13L (685758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116098647	116098650	+	IGR	DEL	AAAG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116098647_116098650delAAAG								TBX3 (976678 upstream) : MED13L (297733 downstream)																																			---	---	---	---
LOC144742	144742	broad.mit.edu	37	12	119734534	119734535	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119734534_119734535delAC	uc009zwt.1	-							NR_024246				Homo sapiens cDNA FLJ32935 fis, clone TESTI2007502.												0																		---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119848005	119848006	+	Intron	DEL	TC	-	-	rs56384600		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119848005_119848006delTC	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
HNF1A	6927	broad.mit.edu	37	12	121418991	121418992	+	Intron	INS	-	T	T	rs142333553	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121418991_121418992insT	uc001tzg.2	+						HNF1A_uc001tze.1_Intron|HNF1A_uc001tzf.2_Intron|HNF1A_uc010szn.1_Intron	NM_000545	NP_000536			hepatic nuclear factor-1-alpha						glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)													Hepatic_Adenoma_Familial_Clustering_of				---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121969710	121969710	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121969710delC	uc001uat.2	-						KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
DIABLO	56616	broad.mit.edu	37	12	122702412	122702412	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122702412delA	uc010tab.1	-						DIABLO_uc010taa.1_Intron|DIABLO_uc010tac.1_Intron|DIABLO_uc010tad.1_Intron|VPS33A_uc001ucc.2_Intron	NM_019887	NP_063940			diablo isoform 1 precursor						activation of caspase activity by cytochrome c|induction of apoptosis via death domain receptors	CD40 receptor complex|cytosol|internal side of plasma membrane|mitochondrial intermembrane space	protein binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)														---	---	---	---
TCTN2	79867	broad.mit.edu	37	12	124161762	124161762	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124161762delC	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085			tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124680568	124680569	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124680568_124680569insT								ZNF664 (180601 upstream) : FAM101A (93141 downstream)																																			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	125017531	125017558	+	Intron	DEL	CTCTTTCCCCCACCTCCAAATCGCACTT	-	-	rs71092207	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125017531_125017558delCTCTTTCCCCCACCTCCAAATCGCACTT	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	125957733	125957733	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125957733delT	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130231722	130231723	+	Intron	INS	-	CTCCTTCTCCCTCCTCCCG	CTCCTTCTCCCTCCTCCCG	rs149346895	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130231722_130231723insCTCCTTCTCCCTCCTCCCG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131365663	131365664	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131365663_131365664delGT								RAN (4839 upstream) : GPR133 (72788 downstream)																																			---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131607234	131607235	+	Intron	DEL	TT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131607234_131607235delTT	uc001uit.3	+						GPR133_uc010tbm.1_Intron|GPR133_uc009zyo.2_Intron|GPR133_uc009zyp.2_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131939339	131939340	+	IGR	INS	-	ACAG	ACAG	rs143861088	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131939339_131939340insACAG								LOC116437 (241864 upstream) : SFRS8 (256295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	19996533	19996534	+	IGR	INS	-	C	C	rs149521081		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19996533_19996534insC								LOC100101938 (77420 upstream) : TPTE2 (487 downstream)																																			---	---	---	---
PSPC1	55269	broad.mit.edu	37	13	20325238	20325238	+	Intron	DEL	C	-	-	rs9508872	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20325238delC	uc001uml.2	-						PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	NM_001042414	NP_001035879			paraspeckle protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22465062	22465062	+	IGR	DEL	C	-	-	rs55872907		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22465062delC								FGF9 (186422 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22791608	22791608	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22791608delT	uc001uoi.2	+						uc001uoj.2_Intron					Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
SACS	26278	broad.mit.edu	37	13	23955495	23955498	+	Intron	DEL	CACA	-	-	rs146993732		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23955495_23955498delCACA	uc001uon.2	-							NM_014363	NP_055178			sacsin						cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	24026052	24026053	+	IGR	INS	-	A	A	rs79277567	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24026052_24026053insA								SACS (18211 upstream) : TNFRSF19 (118670 downstream)																																			---	---	---	---
WASF3	10810	broad.mit.edu	37	13	27195842	27195843	+	Intron	INS	-	CTCT	CTCT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27195842_27195843insCTCT	uc001uqv.2	+						WASF3_uc001uqw.2_Intron	NM_006646	NP_006637			WAS protein family, member 3						actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	30650518	30650518	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30650518delC								UBL3 (225698 upstream) : KATNAL1 (126250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30734498	30734499	+	IGR	DEL	AT	-	-	rs68047527		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30734498_30734499delAT								UBL3 (309678 upstream) : KATNAL1 (42269 downstream)																																			---	---	---	---
B3GALTL	145173	broad.mit.edu	37	13	31815189	31815189	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31815189delG	uc010aaz.2	+							NM_194318	NP_919299			beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	37158627	37158628	+	IGR	DEL	TG	-	-	rs139538181		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37158627_37158628delTG								CCNA1 (141609 upstream) : C13orf36 (89421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38023749	38023749	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38023749delA								CSNK1A1L (343948 upstream) : POSTN (112971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	40199456	40199459	+	IGR	DEL	ACAC	-	-	rs71796979		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40199456_40199459delACAC								LHFP (22100 upstream) : COG6 (30305 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43866910	43866911	+	Intron	INS	-	C	C	rs138311291	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43866910_43866911insC	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46899950	46899951	+	IGR	INS	-	TCT	TCT	rs145265450	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46899950_46899951insTCT								LCP1 (143491 upstream) : C13orf18 (16188 downstream)																																			---	---	---	---
FNDC3A	22862	broad.mit.edu	37	13	49763623	49763623	+	Intron	DEL	T	-	-	rs79771257		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49763623delT	uc001vcm.2	+						FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141			fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---
NEK5	341676	broad.mit.edu	37	13	52657678	52657680	+	Intron	DEL	TTT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52657678_52657680delTTT	uc001vge.2	-							NM_199289	NP_954983			NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	53709145	53709145	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53709145delA								OLFM4 (82959 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54872313	54872314	+	IGR	INS	-	A	A	rs35974457		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54872313_54872314insA								None (None upstream) : MIR1297 (13793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58314177	58314178	+	IGR	INS	-	T	T	rs149430866	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58314177_58314178insT								PCDH17 (11112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59501975	59501979	+	IGR	DEL	TTTGT	-	-	rs72366571		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59501975_59501979delTTTGT								None (None upstream) : DIAPH3 (737746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59832322	59832322	+	IGR	DEL	A	-	-	rs76016831		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59832322delA								None (None upstream) : DIAPH3 (407403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62985060	62985063	+	IGR	DEL	ACAG	-	-	rs144119061		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62985060_62985063delACAG								PCDH20 (982981 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63633384	63633385	+	IGR	DEL	TT	-	-	rs72302550		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63633384_63633385delTT								None (None upstream) : OR7E156P (678183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66497435	66497436	+	IGR	INS	-	AG	AG	rs142611026	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66497435_66497436insAG								None (None upstream) : PCDH9 (379531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66509280	66509281	+	IGR	INS	-	AG	AG	rs148845026	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66509280_66509281insAG								None (None upstream) : PCDH9 (367686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70065407	70065407	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70065407delT								None (None upstream) : KLHL1 (209319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75467052	75467052	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75467052delA								KLF12 (758658 upstream) : LOC647288 (344838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78384758	78384758	+	IGR	DEL	T	-	-	rs113921754		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78384758delT								SLAIN1 (46381 upstream) : EDNRB (84858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78977666	78977667	+	Intron	INS	-	T	T	rs141683495	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78977666_78977667insT	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	82988776	82988776	+	IGR	DEL	T	-	-	rs34923568		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82988776delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83276675	83276676	+	IGR	INS	-	ACAC	ACAC	rs142090892	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83276675_83276676insACAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83456877	83456877	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83456877delA								None (None upstream) : SLITRK1 (994467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85578935	85578937	+	IGR	DEL	CTT	-	-	rs4040799		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85578935_85578937delCTT								None (None upstream) : SLITRK6 (787985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86059401	86059403	+	IGR	DEL	CAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86059401_86059403delCAA								None (None upstream) : SLITRK6 (307519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91315361	91315361	+	IGR	DEL	T	-	-	rs75743572		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91315361delT								MIR622 (431830 upstream) : LOC144776 (227847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	95072949	95072950	+	IGR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95072949_95072950delAG								GPC6 (12682 upstream) : DCT (18893 downstream)																																			---	---	---	---
FARP1	10160	broad.mit.edu	37	13	98930426	98930427	+	Intron	INS	-	GT	GT	rs140356663	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98930426_98930427insGT	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757			FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
FARP1	10160	broad.mit.edu	37	13	98971204	98971205	+	Intron	INS	-	T	T	rs67683358		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98971204_98971205insT	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757			FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
STK24	8428	broad.mit.edu	37	13	99221668	99221668	+	Intron	DEL	A	-	-	rs150582275		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99221668delA	uc001vnn.1	-						STK24_uc010tim.1_Intron	NM_001032296	NP_001027467			serine/threonine kinase 24 isoform b						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	100109874	100109874	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100109874delT								UBAC2 (71123 upstream) : TM9SF2 (43854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	103415370	103415370	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103415370delA								LOC643677 (3948 upstream) : C13orf27 (3095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106736792	106736793	+	IGR	INS	-	CG	CG	rs138731893	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106736792_106736793insCG								DAOA (593410 upstream) : EFNB2 (405305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107415390	107415409	+	IGR	DEL	CACACACCCTCTCTCTCTCT	-	-	rs59181502	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107415390_107415409delCACACACCCTCTCTCTCTCT								ARGLU1 (194876 upstream) : FAM155A (405471 downstream)																																			---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108074821	108074822	+	Intron	INS	-	TCA	TCA	rs139162456	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108074821_108074822insTCA	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108114656	108114657	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108114656_108114657insA	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	110262020	110262027	+	IGR	DEL	AGGGAGAA	-	-	rs111280100	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110262020_110262027delAGGGAGAA								MYO16 (401665 upstream) : IRS2 (144159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112628055	112628055	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112628055delG								C13orf16 (631462 upstream) : SOX1 (93858 downstream)																																			---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113402151	113402152	+	Intron	INS	-	A	A	rs138507528	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113402151_113402152insA	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|uc001vsk.2_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113458643	113458644	+	Intron	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113458643_113458644insC	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|ATP11A_uc001vsm.1_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
RNASE2	6036	broad.mit.edu	37	14	21400549	21400549	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21400549delT	uc010aif.2	+							NM_002934	NP_002925			ribonuclease, RNase A family, 2 (liver,						chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22019017	22019018	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22019017_22019018delTG								SALL2 (13680 upstream) : OR10G3 (18917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	26673635	26673642	+	IGR	DEL	ATATATAT	-	-	rs71954578		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26673635_26673642delATATATAT								None (None upstream) : NOVA1 (241448 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27782426	27782426	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27782426delA								NOVA1 (715466 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28311114	28311115	+	IGR	INS	-	T	T	rs143273411	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28311114_28311115insT								None (None upstream) : FOXG1 (925172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28534696	28534697	+	IGR	DEL	GT	-	-	rs71436311		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28534696_28534697delGT								None (None upstream) : FOXG1 (701590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34579184	34579184	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34579184delC								EGLN3 (158897 upstream) : C14orf147 (322961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34638604	34638604	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34638604delA								EGLN3 (218317 upstream) : C14orf147 (263541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	41843014	41843014	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41843014delA								None (None upstream) : LRFN5 (233750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	42636201	42636201	+	IGR	DEL	C	-	-	rs56914465		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42636201delC								LRFN5 (262451 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43231251	43231252	+	IGR	INS	-	TGTTTTGTTT	TGTTTTGTTT	rs112294895		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43231251_43231252insTGTTTTGTTT								LRFN5 (857501 upstream) : None (None downstream)																																			---	---	---	---
FANCM	57697	broad.mit.edu	37	14	45618489	45618490	+	Intron	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45618489_45618490delCA	uc001wwd.3	+						FANCM_uc001wwc.2_Intron|FANCM_uc010anf.2_Intron	NM_020937	NP_065988			Fanconi anemia, complementation group M						DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7													Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
Unknown	0	broad.mit.edu	37	14	45848865	45848865	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45848865delA								C14orf106 (126260 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	49822798	49822799	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49822798_49822799delCA								None (None upstream) : SDCCAG1 (210228 downstream)																																			---	---	---	---
DLGAP5	9787	broad.mit.edu	37	14	55643694	55643695	+	Intron	INS	-	A	A	rs34109336		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55643694_55643695insA	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565			discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	59230669	59230669	+	IGR	DEL	G	-	-	rs35815331		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59230669delG								DACT1 (115633 upstream) : DAAM1 (424730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	61626477	61626479	+	IGR	DEL	ATT	-	-	rs34795040	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61626477_61626479delATT								SLC38A6 (76027 upstream) : PRKCH (27808 downstream)																																			---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64414874	64414875	+	Intron	INS	-	AC	AC	rs151256085	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64414874_64414875insAC	uc001xgm.2	+						SYNE2_uc001xgk.2_Intron|SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65634150	65634150	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65634150delG								MAX (64923 upstream) : LOC645431 (243163 downstream)																																			---	---	---	---
EIF2S1	1965	broad.mit.edu	37	14	67849626	67849627	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67849626_67849627delGT	uc001xjg.2	+							NM_004094	NP_004085			eukaryotic translation initiation factor 2,							cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)														---	---	---	---
KIAA0247	9766	broad.mit.edu	37	14	70113417	70113418	+	Intron	INS	-	T	T	rs61409476		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70113417_70113418insT	uc001xlk.2	+						KIAA0247_uc010aqz.2_Intron	NM_014734	NP_055549			hypothetical protein LOC9766 precursor							integral to membrane				ovary(3)	3				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)														---	---	---	---
KIAA0247	9766	broad.mit.edu	37	14	70117470	70117472	+	Intron	DEL	TTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70117470_70117472delTTG	uc001xlk.2	+						KIAA0247_uc010aqz.2_Intron	NM_014734	NP_055549			hypothetical protein LOC9766 precursor							integral to membrane				ovary(3)	3				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	70750711	70750712	+	IGR	DEL	AT	-	-	rs71835578		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70750711_70750712delAT								ADAM21P1 (36193 upstream) : COX16 (41087 downstream)																																			---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73120464	73120464	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73120464delA	uc001xnc.2	-							NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74775774	74775774	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74775774delT								ABCD4 (6007 upstream) : C14orf115 (39392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	74857482	74857485	+	IGR	DEL	CATC	-	-	rs72107511		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74857482_74857485delCATC								C14orf115 (30772 upstream) : TMEM90A (15111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	75340955	75340955	+	IGR	DEL	T	-	-	rs35863744		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75340955delT								PROX2 (10418 upstream) : DLST (7639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	76016341	76016342	+	IGR	DEL	TC	-	-	rs74364112		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76016341_76016342delTC								BATF (3014 upstream) : FLVCR2 (28598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	76552544	76552545	+	IGR	INS	-	A	A	rs140202759	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76552544_76552545insA								C14orf179 (1614 upstream) : C14orf118 (65714 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	78806505	78806505	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78806505delA	uc001xum.1	+											Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	86342325	86342325	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86342325delG								FLRT2 (248056 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87753611	87753612	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87753611_87753612insT								None (None upstream) : GALC (550552 downstream)																																			---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89735824	89735824	+	Intron	DEL	G	-	-	rs56288367		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89735824delG	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
C14orf143	90141	broad.mit.edu	37	14	90331800	90331801	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90331800_90331801delGA	uc001xxt.2	-						C14orf143_uc001xxs.2_Intron|C14orf143_uc001xxv.1_Intron	NM_145231	NP_660274			hypothetical protein LOC90141								calcium ion binding				0		all_cancers(154;0.136)		Epithelial(152;0.194)														---	---	---	---
RPS6KA5	9252	broad.mit.edu	37	14	91380010	91380010	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91380010delT	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746			ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	96643397	96643398	+	IGR	DEL	CA	-	-	rs10562506		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96643397_96643398delCA								C14orf132 (83264 upstream) : BDKRB2 (27737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98311208	98311211	+	IGR	DEL	GAAG	-	-	rs111619571	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98311208_98311211delGAAG								VRK1 (963258 upstream) : C14orf64 (80736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98480461	98480462	+	IGR	INS	-	CTTT	CTTT	rs149441117	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480461_98480462insCTTT								C14orf64 (36000 upstream) : C14orf177 (697488 downstream)																																			---	---	---	---
WDR25	79446	broad.mit.edu	37	14	100881265	100881266	+	Intron	INS	-	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100881265_100881266insG	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948			WD repeat domain 25												0		Melanoma(154;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	102992124	102992127	+	IGR	DEL	TTTC	-	-	rs148771243		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102992124_102992127delTTTC								ANKRD9 (15996 upstream) : RCOR1 (67106 downstream)																																			---	---	---	---
TRAF3	7187	broad.mit.edu	37	14	103291931	103291931	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103291931delC	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777			TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)														---	---	---	---
AMN	81693	broad.mit.edu	37	14	103391246	103391246	+	Intron	DEL	A	-	-	rs35919524		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103391246delA	uc001ymg.3	+						AMN_uc001ymh.3_Intron	NM_030943	NP_112205			amnionless protein precursor						lipid metabolic process|lipoprotein metabolic process|multicellular organismal development	integral to membrane|plasma membrane					0				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106097365	106097385	+	Intron	DEL	CAGGAAGTGTCCAGCGTGGAC	-	-	rs71960640	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106097365_106097385delCAGGAAGTGTCCAGCGTGGAC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yry.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106784710	106784710	+	Intron	DEL	A	-	-	rs66714645		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106784710delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106920639	106920639	+	Intron	DEL	C	-	-	rs2467901		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106920639delC	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20033695	20033695	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20033695delC								None (None upstream) : GOLGA6L6 (703399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20604799	20604800	+	Intron	INS	-	GATGCTCCTCCTCCTCCC	GATGCTCCTCCTCCTCCC	rs144895063	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20604799_20604800insGATGCTCCTCCTCCTCCC	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
BCL8	606	broad.mit.edu	37	15	20877913	20877916	+	Intron	DEL	TAAC	-	-	rs75410064		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20877913_20877916delTAAC	uc010tze.1	-						BCL8_uc010tzd.1_5'Flank	NR_027992				RecName: Full=Putative protein BCL8;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	22653147	22653148	+	IGR	DEL	TT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22653147_22653148delTT								MIR1268 (139867 upstream) : GOLGA8DP (49137 downstream)																																			---	---	---	---
CYFIP1	23191	broad.mit.edu	37	15	22910485	22910485	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22910485delA	uc001yus.2	+						CYFIP1_uc001yut.2_Intron	NM_014608	NP_055423			cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)														---	---	---	---
CYFIP1	23191	broad.mit.edu	37	15	22933486	22933487	+	Intron	INS	-	TTT	TTT	rs56068008		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22933486_22933487insTTT	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423			cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)														---	---	---	---
SNORD116-1	100033413	broad.mit.edu	37	15	25295883	25295884	+	5'Flank	DEL	AC	-	-	rs141863581		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25295883_25295884delAC	uc001yxg.2	+							NR_003316				Homo sapiens small nucleolar RNA, C/D box 116-1 (SNORD116-1), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	26478449	26478449	+	IGR	DEL	T	-	-	rs111385489		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26478449delT								ATP10A (368132 upstream) : GABRB3 (310246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	27905919	27905920	+	IGR	INS	-	ACAC	ACAC	rs138727020	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27905919_27905920insACAC								GABRG3 (127785 upstream) : OCA2 (94105 downstream)																																			---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28071498	28071499	+	Intron	DEL	CA	-	-	rs10535869		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28071498_28071499delCA	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266			oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28115880	28115887	+	Intron	DEL	AGGGAGGG	-	-	rs140550470	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28115880_28115887delAGGGAGGG	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266			oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
Unknown	0	broad.mit.edu	37	15	39000104	39000105	+	IGR	INS	-	TTTTATA	TTTTATA	rs146834800	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39000104_39000105insTTTTATA								C15orf53 (7865 upstream) : C15orf54 (542780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	39642997	39642997	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39642997delT								C15orf54 (95949 upstream) : THBS1 (230283 downstream)																																			---	---	---	---
BUB1B	701	broad.mit.edu	37	15	40511929	40511930	+	Intron	INS	-	T	T	rs144209204	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40511929_40511930insT	uc001zkx.3	+						PAK6_uc010bbl.2_Intron|PAK6_uc010bbm.2_Intron	NM_001211	NP_001202			budding uninhibited by benzimidazoles 1 beta						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)				Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
DISP2	85455	broad.mit.edu	37	15	40650785	40650785	+	Intron	DEL	C	-	-	rs111246437		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40650785delC	uc001zlk.1	+							NM_033510	NP_277045			dispatched B						smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)														---	---	---	---
MAPKBP1	23005	broad.mit.edu	37	15	42118596	42118597	+	3'UTR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42118596_42118597delAC	uc001zok.3	+	32					MAPKBP1_uc001zoj.3_3'UTR|MAPKBP1_uc010bcj.2_3'UTR|MAPKBP1_uc010bci.2_3'UTR|MAPKBP1_uc010udb.1_3'UTR|MAPKBP1_uc010bck.2_3'UTR|MAPKBP1_uc010bcl.2_3'UTR|JMJD7-PLA2G4B_uc010bcm.1_5'Flank|JMJD7-PLA2G4B_uc001zom.2_5'Flank|JMJD7-PLA2G4B_uc001zon.2_5'Flank|JMJD7-PLA2G4B_uc001zoo.3_5'Flank|JMJD7-PLA2G4B_uc010bcn.2_5'Flank	NM_001128608	NP_001122080			mitogen-activated protein kinase binding protein											central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	44497346	44497361	+	IGR	DEL	GAAGGTAGGAAGGGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44497346_44497361delGAAGGTAGGAAGGGAA								FRMD5 (9917 upstream) : CASC4 (83568 downstream)																																			---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45434984	45434987	+	Intron	DEL	AGGG	-	-	rs67057268		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45434984_45434987delAGGG	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130			dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45756128	45756129	+	Intron	INS	-	CACCATCACCACCACCACCACCACCACCACACCATCAC	CACCATCACCACCACCACCACCACCACCACACCATCAC	rs71700299		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45756128_45756129insCACCATCACCACCACCACCACCACCACCACACCATCAC	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	46057689	46057689	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46057689delA								SQRDL (74211 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46282378	46282378	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46282378delA								SQRDL (298900 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	54065366	54065366	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54065366delA								WDR72 (13507 upstream) : UNC13C (239735 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54462206	54462206	+	Intron	DEL	A	-	-	rs71824682		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54462206delA	uc002ack.2	+							NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
NEDD4	4734	broad.mit.edu	37	15	56268825	56268826	+	Intron	DEL	AT	-	-	rs67005489		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56268825_56268826delAT	uc002adl.2	-							NM_006154	NP_006145			neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	58661864	58661865	+	IGR	INS	-	TGCA	TGCA	rs408684	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58661864_58661865insTGCA								ALDH1A2 (90402 upstream) : LIPC (40910 downstream)																																			---	---	---	---
RORA	6095	broad.mit.edu	37	15	60988574	60988574	+	Intron	DEL	A	-	-	rs34583179		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60988574delA	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	62644608	62644608	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62644608delA								C2CD4B (187126 upstream) : MGC15885 (284763 downstream)																																			---	---	---	---
SLC24A1	9187	broad.mit.edu	37	15	65905818	65905819	+	Intron	INS	-	TG	TG	rs141548935	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65905818_65905819insTG	uc010uje.1	+						SLC24A1_uc010ujd.1_Intron|C15orf44_uc002apd.2_5'Flank|C15orf44_uc010uix.1_5'Flank|C15orf44_uc010uiz.1_5'Flank|C15orf44_uc010uja.1_5'Flank|C15orf44_uc010ujb.1_5'Flank|C15orf44_uc002ape.3_5'Flank|C15orf44_uc010uiy.1_5'Flank|C15orf44_uc010ujc.1_5'Flank	NM_004727	NP_004718			solute carrier family 24						response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	66116436	66116436	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66116436delA								DENND4A (31805 upstream) : RAB11A (45360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	67154684	67154684	+	RNA	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67154684delG	uc002aqh.1	+	1		c.2044delG			uc002aqi.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp686F0429 (from clone DKFZp686F0429).																												OREG0023212	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
C15orf61	145853	broad.mit.edu	37	15	67817175	67817176	+	Intron	INS	-	T	T	rs34961516		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67817175_67817176insT	uc002aqs.2	+						uc002aqr.1_5'Flank	NM_001143936	NP_001137408			hypothetical protein LOC145853 precursor							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	68306645	68306646	+	IGR	INS	-	T	T	rs67584313		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68306645_68306646insT								LBXCOR1 (180471 upstream) : PIAS1 (39926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70135751	70135751	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70135751delG								C15orf50 (446 upstream) : TLE3 (204792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70678976	70678977	+	IGR	INS	-	AC	AC	rs140835916	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70678976_70678977insAC								TLE3 (288720 upstream) : UACA (267918 downstream)																																			---	---	---	---
CYP11A1	1583	broad.mit.edu	37	15	74630610	74630610	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74630610delT	uc002axt.2	-						CYP11A1_uc002axs.2_Intron|CYP11A1_uc010bjm.1_Intron|CYP11A1_uc010bjn.1_Intron|CYP11A1_uc010bjo.1_Intron	NM_000781	NP_000772			cytochrome P450, family 11, subfamily A,						C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)													---	---	---	---
SEMA7A	8482	broad.mit.edu	37	15	74721794	74721794	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74721794delT	uc002axv.2	-						SEMA7A_uc010ulk.1_Intron|SEMA7A_uc010ull.1_Intron	NM_003612	NP_003603			semaphorin 7A isoform 1 preproprotein						axon guidance|immune response|inflammatory response|integrin-mediated signaling pathway|positive regulation of axon extension|positive regulation of ERK1 and ERK2 cascade|positive regulation of macrophage cytokine production|regulation of inflammatory response	anchored to membrane|external side of plasma membrane	receptor activity			breast(1)|central_nervous_system(1)	2																		---	---	---	---
CLK3	1198	broad.mit.edu	37	15	74916771	74916771	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74916771delC	uc010uln.1	+						CLK3_uc002ayg.3_Intron|CLK3_uc002ayh.3_Intron|CLK3_uc002ayj.3_Intron|CLK3_uc002ayk.3_Intron|CLK3_uc002ayl.3_5'UTR	NM_001130028	NP_001123500			CDC-like kinase 3 isoform a							acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75281204	75281205	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75281204_75281205insT								RPP25 (31429 upstream) : SCAMP5 (6696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80921098	80921098	+	IGR	DEL	A	-	-	rs111340813		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80921098delA								ARNT2 (30826 upstream) : FAM108C1 (66554 downstream)																																			---	---	---	---
EFTUD1	79631	broad.mit.edu	37	15	82491672	82491673	+	Intron	INS	-	AG	AG	rs140710084	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82491672_82491673insAG	uc002bgt.1	-						EFTUD1_uc002bgu.1_Intron	NM_024580	NP_078856			elongation factor Tu GTP binding domain						mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1																		---	---	---	---
FSD2	123722	broad.mit.edu	37	15	83441201	83441201	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83441201delT	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123			fibronectin type III and SPRY domain containing											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	89962456	89962456	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89962456delC								LOC254559 (20738 upstream) : RHCG (52182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90002096	90002097	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90002096_90002097insA								LOC254559 (60378 upstream) : RHCG (12541 downstream)																																			---	---	---	---
IQGAP1	8826	broad.mit.edu	37	15	91014596	91014596	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91014596delA	uc002bpl.1	+							NM_003870	NP_003861			IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	98946169	98946170	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98946169_98946170delCT								ARRDC4 (429102 upstream) : FAM169B (34221 downstream)																																			---	---	---	---
FAM169B	283777	broad.mit.edu	37	15	98987370	98987370	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98987370delT	uc002buk.1	-							NM_182562	NP_872368			hypothetical protein LOC283777												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	99168207	99168208	+	IGR	INS	-	GT	GT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99168207_99168208insGT								FAM169B (110596 upstream) : IGF1R (24553 downstream)																																			---	---	---	---
WDR90	197335	broad.mit.edu	37	16	698507	698507	+	5'Flank	DEL	G	-	-	rs77971006		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:698507delG	uc002cii.1	+						WDR90_uc002cig.1_5'Flank|WDR90_uc002cih.1_5'Flank|WDR90_uc002cij.1_5'Flank	NM_145294	NP_660337			WD repeat domain 90											ovary(1)	1		Hepatocellular(780;0.0218)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	3005006	3005007	+	IGR	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3005006_3005007insC								FLYWCH1 (3798 upstream) : KREMEN2 (9210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	3010024	3010035	+	IGR	DEL	ACCTACCTACCT	-	-	rs111260640		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3010024_3010035delACCTACCTACCT								FLYWCH1 (8816 upstream) : KREMEN2 (4182 downstream)																																			---	---	---	---
ZNF174	7727	broad.mit.edu	37	16	3456839	3456839	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3456839delA	uc002cvc.2	+							NM_003450	NP_003441			zinc finger protein 174 isoform a						negative regulation of transcription from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|cytoplasm|nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0																		---	---	---	---
CLUAP1	23059	broad.mit.edu	37	16	3585043	3585044	+	Intron	INS	-	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3585043_3585044insG	uc002cvk.1	+						CLUAP1_uc002cvj.1_3'UTR|CLUAP1_uc002cvl.1_Intron|CLUAP1_uc002cvm.1_Intron|uc002cvn.1_5'Flank	NM_015041	NP_055856			clusterin associated protein 1 isoform 1							nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3																		---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6535407	6535407	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6535407delT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7716391	7716392	+	Intron	INS	-	AA	AA	rs147344433	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7716391_7716392insAA	uc002cys.2	+						A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	8400400	8400400	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8400400delT								A2BP1 (637060 upstream) : TMEM114 (219103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9605935	9605935	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9605935delG								C16orf72 (392390 upstream) : GRIN2A (241332 downstream)																																			---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	9882122	9882123	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9882122_9882123insT	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879			N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10060060	10060060	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10060060delT	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879			N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	10716143	10716144	+	IGR	INS	-	CA	CA	rs143540456	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10716143_10716144insCA								EMP2 (41604 upstream) : TEKT5 (5217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	12728442	12728443	+	IGR	INS	-	AA	AA	rs111613423		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12728442_12728443insAA								SNX29 (60297 upstream) : CPPED1 (25214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	13883725	13883726	+	IGR	INS	-	A	A	rs149485769	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13883725_13883726insA								SHISA9 (549453 upstream) : ERCC4 (130288 downstream)																																			---	---	---	---
MKL2	57496	broad.mit.edu	37	16	14332294	14332294	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14332294delA	uc010uza.1	+						MKL2_uc002dcg.2_Intron|MKL2_uc002dch.2_Intron|MKL2_uc010uzb.1_Intron	NM_014048	NP_054767			megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
PARN	5073	broad.mit.edu	37	16	14660173	14660174	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14660173_14660174delAC	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
BFAR	51283	broad.mit.edu	37	16	14756194	14756194	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14756194delT	uc002dco.2	+						BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_Intron	NM_016561	NP_057645			bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	15379535	15379538	+	IGR	DEL	GAAC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15379535_15379538delGAAC								PDXDC1 (146340 upstream) : MPV17L (110073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17641681	17641684	+	IGR	DEL	ATCT	-	-	rs66504203		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17641681_17641684delATCT								XYLT1 (76943 upstream) : NOMO2 (869499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18045183	18045183	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18045183delA								XYLT1 (480445 upstream) : NOMO2 (466000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18120452	18120459	+	IGR	DEL	CTTCCTTT	-	-	rs72073684	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18120452_18120459delCTTCCTTT								XYLT1 (555714 upstream) : NOMO2 (390724 downstream)																																			---	---	---	---
TMC5	79838	broad.mit.edu	37	16	19502034	19502053	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCC	-	-	rs71887982		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19502034_19502053delTTCCTTCCTTCCTTCCTTCC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dgd.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718			transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20211384	20211385	+	IGR	INS	-	AGAAAAAG	AGAAAAAG	rs142595033	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20211384_20211385insAGAAAAAG								GPR139 (126284 upstream) : GP2 (110427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20288522	20288523	+	IGR	INS	-	A	A	rs111783363		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20288522_20288523insA								GPR139 (203422 upstream) : GP2 (33289 downstream)																																			---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21097982	21097982	+	Intron	DEL	A	-	-	rs79427777	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21097982delA	uc010vbe.1	-							NM_017539	NP_060009			dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21609673	21609674	+	Intron	INS	-	A	A	rs72275120		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21609673_21609674insA	uc002diq.3	+						METTL9_uc002dje.2_5'Flank|METTL9_uc002djf.2_5'Flank					Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	23301429	23301429	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23301429delT								SCNN1G (73229 upstream) : SCNN1B (12162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	24250023	24250024	+	IGR	DEL	CT	-	-	rs57577043		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24250023_24250024delCT								PRKCB (18093 upstream) : CACNG3 (16852 downstream)																																			---	---	---	---
CACNG3	10368	broad.mit.edu	37	16	24303321	24303322	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24303321_24303322delGA	uc002dmf.2	+							NM_006539	NP_006530			voltage-dependent calcium channel gamma-3						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)														---	---	---	---
CACNG3	10368	broad.mit.edu	37	16	24326930	24326930	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24326930delT	uc002dmf.2	+							NM_006539	NP_006530			voltage-dependent calcium channel gamma-3						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	26816650	26816650	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26816650delT								HS3ST4 (667642 upstream) : C16orf82 (261569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26939315	26939318	+	IGR	DEL	GAAA	-	-	rs10574808	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26939315_26939318delGAAA								HS3ST4 (790307 upstream) : C16orf82 (138901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26967675	26967675	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26967675delA								HS3ST4 (818667 upstream) : C16orf82 (110544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27137916	27137916	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27137916delG								C16orf82 (57430 upstream) : JMJD5 (76891 downstream)																																			---	---	---	---
KIAA0556	23247	broad.mit.edu	37	16	27599242	27599243	+	Intron	INS	-	T	T	rs111346127		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27599242_27599243insT	uc002dow.2	+							NM_015202	NP_056017			hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8																		---	---	---	---
CLN3	1201	broad.mit.edu	37	16	28492742	28492743	+	Intron	INS	-	ACAT	ACAT	rs144366314	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28492742_28492743insACAT	uc002dpo.2	-						uc010vct.1_Intron|CLN3_uc002dpl.2_Intron|CLN3_uc010vcu.1_Intron|CLN3_uc002dpn.2_Intron|CLN3_uc002dpm.2_Intron|CLN3_uc010vcv.1_Intron|CLN3_uc010byd.2_Intron|CLN3_uc002dpp.2_Intron|CLN3_uc002dpt.1_Intron|CLN3_uc002dpq.1_Intron|CLN3_uc010bye.1_Intron|CLN3_uc002dpr.1_Intron|CLN3_uc010byf.1_Intron|CLN3_uc002dps.1_Intron|CLN3_uc002dpu.1_Intron	NM_000086	NP_000077			ceroid-lipofuscinosis, neuronal 3						amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0																		---	---	---	---
ITGAM	3684	broad.mit.edu	37	16	31340222	31340223	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31340222_31340223delTG	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623			integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32409475	32409475	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32409475delT								HERC2P4 (245601 upstream) : TP53TG3B (275366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32522545	32522545	+	IGR	DEL	C	-	-	rs76051919		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32522545delC								HERC2P4 (358671 upstream) : TP53TG3B (162296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33041000	33041001	+	IGR	DEL	AT	-	-	rs79665710		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33041000_33041001delAT								SLC6A10P (144537 upstream) : MIR1826 (924507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33549601	33549610	+	IGR	DEL	TATATGTGTG	-	-	rs28410553		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33549601_33549610delTATATGTGTG								SLC6A10P (653138 upstream) : MIR1826 (415898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33976289	33976289	+	IGR	DEL	T	-	-	rs147837943		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33976289delT								MIR1826 (10697 upstream) : UBE2MP1 (427513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46418105	46418106	+	IGR	INS	-	TCT	TCT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46418105_46418106insTCT								None (None upstream) : ANKRD26P1 (85143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46459519	46459519	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46459519delC								None (None upstream) : ANKRD26P1 (43730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51906894	51906894	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51906894delA								SALL1 (721711 upstream) : TOX3 (565024 downstream)																																			---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57999028	57999031	+	Intron	DEL	ACTC	-	-	rs138498015		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57999028_57999031delACTC	uc002emt.2	-						CNGB1_uc010cdh.2_Intron|CNGB1_uc002emu.2_Intron	NM_001297	NP_001288			cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58085389	58085390	+	IGR	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58085389_58085390delGA								MMP15 (4587 upstream) : C16orf80 (62107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59728532	59728532	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59728532delG								GOT2 (960286 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66386394	66386422	+	IGR	DEL	TTACATTACACACATTCTTACCTCCCTCT	-	-	rs11276305		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66386394_66386422delTTACATTACACACATTCTTACCTCCCTCT								LOC283867 (776191 upstream) : CDH5 (14103 downstream)																																			---	---	---	---
CDH5	1003	broad.mit.edu	37	16	66414782	66414782	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66414782delA	uc002eom.3	+						CDH5_uc002eon.1_Intron	NM_001795	NP_001786			cadherin 5, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)														---	---	---	---
CBFB	865	broad.mit.edu	37	16	67103273	67103273	+	Intron	DEL	A	-	-	rs76979224		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67103273delA	uc002era.2	+						CBFB_uc002erb.2_Intron|CBFB_uc010vja.1_Intron	NM_001755	NP_001746			core-binding factor, beta subunit isoform 2						transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)				T	MYH11	AML								---	---	---	---
CTCF	10664	broad.mit.edu	37	16	67607161	67607161	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67607161delA	uc002etl.2	+						CTCF_uc010cek.2_Intron	NM_006565	NP_006556			CCCTC-binding factor						chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	68559221	68559222	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68559221_68559222insA								SMPD3 (76812 upstream) : ZFP90 (4826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	70673521	70673522	+	IGR	INS	-	GCTTGGGCTTGA	GCTTGGGCTTGA	rs140660971	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70673521_70673522insGCTTGGGCTTGA								SF3B3 (61951 upstream) : IL34 (6946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	72381052	72381055	+	IGR	DEL	ACAG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72381052_72381055delACAG								PMFBP1 (174703 upstream) : ZFHX3 (435733 downstream)																																			---	---	---	---
CFDP1	10428	broad.mit.edu	37	16	75340776	75340777	+	Intron	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75340776_75340777delCA	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron	NM_006324	NP_006315			craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	79731752	79731755	+	IGR	DEL	TTTC	-	-	rs140405595		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79731752_79731755delTTTC								MAF (97130 upstream) : DYNLRB2 (843099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	82293762	82293765	+	IGR	DEL	CCTG	-	-	rs146559305		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82293762_82293765delCCTG								MPHOSPH6 (89933 upstream) : CDH13 (366813 downstream)																																			---	---	---	---
FOXL1	2300	broad.mit.edu	37	16	86610831	86610832	+	5'Flank	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86610831_86610832delTG	uc002fjr.2	+							NM_005250	NP_005241			forkhead box L1						brain development|camera-type eye development|cartilage development|embryo development|forelimb morphogenesis|heart development|organ morphogenesis|pattern specification process|proteoglycan biosynthetic process|regulation of sequence-specific DNA binding transcription factor activity|regulation of Wnt receptor signaling pathway|visceral mesoderm-endoderm interaction involved in midgut development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	88278466	88278466	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88278466delA								BANP (167543 upstream) : ZNF469 (215413 downstream)																																			---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89679869	89679882	+	Intron	DEL	CTCTCTCCCTCCTG	-	-	rs111857923		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89679869_89679882delCTCTCTCCCTCCTG	uc010cin.2	+							NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89701363	89701363	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89701363delT	uc010cin.2	+						DPEP1_uc002fnr.3_Intron|DPEP1_uc002fns.3_Intron	NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	164259	164259	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:164259delC	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
TUSC5	286753	broad.mit.edu	37	17	1185356	1185357	+	Intron	INS	-	TATACACATA	TATACACATA	rs147011086	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1185356_1185357insTATACACATA	uc002fsi.1	+							NM_172367	NP_758955			LOST1						response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
TUSC5	286753	broad.mit.edu	37	17	1191559	1191559	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1191559delC	uc002fsi.1	+							NM_172367	NP_758955			LOST1						response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	10339275	10339276	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10339275_10339276delTG	uc002gml.1	+											Homo sapiens cDNA FLJ40181 fis, clone TESTI2018178.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	11027169	11027170	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11027169_11027170delAC								PIRT (285751 upstream) : SHISA6 (117570 downstream)																																			---	---	---	---
SHISA6	388336	broad.mit.edu	37	17	11356260	11356260	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11356260delT	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269			shisa homolog 6							integral to membrane				breast(1)	1																		---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11836692	11836692	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11836692delT	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12547837	12547838	+	IGR	INS	-	ATG	ATG	rs142958190	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12547837_12547838insATG								MAP2K4 (500787 upstream) : MYOCD (21369 downstream)																																			---	---	---	---
HS3ST3A1	9955	broad.mit.edu	37	17	13445647	13445647	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13445647delA	uc002gob.1	-							NM_006042	NP_006033			heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	15708330	15708331	+	IGR	INS	-	TTCC	TTCC			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15708330_15708331insTTCC								MEIS3P1 (15313 upstream) : ADORA2B (139900 downstream)																																			---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16068784	16068787	+	Intron	DEL	AAAG	-	-	rs113666369		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16068784_16068787delAAAG	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	16485023	16485024	+	IGR	DEL	TG	-	-	rs112289802		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16485023_16485024delTG								ZNF287 (12503 upstream) : ZNF624 (39024 downstream)																																			---	---	---	---
CCDC144A	9720	broad.mit.edu	37	17	16649585	16649585	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16649585delC	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510			coiled-coil domain containing 144A												0																		---	---	---	---
FLCN	201163	broad.mit.edu	37	17	17125133	17125133	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17125133delG	uc002gra.3	-						PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_Intron	NM_144997	NP_659434			folliculin isoform 1						regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3														Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	17	17363490	17363492	+	IGR	DEL	CAC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17363490_17363492delCAC								NT5M (112515 upstream) : MED9 (16808 downstream)																																			---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17903672	17903673	+	Intron	DEL	GT	-	-	rs113487468		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17903672_17903673delGT	uc010vxd.1	+						LRRC48_uc002gsa.2_Intron|LRRC48_uc010vxc.1_Intron|LRRC48_uc002gsb.2_Intron|LRRC48_uc010vxe.1_Intron	NM_001130090	NP_001123562			leucine rich repeat containing 48 isoform a							cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
AKAP10	11216	broad.mit.edu	37	17	19851652	19851654	+	Intron	DEL	AAG	-	-	rs71847238		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19851652_19851654delAAG	uc002gwo.2	-						AKAP10_uc002gwp.1_Intron|AKAP10_uc010cqw.1_Intron|AKAP10_uc010vze.1_Intron	NM_007202	NP_009133			A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)																	---	---	---	---
CYTSB	92521	broad.mit.edu	37	17	20112875	20112880	+	Intron	DEL	TTTCTT	-	-	rs10594977		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20112875_20112880delTTTCTT	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725			spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0																		---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21210484	21210485	+	Intron	INS	-	A	A	rs143826793		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21210484_21210485insA	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21231335	21231336	+	IGR	INS	-	G	G	rs59433745		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21231335_21231336insG								MAP2K3 (12786 upstream) : KCNJ12 (48363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21235599	21235600	+	IGR	INS	-	A	A	rs138252465		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21235599_21235600insA								MAP2K3 (17050 upstream) : KCNJ12 (44099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21338046	21338047	+	IGR	INS	-	AAACAAAC	AAACAAAC	rs144134558	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21338046_21338047insAAACAAAC								KCNJ12 (14867 upstream) : C17orf51 (93525 downstream)																																			---	---	---	---
C17orf51	339263	broad.mit.edu	37	17	21473120	21473121	+	Intron	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21473120_21473121delGT	uc002gyx.1	-											Homo sapiens cDNA FLJ12977 fis, clone NT2RP2006261.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	25318216	25318216	+	IGR	DEL	T	-	-	rs111803514		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25318216delT								None (None upstream) : WSB1 (302890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25328379	25328379	+	IGR	DEL	A	-	-	rs113272930		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25328379delA								None (None upstream) : WSB1 (292727 downstream)																																			---	---	---	---
GOSR1	9527	broad.mit.edu	37	17	28849612	28849612	+	3'UTR	DEL	A	-	-	rs76806222		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28849612delA	uc002hfe.2	+	9					GOSR1_uc002hfd.2_3'UTR|GOSR1_uc002hff.2_3'UTR	NM_004871	NP_004862			golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	32560352	32560353	+	IGR	INS	-	AGAA	AGAA	rs140694482	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32560352_32560353insAGAA								ACCN1 (76527 upstream) : CCL2 (21943 downstream)																																			---	---	---	---
TMEM132E	124842	broad.mit.edu	37	17	32924799	32924800	+	Intron	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32924799_32924800insC	uc002hif.2	+							NM_207313	NP_997196			transmembrane protein 132E precursor							integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	33783078	33783078	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33783078delA								SLFN13 (7222 upstream) : SLFN12L (18848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	36389849	36389849	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36389849delA	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	37180079	37180079	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37180079delA								FBXO47 (56424 upstream) : PLXDC1 (39477 downstream)																																			---	---	---	---
STARD3	10948	broad.mit.edu	37	17	37808410	37808410	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37808410delG	uc002hsd.2	+						STARD3_uc010weg.1_Intron|STARD3_uc010weh.1_Intron|STARD3_uc002hse.2_Intron|STARD3_uc010wei.1_Intron|STARD3_uc002hsf.2_5'Flank	NM_006804	NP_006795			StAR-related lipid transfer (START) domain						cholesterol metabolic process|mitochondrial transport|steroid biosynthetic process	integral to membrane|late endosome membrane	cholesterol binding|cholesterol transporter activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)															---	---	---	---
RARA	5914	broad.mit.edu	37	17	38472742	38472742	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38472742delT	uc002huk.1	+						RARA_uc002hul.3_5'Flank|RARA_uc010wfe.1_5'Flank	NM_000964	NP_000955			retinoic acid receptor, alpha isoform 1						apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								---	---	---	---
TOP2A	7153	broad.mit.edu	37	17	38568288	38568289	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38568288_38568289insA	uc002huq.2	-						TOP2A_uc002hur.1_5'Flank	NM_001067	NP_001058			DNA topoisomerase II, alpha isozyme						apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	39063596	39063597	+	IGR	INS	-	CCTT	CCTT	rs75186134	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39063596_39063597insCCTT								KRT20 (22117 upstream) : KRT23 (15355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	39099090	39099091	+	IGR	INS	-	TCT	TCT	rs143295826	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39099090_39099091insTCT								KRT23 (5254 upstream) : KRT39 (15578 downstream)																																			---	---	---	---
KRTAP17-1	83902	broad.mit.edu	37	17	39473762	39473763	+	5'Flank	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39473762_39473763insT	uc002hwj.2	-							NM_031964	NP_114170			keratin associated protein 17-1							intermediate filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	43260214	43260227	+	IGR	DEL	ATGTGTGTGTGTGT	-	-	rs72501093		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43260214_43260227delATGTGTGTGTGTGT								HEXIM2 (12808 upstream) : FMNL1 (39065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	43669171	43669171	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43669171delA								LRRC37A4 (73655 upstream) : LOC644172 (8320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	44352433	44352433	+	IGR	DEL	T	-	-	rs113600189		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44352433delT								KIAA1267 (49716 upstream) : ARL17B (11430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	44445822	44445823	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44445822_44445823delCA								ARL17A (6659 upstream) : LRRC37A2 (144253 downstream)																																			---	---	---	---
CA10	56934	broad.mit.edu	37	17	50238801	50238802	+	5'Flank	INS	-	C	C	rs139399336	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50238801_50238802insC	uc002itw.3	-						CA10_uc002itx.3_5'Flank|CA10_uc002ity.3_5'Flank|CA10_uc002itz.2_5'Flank	NM_020178	NP_064563			carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	54035614	54035623	+	IGR	DEL	TGTGTGTGTA	-	-	rs67639553		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54035614_54035623delTGTGTGTGTA								PCTP (180867 upstream) : ANKFN1 (195213 downstream)																																			---	---	---	---
EFCAB3	146779	broad.mit.edu	37	17	60454404	60454405	+	Intron	DEL	AG	-	-	rs111680352		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60454404_60454405delAG	uc010wpc.1	+							NM_001144933	NP_001138405			EF-hand calcium binding domain 3 isoform a								calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	62696341	62696342	+	IGR	INS	-	CTTT	CTTT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62696341_62696342insCTTT								SMURF2 (37955 upstream) : LOC146880 (49439 downstream)																																			---	---	---	---
AXIN2	8313	broad.mit.edu	37	17	63619617	63619617	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63619617delG	uc010den.1	-							NM_004655	NP_004646			axin 2						cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2														Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	64103902	64103903	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64103902_64103903insA	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64508576	64508577	+	Intron	DEL	GT	-	-	rs71826486		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64508576_64508577delGT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	65272158	65272159	+	IGR	INS	-	T	T	rs142995470	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65272158_65272159insT								HELZ (30839 upstream) : PSMD12 (64461 downstream)																																			---	---	---	---
ABCA6	23460	broad.mit.edu	37	17	67141007	67141007	+	5'Flank	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67141007delT	uc002jhw.1	-						ABCA6_uc002jhy.2_5'Flank	NM_080284	NP_525023			ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	67358091	67358098	+	IGR	DEL	CCTTCCTT	-	-	rs34045164		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67358091_67358098delCCTTCCTT								ABCA5 (34768 upstream) : MAP2K6 (52740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70512410	70512410	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70512410delC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
QRICH2	84074	broad.mit.edu	37	17	74280901	74280902	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74280901_74280902insA	uc002jrd.1	-						QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510			glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
RHBDF2	79651	broad.mit.edu	37	17	74480666	74480666	+	Intron	DEL	T	-	-	rs35165094		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74480666delT	uc002jrq.1	-						RHBDF2_uc002jrp.1_Intron|RHBDF2_uc002jrr.1_5'Flank|RHBDF2_uc010wtf.1_Intron	NM_024599	NP_078875			rhomboid, veinlet-like 6 isoform 1						negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0																		---	---	---	---
BIRC5	332	broad.mit.edu	37	17	76208300	76208300	+	5'Flank	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76208300delA	uc002jvg.2	+						BIRC5_uc002jvc.2_5'Flank|BIRC5_uc002jve.1_5'Flank|BIRC5_uc002jvd.1_5'Flank|BIRC5_uc010dhk.1_5'Flank|BIRC5_uc010dhl.1_5'Flank|BIRC5_uc002jvf.2_5'Flank|BIRC5_uc002jvh.2_5'Flank|BIRC5_uc002jvi.2_5'Flank	NM_001168	NP_001159			baculoviral IAP repeat-containing protein 5						anti-apoptosis|apoptosis|cell division|chromosome segregation|cytokinesis|establishment of chromosome localization|G2/M transition of mitotic cell cycle|mitosis|mitotic prometaphase|positive regulation of exit from mitosis|positive regulation of mitotic cell cycle|protein complex localization|spindle checkpoint	centriole|chromosome passenger complex|chromosome, centromeric region|cytoplasm|cytoplasmic microtubule|cytosol|interphase microtubule organizing center|midbody|midbody|nuclear chromosome|spindle|spindle microtubule	caspase inhibitor activity|chaperone binding|cobalt ion binding|cofactor binding|cysteine-type endopeptidase inhibitor activity|metal ion binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|Ran GTPase binding|zinc ion binding			kidney(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)															---	---	---	---
C1QTNF1	114897	broad.mit.edu	37	17	77039816	77039817	+	Intron	INS	-	GT	GT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77039816_77039817insGT	uc002jwp.2	+						C1QTNF1_uc002jwq.2_Intron|C1QTNF1_uc002jwr.3_Intron|C1QTNF1_uc002jws.2_Intron|C1QTNF1_uc002jwt.2_Frame_Shift_Ins_p.C20fs	NM_030968	NP_112230			C1q and tumor necrosis factor related protein 1							collagen				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)															---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77292878	77292879	+	Intron	INS	-	TCT	TCT	rs148773857	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77292878_77292879insTCT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78674577	78674579	+	Intron	DEL	GAT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674577_78674579delGAT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
NPLOC4	55666	broad.mit.edu	37	17	79541903	79541904	+	Intron	DEL	AC	-	-	rs71924317		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79541903_79541904delAC	uc002kat.3	-						NPLOC4_uc002kau.3_Intron|NPLOC4_uc010wur.1_Intron	NM_017921	NP_060391			nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)															---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80729300	80729300	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80729300delT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	826363	826364	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:826363_826364insA								YES1 (13821 upstream) : ADCYAP1 (78580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	4956889	4956889	+	IGR	DEL	A	-	-	rs35463684		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4956889delA								DLGAP1 (501623 upstream) : LOC642597 (186783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5902739	5902740	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5902739_5902740delAC								TMEM200C (10636 upstream) : L3MBTL4 (51966 downstream)																																			---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8126883	8126883	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8126883delG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	8424977	8424977	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8424977delC								PTPRM (18119 upstream) : RAB12 (184458 downstream)																																			---	---	---	---
APCDD1	147495	broad.mit.edu	37	18	10459596	10459597	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10459596_10459597insA	uc002kom.3	+							NM_153000	NP_694545			adenomatosis polyposis coli down-regulated 1						hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)														---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10747971	10747971	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10747971delT	uc002kos.1	-						FAM38B_uc002kot.1_Intron					SubName: Full=cDNA FLJ45725 fis, clone HCHON2009766; Flags: Fragment;							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
SLMO1	10650	broad.mit.edu	37	18	12430502	12430502	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12430502delG	uc002kra.2	+						SLMO1_uc010wzu.1_Intron|SLMO1_uc010wzv.1_Intron	NM_001142405	NP_001135877			slowmo homolog 1 isoform 1												0																		---	---	---	---
CEP76	79959	broad.mit.edu	37	18	12683393	12683393	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12683393delA	uc002kri.2	-						PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Intron|CEP76_uc010wzz.1_Intron|CEP76_uc010xaa.1_Intron	NM_024899	NP_079175			centrosomal protein 76kDa						G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0																		---	---	---	---
PTPN2	5771	broad.mit.edu	37	18	12867844	12867848	+	Intron	DEL	TTTCT	-	-	rs113414084		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12867844_12867848delTTTCT	uc002krp.2	-						PTPN2_uc002krl.2_Intron|PTPN2_uc002krn.2_Intron|PTPN2_uc002kro.2_Intron|PTPN2_uc002krm.2_Intron	NM_002828	NP_002819			protein tyrosine phosphatase, non-receptor type						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding			skin(2)	2		Lung NSC(161;8.94e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	13190946	13190947	+	IGR	INS	-	GTGT	GTGT	rs150552136	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13190946_13190947insGTGT								CEP192 (65897 upstream) : C18orf1 (27839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14581391	14581392	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14581391_14581392delCA								POTEC (37792 upstream) : ANKRD30B (166847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15299281	15299282	+	IGR	DEL	CA	-	-	rs113248324		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15299281_15299282delCA								ANKRD30B (446544 upstream) : LOC644669 (14273 downstream)																																			---	---	---	---
GREB1L	80000	broad.mit.edu	37	18	19056708	19056708	+	Intron	DEL	T	-	-	rs111922743		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19056708delT	uc010xam.1	+						GREB1L_uc010dlp.1_Intron|GREB1L_uc010xan.1_Intron|GREB1L_uc010dlr.1_Intron	NM_001142966	NP_001136438			growth regulation by estrogen in breast							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	20059782	20059782	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20059782delC								CTAGE1 (61904 upstream) : RBBP8 (453513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20676791	20676791	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20676791delG								RBBP8 (70346 upstream) : CABLES1 (37737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20682774	20682775	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20682774_20682775insT								RBBP8 (76329 upstream) : CABLES1 (31753 downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21608109	21608109	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21608109delA	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
OSBPL1A	114876	broad.mit.edu	37	18	21792038	21792038	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21792038delT	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron|OSBPL1A_uc002kvf.3_Intron	NM_080597	NP_542164			oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---
TTR	7276	broad.mit.edu	37	18	29174107	29174107	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29174107delA	uc002kwx.3	+							NM_000371	NP_000362			transthyretin precursor						transport	cytoplasm	hormone activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
C18orf21	83608	broad.mit.edu	37	18	33557185	33557185	+	Intron	DEL	A	-	-	rs78863701		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33557185delA	uc002kzc.2	+						C18orf21_uc002kzd.2_Intron	NM_031446	NP_113634			chromosome 18 open reading frame 21												0																		---	---	---	---
SLC39A6	25800	broad.mit.edu	37	18	33703897	33703897	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33703897delA	uc010dmy.2	-						SLC39A6_uc002kzj.2_Intron	NM_012319	NP_036451			solute carrier family 39 (zinc transporter),							integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2																		---	---	---	---
LOC647946	647946	broad.mit.edu	37	18	37074719	37074723	+	Intron	DEL	GTCAT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37074719_37074723delGTCAT	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	41693086	41693087	+	IGR	INS	-	A	A	rs78961512		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41693086_41693087insA								SYT4 (835471 upstream) : SETBP1 (567051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	44904278	44904278	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44904278delT	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	44929196	44929197	+	Intron	INS	-	T	T	rs149508513	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44929196_44929197insT	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	45293739	45293740	+	IGR	INS	-	A	A	rs2852944		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45293739_45293740insA								IER3IP1 (590994 upstream) : SMAD2 (65727 downstream)																																			---	---	---	---
ZBTB7C	201501	broad.mit.edu	37	18	45633673	45633684	+	Intron	DEL	GAGGAGGGATGG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45633673_45633684delGAGGAGGGATGG	uc010dnv.2	-						ZBTB7C_uc002ldb.2_Intron|ZBTB7C_uc010dnu.2_Intron|ZBTB7C_uc010dnw.2_Intron|ZBTB7C_uc010dnx.1_Intron|ZBTB7C_uc010dny.1_Intron|ZBTB7C_uc010dnz.1_Intron|ZBTB7C_uc010dob.1_Intron|ZBTB7C_uc010doc.1_Intron|ZBTB7C_uc010dod.1_Intron|ZBTB7C_uc010doe.1_Intron|ZBTB7C_uc010dof.1_Intron|ZBTB7C_uc010dog.1_Intron|ZBTB7C_uc010doh.1_Intron|ZBTB7C_uc010doi.1_Intron|ZBTB7C_uc010doj.1_Intron|ZBTB7C_uc010dok.1_Intron|ZBTB7C_uc010dol.1_Intron|ZBTB7C_uc010doa.1_Intron|ZBTB7C_uc010don.1_Intron|ZBTB7C_uc010doo.1_Intron|ZBTB7C_uc010dop.1_Intron|ZBTB7C_uc010doq.1_Intron|ZBTB7C_uc010dor.1_Intron|ZBTB7C_uc010dos.1_Intron|ZBTB7C_uc010dot.1_Intron|ZBTB7C_uc010dou.1_Intron|ZBTB7C_uc010dom.1_Intron	NM_001039360	NP_001034449			zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	47194014	47194015	+	IGR	DEL	TT	-	-	rs34014717		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47194014_47194015delTT								LIPG (74738 upstream) : ACAA2 (115860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	47964171	47964172	+	IGR	INS	-	T	T	rs145646486	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47964171_47964172insT								SKA1 (43637 upstream) : MAPK4 (122312 downstream)																																			---	---	---	---
MAPK4	5596	broad.mit.edu	37	18	48137872	48137872	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48137872delA	uc002lev.2	+						MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Intron	NM_002747	NP_002738			mitogen-activated protein kinase 4						cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	48695608	48695608	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48695608delA								SMAD4 (84199 upstream) : MEX3C (5314 downstream)																																			---	---	---	---
DCC	1630	broad.mit.edu	37	18	50245234	50245234	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50245234delT	uc002lfe.1	+							NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50561531	50561532	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50561531_50561532delTG	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	51387926	51387933	+	IGR	DEL	GGAGGGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51387926_51387933delGGAGGGAA								DCC (330144 upstream) : MBD2 (292642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	52878449	52878449	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52878449delA								CCDC68 (251710 upstream) : TCF4 (11113 downstream)																																			---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	55932253	55932253	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55932253delT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc010dpl.1_Intron|NEDD4L_uc002lhg.2_Intron|NEDD4L_uc002lhh.2_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	57855446	57855447	+	IGR	INS	-	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57855446_57855447insG								PMAIP1 (283908 upstream) : MC4R (183117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	60708463	60708464	+	IGR	INS	-	AAAG	AAAG	rs142000855	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60708463_60708464insAAAG								PHLPP1 (60798 upstream) : BCL2 (82115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64544703	64544704	+	IGR	INS	-	GAAC	GAAC	rs147998320	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64544703_64544704insGAAC								CDH19 (273487 upstream) : DSEL (629115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66165496	66165499	+	IGR	DEL	ATAA	-	-	rs36009088		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66165496_66165499delATAA								DSEL (981529 upstream) : TMX3 (175428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70231364	70231365	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70231364_70231365delAC								CBLN2 (19641 upstream) : NETO1 (178186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73931135	73931136	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73931135_73931136delTG								C18orf62 (791546 upstream) : ZNF516 (140483 downstream)																																			---	---	---	---
CTDP1	9150	broad.mit.edu	37	18	77511774	77511775	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77511774_77511775delTG	uc002lnh.1	+						CTDP1_uc002lni.1_Intron|CTDP1_uc010drd.1_Intron	NM_004715	NP_004706			CTD (carboxy-terminal domain, RNA polymerase II,						positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)												OREG0025083	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	1280340	1280340	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1280340delT								C19orf24 (1098 upstream) : EFNA2 (5828 downstream)																																	OREG0025115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FAM108A1	81926	broad.mit.edu	37	19	1881526	1881528	+	In_Frame_Del	DEL	AGA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1881526_1881528delAGA	uc002lug.2	-	2	444_446	c.38_40delTCT	c.(37-42)TTCTGC>TGC	p.F13del	FAM108A1_uc002lud.2_In_Frame_Del_p.F13del|FAM108A1_uc002lue.2_In_Frame_Del_p.F13del|FAM108A1_uc002luf.2_In_Frame_Del_p.F13del	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2	13						extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2604542	2604545	+	Intron	DEL	GGAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2604542_2604545delGGAA	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF77	58492	broad.mit.edu	37	19	2939028	2939062	+	Intron	DEL	CCTTACCCAAGGAGGCAGTGAGGGAATGACGCCAT	-	-	rs140348764	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2939028_2939062delCCTTACCCAAGGAGGCAGTGAGGGAATGACGCCAT	uc002lws.3	-							NM_021217	NP_067040			zinc finger protein 77						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	3990926	3990926	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3990926delT								EEF2 (5465 upstream) : PIAS4 (16823 downstream)																																			---	---	---	---
PLIN4	729359	broad.mit.edu	37	19	4510389	4510389	+	Intron	DEL	C	-	-	rs56906779		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4510389delC	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869			plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0																		---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5068104	5068104	+	Intron	DEL	T	-	-	rs113226929		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5068104delT	uc002mbq.3	+						KDM4B_uc010xil.1_Intron|KDM4B_uc010xim.1_Intron|KDM4B_uc002mbr.3_5'Flank	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
RFX2	5990	broad.mit.edu	37	19	6070180	6070184	+	Intron	DEL	GAATG	-	-	rs111363773	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6070180_6070184delGAATG	uc002meb.2	-						RFX2_uc002mec.2_Intron|RFX2_uc010xiy.1_Intron	NM_000635	NP_000626			regulatory factor X2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
C3	718	broad.mit.edu	37	19	6688536	6688536	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6688536delT	uc002mfm.2	-						C3_uc002mfl.2_Intron	NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	7429288	7429289	+	IGR	INS	-	AGGC	AGGC	rs11260009	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7429288_7429289insAGGC								INSR (135277 upstream) : ARHGEF18 (18431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	7848006	7848007	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7848006_7848007insA								CLEC4M (13516 upstream) : CLEC4GP1 (4363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	7949345	7949348	+	IGR	DEL	AAGG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7949345_7949348delAAGG								EVI5L (19484 upstream) : LRRC8E (4042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9884088	9884089	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9884088_9884089delGT								ZNF846 (4678 upstream) : FBXL12 (36856 downstream)																																			---	---	---	---
DOCK6	57572	broad.mit.edu	37	19	11369434	11369435	+	Intron	DEL	TC	-	-	rs148345584		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11369434_11369435delTC	uc002mqs.3	-							NM_020812	NP_065863			dedicator of cytokinesis 6						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
TNPO2	30000	broad.mit.edu	37	19	12836243	12836243	+	5'Flank	DEL	T	-	-	rs35015172		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12836243delT	uc002muo.2	-						TNPO2_uc002mur.2_5'Flank	NM_001136196	NP_001129668			transportin 2 (importin 3, karyopherin beta 2b)						intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1																		---	---	---	---
C19orf43	79002	broad.mit.edu	37	19	12842365	12842365	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12842365delG	uc002muu.2	-							NM_024038	NP_076943			hypothetical protein MGC2803												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	13685623	13685623	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13685623delT								CACNA1A (68349 upstream) : CCDC130 (156951 downstream)																																			---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15107371	15107373	+	Intron	DEL	TTG	-	-	rs71168537		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15107371_15107373delTTG	uc010xod.1	-											SubName: Full=cDNA FLJ53385, highly similar to Excitatory amino acid transporter 4;						synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
NOTCH3	4854	broad.mit.edu	37	19	15273579	15273584	+	Intron	DEL	TGTGTT	-	-	rs3071617	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15273579_15273584delTGTGTT	uc002nan.2	-							NM_000435	NP_000426			Notch homolog 3 precursor						Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)															---	---	---	---
WIZ	58525	broad.mit.edu	37	19	15548806	15548807	+	Intron	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15548806_15548807delAC	uc002nbb.3	-							NM_021241	NP_067064			widely-interspaced zinc finger motifs							nucleus	zinc ion binding				0																OREG0025321	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EPS15L1	58513	broad.mit.edu	37	19	16577961	16577962	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16577961_16577962insT	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron|EPS15L1_uc002nec.1_Intron	NM_021235	NP_067058			epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5																		---	---	---	---
FCHO1	23149	broad.mit.edu	37	19	17874854	17874854	+	Intron	DEL	T	-	-	rs71687109		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17874854delT	uc010ebb.2	+						FCHO1_uc002nhg.3_Intron|FCHO1_uc002nhh.2_Intron|FCHO1_uc010xpw.1_Intron|FCHO1_uc010ebc.1_Intron	NM_001161358	NP_001154830			FCH domain only 1 isoform b											breast(1)	1																		---	---	---	---
IL12RB1	3594	broad.mit.edu	37	19	18195471	18195474	+	Intron	DEL	CCAT	-	-	rs145718142		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18195471_18195474delCCAT	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526			interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	18406362	18406362	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18406362delT								JUND (13930 upstream) : LSM4 (11356 downstream)																																			---	---	---	---
ZNF826	664701	broad.mit.edu	37	19	20594818	20594818	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20594818delT	uc010ecm.2	-						ZNF826_uc002now.1_Intron|ZNF826_uc010ecl.1_Intron|ZNF826_uc010xrf.1_Intron	NM_001039884	NP_001034973			zinc finger protein 826												0																		---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22193773	22193774	+	5'Flank	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22193773_22193774insC	uc002nqp.2	-						ZNF208_uc002nqo.1_5'Flank|ZNF208_uc002nqq.2_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	23649767	23649767	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23649767delC								ZNF91 (71498 upstream) : ZNF675 (185942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24542190	24542190	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24542190delT								LOC100101266 (195941 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27882590	27882590	+	IGR	DEL	A	-	-	rs111531532		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27882590delA								None (None upstream) : LOC148189 (398812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28572762	28572765	+	IGR	DEL	GAGA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28572762_28572765delGAGA								LOC148189 (287914 upstream) : LOC148145 (883275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33810709	33810709	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33810709delC								LOC80054 (14747 upstream) : CEBPG (53900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34034612	34034613	+	IGR	INS	-	CTTC	CTTC	rs143876506	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34034612_34034613insCTTC								PEPD (21811 upstream) : CHST8 (78248 downstream)																																			---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34237731	34237731	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34237731delT	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_Intron	NM_001127895	NP_001121367			carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34367203	34367203	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34367203delA								KCTD15 (60538 upstream) : LSM14A (296149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34477362	34477363	+	IGR	INS	-	T	T	rs147264087	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34477362_34477363insT								KCTD15 (170697 upstream) : LSM14A (185989 downstream)																																			---	---	---	---
PRODH2	58510	broad.mit.edu	37	19	36294646	36294647	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36294646_36294647insA	uc002obx.1	-							NM_021232	NP_067055			kidney and liver proline oxidase 1						glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
ZFP14	57677	broad.mit.edu	37	19	36862888	36862889	+	Intron	INS	-	GGAG	GGAG	rs139062759	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36862888_36862889insGGAG	uc010eex.1	-							NM_020917	NP_065968			zinc finger protein 14-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
HKR1	284459	broad.mit.edu	37	19	37840033	37840034	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37840033_37840034delTG	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002ofz.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451			GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
YIF1B	90522	broad.mit.edu	37	19	38808202	38808202	+	5'Flank	DEL	T	-	-	rs35549600		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38808202delT	uc002ohz.2	-						YIF1B_uc002ohx.2_5'Flank|YIF1B_uc010xtx.1_5'Flank|YIF1B_uc010xty.1_5'Flank|YIF1B_uc002oia.2_5'Flank|YIF1B_uc002ohy.2_5'Flank|YIF1B_uc002oib.2_5'Flank|KCNK6_uc002oic.2_5'Flank	NM_001039672	NP_001034761			Yip1 interacting factor homolog B isoform 5							integral to membrane					0	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
RASGRP4	115727	broad.mit.edu	37	19	38902724	38902726	+	Intron	DEL	TTG	-	-	rs60871565		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38902724_38902726delTTG	uc002oir.2	-						RASGRP4_uc010efz.1_Intron|RASGRP4_uc010ega.1_Intron|RASGRP4_uc010xua.1_Intron|RASGRP4_uc010xub.1_Intron|RASGRP4_uc010xuc.1_Intron|RASGRP4_uc010xud.1_Intron|RASGRP4_uc010xue.1_Intron|RASGRP4_uc010egb.2_Intron	NM_170604	NP_733749			RAS guanyl releasing protein 4 isoform a						activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	40189265	40189265	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40189265delA								LOC400696 (12252 upstream) : LGALS14 (5681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	41151842	41151842	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41151842delT								LTBP4 (16117 upstream) : NUMBL (19972 downstream)																																			---	---	---	---
BCKDHA	593	broad.mit.edu	37	19	41885456	41885457	+	Intron	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41885456_41885457delGA	uc002oqm.3	+						CYP2F1_uc010xvw.1_Intron|TMEM91_uc002oqi.2_Intron|TMEM91_uc010ehq.2_Intron|TMEM91_uc002oql.2_Intron|TMEM91_uc010ehr.2_Intron|TMEM91_uc010ehs.2_Intron|TMEM91_uc010eht.2_Intron|TMEM91_uc002oqk.3_Intron|TMEM91_uc002oqn.2_Intron	NM_000709	NP_000700			branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0																		---	---	---	---
ZNF284	342909	broad.mit.edu	37	19	44537376	44537379	+	Intron	DEL	GTTT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44537376_44537379delGTTT	uc010ejd.2	+							NM_013361				zinc finger protein 223						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)																---	---	---	---
SFRS16	11129	broad.mit.edu	37	19	45559414	45559414	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45559414delG	uc002pak.2	+						SFRS16_uc002pal.2_Intron|SFRS16_uc010xxh.1_Intron|SFRS16_uc002pam.2_Intron|SFRS16_uc002pan.1_Intron	NM_007056	NP_008987			splicing factor, arginine/serine-rich 16						mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47075877	47075890	+	Intron	DEL	AGAGAGAGAGAGAG	-	-	rs140595292	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47075877_47075890delAGAGAGAGAGAGAG	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																														---	---	---	---
CABP5	56344	broad.mit.edu	37	19	48542084	48542084	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48542084delA	uc002phu.1	-							NM_019855	NP_062829			calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)														---	---	---	---
NTN5	126147	broad.mit.edu	37	19	49173241	49173241	+	Intron	DEL	T	-	-	rs71179032		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173241delT	uc002pkb.2	-						SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Intron	NM_145807	NP_665806			netrin 5 precursor							extracellular region				large_intestine(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	50223427	50223427	+	IGR	DEL	T	-	-	rs12979136		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50223427delT								CPT1C (6439 upstream) : TSKS (19585 downstream)																																			---	---	---	---
MYH14	79784	broad.mit.edu	37	19	50749368	50749369	+	Intron	INS	-	CTTC	CTTC	rs142068028	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50749368_50749369insCTTC	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005			myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)														---	---	---	---
CEACAM18	729767	broad.mit.edu	37	19	51982185	51982186	+	Intron	INS	-	ACACAC	ACACAC	rs150760635	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51982185_51982186insACACAC	uc002pwv.1	+							NM_001080405	NP_001073874			carcinoembryonic antigen-related cell adhesion							integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)														---	---	---	---
HAS1	3036	broad.mit.edu	37	19	52224191	52224193	+	Intron	DEL	TAA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52224191_52224193delTAA	uc002pxo.1	-						HAS1_uc010epd.1_5'Flank|HAS1_uc002pxn.1_5'Flank|HAS1_uc002pxp.1_Intron	NM_001523	NP_001514			hyaluronan synthase 1						cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)														---	---	---	---
ZNF765	91661	broad.mit.edu	37	19	53907873	53907874	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53907873_53907874delTG	uc010ydx.1	+						ZNF765_uc002qbm.2_Intron|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275			zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)														---	---	---	---
ZNF787	126208	broad.mit.edu	37	19	56618858	56618875	+	Intron	DEL	GGGAGACACGGGGTCACT	-	-	rs59423271	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56618858_56618875delGGGAGACACGGGGTCACT	uc010eth.1	-						ZNF787_uc002qml.1_Intron	NM_001002836	NP_001002836			zinc finger protein 787						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56943898	56943898	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56943898delA								ZNF583 (7498 upstream) : ZNF667 (7306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57845842	57845843	+	IGR	INS	-	TTGG	TTGG	rs145482494	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57845842_57845843insTTGG								ZNF543 (3698 upstream) : ZNF304 (16802 downstream)																																			---	---	---	---
MAVS	57506	broad.mit.edu	37	20	3840472	3840472	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3840472delT	uc002wjw.3	+						MAVS_uc010zqn.1_Intron|MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_Intron	NM_020746	NP_065797			virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5649977	5649977	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5649977delA								GPCPD1 (58305 upstream) : C20orf196 (81066 downstream)																																			---	---	---	---
C20orf196	149840	broad.mit.edu	37	20	5798041	5798048	+	Intron	DEL	TCTCTCTC	-	-	rs113641229		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5798041_5798048delTCTCTCTC	uc002wmf.2	+							NM_152504	NP_689717			hypothetical protein LOC149840												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	6598614	6598614	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6598614delC								FERMT1 (494423 upstream) : BMP2 (150131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	10046179	10046188	+	Intron	DEL	AGAAAGAAAG	-	-	rs147616870		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10046179_10046188delAGAAAGAAAG	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																														---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15509369	15509370	+	Intron	INS	-	T	T	rs11478901		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15509369_15509370insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	19029146	19029146	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19029146delG								C20orf79 (234113 upstream) : SLC24A3 (164144 downstream)																																			---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19618486	19618487	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19618486_19618487delTG	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25830347	25830347	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25830347delT	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25859712	25859712	+	IGR	DEL	T	-	-	rs113885992		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25859712delT								FAM182B (10926 upstream) : LOC100134868 (130723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29434306	29434306	+	IGR	DEL	C	-	-	rs113699510		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29434306delC								None (None upstream) : FRG1B (177573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29547870	29547870	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29547870delA								None (None upstream) : FRG1B (64009 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29648657	29648657	+	Intron	DEL	T	-	-	rs71221959		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29648657delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30382559	30382562	+	Intron	DEL	GTGT	-	-	rs113985100		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30382559_30382562delGTGT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
DUSP15	128853	broad.mit.edu	37	20	30444839	30444839	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30444839delT	uc002wwu.1	-											RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;							cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34400533	34400533	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34400533delT	uc002xek.1	+						PHF20_uc002xei.1_Intron|PHF20_uc010gfo.1_Intron|PHF20_uc002xej.1_Intron|PHF20_uc002xeh.2_Intron	NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
SCAND1	51282	broad.mit.edu	37	20	34546563	34546564	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34546563_34546564delTG	uc002xep.2	-							NM_033630	NP_361012			SCAN domain containing protein 1						viral reproduction	nucleus	identical protein binding|sequence-specific DNA binding transcription factor activity				0	Breast(12;0.00631)|all_lung(11;0.0233)																	---	---	---	---
C20orf152	140894	broad.mit.edu	37	20	34598697	34598697	+	Intron	DEL	A	-	-	rs112198652		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34598697delA	uc002xes.1	+						C20orf152_uc002xer.1_Intron|C20orf152_uc010gfp.1_Intron					SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)																	---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35129467	35129468	+	Intron	INS	-	T	T	rs66626764		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35129467_35129468insT	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron|DLGAP4_uc002xfg.2_Intron|DLGAP4_uc002xfh.2_Intron|DLGAP4_uc002xfi.2_Intron|DLGAP4_uc002xfj.2_Intron	NM_014902	NP_055717			disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36109007	36109010	+	IGR	DEL	TTCC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36109007_36109010delTTCC								SRC (75188 upstream) : BLCAP (36810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	36261471	36261474	+	IGR	DEL	TGTG	-	-	rs67165667		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36261471_36261474delTGTG								BLCAP (105168 upstream) : CTNNBL1 (60960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39958272	39958272	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39958272delA								ZHX3 (12030 upstream) : LPIN3 (11288 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	42047496	42047497	+	IGR	INS	-	AAGG	AAGG	rs148360887	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42047496_42047497insAAGG								PTPRT (228939 upstream) : SFRS6 (39007 downstream)																																			---	---	---	---
R3HDML	140902	broad.mit.edu	37	20	42968220	42968221	+	Intron	DEL	TG	-	-	rs142456726		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42968220_42968221delTG	uc002xls.1	+							NM_178491	NP_848586			R3H domain containing-like precursor							extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	43313422	43313422	+	Intron	DEL	G	-	-	rs5841563		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43313422delG	uc002xml.1	-						uc002xmm.1_Intron					Homo sapiens cDNA FLJ33523 fis, clone BRAMY2006411.																												OREG0025968	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	20	44798404	44798405	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44798404_44798405delAC								CD40 (40020 upstream) : CDH22 (3971 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45684302	45684302	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45684302delT	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45908868	45908869	+	Intron	INS	-	A	A	rs72091806		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45908868_45908869insA	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47600473	47600473	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47600473delG	uc002xtx.3	+						ARFGEF2_uc010zyf.1_5'Flank	NM_006420	NP_006411			ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
STAU1	6780	broad.mit.edu	37	20	47774018	47774018	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47774018delT	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347			staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)															---	---	---	---
PTGIS	5740	broad.mit.edu	37	20	48177116	48177116	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48177116delG	uc002xut.2	-						PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952			prostaglandin I2 synthase						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	51155274	51155274	+	IGR	DEL	T	-	-	rs72200910		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51155274delT								ZFP64 (346750 upstream) : TSHZ2 (433603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52138579	52138586	+	IGR	DEL	GAAGGAGG	-	-	rs74179204		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52138579_52138586delGAAGGAGG								TSHZ2 (34614 upstream) : ZNF217 (45026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52177621	52177632	+	IGR	DEL	GGAAGGAAAGAA	-	-	rs66593844		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52177621_52177632delGGAAGGAAAGAA								TSHZ2 (73656 upstream) : ZNF217 (5980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52455204	52455205	+	IGR	DEL	CG	-	-	rs11467800	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52455204_52455205delCG								ZNF217 (244403 upstream) : SUMO1P1 (35837 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53220479	53220480	+	Intron	INS	-	TT	TT	rs35690531		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53220479_53220480insTT	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53489178	53489179	+	IGR	INS	-	T	T	rs142243629	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53489178_53489179insT								DOK5 (221469 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55214777	55214777	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55214777delT								TFAP2C (441 upstream) : BMP7 (529032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55400692	55400692	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55400692delA								TFAP2C (186356 upstream) : BMP7 (343117 downstream)																																			---	---	---	---
PMEPA1	56937	broad.mit.edu	37	20	56236982	56236983	+	Intron	INS	-	G	G	rs138119495	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56236982_56236983insG	uc002xyq.2	-						PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron	NM_020182	NP_064567			transmembrane prostate androgen-induced protein						androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	57673081	57673081	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57673081delA								SLMO2 (55180 upstream) : ZNF831 (92994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	58670625	58670626	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58670625_58670626insA	uc002ybk.1	+											full-length cDNA clone CS0DJ007YF24 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59028392	59028393	+	Intron	DEL	CA	-	-	rs11470176		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59028392_59028393delCA	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60589101	60589102	+	Intron	DEL	TA	-	-	rs111407783		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60589101_60589102delTA	uc002ybs.2	-							NM_003185	NP_003176			TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60783805	60783806	+	IGR	DEL	GT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60783805_60783806delGT								GTPBP5 (5997 upstream) : HRH3 (6211 downstream)																																			---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62830456	62830456	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62830456delT	uc002yii.2	+						MYT1_uc002yih.2_Intron	NM_004535	NP_004526			myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9873435	9873435	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9873435delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10459303	10459306	+	Intron	DEL	TCTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10459303_10459306delTCTC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10545062	10545065	+	Intron	DEL	ATAC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10545062_10545065delATAC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10588972	10588973	+	Intron	DEL	GA	-	-	rs71274665		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10588972_10588973delGA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10745931	10745931	+	IGR	DEL	T	-	-	rs111734254		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10745931delT								None (None upstream) : TPTE (160812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10776979	10776983	+	IGR	DEL	GGAGT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10776979_10776983delGGAGT								None (None upstream) : TPTE (129760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10788037	10788038	+	IGR	INS	-	GAATGGAATG	GAATGGAATG	rs61127042		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10788037_10788038insGAATGGAATG								None (None upstream) : TPTE (118705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10838273	10838282	+	IGR	DEL	AATGGAATGG	-	-	rs72391973		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10838273_10838282delAATGGAATGG								None (None upstream) : TPTE (68461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10844476	10844485	+	IGR	DEL	GAATGGAATG	-	-	rs111412015		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10844476_10844485delGAATGGAATG								None (None upstream) : TPTE (62258 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11063054	11063055	+	Intron	DEL	TG	-	-	rs150570310		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11063054_11063055delTG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11091170	11091171	+	Intron	INS	-	T	T	rs112568653		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11091170_11091171insT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11137928	11137935	+	IGR	DEL	TCTTTCTC	-	-	rs71684446		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11137928_11137935delTCTTTCTC								BAGE (38991 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11139247	11139248	+	IGR	INS	-	G	G	rs147390963		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11139247_11139248insG								BAGE (40310 upstream) : None (None downstream)																																			---	---	---	---
CHODL	140578	broad.mit.edu	37	21	19302720	19302721	+	Intron	INS	-	CCA	CCA	rs139180144	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19302720_19302721insCCA	uc002ykt.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002yku.2_Intron					RecName: Full=Chondrolectin; AltName: Full=Transmembrane protein MT75; Flags: Precursor;						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)														---	---	---	---
CHODL	140578	broad.mit.edu	37	21	19589808	19589808	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19589808delC	uc002ykt.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002yku.2_Intron					RecName: Full=Chondrolectin; AltName: Full=Transmembrane protein MT75; Flags: Precursor;						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20759099	20759099	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20759099delT								TMPRSS15 (983129 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21144778	21144779	+	IGR	INS	-	AAAC	AAAC	rs148228727	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21144778_21144779insAAAC								None (None upstream) : C21orf131 (970135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23407101	23407103	+	Intron	DEL	CTC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23407101_23407103delCTC	uc002ylf.2	-											Homo sapiens cDNA clone IMAGE:5271510.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	25112231	25112232	+	IGR	INS	-	A	A	rs28637038	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25112231_25112232insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25451515	25451515	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25451515delA								None (None upstream) : None (None downstream)																																			---	---	---	---
APP	351	broad.mit.edu	37	21	27489991	27489992	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27489991_27489992delTG	uc002ylz.2	-						APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron|APP_uc011acj.1_Intron	NM_000484	NP_000475			amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)																---	---	---	---
CYYR1	116159	broad.mit.edu	37	21	27935047	27935048	+	Intron	DEL	AC	-	-	rs72141529		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27935047_27935048delAC	uc002ymd.2	-						CYYR1_uc011ack.1_Intron|CYYR1_uc002yme.2_Intron	NM_052954	NP_443186			cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	31941373	31941374	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31941373_31941374delAC								KRTAP19-7 (7765 upstream) : KRTAP6-3 (23385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33001392	33001392	+	IGR	DEL	A	-	-	rs71865387		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33001392delA								TIAM1 (69102 upstream) : SOD1 (30543 downstream)																																			---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34133212	34133213	+	Intron	DEL	GC	-	-	rs8133271		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133212_34133213delGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	35612762	35612762	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35612762delT								C21orf82 (50542 upstream) : KCNE2 (123561 downstream)																																			---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37896413	37896413	+	Intron	DEL	T	-	-	rs67383855		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37896413delT	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550			claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40866178	40866178	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40866178delT	uc002yya.2	+						SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367			SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	41333275	41333275	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41333275delT								PCP4 (31955 upstream) : DSCAM (51068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	41355789	41355790	+	IGR	INS	-	TCCC	TCCC	rs71890179		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41355789_41355790insTCCC								PCP4 (54469 upstream) : DSCAM (28553 downstream)																																			---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42020209	42020210	+	Intron	INS	-	CACA	CACA	rs2410261	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42020209_42020210insCACA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	44015938	44015938	+	IGR	DEL	T	-	-	rs113213537		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44015938delT								SLC37A1 (14389 upstream) : PDE9A (57924 downstream)																																			---	---	---	---
PDE9A	5152	broad.mit.edu	37	21	44097801	44097801	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44097801delG	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597			phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
PTTG1IP	754	broad.mit.edu	37	21	46283143	46283172	+	Intron	DEL	CCACGGCCTCAGCAGCAGAGACACAGCCCG	-	-	rs71992404	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46283143_46283172delCCACGGCCTCAGCAGCAGAGACACAGCCCG	uc002zgb.1	-						PTTG1IP_uc011afj.1_Intron|PTTG1IP_uc011afk.1_Intron	NM_004339	NP_004330			pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	46412663	46412663	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46412663delG	uc002zgn.1	-											Homo sapiens, clone IMAGE:4536929, mRNA.																														---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47196385	47196386	+	Intron	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47196385_47196386delTC	uc010gqb.2	+							NM_020528	NP_065389			poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	17238759	17238759	+	IGR	DEL	A	-	-	rs113462520		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17238759delA								psiTPTE22 (59238 upstream) : XKR3 (25554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	19317108	19317109	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19317108_19317109delAC								CLTCL1 (37869 upstream) : HIRA (1115 downstream)																																			---	---	---	---
GNB1L	54584	broad.mit.edu	37	22	19789177	19789178	+	Intron	DEL	TT	-	-	rs66524521		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19789177_19789178delTT	uc002zqe.1	-						GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqf.1_Intron	NM_053004	NP_443730			guanine nucleotide binding protein						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	21052399	21052399	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21052399delG								POM121L4P (6390 upstream) : TMEM191A (3003 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23183038	23183039	+	Intron	INS	-	GTGT	GTGT	rs145725450	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23183038_23183039insGTGT	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23886849	23886849	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23886849delA								ZDHHC8P1 (142050 upstream) : IGLL1 (28466 downstream)																																			---	---	---	---
SLC2A11	66035	broad.mit.edu	37	22	24204813	24204813	+	Intron	DEL	T	-	-	rs111619634		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24204813delT	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Intron|SLC2A11_uc011ajd.1_Intron|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109			glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26709567	26709570	+	Intron	DEL	CACG	-	-	rs56086023		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26709567_26709570delCACG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28706162	28706163	+	Intron	DEL	AA	-	-	rs67953175		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28706162_28706163delAA	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33185211	33185211	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33185211delC	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33216355	33216356	+	Intron	INS	-	GTG	GTG			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33216355_33216356insGTG	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|TIMP3_uc003anb.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
LARGE	9215	broad.mit.edu	37	22	34051773	34051773	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34051773delA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	34333698	34333699	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34333698_34333699delTG								LARGE (15114 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34461961	34461976	+	IGR	DEL	TACGTACGTACGTACG	-	-	rs71189408	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34461961_34461976delTACGTACGTACGTACG								LARGE (143377 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35396342	35396343	+	IGR	DEL	TG	-	-	rs34778350		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35396342_35396343delTG								None (None upstream) : ISX (65786 downstream)																																			---	---	---	---
APOL2	23780	broad.mit.edu	37	22	36631789	36631792	+	Intron	DEL	GGGT	-	-	rs151110005	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36631789_36631792delGGGT	uc003aoz.2	-						APOL2_uc011amm.1_Intron|APOL2_uc003apa.2_Intron	NM_030882	NP_112092			apolipoprotein L2						acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0																		---	---	---	---
PVALB	5816	broad.mit.edu	37	22	37212087	37212088	+	Intron	DEL	TT	-	-	rs111360103		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37212087_37212088delTT	uc010gwz.2	-						PVALB_uc003apx.2_Intron	NM_002854	NP_002845			parvalbumin								calcium ion binding			skin(1)	1																		---	---	---	---
SREBF2	6721	broad.mit.edu	37	22	42234470	42234470	+	Intron	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42234470delC	uc003bbi.2	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron	NM_004599	NP_004590			sterol regulatory element-binding transcription						cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
PARVB	29780	broad.mit.edu	37	22	44495399	44495399	+	Intron	DEL	C	-	-	rs11353013		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44495399delC	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459			parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---
KIAA1644	85352	broad.mit.edu	37	22	44665355	44665356	+	Intron	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44665355_44665356delCA	uc003bet.2	-							NM_001099294	NP_001092764			hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	44807442	44807442	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44807442delT								KIAA1644 (98711 upstream) : LDOC1L (81008 downstream)																																			---	---	---	---
PHF21B	112885	broad.mit.edu	37	22	45321191	45321191	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45321191delA	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron|PHF21B_uc011aqm.1_Intron	NM_138415	NP_612424			PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	45476292	45476297	+	IGR	DEL	TCACCG	-	-	rs62231072		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45476292_45476297delTCACCG								PHF21B (70483 upstream) : NUP50 (83429 downstream)																																			---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47243852	47243855	+	Intron	DEL	GCGC	-	-	rs62233856		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47243852_47243855delGCGC	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	49776291	49776291	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49776291delA								FAM19A5 (628549 upstream) : C22orf34 (31885 downstream)																																			---	---	---	---
BRD1	23774	broad.mit.edu	37	22	50190010	50190011	+	Intron	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50190010_50190011insT	uc003biv.2	-						BRD1_uc011arf.1_Intron|BRD1_uc011arg.1_Intron|BRD1_uc011arh.1_Intron|BRD1_uc003biu.3_Intron	NM_014577	NP_055392			bromodomain containing protein 1						histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	50348046	50348046	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50348046delG								CRELD2 (26860 upstream) : PIM3 (6097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	50605130	50605153	+	IGR	DEL	TCCCAGCATGGCTCATGCCTGCAG	-	-	rs62239296	by1000genomes;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50605130_50605153delTCCCAGCATGGCTCATGCCTGCAG								MOV10L1 (5015 upstream) : PANX2 (4007 downstream)																																			---	---	---	---
PANX2	56666	broad.mit.edu	37	22	50614941	50614942	+	Intron	INS	-	C	C	rs137942023	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50614941_50614942insC	uc003bjn.3	+						PANX2_uc003bjp.3_Intron|PANX2_uc003bjo.3_Intron	NM_052839	NP_443071			pannexin 2 isoform 1						protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)														---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2207164	2207164	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2207164delT	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3245256	3245256	+	Intron	DEL	C	-	-	rs68160607		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3245256delC	uc004crg.3	-							NM_015419	NP_056234			adlican precursor							extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3247360	3247361	+	Intron	INS	-	GAAG	GAAG			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3247360_3247361insGAAG	uc004crg.3	-							NM_015419	NP_056234			adlican precursor							extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	5153052	5153053	+	IGR	INS	-	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5153052_5153053insC								None (None upstream) : NLGN4X (655031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	5762968	5762969	+	IGR	DEL	AA	-	-	rs112208549		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5762968_5762969delAA								None (None upstream) : NLGN4X (45115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	6326117	6326118	+	IGR	INS	-	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6326117_6326118insT								NLGN4X (179411 upstream) : VCX3A (125542 downstream)																																			---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12738172	12738173	+	Intron	INS	-	G	G	rs11389537		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12738172_12738173insG	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	15739148	15739148	+	IGR	DEL	T	-	-	rs59048305		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15739148delT								CA5BP (17673 upstream) : CA5B (17264 downstream)																																			---	---	---	---
RAI2	10742	broad.mit.edu	37	X	17833444	17833449	+	Intron	DEL	CACACA	-	-	rs71698741		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17833444_17833449delCACACA	uc004cyf.2	-						RAI2_uc004cyg.2_Intron|RAI2_uc010nfa.2_Intron|RAI2_uc004cyh.3_Intron|RAI2_uc011miy.1_Intron	NM_021785	NP_068557			retinoic acid induced 2						embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)																	---	---	---	---
CXorf23	256643	broad.mit.edu	37	X	19964599	19964599	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19964599delT	uc004czp.2	-						CXorf23_uc010nfn.2_Intron|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Intron	NM_198279	NP_938020			hypothetical protein LOC256643							mitochondrion				lung(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	21837715	21837715	+	IGR	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21837715delG								SMPX (61485 upstream) : MBTPS2 (19941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	22295731	22295731	+	IGR	DEL	T	-	-	rs142336095		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22295731delT								ZNF645 (3157 upstream) : DDX53 (722356 downstream)																																			---	---	---	---
ACOT9	23597	broad.mit.edu	37	X	23734067	23734067	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23734067delT	uc004dap.2	-						ACOT9_uc004dao.2_Intron|ACOT9_uc004daq.2_Intron|ACOT9_uc004dar.2_Intron|ACOT9_uc011mjt.1_Intron|ACOT9_uc004das.2_Intron|ACOT9_uc004dat.1_Intron	NM_001033583	NP_001028755			acyl-Coenzyme A thioesterase 2, mitochondrial						acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	30454857	30454860	+	IGR	DEL	TGTG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30454857_30454860delTGTG								NR0B1 (127362 upstream) : CXorf21 (122081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	34745409	34745410	+	IGR	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34745409_34745410delTC								TMEM47 (70004 upstream) : FAM47B (215521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	35413234	35413235	+	IGR	DEL	CT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35413234_35413235delCT								FAM47B (450200 upstream) : MAGEB16 (403224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	35432297	35432297	+	IGR	DEL	T	-	-	rs77023716		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35432297delT								FAM47B (469263 upstream) : MAGEB16 (384162 downstream)																																			---	---	---	---
LANCL3	347404	broad.mit.edu	37	X	37513172	37513173	+	Intron	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37513172_37513173insA	uc011mkd.1	+						LANCL3_uc004ddp.1_Intron	NM_198511	NP_940913			LanC lantibiotic synthetase component C-like 3								catalytic activity				0																		---	---	---	---
RPGR	6103	broad.mit.edu	37	X	38144668	38144668	+	3'UTR	DEL	T	-	-	rs66997072		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38144668delT	uc004ded.1	-	15					RPGR_uc004deb.2_Intron|RPGR_uc004dea.2_Intron|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025			retinitis pigmentosa GTPase regulator isoform C						intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	39215951	39215952	+	IGR	DEL	AG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39215951_39215952delAG								MID1IP1 (550170 upstream) : BCOR (694549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39572649	39572650	+	IGR	INS	-	ATGG	ATGG			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39572649_39572650insATGG								MID1IP1 (906868 upstream) : BCOR (337851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	41236886	41236886	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41236886delA								DDX3X (13162 upstream) : NYX (69827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	42896847	42896847	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42896847delA								PPP1R2P9 (259361 upstream) : MAOA (618562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	45314453	45314453	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45314453delT								CXorf36 (254307 upstream) : MIR221 (291132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	50902369	50902370	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50902369_50902370delCA								BMP15 (242763 upstream) : NUDT10 (172713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	62411750	62411751	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62411750_62411751delTG								None (None upstream) : SPIN4 (155357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	62630599	62630600	+	IGR	DEL	GA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62630599_62630600delGA								SPIN4 (59381 upstream) : LOC92249 (15839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	63902461	63902462	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63902461_63902462insA								MTMR8 (287150 upstream) : ZC4H2 (233800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	65241035	65241036	+	IGR	DEL	CA	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65241035_65241036delCA								MIR223 (2214 upstream) : VSIG4 (544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68279884	68279889	+	IGR	DEL	TGTGTG	-	-	rs72325743		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68279884_68279889delTGTGTG								EFNB1 (213855 upstream) : PJA1 (100693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68321929	68321930	+	IGR	DEL	GT	-	-	rs71662599		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68321929_68321930delGT								EFNB1 (255900 upstream) : PJA1 (58652 downstream)																																			---	---	---	---
TAF1	6872	broad.mit.edu	37	X	70652350	70652350	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70652350delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron|TAF1_uc004dzw.1_Intron	NM_138923	NP_620278			TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---
SLC16A2	6567	broad.mit.edu	37	X	73681242	73681243	+	Intron	INS	-	GT	GT	rs140818072		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73681242_73681243insGT	uc004ebt.2	+							NM_006517	NP_006508			solute carrier family 16, member 2							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	75555025	75555026	+	IGR	INS	-	T	T	rs113039017		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75555025_75555026insT								CXorf26 (156992 upstream) : MAGEE1 (93091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	76195311	76195312	+	Intron	INS	-	AG	AG			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76195311_76195312insAG	uc010nlv.1	-											Homo sapiens cDNA FLJ25017 fis, clone CBL01605.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	78456958	78456959	+	IGR	INS	-	A	A	rs35638053		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78456958_78456959insA								GPR174 (29232 upstream) : ITM2A (158924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	78494193	78494194	+	IGR	DEL	TC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78494193_78494194delTC								GPR174 (66467 upstream) : ITM2A (121689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	78498815	78498815	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78498815delT								GPR174 (71089 upstream) : ITM2A (117068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	84825845	84825846	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84825845_84825846insA								POF1B (191097 upstream) : MIR1321 (264939 downstream)																																			---	---	---	---
DIAPH2	1730	broad.mit.edu	37	X	96642546	96642547	+	Intron	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96642546_96642547delTG	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720			diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	101085047	101085047	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101085047delA								ARMCX2 (170184 upstream) : NXF5 (2038 downstream)																																			---	---	---	---
NXF5	55998	broad.mit.edu	37	X	101097274	101097277	+	Intron	DEL	TTCC	-	-	rs6621225		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097274_101097277delTTCC	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564			nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	103134003	103134004	+	IGR	INS	-	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103134003_103134004insA								RAB9B (46845 upstream) : TMSB15B (39475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	107023928	107023928	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107023928delC								TSC22D3 (4726 upstream) : MID2 (45156 downstream)																																			---	---	---	---
COL4A6	1288	broad.mit.edu	37	X	107562362	107562363	+	Intron	INS	-	T	T	rs139816685		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107562362_107562363insT	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron|COL4A6_uc004enx.2_Intron|COL4A6_uc004eny.2_Intron	NM_001847	NP_001838			type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
Unknown	0	broad.mit.edu	37	X	116150689	116150689	+	IGR	DEL	C	-	-	rs11300175		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116150689delC								CXorf61 (556552 upstream) : KLHL13 (881088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	117465084	117465085	+	IGR	INS	-	A	A	rs77149288		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117465084_117465085insA								KLHL13 (214296 upstream) : WDR44 (14957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118054153	118054153	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118054153delT								ZCCHC12 (93223 upstream) : LONRF3 (54560 downstream)																																			---	---	---	---
LONRF3	79836	broad.mit.edu	37	X	118106925	118106925	+	5'Flank	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118106925delT	uc004eqw.2	+						LONRF3_uc004eqx.2_5'Flank|LONRF3_uc004eqy.2_5'Flank	NM_001031855	NP_001027026			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	121457601	121457602	+	IGR	INS	-	AG	AG	rs111594686		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:121457601_121457602insAG								None (None upstream) : GRIA3 (860494 downstream)																																			---	---	---	---
GRIA3	2892	broad.mit.edu	37	X	122453668	122453668	+	Intron	DEL	A	-	-	rs144537047		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122453668delA	uc004etq.3	+						GRIA3_uc004etr.3_Intron|GRIA3_uc004ets.3_Intron|GRIA3_uc011muf.1_Intron	NM_007325	NP_015564			glutamate receptor, ionotrophic, AMPA 3 isoform						glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)													---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122772406	122772406	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772406delA	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019			THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	128740968	128740983	+	IGR	DEL	GAAGGAAGGAAGTAAG	-	-	rs72092281		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128740968_128740983delGAAGGAAGGAAGTAAG								OCRL (14440 upstream) : APLN (38343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	134083800	134083801	+	IGR	INS	-	GT	GT			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134083800_134083801insGT								MOSPD1 (34503 upstream) : LOC644538 (41167 downstream)																																			---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135732733	135732733	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135732733delA	uc004faa.2	+						CD40LG_uc010nsd.2_Intron|CD40LG_uc010nse.1_Intron	NM_000074	NP_000065			CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
Unknown	0	broad.mit.edu	37	X	136519985	136519985	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136519985delA								GPR101 (406152 upstream) : ZIC3 (128361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	138991698	138991699	+	IGR	DEL	AC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138991698_138991699delAC								ATP11C (77251 upstream) : MIR505 (14608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146128797	146128797	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146128797delA								CXorf51 (236873 upstream) : MIR513C (142425 downstream)																																			---	---	---	---
MAMLD1	10046	broad.mit.edu	37	X	149589032	149589032	+	Intron	DEL	G	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149589032delG	uc011mxu.1	+						MAMLD1_uc011mxt.1_Intron					RecName: Full=Mastermind-like domain-containing protein 1;          Short=Protein CG1; AltName: Full=F18;						male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	150299667	150299667	+	IGR	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150299667delT								HMGB3 (140421 upstream) : GPR50 (45392 downstream)																																			---	---	---	---
GABRA3	2556	broad.mit.edu	37	X	151357374	151357374	+	Intron	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151357374delA	uc010ntk.1	-							NM_000808	NP_000799			gamma-aminobutyric acid A receptor, alpha 3						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	153260210	153260211	+	IGR	DEL	TG	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153260210_153260211delTG								TMEM187 (11564 upstream) : IRAK1 (15746 downstream)																																			---	---	---	---
VBP1	7411	broad.mit.edu	37	X	154456942	154456942	+	Intron	DEL	T	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154456942delT	uc004fnc.2	+						VBP1_uc004fnd.2_Intron	NM_003372	NP_003363			von Hippel-Lindau binding protein 1						'de novo' posttranslational protein folding	nucleus|prefoldin complex	unfolded protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9936726	9936726	+	IGR	DEL	A	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9936726delA								TTTY22 (285872 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13272775	13272776	+	IGR	DEL	TT	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13272775_13272776delTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13464699	13464699	+	IGR	DEL	C	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13464699delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58973997	58974001	+	IGR	DEL	ATTCC	-	-			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58973997_58974001delATTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59010955	59010956	+	IGR	INS	-	A	A	rs137917613		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59010955_59010956insA								None (None upstream) : None (None downstream)																																			---	---	---	---
C1orf158	93190	broad.mit.edu	37	1	12815711	12815711	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12815711C>A	uc001auh.2	+	2	389	c.173C>A	c.(172-174)CCA>CAA	p.P58Q	C1orf158_uc010obe.1_Missense_Mutation_p.P58Q	NM_152290	NP_689503	Q8N1D5	CA158_HUMAN	hypothetical protein LOC93190	58										ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
SLC2A1	6513	broad.mit.edu	37	1	43395455	43395455	+	Intron	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43395455G>T	uc001cik.2	-							NM_006516	NP_006507			solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)													---	---	---	---
GON4L	54856	broad.mit.edu	37	1	155721587	155721587	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155721587G>T	uc001flz.2	-	31	6644	c.6547C>A	c.(6547-6549)CAG>AAG	p.Q2183K	GON4L_uc001flx.1_Missense_Mutation_p.Q17K|GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.Q2182K|GON4L_uc009wrh.1_Missense_Mutation_p.Q2182K|GON4L_uc001fma.1_Missense_Mutation_p.Q2183K	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	2183	Myb-like.				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158614074	158614074	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158614074C>A	uc001fst.1	-	30	4506	c.4307G>T	c.(4306-4308)CGG>CTG	p.R1436L		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1436	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178426964	178426964	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178426964G>A	uc001glr.2	+	12	2239	c.2114G>A	c.(2113-2115)CGG>CAG	p.R705Q	RASAL2_uc001glq.2_Missense_Mutation_p.R846Q|RASAL2_uc009wxc.2_Missense_Mutation_p.R219Q	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	705					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186092180	186092180	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186092180C>T	uc001grq.1	+	81	12556	c.12327C>T	c.(12325-12327)GAC>GAT	p.D4109D		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4109	Ig-like C2-type 40.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
NID1	4811	broad.mit.edu	37	1	236143118	236143118	+	Intron	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236143118G>A	uc001hxo.2	-						NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_Intron	NM_002508	NP_002499			nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
NID1	4811	broad.mit.edu	37	1	236205258	236205258	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236205258G>T	uc001hxo.2	-	4	1189	c.1087C>A	c.(1087-1089)CAG>AAG	p.Q363K	NID1_uc009xgd.2_Missense_Mutation_p.Q363K	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	363					cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
MTR	4548	broad.mit.edu	37	1	237052470	237052470	+	Intron	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237052470C>T	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
EFCAB2	84288	broad.mit.edu	37	1	245222730	245222730	+	Silent	SNP	G	T	T	rs138478256		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245222730G>T	uc001ibd.2	+	4	702	c.561G>T	c.(559-561)ACG>ACT	p.T187T	EFCAB2_uc001ibc.2_Silent_p.T51T|EFCAB2_uc010pyo.1_Silent_p.T61T|EFCAB2_uc010pyp.1_Silent_p.T51T|EFCAB2_uc001ibe.2_RNA	NR_026586		Q5VUJ9	EFCB2_HUMAN	RecName: Full=EF-hand calcium-binding domain-containing protein 2;	187							calcium ion binding				0	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)															---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33572560	33572560	+	Missense_Mutation	SNP	G	A	A	rs139673362		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33572560G>A	uc002ros.2	+	26	3986	c.3986G>A	c.(3985-3987)CGC>CAC	p.R1329H	LTBP1_uc002rot.2_Missense_Mutation_p.R1003H|LTBP1_uc002rou.2_Missense_Mutation_p.R1002H|LTBP1_uc002rov.2_Missense_Mutation_p.R949H|LTBP1_uc010ymz.1_Missense_Mutation_p.R960H|LTBP1_uc010yna.1_Missense_Mutation_p.R907H|LTBP1_uc010ynb.1_Missense_Mutation_p.R226H	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1328	EGF-like 14; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
LHCGR	3973	broad.mit.edu	37	2	48915521	48915521	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915521A>G	uc002rwu.3	-	11	1485	c.1415T>C	c.(1414-1416)ATT>ACT	p.I472T	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	472	Cytoplasmic (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)									Familial_Male-Limited_Precocious_Puberty				---	---	---	---
LRRTM1	347730	broad.mit.edu	37	2	80529646	80529646	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529646C>A	uc002sok.1	-	2	1569	c.1299G>T	c.(1297-1299)ATG>ATT	p.M433I	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	433	Helical; (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5															HNSCC(69;0.2)			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80835315	80835315	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80835315G>T	uc010ysh.1	+	16	2307	c.2302G>T	c.(2302-2304)GAT>TAT	p.D768Y	CTNNA2_uc010yse.1_Missense_Mutation_p.D768Y|CTNNA2_uc010ysf.1_Missense_Mutation_p.D768Y|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Missense_Mutation_p.D400Y|CTNNA2_uc010ysj.1_Missense_Mutation_p.D97Y	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	768					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
SPOPL	339745	broad.mit.edu	37	2	139308588	139308588	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139308588C>A	uc002tvh.2	+	4	716	c.316C>A	c.(316-318)CTT>ATT	p.L106I		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	106	MATH.					nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)														---	---	---	---
RAPGEF4	11069	broad.mit.edu	37	2	173679118	173679118	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173679118C>T	uc002uhv.3	+	4	596	c.409C>T	c.(409-411)CGC>TGC	p.R137C	RAPGEF4_uc002uhu.2_Missense_Mutation_p.R137C|RAPGEF4_uc010fqn.2_Missense_Mutation_p.R120C	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	137	cAMP 1.				blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179429737	179429737	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179429737G>A	uc010zfg.1	-	275	73642	c.73418C>T	c.(73417-73419)ACG>ATG	p.T24473M	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T18168M|TTN_uc010zfi.1_Missense_Mutation_p.T18101M|TTN_uc010zfj.1_Missense_Mutation_p.T17976M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25400							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	197878392	197878392	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197878392C>T	uc002uua.1	-	18	1769	c.1692G>A	c.(1690-1692)TCG>TCA	p.S564S	ANKRD44_uc002utz.3_Silent_p.S296S	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	589	ANK 17.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
PLEKHM3	389072	broad.mit.edu	37	2	208693094	208693094	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208693094C>A	uc002vcl.2	-	8	2725	c.2235G>T	c.(2233-2235)GAG>GAT	p.E745D		NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	745					intracellular signal transduction		metal ion binding			ovary(1)	1																		---	---	---	---
C2orf80	389073	broad.mit.edu	37	2	209047703	209047703	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209047703C>T	uc002vcr.2	-	4	364	c.192G>A	c.(190-192)CTG>CTA	p.L64L		NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073	64										skin(1)	1																		---	---	---	---
C3orf20	84077	broad.mit.edu	37	3	14731512	14731512	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14731512G>A	uc003byy.2	+	5	1038	c.634G>A	c.(634-636)GCA>ACA	p.A212T	C3orf20_uc003byz.2_Missense_Mutation_p.A90T|C3orf20_uc003bza.2_Missense_Mutation_p.A90T|C3orf20_uc003byx.1_Missense_Mutation_p.A212T	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	212						cytoplasm|integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41277254	41277254	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41277254G>A	uc010hia.1	+	12	1879	c.1723G>A	c.(1723-1725)GGA>AGA	p.G575R	CTNNB1_uc003ckp.2_Missense_Mutation_p.G575R|CTNNB1_uc003ckq.2_Missense_Mutation_p.G575R|CTNNB1_uc003ckr.2_Missense_Mutation_p.G575R|CTNNB1_uc011azf.1_Missense_Mutation_p.G568R|CTNNB1_uc011azg.1_Missense_Mutation_p.G503R|CTNNB1_uc003cks.2_3'UTR|CTNNB1_uc003ckt.1_Missense_Mutation_p.G10R	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	575					adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
NBEAL2	23218	broad.mit.edu	37	3	47049627	47049627	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47049627G>A	uc003cqp.2	+	50	7849	c.7670G>A	c.(7669-7671)AGC>AAC	p.S2557N	NBEAL2_uc010hjm.1_Missense_Mutation_p.S1934N|NBEAL2_uc010hjn.1_Missense_Mutation_p.S923N|NBEAL2_uc010hjo.1_Missense_Mutation_p.S117N	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2557	WD 4.						binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)														---	---	---	---
RHOA	387	broad.mit.edu	37	3	49412898	49412898	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49412898T>C	uc003cwu.2	-	2	401	c.125A>G	c.(124-126)TAT>TGT	p.Y42C	RHOA_uc010hku.2_5'UTR	NM_001664	NP_001655	P61586	RHOA_HUMAN	ras homolog gene family, member A precursor	42	Effector region (Potential).				axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52941259	52941259	+	Silent	SNP	G	T	T	rs138166180		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52941259G>T	uc003dgf.2	-	20	2726	c.2157C>A	c.(2155-2157)TCC>TCA	p.S719S	SFMBT1_uc010hmr.2_Silent_p.S666S|SFMBT1_uc003dgg.2_Silent_p.S719S|SFMBT1_uc003dgh.2_Silent_p.S719S	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	719					regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
LRIG1	26018	broad.mit.edu	37	3	66457882	66457882	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66457882G>A	uc003dmx.2	-	8	983	c.969C>T	c.(967-969)GAC>GAT	p.D323D	LRIG1_uc003dmw.2_5'Flank|LRIG1_uc010hnz.2_Silent_p.D63D|LRIG1_uc010hoa.2_Silent_p.D323D	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	323	Extracellular (Potential).|LRR 11.					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)												OREG0015662	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PIK3R4	30849	broad.mit.edu	37	3	130437243	130437243	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130437243G>T	uc003enj.2	-	8	2698	c.2117C>A	c.(2116-2118)CCA>CAA	p.P706Q		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	706					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12																		---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	155838473	155838473	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155838473G>T	uc003far.2	+	1	137	c.73G>T	c.(73-75)GGG>TGG	p.G25W	KCNAB1_uc011bon.1_Missense_Mutation_p.G25W	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	25						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
KLHL24	54800	broad.mit.edu	37	3	183368716	183368716	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183368716C>T	uc003flv.2	+	3	867	c.572C>T	c.(571-573)GCG>GTG	p.A191V	KLHL24_uc003flw.2_Missense_Mutation_p.A191V|KLHL24_uc003flx.2_Missense_Mutation_p.A191V	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	191	BACK.					axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)															---	---	---	---
ECE2	9718	broad.mit.edu	37	3	184005662	184005662	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184005662C>T	uc003fni.3	+	11	1693	c.1655C>T	c.(1654-1656)ACG>ATG	p.T552M	ECE2_uc011brh.1_Missense_Mutation_p.T405M|ECE2_uc003fnl.3_Missense_Mutation_p.T480M|ECE2_uc003fnm.3_Missense_Mutation_p.T434M|ECE2_uc003fnk.3_Missense_Mutation_p.T405M|ECE2_uc011bri.1_Missense_Mutation_p.T467M|ECE2_uc010hxv.2_Missense_Mutation_p.T196M	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	552	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193036905	193036905	+	Intron	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193036905G>T	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
PCYT1A	5130	broad.mit.edu	37	3	195974306	195974306	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195974306G>A	uc003fwg.2	-	6	591	c.418C>T	c.(418-420)CGC>TGC	p.R140C	PCYT1A_uc003fwh.2_Missense_Mutation_p.R140C	NM_005017	NP_005008	P49585	PCY1A_HUMAN	choline phosphate cytidylyltransferase 1 alpha	140	Catalytic (Potential).					cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity				0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)													---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	54011743	54011743	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54011743C>A	uc003gzu.2	-	5	1452	c.1318G>T	c.(1318-1320)GGG>TGG	p.G440W	SCFD2_uc010igm.2_Missense_Mutation_p.G440W	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	440					protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73164020	73164020	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73164020G>C	uc003hgk.1	-	18	2601	c.2564C>G	c.(2563-2565)TCT>TGT	p.S855C	ADAMTS3_uc003hgl.2_Missense_Mutation_p.S196C	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	855	TSP type-1 2.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79369389	79369389	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79369389G>T	uc003hlb.2	+	44	6633	c.6193G>T	c.(6193-6195)GGG>TGG	p.G2065W		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2064	CSPG 9.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
GK2	2712	broad.mit.edu	37	4	80327926	80327926	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80327926G>T	uc003hlu.2	-	1	1447	c.1429C>A	c.(1429-1431)CAG>AAG	p.Q477K		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	477					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4																		---	---	---	---
PRKG2	5593	broad.mit.edu	37	4	82125924	82125924	+	Missense_Mutation	SNP	G	A	A	rs147037183	byFrequency	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82125924G>A	uc003hmh.2	-	1	292	c.278C>T	c.(277-279)CCG>CTG	p.P93L	PRKG2_uc011cch.1_Missense_Mutation_p.P93L	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	93					platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7																		---	---	---	---
TACR3	6870	broad.mit.edu	37	4	104640553	104640553	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104640553C>T	uc003hxe.1	-	1	423	c.280G>A	c.(280-282)GTG>ATG	p.V94M		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	94	Helical; Name=1; (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)														---	---	---	---
PCDH10	57575	broad.mit.edu	37	4	134072680	134072680	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072680G>A	uc003iha.2	+	1	2211	c.1385G>A	c.(1384-1386)CGT>CAT	p.R462H	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.R462H	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	462	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)														---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13776589	13776589	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13776589A>G	uc003jfd.2	-	55	9374	c.9332T>C	c.(9331-9333)ATT>ACT	p.I3111T		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3111	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	32088490	32088490	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32088490C>A	uc003jhl.2	+	20	5324	c.4936C>A	c.(4936-4938)CGT>AGT	p.R1646S	PDZD2_uc003jhm.2_Missense_Mutation_p.R1646S	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1646					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
ZCCHC9	84240	broad.mit.edu	37	5	80600638	80600638	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80600638G>T	uc003khj.2	+	2	195	c.62G>T	c.(61-63)TGG>TTG	p.W21L	RNU5E_uc011cto.1_Intron|ZCCHC9_uc003khk.3_Missense_Mutation_p.W21L|ZCCHC9_uc003khi.2_Missense_Mutation_p.W21L	NM_001131035	NP_001124507	Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	21							nucleic acid binding|zinc ion binding			ovary(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)														---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118469231	118469231	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118469231G>A	uc003ksd.2	+	12	1793	c.1612G>A	c.(1612-1614)GAT>AAT	p.D538N	DMXL1_uc010jcl.1_Missense_Mutation_p.D538N|DMXL1_uc003ksc.1_Missense_Mutation_p.D538N	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	538										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132535203	132535203	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132535203C>T	uc003kyn.1	-	16	2331	c.2113G>A	c.(2113-2115)GCA>ACA	p.A705T	FSTL4_uc003kym.1_Missense_Mutation_p.A354T	NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	705						extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
CATSPER3	347732	broad.mit.edu	37	5	134346133	134346133	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134346133C>A	uc003lag.2	+	7	1075	c.1007C>A	c.(1006-1008)CCA>CAA	p.P336Q		NM_178019	NP_821138	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	336					cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
PCDHA3	56145	broad.mit.edu	37	5	140182827	140182827	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140182827C>T	uc003lhf.2	+	1	2045	c.2045C>T	c.(2044-2046)GCG>GTG	p.A682V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.A682V	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	682	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHAC1	56135	broad.mit.edu	37	5	140307641	140307641	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140307641G>A	uc003lih.2	+	1	1340	c.1164G>A	c.(1162-1164)ACG>ACA	p.T388T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Silent_p.T388T	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	388	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB16	57717	broad.mit.edu	37	5	140564164	140564164	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140564164C>G	uc003liv.2	+	1	3185	c.2030C>G	c.(2029-2031)GCC>GGC	p.A677G	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	677	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
FAT2	2196	broad.mit.edu	37	5	150922506	150922506	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150922506G>A	uc003lue.3	-	9	8195	c.8182C>T	c.(8182-8184)CGG>TGG	p.R2728W	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2728	Cadherin 24.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7899864	7899864	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7899864C>A	uc003mxv.2	-	3	496	c.464G>T	c.(463-465)CGG>CTG	p.R155L	TXNDC5_uc003mxw.2_Missense_Mutation_p.R112L|TXNDC5_uc010jnz.2_Missense_Mutation_p.R47L|TXNDC5_uc010joa.1_Missense_Mutation_p.R47L	NM_030810	NP_110437	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 isoform 1	155	Thioredoxin 1.				anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
GCM2	9247	broad.mit.edu	37	6	10876693	10876693	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10876693G>A	uc003mzn.3	-	3	513	c.441C>T	c.(439-441)AAC>AAT	p.N147N	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	147	GCM.				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)																---	---	---	---
TRIM27	5987	broad.mit.edu	37	6	28872094	28872094	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28872094G>T	uc003nlr.2	-	8	1654	c.1295C>A	c.(1294-1296)CCG>CAG	p.P432Q	TRIM27_uc003nls.2_Intron|TRIM27_uc003nlt.1_3'UTR	NM_006510	NP_006501	P14373	TRI27_HUMAN	ret finger protein	432	B30.2/SPRY.				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding			ovary(1)	1								T	RET	papillary thyroid								---	---	---	---
TRIM31	11074	broad.mit.edu	37	6	30078266	30078266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30078266G>T	uc003npg.1	-	4	813	c.703C>A	c.(703-705)CTG>ATG	p.L235M	TRIM31_uc003npi.3_RNA	NM_007028	NP_008959	Q9BZY9	TRI31_HUMAN	tripartite motif protein 31	235				ASTEPQLNDLKKLVDSLK -> EIPLMPTVERSQEARCYP (in Ref. 6; CAA69165).		mitochondrion	ligase activity|zinc ion binding			lung(1)	1																		---	---	---	---
HLA-DRB1	3123	broad.mit.edu	37	6	32548553	32548553	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32548553C>A	uc003obp.3	-	4	776	c.733G>T	c.(733-735)GGG>TGG	p.G245W	HLA-DRB1_uc011dqa.1_Missense_Mutation_p.G75W|HLA-DRB5_uc003obk.3_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc011dqb.1_Intron|HLA-DRB1_uc011dqc.1_Missense_Mutation_p.G75W	NM_002124	NP_002115	P01911	2B1F_HUMAN	major histocompatibility complex, class II, DR	245	Helical; (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex				skin(1)	1														Rheumatoid_Arthritis|Sj_gren_syndrome	Multiple Myeloma(14;0.17)			---	---	---	---
C6orf129	154467	broad.mit.edu	37	6	37451032	37451032	+	Missense_Mutation	SNP	C	A	A	rs148927861		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37451032C>A	uc003ont.2	-	4	285	c.224G>T	c.(223-225)CGG>CTG	p.R75L		NM_138493	NP_612502	Q9P0B6	CF129_HUMAN	hypothetical protein LOC154467	75	Potential.					integral to membrane					0																		---	---	---	---
ZNF318	24149	broad.mit.edu	37	6	43322462	43322462	+	Silent	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43322462G>T	uc003oux.2	-	4	2688	c.2610C>A	c.(2608-2610)CTC>CTA	p.L870L	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	870					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)															---	---	---	---
THEMIS	387357	broad.mit.edu	37	6	128134866	128134866	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128134866A>G	uc003qbi.2	-	5	1239	c.920T>C	c.(919-921)ATT>ACT	p.I307T	THEMIS_uc010kfa.2_Missense_Mutation_p.I210T|THEMIS_uc011ebt.1_Missense_Mutation_p.I307T|THEMIS_uc010kfb.2_Missense_Mutation_p.I272T	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	307	CABIT 2.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4																		---	---	---	---
GRM1	2911	broad.mit.edu	37	6	146755675	146755675	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146755675G>A	uc010khw.1	+	9	3798	c.3328G>A	c.(3328-3330)GTG>ATG	p.V1110M	GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	1110	Asp/Glu-rich (acidic).|Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)													---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152265479	152265479	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152265479C>T	uc003qom.3	+	6	1302	c.932C>T	c.(931-933)ACG>ATG	p.T311M	ESR1_uc010kin.2_Missense_Mutation_p.T311M|ESR1_uc010kio.2_Missense_Mutation_p.T313M|ESR1_uc010kip.2_Missense_Mutation_p.T310M|ESR1_uc003qon.3_Missense_Mutation_p.T311M|ESR1_uc003qoo.3_Missense_Mutation_p.T311M|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Missense_Mutation_p.T92M|ESR1_uc010kit.1_Missense_Mutation_p.T48M|ESR1_uc011eey.1_Missense_Mutation_p.T48M	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	311	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155465799	155465799	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155465799C>A	uc003qqb.2	+	8	2963	c.1690C>A	c.(1690-1692)CCT>ACT	p.P564T	TIAM2_uc003qqe.2_Missense_Mutation_p.P564T|TIAM2_uc010kjj.2_Missense_Mutation_p.P97T	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	564	PH 1.				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
SAMD9	54809	broad.mit.edu	37	7	92730689	92730689	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92730689C>A	uc003umf.2	-	3	4978	c.4722G>T	c.(4720-4722)CTG>CTT	p.L1574L	SAMD9_uc003umg.2_Silent_p.L1574L	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1574						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
RABL5	64792	broad.mit.edu	37	7	100959744	100959744	+	Missense_Mutation	SNP	G	A	A	rs140464086	byFrequency	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100959744G>A	uc003uyl.2	-	4	389	c.286C>T	c.(286-288)CGG>TGG	p.R96W	RABL5_uc011kkk.1_Missense_Mutation_p.R19W|RABL5_uc011kkl.1_Missense_Mutation_p.R19W|RABL5_uc003uym.2_Missense_Mutation_p.R66W|RABL5_uc010lhw.2_RNA|RABL5_uc011kkm.1_Missense_Mutation_p.R96W	NM_022777	NP_073614	Q9H7X7	RABL5_HUMAN	RAB, member RAS oncogene family-like 5 isoform	96							GTP binding				0	Lung NSC(181;0.215)																	---	---	---	---
NEFL	4747	broad.mit.edu	37	8	24811294	24811294	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24811294G>A	uc003xee.2	-	3	1287	c.1185C>T	c.(1183-1185)GGC>GGT	p.G395G		NM_006158	NP_006149	P07196	NFL_HUMAN	neurofilament, light polypeptide 68kDa	395	Rod.|Coil 2B.				anterograde axon cargo transport|axon transport of mitochondrion|neurofilament bundle assembly|retrograde axon cargo transport|synaptic transmission	cytosol|neurofilament	identical protein binding|protein C-terminus binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)														---	---	---	---
YTHDF3	253943	broad.mit.edu	37	8	64098993	64098993	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64098993C>T	uc003xuy.2	+	5	740	c.424C>T	c.(424-426)CAG>TAG	p.Q142*	YTHDF3_uc010lys.2_Nonsense_Mutation_p.Q86*|YTHDF3_uc003xuz.2_Nonsense_Mutation_p.Q86*|YTHDF3_uc003xva.2_Nonsense_Mutation_p.Q86*|YTHDF3_uc011len.1_Nonsense_Mutation_p.Q86*	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	142											0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
POP1	10940	broad.mit.edu	37	8	99146829	99146829	+	Missense_Mutation	SNP	C	A	A	rs144891262	byFrequency;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99146829C>A	uc003yij.3	+	7	1053	c.953C>A	c.(952-954)CCG>CAG	p.P318Q	POP1_uc011lgv.1_Missense_Mutation_p.P318Q|POP1_uc003yik.2_Missense_Mutation_p.P318Q	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	318					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)															---	---	---	---
KCNV1	27012	broad.mit.edu	37	8	110986297	110986297	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110986297C>T	uc003ynr.3	-	1	663	c.321G>A	c.(319-321)TCG>TCA	p.S107S	KCNV1_uc010mcw.2_Silent_p.S107S	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	107	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113564865	113564865	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113564865C>T	uc003ynu.2	-	26	4478	c.4319G>A	c.(4318-4320)CGT>CAT	p.R1440H	CSMD3_uc003yns.2_Missense_Mutation_p.R712H|CSMD3_uc003ynt.2_Missense_Mutation_p.R1400H|CSMD3_uc011lhx.1_Missense_Mutation_p.R1336H	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1440	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
ZHX2	22882	broad.mit.edu	37	8	123965143	123965143	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123965143G>T	uc003ypk.1	+	3	1960	c.1393G>T	c.(1393-1395)GAC>TAC	p.D465Y		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	465	Required for interaction with NFYA.|Homeobox 2.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
TMEFF1	8577	broad.mit.edu	37	9	103279048	103279048	+	Silent	SNP	T	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103279048T>C	uc004baz.1	+	5	665	c.555T>C	c.(553-555)AAT>AAC	p.N185N	TMEFF1_uc004bay.1_Silent_p.N259N	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two	185	Kazal-like 2.|Extracellular (Potential).				multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)																---	---	---	---
TNC	3371	broad.mit.edu	37	9	117849383	117849383	+	Silent	SNP	G	A	A	rs138151398		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117849383G>A	uc004bjj.3	-	3	989	c.627C>T	c.(625-627)GAC>GAT	p.D209D	TNC_uc010mvf.2_Silent_p.D209D	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	209	EGF-like 2.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
ZNF79	7633	broad.mit.edu	37	9	130206310	130206310	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130206310T>C	uc004bqw.3	+	5	745	c.331T>C	c.(331-333)TGG>CGG	p.W111R	ZNF79_uc011maf.1_Missense_Mutation_p.W87R|ZNF79_uc011mag.1_Missense_Mutation_p.W87R	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	111					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
DNM1	1759	broad.mit.edu	37	9	130981357	130981357	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130981357G>T	uc011mau.1	+	4	502	c.415G>T	c.(415-417)GGA>TGA	p.G139*	DNM1_uc010mxr.2_Nonsense_Mutation_p.G139*|DNM1_uc011mat.1_Nonsense_Mutation_p.G139*	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	139	GTP (By similarity).				receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2																		---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137623457	137623457	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137623457C>A	uc004cfe.2	+	8	1662	c.1280C>A	c.(1279-1281)CCG>CAG	p.P427Q		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	427	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
QSOX2	169714	broad.mit.edu	37	9	139107020	139107020	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139107020G>T	uc010nbi.2	-	10	1378	c.1340C>A	c.(1339-1341)CCA>CAA	p.P447Q		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	447	ERV/ALR sulfhydryl oxidase.				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)														---	---	---	---
TRAF2	7186	broad.mit.edu	37	9	139818390	139818390	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139818390C>A	uc010nbu.2	+	11	1398	c.1225C>A	c.(1225-1227)CTC>ATC	p.L409I	TRAF2_uc004cjv.2_Missense_Mutation_p.L409I|TRAF2_uc011mek.1_Missense_Mutation_p.L398I|TRAF2_uc010nbw.2_Missense_Mutation_p.L384I	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	409	MATH.				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)														---	---	---	---
GRID1	2894	broad.mit.edu	37	10	88123850	88123850	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88123850G>A	uc001kdl.1	-	2	184	c.83C>T	c.(82-84)GCC>GTC	p.A28V	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	28	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
CPN1	1369	broad.mit.edu	37	10	101841323	101841323	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101841323C>A	uc001kql.2	-	1	320	c.60G>T	c.(58-60)CCG>CCT	p.P20P		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	20					proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)														---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123976316	123976316	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123976316G>A	uc001lfv.2	+	11	7879	c.7519G>A	c.(7519-7521)GAG>AAG	p.E2507K	TACC2_uc001lfw.2_Missense_Mutation_p.E653K|TACC2_uc009xzx.2_Missense_Mutation_p.E2462K|TACC2_uc010qtv.1_Missense_Mutation_p.E2511K|TACC2_uc001lfx.2_Missense_Mutation_p.E211K|TACC2_uc001lfy.2_Missense_Mutation_p.E207K|TACC2_uc001lfz.2_Missense_Mutation_p.E585K|TACC2_uc001lga.2_Missense_Mutation_p.E585K|TACC2_uc009xzy.2_Missense_Mutation_p.E597K|TACC2_uc001lgb.2_Missense_Mutation_p.E542K|TACC2_uc010qtw.1_Missense_Mutation_p.E602K	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	2507						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
DMBT1	1755	broad.mit.edu	37	10	124402642	124402642	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124402642G>A	uc001lgk.1	+	53	7076	c.6970G>A	c.(6970-6972)GTG>ATG	p.V2324M	DMBT1_uc001lgl.1_Missense_Mutation_p.V2314M|DMBT1_uc001lgm.1_Missense_Mutation_p.V1696M|DMBT1_uc009xzz.1_Missense_Mutation_p.V2323M|DMBT1_uc010qtx.1_Missense_Mutation_p.V1044M|DMBT1_uc009yab.1_Missense_Mutation_p.V1027M|DMBT1_uc009yac.1_Missense_Mutation_p.V618M	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	2324	ZP.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1213351	1213351	+	Intron	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1213351G>T	uc009ycr.1	+						uc001lsz.2_RNA	NM_017511	NP_059981			SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	31115643	31115643	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31115643G>A	uc009yjk.1	-	4	485	c.416C>T	c.(415-417)GCG>GTG	p.A139V	uc009yjl.1_Missense_Mutation_p.A67V|DCDC1_uc001msu.1_Missense_Mutation_p.A310V					RecName: Full=Doublecortin domain-containing protein 5;																														---	---	---	---
OR5L1	219437	broad.mit.edu	37	11	55579431	55579431	+	Silent	SNP	T	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579431T>C	uc001nhw.1	+	1	489	c.489T>C	c.(487-489)GCT>GCC	p.A163A		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	163	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)																---	---	---	---
SCYL1	57410	broad.mit.edu	37	11	65303520	65303520	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65303520C>A	uc001oea.1	+	11	1560	c.1483C>A	c.(1483-1485)CAC>AAC	p.H495N	SCYL1_uc009yqk.2_Missense_Mutation_p.H495N|SCYL1_uc001oeb.1_Missense_Mutation_p.H495N|SCYL1_uc001oec.1_Missense_Mutation_p.H495N|SCYL1_uc001oed.1_Missense_Mutation_p.H352N|SCYL1_uc001oee.1_Missense_Mutation_p.H139N	NM_020680	NP_065731	Q96KG9	NTKL_HUMAN	SCY1-like 1 isoform A	495			H -> Y (in a metastatic melanoma sample; somatic mutation).		regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity	p.H495Y(1)		skin(1)	1																		---	---	---	---
ADRBK1	156	broad.mit.edu	37	11	67048606	67048606	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67048606G>T	uc009yrn.1	+	8	864	c.598G>T	c.(598-600)GGG>TGG	p.G200W	ADRBK1_uc009yrm.1_Missense_Mutation_p.G200W	NM_001619	NP_001610	P25098	ARBK1_HUMAN	beta-adrenergic receptor kinase 1	200	Protein kinase.|ATP (By similarity).				activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)													---	---	---	---
RSF1	51773	broad.mit.edu	37	11	77386245	77386245	+	Missense_Mutation	SNP	G	A	A	rs149460903	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77386245G>A	uc001oyn.2	-	14	3518	c.3398C>T	c.(3397-3399)CCG>CTG	p.P1133L	RSF1_uc001oym.2_Missense_Mutation_p.P881L	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1133					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)															---	---	---	---
KDM4D	55693	broad.mit.edu	37	11	94731276	94731276	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731276C>A	uc001pfe.2	+	3	1572	c.740C>A	c.(739-741)GCC>GAC	p.A247D		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	247	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
KCNA1	3736	broad.mit.edu	37	12	5021267	5021267	+	Silent	SNP	C	T	T	rs147731985		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5021267C>T	uc001qnh.2	+	2	1828	c.723C>T	c.(721-723)TTC>TTT	p.F241F		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	241	Helical; Name=Segment S2; (Potential).				synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity	p.F241F(1)		ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
RBP5	83758	broad.mit.edu	37	12	7277308	7277308	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7277308C>A	uc001qsq.2	-	3	366	c.271G>T	c.(271-273)GAG>TAG	p.E91*		NM_031491	NP_113679	P82980	RET5_HUMAN	retinol binding protein 5, cellular	91						cytoplasm	retinal binding|retinol binding|transporter activity			ovary(1)	1					Vitamin A(DB00162)													---	---	---	---
PEX5	5830	broad.mit.edu	37	12	7361645	7361645	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7361645G>A	uc009zfu.1	+	15	2019	c.1439G>A	c.(1438-1440)CGG>CAG	p.R480Q	PEX5_uc001qsw.2_Missense_Mutation_p.R480Q|PEX5_uc010sgc.1_Missense_Mutation_p.R495Q|PEX5_uc001qsu.2_Missense_Mutation_p.R443Q|PEX5_uc010sgd.1_Missense_Mutation_p.R501Q|PEX5_uc001qsv.2_Missense_Mutation_p.R472Q	NM_001131026	NP_001124498	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5 isoform d	480	TPR 4.				protein import into peroxisome matrix, translocation|protein targeting to peroxisome|protein tetramerization|protein transport	cytosol|peroxisomal matrix|peroxisomal membrane	peroxisome matrix targeting signal-1 binding|protein C-terminus binding|protein N-terminus binding			ovary(1)	1																		---	---	---	---
PHC1	1911	broad.mit.edu	37	12	9087073	9087073	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9087073C>A	uc001qvd.2	+	10	2408	c.2252C>A	c.(2251-2253)CCG>CAG	p.P751Q	PHC1_uc001qve.2_Missense_Mutation_p.P751Q	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	751					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
KRT72	140807	broad.mit.edu	37	12	52981554	52981554	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52981554C>A	uc001sar.2	-	7	1257	c.1171G>T	c.(1171-1173)GAG>TAG	p.E391*	KRT72_uc001saq.2_Nonsense_Mutation_p.E391*|KRT72_uc010sns.1_Nonsense_Mutation_p.E349*|KRT72_uc010snt.1_Nonsense_Mutation_p.E203*	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1	391	Coil 2.|Rod.					keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)														---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94654549	94654549	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94654549G>A	uc001tdc.2	+	20	3632	c.3383G>A	c.(3382-3384)CGC>CAC	p.R1128H	PLXNC1_uc010sut.1_Missense_Mutation_p.R175H|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1128	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
GNPTAB	79158	broad.mit.edu	37	12	102155073	102155073	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102155073C>A	uc001tit.2	-	15	3146	c.2967G>T	c.(2965-2967)GAG>GAT	p.E989D		NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase	989					cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2																		---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113730792	113730792	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113730792G>A	uc001tuw.2	+	26	2464	c.2167G>A	c.(2167-2169)GTC>ATC	p.V723I	TPCN1_uc001tux.2_Missense_Mutation_p.V795I|TPCN1_uc010syu.1_5'Flank	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	723	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
SETD8	387893	broad.mit.edu	37	12	123880881	123880881	+	Intron	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123880881C>A	uc001uew.2	+						SETD8_uc001uex.2_Intron	NM_020382	NP_065115			SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36241608	36241608	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36241608C>T	uc001uvb.2	+	56	8705	c.8499C>T	c.(8497-8499)AGC>AGT	p.S2833S	NBEA_uc010abi.2_Silent_p.S1491S|NBEA_uc010tef.1_Silent_p.S626S|NBEA_uc001uvd.2_Silent_p.S411S	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2833						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76397896	76397896	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76397896C>A	uc001vjv.2	+	12	2897	c.2137C>A	c.(2137-2139)CAA>AAA	p.Q713K	LMO7_uc010thv.1_Missense_Mutation_p.Q664K|LMO7_uc001vjt.1_Missense_Mutation_p.Q612K|LMO7_uc010thw.1_Missense_Mutation_p.Q563K|LMO7_uc001vjw.1_Missense_Mutation_p.Q619K	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	998						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77780921	77780921	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77780921C>T	uc001vkf.2	-	25	3433	c.3342G>A	c.(3340-3342)GCG>GCA	p.A1114A	MYCBP2_uc010aev.2_Silent_p.A518A	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1114					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
ANGEL1	23357	broad.mit.edu	37	14	77275735	77275735	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77275735C>A	uc001xsv.2	-	2	429	c.316G>T	c.(316-318)GAG>TAG	p.E106*	ANGEL1_uc010tvf.1_Nonsense_Mutation_p.E106*	NM_015305	NP_056120	Q9UNK9	ANGE1_HUMAN	angel homolog 1	106										ovary(2)|central_nervous_system(1)|skin(1)	4			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)														---	---	---	---
C14orf174	161394	broad.mit.edu	37	14	77844002	77844002	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77844002G>T	uc001xtq.1	+	1	241	c.241G>T	c.(241-243)GGG>TGG	p.G81W	TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394	81											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)														---	---	---	---
CKMT1B	1159	broad.mit.edu	37	15	43890444	43890444	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43890444G>T	uc001zsc.2	+	8	1322	c.930G>T	c.(928-930)TTG>TTT	p.L310F	CKMT1B_uc010uds.1_Missense_Mutation_p.L341F|CKMT1B_uc010udv.1_3'UTR|CKMT1B_uc001zsd.3_Missense_Mutation_p.L310F|CKMT1B_uc010bdj.2_RNA|CKMT1B_uc010udy.1_RNA	NM_020990	NP_066270	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B precursor	310	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)													---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84566682	84566682	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84566682G>T	uc002bjz.3	+	14	1764	c.1540G>T	c.(1540-1542)GGG>TGG	p.G514W	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.G514W|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.G514W	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	514	TSP type-1 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
ACAN	176	broad.mit.edu	37	15	89401784	89401784	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89401784G>T	uc010upo.1	+	12	6342	c.5968G>T	c.(5968-5970)GGG>TGG	p.G1990W	ACAN_uc010upp.1_Missense_Mutation_p.G1990W|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1990					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)															---	---	---	---
UNC45A	55898	broad.mit.edu	37	15	91491480	91491480	+	Silent	SNP	G	A	A	rs139418696	by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91491480G>A	uc002bqg.2	+	12	2044	c.1704G>A	c.(1702-1704)GCG>GCA	p.A568A	UNC45A_uc002bqd.2_Silent_p.A553A|UNC45A_uc010uqr.1_5'UTR|UNC45A_uc002bqi.2_5'Flank	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	568					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)															---	---	---	---
HS3ST2	9956	broad.mit.edu	37	16	22926408	22926408	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22926408G>A	uc002dli.2	+	2	701	c.629G>A	c.(628-630)CGT>CAT	p.R210H	HS3ST2_uc002dlj.2_RNA	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl	210	PAPS and substrate (By similarity).|Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)														---	---	---	---
SALL1	6299	broad.mit.edu	37	16	51174297	51174297	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51174297G>A	uc010vgs.1	-	2	1867	c.1836C>T	c.(1834-1836)GCC>GCT	p.A612A	SALL1_uc010vgr.1_Silent_p.A515A|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	612					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)															---	---	---	---
CCDC135	84229	broad.mit.edu	37	16	57732064	57732064	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57732064C>A	uc002emi.2	+	2	292	c.203C>A	c.(202-204)CCG>CAG	p.P68Q	CCDC135_uc002emj.2_Missense_Mutation_p.P68Q|CCDC135_uc002emk.2_Missense_Mutation_p.P68Q	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	68						cytoplasm				central_nervous_system(1)	1																		---	---	---	---
CDH1	999	broad.mit.edu	37	16	68842699	68842699	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68842699G>A	uc002ewg.1	+	5	759	c.635G>A	c.(634-636)GGA>GAA	p.G212E	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.G212E	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	212	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
BCAR1	9564	broad.mit.edu	37	16	75267813	75267813	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75267813C>A	uc002fdv.2	-	6	2154	c.2031G>T	c.(2029-2031)AAG>AAT	p.K677N	BCAR1_uc002fdt.2_Missense_Mutation_p.K130N|BCAR1_uc002fdu.2_Missense_Mutation_p.K467N|BCAR1_uc010cgu.2_Missense_Mutation_p.K666N|BCAR1_uc010vna.1_Missense_Mutation_p.K675N|BCAR1_uc010vnb.1_Missense_Mutation_p.K723N|BCAR1_uc002fdw.2_Missense_Mutation_p.K677N|BCAR1_uc010vnc.1_Missense_Mutation_p.K529N|BCAR1_uc010vnd.1_Missense_Mutation_p.K695N|BCAR1_uc002fdx.2_Missense_Mutation_p.K695N	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	677					actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)														---	---	---	---
VAT1L	57687	broad.mit.edu	37	16	77918562	77918562	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77918562G>A	uc002ffg.1	+	7	1037	c.940G>A	c.(940-942)GCG>ACG	p.A314T		NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.	314							oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
MBTPS1	8720	broad.mit.edu	37	16	84126880	84126880	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84126880C>A	uc002fhi.2	-	6	1261	c.759G>T	c.(757-759)GTG>GTT	p.V253V		NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	253	Serine protease.|Lumenal (Potential).				cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
GP1BA	2811	broad.mit.edu	37	17	4835962	4835962	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4835962G>T	uc010vsq.1	+	2	138	c.63G>T	c.(61-63)GAG>GAT	p.E21D	uc002fzn.1_RNA	NM_000173	NP_000164	P07359	GP1BA_HUMAN	platelet glycoprotein Ib alpha polypeptide	21											0																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8215700	8215700	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8215700C>A	uc002glc.2	+	2	464	c.343C>A	c.(343-345)CGG>AGG	p.R115R	ARHGEF15_uc002glb.1_Silent_p.R115R|ARHGEF15_uc002gld.2_Silent_p.R115R|ARHGEF15_uc010vuw.1_Silent_p.R115R	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	115	Pro-rich.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11651040	11651040	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11651040G>A	uc002gne.2	+	32	6635	c.6567G>A	c.(6565-6567)GAG>GAA	p.E2189E	DNAH9_uc010coo.2_Silent_p.E1483E	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2189	AAA 2 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
ZNF207	7756	broad.mit.edu	37	17	30696691	30696691	+	Silent	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30696691G>T	uc002hhh.3	+	11	1498	c.1350G>T	c.(1348-1350)CCG>CCT	p.P450P	ZNF207_uc002hhj.3_Silent_p.P466P|ZNF207_uc002hhi.3_Silent_p.P435P|ZNF207_uc010csz.2_Silent_p.P469P|ZNF207_uc002hhk.1_Silent_p.P466P|ZNF207_uc002hhl.1_RNA	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	450						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)															---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30932222	30932222	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30932222A>G	uc002hho.1	-	21	2759	c.2747T>C	c.(2746-2748)CTT>CCT	p.L916P	MYO1D_uc002hhp.1_Missense_Mutation_p.L916P	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	916						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
GPR179	440435	broad.mit.edu	37	17	36485368	36485368	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36485368C>A	uc002hpz.2	-	11	4105	c.4084G>T	c.(4084-4086)GGG>TGG	p.G1362W		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1362	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)																---	---	---	---
FBXL20	84961	broad.mit.edu	37	17	37417817	37417817	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37417817G>T	uc010wed.1	-	15	1428	c.1207C>A	c.(1207-1209)CAT>AAT	p.H403N	FBXL20_uc002hrt.2_Missense_Mutation_p.H403N|FBXL20_uc010cvu.2_Missense_Mutation_p.H371N	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	403	LRR 13.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)															---	---	---	---
KRT16	3868	broad.mit.edu	37	17	39767374	39767374	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39767374C>T	uc002hxg.3	-	4	1019	c.880G>A	c.(880-882)GAG>AAG	p.E294K	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	294	Rod.|Coil 2.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)																---	---	---	---
OSBPL7	114881	broad.mit.edu	37	17	45894030	45894030	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45894030A>T	uc002ilx.1	-	10	1030	c.827T>A	c.(826-828)CTG>CAG	p.L276Q	OSBPL7_uc002ilw.1_5'UTR	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7	276					lipid transport		lipid binding				0																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61498701	61498701	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61498701C>G	uc002jal.3	+	25	5381	c.5358C>G	c.(5356-5358)AGC>AGG	p.S1786R	TANC2_uc010wpe.1_3'UTR|TANC2_uc002jao.3_Missense_Mutation_p.S897R	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1786							binding			ovary(2)	2																		---	---	---	---
RGS9	8787	broad.mit.edu	37	17	63221358	63221358	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63221358G>A	uc002jfe.2	+	18	1756	c.1646G>A	c.(1645-1647)CGT>CAT	p.R549H	RGS9_uc010dem.2_Missense_Mutation_p.R546H|RGS9_uc002jfd.2_Missense_Mutation_p.R546H|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Missense_Mutation_p.R320H	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	549				GSMAPR -> WSGANP (in Ref. 7; AAC25430).	intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4																		---	---	---	---
CD7	924	broad.mit.edu	37	17	80274701	80274701	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80274701G>A	uc002kel.1	-	2	348	c.239C>T	c.(238-240)ACG>ATG	p.T80M	CD7_uc010din.2_Missense_Mutation_p.T80M|CD7_uc002kem.2_Silent_p.Y61Y|CD7_uc010wvk.1_Missense_Mutation_p.T80M	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor	80	Ig-like.|Extracellular (Probable).				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)															---	---	---	---
MALT1	10892	broad.mit.edu	37	18	56376637	56376637	+	Missense_Mutation	SNP	A	C	C	rs149988025		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56376637A>C	uc002lhm.1	+	5	935	c.677A>C	c.(676-678)AAG>ACG	p.K226T	MALT1_uc002lhn.1_Missense_Mutation_p.K226T	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	226	Ig-like C2-type 2.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4								T	BIRC3	MALT								---	---	---	---
MALT1	10892	broad.mit.edu	37	18	56376642	56376642	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56376642C>T	uc002lhm.1	+	5	940	c.682C>T	c.(682-684)CAA>TAA	p.Q228*	MALT1_uc002lhn.1_Nonsense_Mutation_p.Q228*	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	228	Ig-like C2-type 2.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4								T	BIRC3	MALT								---	---	---	---
RLN3	117579	broad.mit.edu	37	19	14139122	14139122	+	Missense_Mutation	SNP	G	A	A	rs141631429		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14139122G>A	uc002mxw.1	+	1	106	c.106G>A	c.(106-108)GGC>AGC	p.G36S	RLN3_uc010dzj.1_Missense_Mutation_p.G36S	NM_080864	NP_543140	Q8WXF3	REL3_HUMAN	relaxin 3 preproprotein	36						extracellular region	hormone activity				0																		---	---	---	---
OCEL1	79629	broad.mit.edu	37	19	17337923	17337923	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17337923C>A	uc002nfp.2	+	3	369	c.367C>A	c.(367-369)CAG>AAG	p.Q123K		NM_024578	NP_078854	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	123										central_nervous_system(1)	1																		---	---	---	---
ZNF682	91120	broad.mit.edu	37	19	20133883	20133883	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20133883C>A	uc002noq.2	-	3	279	c.156G>T	c.(154-156)CTG>CTT	p.L52L	ZNF682_uc002noo.2_Silent_p.L20L|ZNF682_uc002nop.2_Silent_p.L20L|ZNF682_uc010eck.2_Intron	NM_033196	NP_149973	O95780	ZN682_HUMAN	zinc finger protein 682 isoform 1	52	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ZNF714	148206	broad.mit.edu	37	19	21299790	21299790	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21299790G>A	uc002npo.3	+	6	683	c.323G>A	c.(322-324)TGT>TAT	p.C108Y	ZNF714_uc002npl.2_5'UTR|ZNF714_uc010ecp.1_Missense_Mutation_p.C59Y|ZNF714_uc002npn.2_RNA	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
DMKN	93099	broad.mit.edu	37	19	36003615	36003615	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36003615C>A	uc002nzm.3	-	2	687	c.504G>T	c.(502-504)CTG>CTT	p.L168L	DMKN_uc002nzj.2_5'Flank|DMKN_uc002nzk.3_5'Flank|DMKN_uc002nzl.3_5'Flank|DMKN_uc002nzo.3_Silent_p.L168L|DMKN_uc002nzn.3_Silent_p.L168L|DMKN_uc002nzw.2_5'Flank|DMKN_uc002nzr.2_5'Flank|DMKN_uc002nzp.2_5'Flank|DMKN_uc002nzq.2_5'Flank|DMKN_uc002nzt.2_5'Flank|DMKN_uc002nzs.2_5'Flank|DMKN_uc002nzu.2_5'Flank|DMKN_uc002nzv.2_5'Flank|DMKN_uc010xsv.1_5'Flank|DMKN_uc010xsw.1_5'Flank|DMKN_uc002nzx.3_5'Flank|DMKN_uc002nzy.3_5'Flank|DMKN_uc002nzz.2_5'Flank|DMKN_uc002oac.3_Silent_p.L168L|DMKN_uc010eeb.2_Silent_p.L168L|DMKN_uc002oaa.3_Silent_p.L168L|DMKN_uc002oab.3_Silent_p.L168L	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor	168	Gly-rich.					extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)															---	---	---	---
MLL4	9757	broad.mit.edu	37	19	36221615	36221615	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36221615C>T	uc010eei.2	+	27	5284	c.5284C>T	c.(5284-5286)CGT>TGT	p.R1762C		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1762	FYR N-terminal.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
SARS2	54938	broad.mit.edu	37	19	39406347	39406347	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39406347C>A	uc002oka.2	-	16	1616	c.1456G>T	c.(1456-1458)GGC>TGC	p.G486C	SARS2_uc002ojz.2_Missense_Mutation_p.G296C|SARS2_uc010xup.1_Missense_Mutation_p.G488C|SARS2_uc002okb.2_Missense_Mutation_p.G486C|SARS2_uc010xuq.1_Missense_Mutation_p.G486C	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	486					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
FBXO17	115290	broad.mit.edu	37	19	39433283	39433283	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39433283G>T	uc002okg.1	-	6	974	c.802C>A	c.(802-804)CAC>AAC	p.H268N	SARS2_uc010xuq.1_Intron|FBXO17_uc002okf.1_Missense_Mutation_p.H277N	NM_024907	NP_079183	Q96EF6	FBX17_HUMAN	F-box protein FBG4 isoform 2	268	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding				0	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
PSG8	440533	broad.mit.edu	37	19	43262204	43262204	+	Missense_Mutation	SNP	C	T	T	rs139399276	byFrequency	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43262204C>T	uc002ouo.2	-	3	757	c.659G>A	c.(658-660)CGG>CAG	p.R220Q	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.R59Q|PSG8_uc002ouh.2_Missense_Mutation_p.R220Q|PSG8_uc010ein.2_Missense_Mutation_p.R98Q|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Missense_Mutation_p.R59Q|PSG8_uc002oul.3_Missense_Mutation_p.R220Q|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	220	Ig-like C2-type 1.					extracellular region					0		Prostate(69;0.00899)																---	---	---	---
CRX	1406	broad.mit.edu	37	19	48343048	48343048	+	Missense_Mutation	SNP	G	A	A	rs61748459	byFrequency;by1000genomes	TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48343048G>A	uc002phq.3	+	4	928	c.724G>A	c.(724-726)GTG>ATG	p.V242M		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	242			V -> M (in CORD2).		organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)														---	---	---	---
AURKC	6795	broad.mit.edu	37	19	57743416	57743416	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57743416C>T	uc002qoe.2	+	3	309	c.120C>T	c.(118-120)GTC>GTT	p.V40V	AURKC_uc002qoc.2_Silent_p.V21V|AURKC_uc002qod.2_Silent_p.V6V|AURKC_uc010etv.2_Silent_p.V37V	NM_001015878	NP_001015878	Q9UQB9	AURKC_HUMAN	aurora kinase C isoform 1	40					cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity			lung(4)|ovary(2)	6		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)														---	---	---	---
C20orf79	140856	broad.mit.edu	37	20	18794549	18794549	+	Silent	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18794549A>G	uc002wrk.2	+	1	180	c.90A>G	c.(88-90)GAA>GAG	p.E30E	uc002wrj.1_Intron	NM_178483	NP_848578	Q9UJQ7	CT079_HUMAN	hypothetical protein LOC140856	30							sterol binding			skin(3)	3																		---	---	---	---
TTLL9	164395	broad.mit.edu	37	20	30521649	30521649	+	Silent	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30521649C>T	uc010gdx.1	+	11	1048	c.795C>T	c.(793-795)TAC>TAT	p.Y265Y	TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_RNA|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Silent_p.Y167Y|TTLL9_uc010ztp.1_RNA|TTLL9_uc010ztq.1_RNA	NM_001008409	NP_001008409	Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	265	TTL.				protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity			ovary(2)	2			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
SLC35C2	51006	broad.mit.edu	37	20	44987111	44987111	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44987111C>A	uc002xro.2	-	2	576	c.35G>T	c.(34-36)TGG>TTG	p.W12L	SLC35C2_uc002xrp.2_Missense_Mutation_p.W12L|SLC35C2_uc002xrq.2_Missense_Mutation_p.W12L|SLC35C2_uc002xrr.2_Missense_Mutation_p.W12L|SLC35C2_uc010zxn.1_5'UTR|SLC35C2_uc010zxo.1_5'UTR|SLC35C2_uc010zxp.1_Missense_Mutation_p.W41L	NM_173179	NP_775271	Q9NQQ7	S35C2_HUMAN	solute carrier family 35, member C2 isoform a	12					transport	integral to membrane				ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60902686	60902686	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60902686C>A	uc002ycq.2	-	37	4904	c.4837G>T	c.(4837-4839)GGG>TGG	p.G1613W		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1613	Laminin EGF-like 15.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32492758	32492758	+	Silent	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32492758G>A	uc002yow.1	-	29	5176	c.4704C>T	c.(4702-4704)AGC>AGT	p.S1568S	TIAM1_uc011adk.1_3'UTR|TIAM1_uc011adl.1_Silent_p.S1508S	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1568					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
PDE9A	5152	broad.mit.edu	37	21	44151921	44151921	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44151921G>T	uc002zbm.2	+	5	367	c.304G>T	c.(304-306)GCT>TCT	p.A102S	PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_5'UTR|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Missense_Mutation_p.A61S|PDE9A_uc002zcb.2_Missense_Mutation_p.A76S|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Missense_Mutation_p.A35S|PDE9A_uc002zcf.2_5'UTR|PDE9A_uc002zcg.2_Intron|PDE9A_uc002zch.2_5'UTR	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a	102					platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
AGPAT3	56894	broad.mit.edu	37	21	45390580	45390580	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45390580G>A	uc002zdv.2	+	6	779	c.557G>A	c.(556-558)CGC>CAC	p.R186H	AGPAT3_uc002zdw.2_Missense_Mutation_p.R186H|AGPAT3_uc002zdx.2_Missense_Mutation_p.R273H|AGPAT3_uc002zdy.2_Missense_Mutation_p.R124H	NM_020132	NP_064517	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	186	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)														---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47320948	47320948	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47320948C>A	uc002zhq.1	+	5	385	c.260C>A	c.(259-261)CCA>CAA	p.P87Q	PCBP3_uc010gqb.2_Missense_Mutation_p.P87Q|PCBP3_uc002zhp.1_Missense_Mutation_p.P87Q|PCBP3_uc010gqc.1_Missense_Mutation_p.P87Q|PCBP3_uc002zhs.1_Missense_Mutation_p.P87Q|PCBP3_uc002zhr.1_Missense_Mutation_p.P87Q|PCBP3_uc002zht.1_Missense_Mutation_p.P55Q	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	87	KH 1.				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
COL6A2	1292	broad.mit.edu	37	21	47549137	47549137	+	Intron	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47549137C>T	uc002zia.1	+						COL6A2_uc002zhy.1_3'UTR|COL6A2_uc002zhz.1_Missense_Mutation_p.P830L|COL6A2_uc002zib.1_Intron|COL6A2_uc002zic.1_Intron|COL6A2_uc010gqe.1_5'Flank	NM_001849	NP_001840			alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
CECR2	27443	broad.mit.edu	37	22	17983913	17983913	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17983913C>A	uc010gqw.1	+	6	735	c.609C>A	c.(607-609)CTC>CTA	p.L203L	CECR2_uc010gqv.1_Silent_p.L82L|CECR2_uc002zml.2_Silent_p.L82L|CECR2_uc002zmm.1_Silent_p.L82L	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	245					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)														---	---	---	---
HIRA	7290	broad.mit.edu	37	22	19349416	19349416	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19349416C>T	uc002zpf.1	-	16	2034	c.1814G>A	c.(1813-1815)CGA>CAA	p.R605Q	HIRA_uc011agx.1_Missense_Mutation_p.R471Q|HIRA_uc010grn.1_Intron|HIRA_uc010gro.1_Missense_Mutation_p.R561Q|HIRA_uc010grp.2_RNA	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	605	Interaction with CCNA1.|Interaction with PAX3 (By similarity).|Interaction with histone H2B.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)																	---	---	---	---
PLA2G3	50487	broad.mit.edu	37	22	31536082	31536082	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31536082A>G	uc003aka.2	-	1	388	c.259T>C	c.(259-261)TGT>CGT	p.C87R		NM_015715	NP_056530	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III precursor	87					cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity				0																		---	---	---	---
MCM5	4174	broad.mit.edu	37	22	35811891	35811891	+	Silent	SNP	C	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35811891C>A	uc003anu.3	+	10	1367	c.1273C>A	c.(1273-1275)CGG>AGG	p.R425R	MCM5_uc010gwr.2_Silent_p.R234R|MCM5_uc003anv.3_Silent_p.R382R|MCM5_uc010gws.1_RNA|MCM5_uc003anw.1_Silent_p.R209R	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	425	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1																		---	---	---	---
CHKB	1120	broad.mit.edu	37	22	51020227	51020227	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51020227G>T	uc003bms.2	-	3	616	c.398C>A	c.(397-399)CCC>CAC	p.P133H	CHKB-CPT1B_uc003bmp.2_5'Flank|CHKB-CPT1B_uc003bmt.1_Intron|CHKB-CPT1B_uc003bmu.2_Missense_Mutation_p.P12H|CHKB_uc003bmv.2_Missense_Mutation_p.P133H|LOC100144603_uc003bmw.3_5'Flank	NM_005198	NP_005189	Q9Y259	CHKB_HUMAN	choline kinase beta	133					phosphatidylethanolamine biosynthetic process		ATP binding|choline kinase activity|ethanolamine kinase activity				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)													---	---	---	---
AKAP4	8852	broad.mit.edu	37	X	49958235	49958235	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49958235C>T	uc004dow.1	-	5	1253	c.1129G>A	c.(1129-1131)GAG>AAG	p.E377K	AKAP4_uc004dov.1_Intron|AKAP4_uc010njp.1_Missense_Mutation_p.E199K|AKAP4_uc004dou.1_Missense_Mutation_p.E368K	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	377					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)																	---	---	---	---
TRO	7216	broad.mit.edu	37	X	54956240	54956240	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54956240G>T	uc004dtq.2	+	12	3190	c.3083G>T	c.(3082-3084)GGT>GTT	p.G1028V	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Missense_Mutation_p.G559V|TRO_uc004dtw.2_Missense_Mutation_p.G631V|TRO_uc004dtx.2_Missense_Mutation_p.G411V	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1028	62 X 10 AA approximate tandem repeats.|22; approximate.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1																		---	---	---	---
XIST	7503	broad.mit.edu	37	X	73064258	73064258	+	RNA	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73064258G>A	uc004ebm.1	-	1		c.8331C>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0																		---	---	---	---
AMOT	154796	broad.mit.edu	37	X	112035098	112035098	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112035098G>A	uc004epr.2	-	6	1888	c.1888C>T	c.(1888-1890)CGA>TGA	p.R630*	AMOT_uc004eps.2_Nonsense_Mutation_p.R221*	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	630	Potential.				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122755146	122755146	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122755146C>G	uc004etu.2	-	31	4110	c.4078G>C	c.(4078-4080)GAG>CAG	p.E1360Q	THOC2_uc010nqt.1_RNA|THOC2_uc004etw.1_Missense_Mutation_p.E181Q	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1360	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
DCAF12L2	340578	broad.mit.edu	37	X	125299117	125299117	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299117T>C	uc004euk.1	-	1	818	c.791A>G	c.(790-792)AAG>AGG	p.K264R		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	264	WD 3.									lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7																		---	---	---	---
GPR101	83550	broad.mit.edu	37	X	136113194	136113194	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136113194C>T	uc011mwh.1	-	1	640	c.640G>A	c.(640-642)GTG>ATG	p.V214M		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	214	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
BGN	633	broad.mit.edu	37	X	152770285	152770285	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152770285G>T	uc004fhr.1	+	2	368	c.196G>T	c.(196-198)GGC>TGC	p.G66C	BGN_uc004fhq.1_RNA	NM_001711	NP_001702	P21810	PGS1_HUMAN	biglycan preproprotein	66	Cys-rich.					proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent			breast(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
PLXNB3	5365	broad.mit.edu	37	X	153043007	153043007	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153043007G>A	uc004fii.2	+	31	5299	c.5125G>A	c.(5125-5127)GAC>AAC	p.D1709N	PLXNB3_uc010nuk.2_Missense_Mutation_p.D1732N|PLXNB3_uc011mzd.1_Missense_Mutation_p.D1348N|SRPK3_uc004fik.2_5'UTR	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	1709	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
MECP2	4204	broad.mit.edu	37	X	153297980	153297980	+	Missense_Mutation	SNP	G	C	C	rs61754425		TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153297980G>C	uc004fjv.2	-	3	281	c.55C>G	c.(55-57)CAG>GAG	p.Q19E	MECP2_uc004fjw.2_Missense_Mutation_p.Q31E	NM_004992	NP_004983	P51608	MECP2_HUMAN	methyl CpG binding protein 2 isoform 1	19					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
DKC1	1736	broad.mit.edu	37	X	153996856	153996856	+	Intron	SNP	T	A	A			TCGA-BR-4188-01A-01D-1126-08	TCGA-BR-4188-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153996856T>A	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_RNA	NM_001363	NP_001354			dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)													Congenital_Dyskeratosis				---	---	---	---
